VWB-attP and φC31-attP integrase-mediated gene recombination methods and their applications in Streptomyces

Through VWB-attP and φC31-attP integrase-mediated gene recombination methods, efficient introduction of multi-copy genes or gene clusters is achieved on Streptomyces chromosomes, solving the problem of limited application scope of Streptomyces gene recombination methods in the prior art, and improving biosynthetic ability and genetic stability.

CN113584068BActive Publication Date: 2025-08-29SHANGHAI INST OF ORGANIC CHEM CHINESE ACAD OF SCI +1
View PDF 5 Cites 0 Cited by

Patent Information

Application Number
CN202010360644.7
Authority / Receiving Office
CN · China
Patent Type
Patents(China)
Current Assignee / Owner
Filing Date
2020-04-30
Publication Date
2025-08-29
Estimated Expiration
2040-04-30

AI Technical Summary

Technical Problem

In the prior art, the application scope of Streptomyces gene recombination method is limited, and it is difficult to effectively improve biosynthesis capabilities, especially to implement multiple copies of the exogenous gene import on Streptomyces chromosomes.

Method used

Using VWB-attP and φC31-attP integrase-mediated gene recombination methods, exogenous attB sites were introduced into the Streptomyces genome, and the target gene or gene cluster was integrated into a specific location through the integrase module to construct a plasmid vector for indirect transfer, and the introduction of multi-copy genes or gene clusters was achieved.

Benefits of technology

The efficient introduction of multiple copies of genes or gene clusters on Streptocytica chromosomes was achieved, the fermentation titers of erythromycin, avermectin and lincomycin were improved, and the genetic stability and yield of engineered bacteria were improved.

✦ Generated by Eureka AI based on patent content.

Smart Images

  • Figure GDA0005518425950000171
    Figure GDA0005518425950000171
  • Figure GDA0005518425950000181
    Figure GDA0005518425950000181
  • Figure GDA0005518425950000191
    Figure GDA0005518425950000191
Patent Text Reader

Abstract

The present invention provides a VWB-attP and φC31-attP integrase-mediated gene recombination method and its application in Streptomyces. Specifically, the present invention utilizes the site-specific integration mechanism mediated by the VWB-attP and φC31-attP integrase systems to construct these two integrase modules into the same plasmid containing the target gene. Through intergeneric conjugational transfer, the target gene to be expressed can be rapidly recombined in multiple copies into the corresponding attB site on the Streptomyces chromosome. The method of the present invention has been applied to abamectin-, erythromycin-, and lincomycin-producing bacteria.
Need to check novelty before this filing date? Find Prior Art

Description

Technical Field

[0001] The present invention belongs to the field of biotechnology, and more specifically relates to a site-specific integration recombination mechanism mediated by VWB-attP integrase and φC31-attP integrase systems to obtain a target gene with multiple copies introduced into a Streptomyces chromosome. Background Art

[0002] Streptomyces is a naturally occurring bacterial species that metabolizes and produces natural products. In the pharmaceutical industry, most antibiotic APIs are produced through fermentation by Streptomyces. For example, erythromycin is produced by fermentation by Saccharopolyspora erythraea, avermectin by Streptomyces avermitilis, and lincomycin by Streptomyces lincolnensis. With the advancement of biotechnology, genetic modification of Streptomyces can address yield and component issues in industrial strain production. Introduction of exogenous genes can be achieved through homologous recombination and site-specific integration. Site-specific integration mediated by phage integrase offers high stability and is less susceptible to reverse mutations, making it the primary method for introducing exogenous genes into Streptomyces.

[0003] Depending on whether the genome of different Streptomyces species contains the corresponding attB site sequence recognized by the corresponding integrase, the corresponding integrase attP module can be constructed in vitro using a plasmid. Finally, the recombinant plasmid is introduced into the Streptomyces host to achieve specific integration of the target gene into the chromosome. The inventors have been granted a patent (ZL200910194419.4 ΦC31-mediated gene recombination and its application to genetic modification of erythromycin-producing bacteria). This method uses a site-specific recombination method mediated by the ΦC31 integrase attP to successfully recombinate the target gene sequence constructed in vitro into the attB site of exogenously introduced erythromycin-producing bacteria, thereby increasing the number of copies of the exogenously constructed target gene.

[0004] Although integrase-mediated gene recombination methods exist in the prior art, their scope of application is still very limited. The art still needs to further develop and optimize gene recombination methods of Streptomyces in order to further improve its biosynthesis capacity. Summary of the Invention

[0005] The purpose of the present invention is to provide a VWB-attP and φC31-attP integrase-mediated gene recombination method and its application in Streptomyces.

[0006] In a first aspect of the present invention, a gene recombination method mediated by VWB-attP and φC31-attP integrase is provided, characterized in that it comprises the steps of:

[0007] (1) Introducing at least one exogenous attB site into the genome of Streptomyces to obtain Streptomyces carrying the exogenous attB site;

[0008] (2) Introducing a vector comprising (i) the ΦC31 integrase module and / or the VWB integrase module, and (ii) the target gene or target gene cluster into the Streptomyces of step (1), and selecting Streptomyces in which the target gene or target gene cluster is integrated into the endogenous attB site and the exogenous attB site of the Streptomyces genome, thereby obtaining Streptomyces in which multiple copies of the gene or gene cluster are integrated.

[0009] In another preferred embodiment, the Streptomyces include Streptomyces avermitilis, Saccharopolyspora erythraea, and Streptomyces lincomyces, preferably Streptomyces lincomyces.

[0010] In another preferred embodiment, the exogenous attB site includes the attB site recognized by ΦC31 integrase and the attB site recognized by VWB integrase.

[0011] In another preferred embodiment, the at least one exogenous attB site is 1-2 exogenous attB sites, preferably 1 exogenous attB site.

[0012] In another preferred embodiment, the Streptomyces is Streptomyces lincomyces, and (i) the exogenous attB site is introduced into the Cysteate NRPS gene cluster of the Streptomyces lincomyces genome, preferably replacing the original SLINC0744 gene of the gene cluster; and / or

[0013] (ii) The exogenous attB site is introduced into the Moenomycin gene cluster of the Streptomyces lincomyces genome, preferably replacing the original SLINC6338 gene, SLINC6339 gene and SLINC63340 gene of the gene cluster.

[0014] In another preferred embodiment, the exogenous attB site introduced into the Cysteate NRPS gene cluster is an attB site recognized by the exogenous VWB integrase.

[0015] In another preferred embodiment, the exogenous attB site introduced into the Moenomycin gene cluster is an attB site recognized by the exogenous φC31 integrase.

[0016] In another preferred embodiment, the sequence of the attB site recognized by the exogenous VWB integrase is shown in SEQ ID NO: 5.

[0017] In another preferred embodiment, the sequence of the attB site recognized by the exogenous φC31 integrase is shown in SEQ ID NO: 1.

[0018] In another preferred embodiment, the Streptomyces is Streptomyces lincomyces, and the genome of Streptomyces lincomyces contains an endogenous attB site selected from the following group:

[0019] (a) located at the 1′ attB site recognized by the VWB integrase of Streptomyces lincomyces SLINC_t29, preferably, the sequence is as shown in SEQ ID NO: 5;

[0020] (b) an attB site 2′ located in the spacer region between SLINC_3666 and SLINC_3667 of Streptomyces lincomyces, recognized by the VWB integrase, preferably having a sequence as shown in SEQ ID NO: 6; and

[0021] (c) The attB site 3′ of the VWB integrase located in the spacer region between SLINC_3671 and SLINC_3672 of Streptomyces lincomyces, preferably, the sequence is as shown in SEQ ID NO: 7.

[0022] In another preferred embodiment, the Streptomyces is Streptomyces lincomyces, and the genome of Streptomyces lincomyces contains an endogenous attB site (attB site 1') recognized by the VWB integrase located at SLINC_t29 of Streptomyces lincomyces.

[0023] In another preferred embodiment, the Streptomyces is Streptomyces avermitilis, and the exogenous attB site is introduced into the oligomycin biosynthesis gene cluster PKS in the genome of Streptomyces avermitilis, preferably replacing the original olmA1-A7 genes of the gene cluster.

[0024] In another preferred embodiment, the exogenous attB site introduced into the oligomycin biosynthesis gene cluster PKS is an attB site recognized by the exogenous ΦC31 integrase.

[0025] In another preferred embodiment, the core sequence of the attB site recognized by the ΦC31 integrase is shown in SEQ ID NO: 3 (ggtgccagggcgtgcccttgggctccccgggcgcg).

[0026] In another preferred embodiment, the attB site recognized by the ΦC31 integrase comprises one or more of the core sequences, preferably 8 copies of the core sequence.

[0027] In another preferred embodiment, the Streptomyces is Streptomyces avermitilis, and the genome of Streptomyces avermitilis contains an endogenous attB site selected from the following group:

[0028] (a) an endogenous attB site 1 recognized by the VWB integrase of the S. avermitilis genome SAV_t18, preferably, the sequence is as shown in SEQ ID NO: 8;

[0029] (b) an endogenous attB site 2 recognized by the VWB integrase located in the spacer between SAV_3727 and SAV_3728 of the S. avermitilis genome, preferably, the sequence is as shown in SEQ ID NO: 9;

[0030] (c) an endogenous attB site 3 recognized by the VWB integrase located in the spacer region between SAV_3746 and SAV_3747 of the S. avermitilis genome, preferably, the sequence is as shown in SEQ ID NO: 10; and

[0031] (d) The endogenous attB site 1 recognized by the ΦC31 integrase located in the S. avermitilis genome SAV_4392, preferably, the sequence is shown in SEQ ID NO:11.

[0032] In another preferred embodiment, the Streptomyces is Saccharopolyspora erythraea, and the exogenous attB site is introduced into the NRPS gene cluster of the Saccharopolyspora erythraea genome, preferably replacing the sequence in the SACE_1305 gene in the gene cluster.

[0033] In another preferred embodiment, the exogenous attB site introduced into the NRPS gene cluster is an attB site recognized by the exogenous ΦC31 integrase.

[0034] In another preferred example, the Streptomyces is Saccharopolyspora erythrae, and the genome of Saccharopolyspora erythrae contains an endogenous attB site recognized by the VWB integrase located in SACE_8013 of the Saccharopolyspora erythrae genome. Preferably, the sequence is shown in SEQ ID NO: 12.

[0035] In another preferred embodiment, the Streptomyces is Saccharopolyspora erythraea, and the exogenous attB site is introduced into the Geosmin synthesis gene cluster of the Saccharopolyspora erythraea genome, preferably replacing the original SACE_4907 gene of the gene cluster.

[0036] In another preferred embodiment, the exogenous attB site that replaces the SACE_4907 gene is an attB site recognized by the exogenous ΦC31 integrase.

[0037] In another preferred embodiment, the core sequence of the attB site recognized by the ΦC31 integrase is shown in SEQ ID NO: 3 (ggtgccagggcgtgcccttgggctccccgggcgcg).

[0038] In another preferred embodiment, the attB site recognized by the ΦC31 integrase comprises one or more of the core sequences, preferably 8 copies of the core sequence.

[0039] In another preferred embodiment, the method comprises the steps of:

[0040] (1) An attB site recognized by the exogenous ΦC31 integrase was introduced into the Geosmin biosynthesis gene cluster in the genome of Saccharopolyspora erythraea, replacing the original SACE_4907 gene in the cluster;

[0041] (2) Introducing a vector comprising (i) the ΦC31 integrase module and the VWB integrase module, and (ii) the target gene or target gene cluster into the erythrocytes of step (1), and selecting Streptomyces in which the target gene or target gene cluster is integrated into the endogenous attB site and the exogenous attB site of the Streptomyces genome, thereby obtaining Streptomyces with multi-copy genes or gene clusters integrated therein.

[0042] In another preferred embodiment, the method comprises the steps of:

[0043] (1) Introducing an exogenous attB site recognized by the VWB integrase into the Cysteate NRPS gene cluster in the genome of Streptomyces lincomycetes to replace the original SLINC0744 gene of the gene cluster; and / or introducing an exogenous attB site recognized by the ΦC31 integrase into the Moenomycin gene cluster in the genome of Streptomyces lincomycetes to replace the original SLINC6338, SLINC6339 and SLINC63340 genes of the gene cluster.

[0044] (2) introducing a vector comprising (i) a VWB integrase module and (ii) a target gene or target gene cluster into the Streptomyces lincomyces of step (1), selecting Streptomyces in which the target gene or target gene cluster is integrated into the endogenous attB site and the exogenous attB site of the Streptomyces genome, thereby obtaining Streptomyces in which multiple copies of the gene or gene cluster are integrated.

[0045] The endogenous attB site is the endogenous attB site (attB site 1') recognized by the VWB integrase of Streptomyces lincomyces.

[0046] In another preferred embodiment, the ΦC31 integrase module includes the ΦC31 integrase gene sequence and the phage attachment site target sequence ΦC31-attP recognized by the ΦC31 integrase.

[0047] In another preferred embodiment, the VWB integrase module includes a VWB integrase gene sequence and a phage attachment site target sequence VWB-attP recognized by the VWB integrase.

[0048] In another preferred embodiment, the target sequence ΦC31-attP is as shown in SEQ ID NO: 4. (ccccaactggggtaacctttgagttctctcagttggggg)

[0049] In another preferred example, the target sequence VWB-attP is as shown in SEQ ID NO: 2 (gactcactcagactcactgaggctcatgatcgctttacgttctctcctaaagcgggtgtcgcaggttcgaatcctgccgggggcacaacctgca).

[0050] In another preferred embodiment, the attB site of the Streptomyces genome and the phage attachment site target sequence attP are recombined under the mediation of ΦC31 integrase and / or VWB integrase to form hybrid sites attL and attR.

[0051] In another preferred embodiment, the vector is introduced into the Streptomyces in step (1) by conjugation transfer.

[0052] In another preferred embodiment, the conjugation transfer is an indirect conjugation transfer.

[0053] In another preferred embodiment, the vector includes plasmid and cosmid.

[0054] In another preferred embodiment, the vector comprises a resistance selection marker and oriT, an element necessary for intergeneric conjugative transfer.

[0055] In another preferred embodiment, the Streptomyces is Streptomyces avermitilis, and the target gene cluster is the avermectin synthesis gene cluster aveA1-aveA2-aveC.

[0056] In another preferred embodiment, the Streptomyces is Saccharopolyspora erythraea, and the target gene cluster is the erythromycin biosynthesis gene cluster.

[0057] In another preferred embodiment, the Streptomyces is Streptomyces lincomycin, and the target gene cluster is the lincomycin biosynthesis gene cluster.

[0058] In a second aspect of the present invention, a genetically engineered strain of Streptomyces lincomyces is provided, wherein the genome of the genetically engineered strain includes at least one exogenous attB site, and (i) the exogenous attB site is introduced into the Cysteate NRPS gene cluster of the Streptomyces lincomyces genome, preferably replacing the original SLINC0744 gene of the gene cluster; and / or

[0059] (ii) The exogenous attB site is introduced into the Moenomycin gene cluster of the Streptomyces lincomyces genome, preferably replacing the original SLINC6338 gene, SLINC6339 gene and SLINC63340 gene of the gene cluster.

[0060] In another preferred embodiment, the genetically engineered Streptomyces lincomyces strain contains at least one endogenous attB site (the specific position and sequence of the endogenous site are the same as those in the preferred embodiment of the first aspect of the present invention).

[0061] In a third aspect of the present invention, a genetically engineered bacterium of Streptomyces avermitilis is provided, wherein the genome of the genetically engineered bacterium includes at least one exogenous attB site, and the exogenous attB site is introduced into the oligomycin biosynthesis gene cluster PKS of the Streptomyces avermitilis genome, preferably replacing the original olmA1-A7 genes of the gene cluster.

[0062] In another preferred embodiment, the exogenous attB site introduced into the oligomycin biosynthesis gene cluster PKS is an attB site recognized by the exogenous ΦC31 integrase.

[0063] In another preferred embodiment, the genetically engineered Streptomyces avermitilis bacteria contains at least one endogenous attB site (the specific position and sequence of the endogenous site are the same as those in the preferred embodiment of the first aspect of the present invention).

[0064] In a fourth aspect of the present invention, a genetically engineered bacterium of Saccharopolyspora erythraea is provided, wherein the genome of the genetically engineered bacterium comprises at least one exogenous attB site, and the exogenous attB site is introduced into the NRPS gene cluster of the Saccharopolyspora erythraea genome.

[0065] In another preferred embodiment, the exogenous attB site introduced into the NRPS gene cluster is an attB site recognized by the exogenous ΦC31 integrase.

[0066] In another preferred embodiment, the genetically engineered Saccharopolyspora erythraea contains at least one endogenous attB site (the specific position and sequence of the endogenous site are the same as those in the preferred embodiment of the first aspect of the present invention).

[0067] In a fifth aspect of the present invention, a genetically engineered bacterium of Saccharopolyspora erythrae is provided, the genome of which includes at least one exogenous attB site, and the exogenous attB site is introduced into the Geosmin synthesis gene cluster of the Saccharopolyspora erythrae genome, preferably replacing the original SACE_4907 gene of the gene cluster.

[0068] In another preferred embodiment, the exogenous attB site that replaces the SACE_4907 gene is an attB site recognized by the exogenous ΦC31 integrase.

[0069] In the sixth aspect of the present invention, there is provided a use of the genetically engineered bacteria described in the second, third, fourth and fifth aspects of the present invention for preparing engineered Streptomyces bacteria carrying multiple copies of a target gene or a target gene cluster.

[0070] In a seventh aspect of the present invention, there is provided an engineered Streptomyces bacterium having multiple copies of a target gene or target gene cluster integrated into its genome, wherein the genome of the engineered Streptomyces bacterium includes at least two copies of the target gene cluster located at the following positions:

[0071] (a) The endogenous attB site in the genome of the engineered Streptomyces strain is located and the original attB site at that location is replaced;

[0072] (b) The location of at least one exogenous attB site in the method according to the first aspect of the present invention.

[0073] In an eighth aspect of the present invention, a method for efficiently expressing a target gene or a target gene cluster using Streptomyces is provided, the method comprising:

[0074] (a) preparing an engineered Streptomyces strain by the method described in the first aspect of the present invention, so that multiple copies of the target gene or target gene cluster are integrated into the Streptomyces genome;

[0075] (b) Cultivating the engineered Streptomyces obtained in step (a) to efficiently express the target gene or target gene cluster.

[0076] In another preferred embodiment, the method further comprises the step of detecting the expression of the target gene by the engineered Streptomyces bacteria.

[0077] It should be understood that within the scope of the present invention, the above-mentioned technical features of the present invention and the technical features described in detail below (such as in the embodiments) can be combined with each other to form new or preferred technical solutions. Due to space limitations, they will not be listed here one by one. DETAILED DESCRIPTION

[0078] After extensive and in-depth research, the inventors have discovered a gene recombination method mediated by VWB-attP and φC31-attP integrases. Specifically, the present invention utilizes the site-specific integration mechanism mediated by the VWB-attP and φC31-attP integrase systems to construct these two integrase modules into the same plasmid containing the target gene. Through intergeneric conjugational transfer, the target gene to be expressed can be rapidly recombined in multiple copies into the corresponding attB site on the Streptomyces chromosome. The method of the present invention has been applied to abamectin- and erythromycin-producing bacteria.

[0079] As used herein, the term "site-specific recombination" refers to a type of homologous recombination that relies on the association of homologous sequences within a small range, requiring the participation of integrase (such as VWB, φC31) and specific recombination sites (such as attB / attP) to ultimately integrate the exogenous plasmid into the genome.

[0080] As used herein, the term "introduction" or "transformation" refers to the transfer of an exogenous polynucleotide into a host cell (Streptomyces in this invention). Alternatively, the exogenous polynucleotide may be integrated into the host genome.

[0081] As used herein, the term "exogenous" or "heterologous" gene or protein refers to a gene or protein that is not naturally contained in the genome of the protozoan (in this case, Streptomyces).

[0082] As used herein, the term "target gene or target gene cluster" refers to a foreign gene introduced into the genome of a protozoan (Streptomyces in the present invention).

[0083] VWB-attP integrase module

[0084] The VWB-attP integrase is a VWB temperate phage that uses its integrase to mediate specific recombination and integration between attP and attB sites. The VWB-attP integrase module contains a gene that can express the VWB integrase and an attP site sequence. The specific sequence is as follows:

[0085]

[0086] φC31-attP integrase module

[0087] The φC31-attP integrase is a Streptomyces phage that utilizes its φC31 integrase to mediate specific recombination and integration between attP and attB sites. The φC31-attP integrase module contains a gene that can express the φC31 integrase and an attP site sequence. The specific sequence is as follows:

[0088]

[0089] The φC31 integrase module can be obtained by restriction enzyme digestion of plasmid pSET152, DNA synthesis, or PCR.

[0090] The present invention provides a method for simply and quickly introducing a target gene into a Streptomyces chromosome. The method comprises constructing a VWB-attP integrase module and a φC31-attP integrase module onto the same plasmid vector containing the target gene, and introducing the target gene into a Streptomyces chromosome containing the VWB-attB site and the φC31-attB site sequence through inter-Streptomyces conjugation transfer, thereby achieving the introduction of multiple copies of the target gene.

[0091] The VWB-attP integrase module and the φC31-attP integrase module can be obtained through enzyme digestion, PCR, or DNA synthesis. Using enzyme digestion, ligation, recombinant cloning, and other techniques, the two integrases are cloned into the same plasmid, creating a base plasmid vector containing both integrase modules. The target gene to be expressed in multiple copies is then cloned and ligated to complete the plasmid construction. This plasmid is then transferred by conjugation into a Streptomyces host with the corresponding attB site. After integration, screening is performed by PCR to verify the presence of attL or attR, completing the introduction of multiple copies of the target gene into the Streptomyces.

[0092] For plasmids or cosmids that have already cloned the target gene, the VWB-attP integrase module, the φC31-attP integrase module, or both modules can be cloned into the corresponding plasmid or cosmid through Gibson cloning or RedET recombination to complete the transformation of the plasmid containing the target gene. Finally, it can be transferred into the Streptomyces host by conjugation, and the integration site can be screened by PCR verification and sequencing.

[0093] The genetically modified Streptomyces of the present invention may be Streptomyces lincomyces, and at least one exogenous attB site is introduced into the genome of Streptomyces lincomyces to obtain Streptomyces lincomyces carrying the exogenous attB site;

[0094] Wherein, (i) the exogenous attB site is introduced into the Cysteate NRPS gene cluster of the Streptomyces lincomyces genome, preferably replacing the original SLINC0744 gene of the gene cluster; and / or

[0095] (ii) The exogenous attB site is introduced into the Moenomycin gene cluster of the Streptomyces lincomyces genome, preferably replacing the original SLINC6338 gene, SLINC6339 gene and SLINC63340 gene of the gene cluster.

[0096] The genome of Streptomyces lincomyces also contains an endogenous attB site selected from the group consisting of:

[0097] (a) located at the 1′ attB site recognized by the VWB integrase of Streptomyces lincomyces SLINC_t29, preferably, the sequence is as shown in SEQ ID NO: 5;

[0098] (b) an attB site 2′ located in the spacer region between SLINC_3666 and SLINC_3667 of Streptomyces lincomyces, recognized by the VWB integrase, preferably having a sequence as shown in SEQ ID NO: 6; and

[0099] (c) The attB site 3′ of the VWB integrase located in the spacer region between SLINC_3671 and SLINC_3672 of Streptomyces lincomyces, preferably, the sequence is as shown in SEQ ID NO: 7.

[0100] The genetically modified Streptomyces of the present invention may be Streptomyces avermitilis, and at least one exogenous attB site is introduced into the genome of Streptomyces avermitilis to obtain Streptomyces avermitilis carrying the exogenous attB site;

[0101] The exogenous attB site is introduced into the oligomycin biosynthesis gene cluster PKS in the genome of Streptomyces avermitilis, preferably replacing the original olmA1-A7 genes of the gene cluster.

[0102] The genome of Streptomyces avermitilis also contains an endogenous attB site selected from the group consisting of:

[0103] (a) an endogenous attB site 1 recognized by the VWB integrase of the S. avermitilis genome SAV_t18, preferably, the sequence is as shown in SEQ ID NO: 8;

[0104] (b) an endogenous attB site 2 recognized by the VWB integrase located in the spacer between SAV_3727 and SAV_3728 of the S. avermitilis genome, preferably, the sequence is as shown in SEQ ID NO: 9;

[0105] (c) an endogenous attB site 3 recognized by the VWB integrase located in the spacer region between SAV_3746 and SAV_3747 of the S. avermitilis genome, preferably, the sequence is as shown in SEQ ID NO: 10; and

[0106] (d) The endogenous attB site 1 recognized by the ΦC31 integrase located in the S. avermitilis genome SAV_4392, preferably, the sequence is shown in SEQ ID NO:11.

[0107] The genetically modified Streptomyces of the present invention can be Saccharopolyspora erythraea, and at least one exogenous attB site is introduced into the genome of Saccharopolyspora erythraea to obtain Saccharopolyspora erythraea carrying the exogenous attB site;

[0108] Wherein, (i) the exogenous attB site is introduced into the NRPS gene cluster of the Saccharopolyspora erythraea genome, preferably replacing the sequence in the SACE_1305 gene in the gene cluster; and / or

[0109] (ii) The exogenous attB site is introduced into the Geosmin synthesis gene cluster of the Saccharopolyspora erythraea genome, preferably replacing the original SACE_4907 gene of the gene cluster.

[0110] The genome of Saccharopolyspora erythrae also includes an endogenous attB site recognized by the VWB integrase located at SACE_8013 of the Saccharopolyspora erythrae genome. Preferably, the sequence is shown in SEQ ID NO:12.

[0111] The main advantages of the present invention include:

[0112] (a) By constructing a basic plasmid containing both the VWB-attP integrase module and the φC31-attP integrase module as a universal plasmid vector, the target gene or gene cluster can be subsequently cloned into the basic plasmid to achieve multi-copy introduction of the target gene into Streptomyces.

[0113] (b) By analyzing the sequence location of endogenous attB sites in Saccharopolyspora erythrae, Streptomyces avermectin, and Streptomyces lincomycin, and introducing exogenous attB sites, we achieved multi-copy introduction of the corresponding target gene clusters, thereby improving the fermentation titers of erythromycin, avermectin, and lincomycin.

[0114] (c) By introducing an exogenous attB site into the SLINC0744 gene of the Cysteate NRPS gene cluster in the genome of Streptomyces lincomycetes, multiple copies of the target gene cluster can be introduced, which can be widely used in the genetic modification of various Streptomyces.

[0115] (d) Since the target gene cluster is discretely distributed after introduction and is less likely to undergo homologous recombination, the engineered Streptomyces obtained by the method of the present invention has good genetic stability, and a genetically stable high-yield strain can be obtained.

[0116] The present invention will be further described below in conjunction with specific examples. It should be understood that these examples are intended to illustrate the present invention only and are not intended to limit the scope of the present invention. The experimental methods in the following examples, for which specific conditions are not specified, are generally based on conventional conditions, such as those described in Sambrook et al., Molecular Cloning: A Laboratory Manual (New York: Cold Spring Harbor Laboratory Press, 1989); Genetic Manipulation of Streptomyces: A Laboratory Manual. 1985. D. A. Hopwood The John Innes Foundation), or according to the conditions recommended by the manufacturer. Unless otherwise stated, percentages and parts are weight percentages and parts by weight.

[0117] General Materials and Methods

[0118] Unless otherwise specified, all plasmids and strains in the examples are conventional or commercially available.

[0119] Specifically, the strains involved in the embodiments include:

[0120] Streptomyces avermitilis ATCC31267 was obtained from the American Type Culture Collection;

[0121] The strain S. avermitilis △olm:attB was constructed in this experiment. It was derived from S. avermitilis ATCC31267 by knocking out the olmA1-A7 genes of the oligomycin biosynthesis gene cluster PKS via homologous recombination and double crossover. Simultaneously, a synthetic φC31-8×attB recombinant sequence was introduced at the knockout position. For the sequence information of the φC31-8×attB recombinant sequence, see SEQ ID NO: 9 in Chinese invention patent ZL200910194419.4.

[0122] The erythromycin-producing strain S. erythraea E3-attB was constructed in this experiment. It was obtained by knocking out one of the NRPS gene clusters on the chromosome and exogenously introducing the φC31-8×attB sequence. The construction process and sequence information are shown in Example 1 of Chinese invention patent ZL200910194419.4.

[0123] The erythromycin-producing strain S. erythraea NRRL2338 was obtained from the Culture Collection Center.

[0124] The erythromycin-producing strain S. erythraea NRRL2338-Δ4907-8attB is a strain constructed in the present invention, in which the erythromycin SACE_4907 gene is knocked out and a φC31-8×attB sequence is introduced at the knockout position to obtain the strain.

[0125] Streptomyces lincolnensis NRRL2936 was obtained from the Culture Collection of China.

[0126] Streptomyces lincolnensis NRRL2936-Δ0744VattB is a strain constructed in the present invention. It is a strain obtained by knocking out the SLINC0744 gene from Streptomyces lincolnensis NRRL2936 and introducing a VWB-attB site sequence at the knockout position.

[0127] Streptomyces lincomycin NRRL2936-△0744VmoeφattB is a strain constructed in the present invention. It is based on NRRL2936-△0744VattB as the starting strain, and the SLINC6338 gene, SLINC6339 gene, and SLINC63340 gene in the moenomycin gene cluster are knocked out. At the same time, an artificially synthesized φC31-attB site sequence is introduced at the knockout position to obtain the strain.

[0128] The plasmids and cosmids involved in the embodiments include:

[0129] Streptomyces application plasmid pSOK804 is a routine operation plasmid for Streptomyces, which is preserved in our laboratory. The sequence information is referenced to GenBank: LT545994.1.

[0130] Streptomyces application plasmid pSET152 is a routine operation plasmid for Streptomyces, which is preserved in our laboratory. The sequence information is referenced to GenBank: AJ414670.1.

[0131] The pCAP01 plasmid is a commonly used plasmid for yeast TAR recombination cloning technology. It is preserved in our laboratory and the sequence information is referenced in PNAS 2014, 111(5): 1957-1962.

[0132] Abamectin cosmid 71320 was constructed in this application using the conventional Streptomyces operation plasmid pOJ436 as a vector. By establishing an abamectin genomic library clone and screening, a 34kb abamectin biosynthetic gene cluster aveD-aveA1-aveA2-aveC was obtained.

[0133] The avermectin pBa1-71320-804 cosmid was constructed according to the present invention, and the VWB-attP integrase module was introduced into the above 71320 cosmid.

[0134] Erythromycin C5 cosmid was constructed in our laboratory. The construction process is described in Example 1 of Chinese invention patent CN201010154463.5.

[0135] The erythromycin pBa1-C6-804 cosmid was constructed in this application, and the VWB-attP integrase module was introduced into the above-mentioned C5 cosmid.

[0136] The lincomycin pCAPlinBGC plasmid was constructed for this application. Cas9 and sgRNA were used to completely cut the 37kb lincomycin biosynthetic gene cluster lmrA to lmbrC fragment, and the pCAP01 plasmid was used as a vector and cloned using yeast TAR homologous recombination technology.

[0137] The lincomycin pBa1-CAPlinBGC-804 plasmid was constructed in this application, and the VWB-attP integrase module was introduced into the above-mentioned pCAPlinBGC plasmid.

[0138] The culture medium involved in the embodiment includes:

[0139] Erythromycin slant medium: corn steep liquor 1%, starch 1%, NaCl 0.3%, (NH4)2SO4 0.3%, CaCO3 0.5%, agar 2%, pH = 7.0.

[0140] Erythromycin seed culture medium: starch 5%, soybean cake powder 1.8%, corn steep liquor 1.3%, NaCl 0.3%, (NH4)2SO4 0.1%, NH4NO3 0.1%, CaCO3 0.6%, soybean oil 0.5%, pH = 6.8-7.0.

[0141] Erythromycin fermentation medium (100 ml): starch 3.0%, soybean cake powder 3%, dextrin 4%, (NH4)2SO4 0.2%, CaCO3 0.6%, soybean oil 1%, pH 7.0-7.2.

[0142] Some of the experimental methods involved in the examples are as follows:

[0143] Verification of the Streptomyces chromosome attB integration site: Site-specific recombinase can accurately recognize the bacterial attachment site attB and the plasmid attP site, catalyzing the integration between attB and attP to form attL and attR. These sites lack significant duplication and cannot serve as substrates for integrase recombination. The reaction is unidirectional and irreversible, allowing for stable propagation with the host. Therefore, by designing primers on both sides of the attB site and the plasmid attP site, combined PCR verification was performed based on the attL and attR sites formed after recombination, and further sequencing confirmation was performed.

[0144] Conjugative transfer method: Genetic Manipulation of Streptomyces: A Laboratory Manual. 1985. D. A. Hopwood The John Innes Foundation

[0145] Fermentation method of erythromycin: smear the erythromycin strain on a slant culture medium plate, culture at 34℃ for 6-8 days until the spores grow thick, dig a piece with a bamboo stick and inoculate 1cm 2 The spore agar block was added to 50 ml seed medium (500 ml shake flask), cultured at 34°C, 220 rpm for 2 days, and transferred to 50 ml fermentation medium (500 ml shake flask) at a 10% inoculum size. After inoculation for 24 hours, 1% n-propanol was added and cultured at 34°C, 220 rpm for 5-6 days. The flask was then sampled and the erythromycin chemical titer was tested.

[0146] Erythromycin chemical potency detection method: After centrifugation of 500μl of fermentation broth, take 8μl of supernatant, add 492μl of 10M phosphoric acid solution, boil in water bath for 3 minutes, add 500μl of 10M phosphoric acid solution and mix well, and finally detect with UV spectrophotometer at a wavelength of 485nm.

[0147] Example 1 Construction of a plasmid containing VWB-attP integrase and φC31-attP integrase modules and introduction into Streptomyces avermitilis

[0148] The commonly used plasmid pSOK804 (GenBank: LT545994.1) in Streptomyces contains the complete VWB-attP integrase module, while the commonly used plasmid pSET152 (GenBank: AJ414670.1) in Streptomyces contains the complete φC31-attP integrase module. The pSOK804 plasmid was digested with XbaI to obtain the complete VWB-attP integrase module, which was then ligated into the XbaI site of pSET152. This resulted in a plasmid containing both the VWB-attP integrase and φC31-attP integrase modules, approximately 7.8 kb in size and designated pBa1. To test the integrity of this constructed plasmid in Streptomyces, it was introduced into Streptomyces avermitilis ATCC 31267 by conjugation. Analysis of the genome sequence of Streptomyces avermitilis revealed the presence of three natural endogenous ave-VWB-attB loci, approximately 23 kb apart:

[0149] The three site sequences are:

[0150] ave-VWB-attB1, with a complete sequence of 73 bp, GCCTTCGTAGCACCGCTCTCCTAAAGCGGGTGTCGCAGGTTCGAATCCTGCCGGGGGCA (SEQ ID NO: 8)

[0151] ave-VWB-attB2, with a 42 bp core sequence, CTCCTAAAGCGGGTGTCGCAGGTTCGAATCCTGCCGGGGGCA (SEQ ID NO: 9)

[0152] ave-VWB-attB3, with a 47 bp core sequence, CCTCTCTCCTAAAGCGGGTGTCGCAGGTTCGAATCCTGCCGGGGGCA (SEQ ID NO: 10)

[0153] and a natural endogenous ave-φC31-attB site with a complete sequence of 51 bp,

[0154] The sequence is seq4: CGGTGGCGGTGCCAGGGGGTGCCCTTGGGCTCGCCCGGCGCGTACTCCACC (SEQ IDNO: 11)

[0155] The following attL sequence verification primers were designed respectively.

[0156] Primers on the VWB-attP site of plasmid pBa1,

[0157] VWB-S: gtccgtctgacgcgtgtggg (SEQ ID NO:13)

[0158] Primers on the φC31-attP site of plasmid pBa1:

[0159] φC31-S:CAGAGCAGGATTCCCGTTGAG(SEQ ID NO:14)

[0160] Primers on the side of the ave-VWB-attB1 site of Streptomyces avermitilis:

[0161] 1S:CGCGAGGCACTCAAGGTACTCA(SEQ ID NO:15)

[0162] Primers on the side of the ave-VWB-attB2 site of Streptomyces avermitilis:

[0163] 2S:TTGCGGTCTCAATCGCCACTT(SEQ ID NO:16)

[0164] Primers on the side of the ave-VWB-attB3 site of Streptomyces avermitilis:

[0165] 3S: GATTCCTCACGGACGAACTGC(SEQ ID NO:17)

[0166] Primers on the side of the ave-φC31-attB site of Streptomyces avermitilis:

[0167] 4S: GCAGCCCGTGATCCCGATGT(SEQ ID NO:18)

[0168] Ten randomly selected conjugates were then subjected to PCR verification of the integration site. Site-specific integration was confirmed by PCR using the expected integration sequence on the attL side of the pBa1 plasmid using primers VWB-S, 1S, 2S, and 3S, respectively. Furthermore, PCR was performed using primers φC31-S and 4S, respectively, for the pBa1 plasmid. The electrophoresed bands were recovered and sequenced for further confirmation.

[0169] Sequencing of the verification PCR products of ave-VWB-attB1, ave-VWB-attB2, and ave-VWB-attB3 all showed the expected complete attL sequence. The attL sequence of ave-VWB-attB1 is as follows: GCCTTCGTAGCTCAGGGGATAGAGCACCGCTCTCCTAAAGCGGGTGTCGCAGGTTCGAATCCTGCCGGGGGCACAACCTGCATCGCAG (SEQ ID NO: 19)

[0170] The attL sequence of ave-VWB-attB2 is as follows: TGGTCCTAGCCCAGGGAGTCGGCGGCCGGAACTCCTAAAGCGGGTGTCGCAGGTTCGAATCCTGCCG GGGGCACAACCTGCATCGCAG (SEQ ID NO.: 29)

[0171] The attL sequence of ave-VWB-attB3 is as follows: GCAGGTCAGTAGCCGGACACCCCACCCTCTCTCCTAAAGCGGGTTGTCGCAGGTTCGAATCCTGCCGG GGGCACAACCTGCATCGCAG (SEQ ID NO: 20)

[0172] The attL sequence of ave-φC31-attB is as follows:

[0173] CGGTGCGGGTGCCAGGGGGTGCCCTTGAGTTCTCTCAGTTGGGGGCGTAGGGTCGCCGACATGACACAAGGGGTTGTGAC (SEQ ID NO: 21)

[0174] The statistical results of the integration of the 10 zygote sites are as follows:

[0175]

[0176] + indicates that site integration occurred as verified by PCR - indicates that site integration did not occur as verified by PCR

[0177] The above results show that conjugates with site-integration were identified at all three endogenous VWB-attB sites and one endogenous φC31-attB site. Of these, two conjugates were found to have simultaneous integration at all four sites, representing an additional four copies of the exogenous plasmid. Therefore, simply by selecting a large number of conjugates and performing PCR verification, it is possible to identify concomitant integration of the exogenous gene sequence at at least four sites, indicating a plasmid incorporation of four copies.

[0178] Example 2: Adding the VWB-integrase attP module to the cosmid 71320 containing the avermectin synthesis gene cluster aveA1-aveA2-aveC and introducing it into the S. avermitilis △olm:attB strain

[0179] Cosmid 71320, containing the 34kb avermectin biosynthetic gene cluster aveD-aveA1-aveA2-aveC, was obtained by cloning and screening an avermectin genomic library using the pOJ436 plasmid as a vector. The 71320 cosmid backbone already contains the φC31-attP integrase module. The VWB-attP integrase module was obtained by PCR and then cloned with the 71320 cosmid using RedET recombination. This resulted in a 71320 cosmid harboring both the VWB-attP and φC31-attP integrase modules. The resulting cosmid was designated pBa1-71320-804.

[0180] The S. avermitilis △olm:attB strain was constructed by knocking out the olmA1-A7 genes of the oligomycin biosynthesis PKS gene cluster via homologous recombination and double crossover. Simultaneously, a synthetic φC31-8×attB insertion cassette sequence was introduced at the knockout site (sequence information is available in Patent ZL200910194419.4). Compared to the original S. avermitilis ATCC31267 strain described in Example 1, this strain has an additional exogenously introduced φC31-8×attB site at the chromosomal attB site.

[0181] The pBa1-71320-804 cosmid was conjugated into the S. avermitilis Δolm:attB strain. Ten randomly selected conjugates were then PCR-confirmed for integration site confirmation and further fermentation to determine changes in avermectin production. PCR verification was performed in the same manner as in Example 1 to verify the integrated attL sequence. Verification primers were designed for the φC31-8×attB site:

[0182] 5S:ATTCAGCCGATAGCGGTGGTGG(SEQ ID NO:22)

[0183] The statistical results of the integration of the 10 zygote sites are as follows:

[0184]

[0185] + indicates that site integration occurred as verified by PCR - indicates that site integration did not occur as verified by PCR

[0186] The above results show that none of the 10 selected conjugates screened for the target gene undergoing recombination at the exogenously introduced φC31-8×attB site. This suggests that the artificially designed exogenous φC31-8×attB sequence is not fully compatible with S. avermitilis and needs to be designed to resemble the native φC31-attB site sequence of S. avermitilis to increase the efficiency of recombination and integration. The integration results of the remaining four endogenous attB sites were essentially consistent with those in Example 1, with all screening for site-specific recombination and integration. Among the 10 conjugates, both ave-VWB-attB1 and ave-φC31-attB were site-integrated, and 3 conjugates with integration were screened out at the ave-VWB-attB2 and ave-VWB-attB3 sites respectively. No conjugates with integration at the four endogenous attB sites were screened out among the 10 selected conjugates. This may be because a larger gene cluster was constructed in the basic plasmid of the pBa1 system, which increased the difficulty of screening. By selecting a large number of conjugates and further screening and verification, more conjugates with integration at the four endogenous attB sites should be screened out.

[0187] Example 3: Introduction of plasmid pBa1 into erythromycin strain S. erythraea E3-attB

[0188] The S. erythraea E3-attB strain is the modified strain described in Example 1 of the inventor's authorized patent ZL200910194419.4. It has an exogenously introduced Ery-φC31-8×attB site. Sequence analysis of the S. erythraea genome also revealed the presence of a complete, 76-bp natural endogenous Ery-VWB-attB site. The sequence is as follows:

[0189] GCCCTCGTAGCTCAGGGGATAGAGCACCGCTCTCCTAAAGCGGGTGTCGCAGGTTCGAATCCTGCCGGGGGCGCAA(SEQ ID NO:12)

[0190] Plasmid pBa1 was introduced into S. erythraea E3-attB strain by conjugation transfer, and PCR verification was performed using primers on both sides of the integrated attL sequence to detect whether site-specific recombination integration occurred.

[0191] Primer 6S on the Ery-VWB-attB site side: ATCCTCGCCGTCGTTCGGACCTTC (SEQ ID NO: 23)

[0192] Ery-φC31-8×attB site side primer 7S: GACGCTGTTCCACTCCTACGCC (SEQ ID NO: 24)

[0193] Ten conjugates were selected and the integration sequence of the attL site of Ery-VWB-attB was verified by PCR using primers VWB-S and 6S, and the integration sequence of the attL site of Ery-φC31-attB was verified by PCR using primers φC31-S and 7S.

[0194] The attL sequence of Ery-VWB-attB is as follows:

[0195] GCCCTCGTAGCTCAGGGGATAGAGCACCGCTCTCCTAAAGCGGGTGTCGCAGGTTCGAATCCTGCCGGGGGCACAACCTGCATCGCAG(SEQ ID NO:25)

[0196] The attL sequence of Ery-φC31-8×attB is as follows:

[0197] TCGGGTGCCAGGGCGTGCCCTTGAGTTCTCTCAGTTGGGGGCGTAGGGTCGCCGACATGACACAAGGGGTTGTGAC (SEQ ID NO: 26)

[0198] The statistical results of the integration of the 10 zygote sites are as follows:

[0199]

[0200] The final results showed that five conjugates had integrated simultaneously at both the Ery-VWB-attB and Ery-φC31-8×attB loci, while the remaining five conjugates had integrated only at either the Ery-VWB-attB or Ery-φC31-8×attB loci. Therefore, in erythromycin-producing strains, the introduction of an exogenous φC31-attB site and the naturally occurring Ery-VWB-attB site can be used to screen for site-specific recombinant integration of two copies of the exogenous plasmid by screening a large number of conjugates and then verifying the integration site through PCR.

[0201] Example 4: Adding the VWB-attP integration module to the C5 cosmid containing the erythromycin synthesis gene cluster and simultaneously introducing it into the erythromycin strain S. erythraea E3-attB

[0202] The erythromycin C5 cosmid contains a 45kb erythromycin biosynthetic gene cluster and a φC31-attP integrase module within its backbone. Information about the C5 cosmid is described in Example 1 of the inventor's previous patent application, CN201010154463.5. The C5 cosmid has a single XbaI restriction site within its original multiple cloning site. Using the pSOK804 plasmid as a template, the complete VWB-attP integrase module was obtained by PCR. This module was then ligated to the XbaI site of the C5 cosmid using Gibson recombination cloning, resulting in a C5 cosmid containing both the VWB-attP and φC31-attP integrase modules. The resulting cosmid was designated pBa1-C6-804. The pBa1-C6-804 cosmid was then conjugated into the S. erythraea E3-attB strain. Ten conjugates were randomly selected for PCR verification of the integration site and further fermentation to detect changes in erythromycin production.

[0203] The primer method used for PCR verification of the sequence site of attL after integration was consistent with that in Example 3.

[0204] The statistical results of the integration of the 10 zygote sites are as follows:

[0205]

[0206] After PCR verification, 6 conjugates were found to be integrated simultaneously at the Ery-VWB-attB and Ery-φC31-8×attB sites. All 10 conjugates were integrated at the natural Ery-VWB-attB site, and 4 conjugates were not integrated at the artificially designed Ery-φC31-8×attB site. Therefore, combined with the results of Examples 3 and 4, the integration efficiency of the naturally occurring Ery-VWB-attB is relatively high in erythromycin-producing strains. The exogenously introduced Ery-φC31-8×attB site can be selected from a large number of conjugates and, after PCR verification, a relatively large number of recombinant strains with integration at both the Ery-VWB-attB and Ery-φC31-attB sites can be obtained.

[0207] Ten conjugates were fermented in 500 ml Erlenmeyer flasks to test erythromycin production. The starting strain, S. erythraea E3-attB, was used as a control. The results are as follows:

[0208]

[0209] After site-specific integration of the erythromycin biosynthetic gene cluster, the chemical potency of erythromycin was significantly increased compared to the starting strain S. erythraea E3-attB, with the exception of conjugant No. 2. Strains with integration at both the Ery-VWB-attB and Ery-φC31-8×attB loci have the potential to screen for higher erythromycin yields compared to strains with integration at only the Ery-VWB-attB locus.

[0210] Example 5: Introduction of pBa1-C6-804 into the erythromycin strain S. erythraea 2338-Δ4907-8attB

[0211] The non-growth-related gene SACE_4907 in the erythromycin model strain S. erythraea 2338 was knocked out, and the φC31-8×attB sequence (sequence information, see SEQ ID NO: 9 in Chinese invention patent ZL200910194419.4) was introduced at the knockout position to obtain the modified strain S. erythraea 2338-△4907-8attB. In addition to containing an endogenous Ery-VWB-attB site, this strain also introduced an exogenous φC31-8×attB site at position 4907.

[0212] The pBa-C6-804 cosmid in Example 4 was introduced into the modified S. erythraea 2338-Δ4907-8attB strain by conjugation, and 10 conjugates were randomly selected for PCR verification of the integration site and further fermentation detection of the change in erythromycin production.

[0213] PCR and sequencing were performed using the sequence on the attL side after integration. The statistical results of the integration of 10 conjugate sites are as follows:

[0214]

[0215] The above results indicate that eight of the ten selected conjugates underwent site-specific recombination mediated by the φC31 integrase at the φC31-8×attB site introduced by the knockout of the SACE_4907 gene. Furthermore, all conjugates underwent site-specific recombination mediated by the VWB integrase at the endogenous Ery-VWB-attB site. This translates to eight of the selected conjugates having two copies of the erythromycin biosynthesis gene cluster plasmid. Fermentation of the ten conjugates in 500ml shake flasks demonstrated a 50%-80% increase in erythromycin production compared to the starting strain, S. erythraea2338-Δ4907-8attB.

[0216] Example 6: Adding the VWB-attP integration module to the pCAPlinBGC plasmid containing the lincomycin synthesis gene cluster and introducing it into Streptomyces lincomycin

[0217] The lincomycin pCAPlinBGC plasmid contains a 37kb complete lincomycin biosynthesis gene cluster, including the complete genes from lmrA to lmrC. The construction process is to extract the total genomic DNA of Streptomyces lincomycin NRRL2936, design Cas9 recognition sites on both sides of the complete lincomycin gene cluster, and use the NEB kit EnGen TM Two sgRNAs were synthesized by in vitro transcription of sgRNA and Cas9, and the total DNA was precisely cleaved. Using the pCAP01 plasmid as a vector, yeast TAR homologous recombination was used to construct a plasmid containing the entire lincomplex gene cluster. This plasmid was named pCAPlinBGC. Since the pCAP01 plasmid only contains the φC31-attP integrase module, the constructed pCAPlinBGC plasmid also contains only the φC31-attP integrase module. The VWB-attP integrase module was obtained by PCR and cloned with the pCAPlinBGC plasmid using RedET recombination. This resulted in a plasmid containing both the VWB-attP and φC31-attP integrase modules. The resulting plasmid was named pBa1-CAPlinBGC-804.

[0218] According to the sequence comparison analysis of Streptomyces lincomyces NRRL2936, it was found that there are three natural endogenous VWB-attB homologous sequence sites, namely:

[0219] seq6:lin-VWB-attB1, with a complete sequence of 76 bp,

[0220] gccttcgtagctcaggggatagagcaccgctctcctaaagcgggtgtcgcaggttcgaatcctgccgggggcacag(SEQ ID NO:5)

[0221] seq7:lin-VWB-attB2, with a 45 bp core sequence, ctcctaaagcgggtgtcgcaggttcgaatcctgccgggggcacag (SEQ ID NO:6)

[0222] seq8:lin-VWB-attB3, with a 45 bp core sequence, ctcctcaagcgggtgtcgcaggttcgaatcctgccgggggcacct (SEQ ID NO: 7)

[0223] The inventors knocked out the SLINC0744 gene (SLINC0744 gene in genebank: CP016438.1) in the Cysteate NRPS gene cluster (J. Org. Chem. 2018, 83, 7102-7108) of Streptomyces lincolnii NRRL2936 and introduced a synthetic VWB-attB site at the knockout position. The sequence information is consistent with the endogenous lin-VWB-attB1 sequence (SEQ ID NO: 5). The knockout strain is named NRRL2936-△0744VattB.

[0224] The inventors knocked out the SLINC6338, SLINC6339, and SLINC63340 genes in the moenomycin cluster, a non-growth-related gene, in the strain NRRL2936-Δ0744VattB. Simultaneously, a synthetic φC31-attB site sequence was introduced at the knockout site. The sequence information is: seq9: cggtgcgggtgccagggcgtgcccttgggctccccgggcgcgtactccacc (SEQ ID NO: 1). The knockout strain is named NRRL2936-Δ0744VmoeφattB. This strain possesses three endogenous VWB-attB sites, one exogenous VWB-attB site, and one exogenous φC31-attB site.

[0225] Plasmid pBa1-CAPlinBGC-804 was introduced into the NRRL2936-△0744VattB strain by conjugation. PCR was performed using primers flanking the integrated attL sequence to verify site-specific recombination. Because the φC31-attB site does not naturally exist in Streptomyces lincomycetes, this verification was not performed.

[0226] Here are the results:

[0227] 1 2 3 4 5 6 7 8 9 10 lin-VWB-attB1 + + + + + + + + + + lin-VWB-attB2 - - - - - - - - - - lin-VWB-attB3 - - - - - - - - - -

[0228] + indicates that site integration occurred as verified by PCR - indicates that site integration did not occur as verified by PCR

[0229] The above results show that among the 10 selected conjugates, the relatively complete endogenous lin-VWB-attB1 was screened to have recombinant integration conjugates, and the exogenously introduced attB site was also screened to have recombinant integration in some conjugates (results not shown).

[0230] Ten conjugates were fermented in 500 ml Erlenmeyer flasks to detect changes in lincomycin production. At the same time, the SLINC0744 knockout strain NRRL2936-△0744VattB of the starting strain lincomycin Streptomyces NRRL2936 was used as a control. Compared with the starting strain's lincomycin A production of about 20 mg / L, the modified strain with an increased copy number of the lincomycin biosynthesis gene cluster can increase the lincomycin A production to 35-200 mg / L, a significant improvement.

[0231] The NRRL2936-△0744VmoeφattB strain contains, in addition to three endogenous VWB-attB sites, a newly introduced exogenous VWB-attB site and an exogenous φC31-attB site. This strain, upon conjugational transfer of the pBa1 series of plasmids containing the desired exogenous gene, has the potential to increase the copy number of multiple exogenous genes through site-specific recombination and screening of a large number of conjugates.

[0232] All documents mentioned in this application are incorporated herein by reference, just as if each document were incorporated herein by reference individually. It should also be understood that after reading the above teachings of the present invention, those skilled in the art may make various changes or modifications to the present invention, and that such equivalents also fall within the scope of the claims appended hereto. Sequence Listing <110> Shanghai Institute of Organic Chemistry, Chinese Academy of Sciences Huzhou Biomanufacturing Innovation Center, Shanghai Institute of Organic Chemistry, Chinese Academy of Sciences <120> VWB-attP and φC31-attP integrase-mediated gene recombination methods and their applications in Streptomyces <130> P2020-0396 <160> 29 <170> SIPOSequenceListing 1.0 <210> 1 <211> 51 <212> DNA <213> Artificial Sequence <400> 1 cggtgcgggt gccagggcgt gcccttgggc tccccgggcg cgtactccac c 51 <210> 2 <211> 94 <212> DNA <213> Artificial Sequence <400> 2 gactcactca gactcactga ggctcatgat cgctttacgt tctctcctaa agcgggtgtc 60 gcaggttcga atcctgccgg gggcacaacc tgca 94 <210> 3 <211> 35 <212> DNA <213> Artificial Sequence <400> 3 ggtgccaggg cgtgcccttg ggctccccgg gcgcg 35 <210> 4 <211> 39 <212> DNA <213> Artificial Sequence <400> 4 ccccaactgg ggtaaccttt gagttctctc agttggggg 39 <210> 5 <211> 76 <212> DNA <213> Streptomyces lincolnensis <400> 5 gccttcgtag ctcaggggat agagcaccgc tctcctaaag cgggtgtcgc aggttcgaat 60 cctgccgggg gcacag 76 <210> 6 <211> 45 <212> DNA <213> Streptomyces lincolnensis <400> 6 ctcctaaagc gggtgtcgca ggttcgaatc ctgccggggg cacag 45 <210> 7 <211> 45 <212> DNA <213> Streptomyces lincolnensis <400> 7 ctcctcaagc gggtgtcgca ggttcgaatc ctgccggggg cacct 45 <210> 8 <211> 73 <212> DNA <213> Streptomyces avermitilis <400> 8 gccttcgtag ctcaggggat agagcaccgc tctcctaaag cgggtgtcgc aggttcgaat 60 cctgccgggg gca 73 <210> 9 <211> 42 <212> DNA <213> Streptomyces avermitilis <400> 9 ctcctaaagc gggtgtcgca ggttcgaatc ctgccggggg ca 42 <210> 10 <211> 47 <212> DNA <213> Streptomyces avermitilis <400> 10 cctctctcct aaagcgggtg tcgcaggttc gaatcctgcc gggggca 47 <210> 11 <211> 51 <212> DNA <213> Streptomyces avermitilis <400> 11 cggtgcgggt gccagggggt gcccttgggc tcgcccggcg cgtactccac c 51 <210> 12 <211> 76 <212> DNA <213> Streptomyces erythraea <400> 12 gccctcgtag ctcaggggat agagcaccgc tctcctaaag cgggtgtcgc aggttcgaat 60 cctgccgggg gcgcaa 76 <210> 13 <211> 20 <212> DNA <213> Artificial Sequence <400> 13 gtccgtctga cgcgtgtggg 20 <210> 14 <211> twenty one <212> DNA <213> Artificial Sequence <400> 14 cagagcagga ttcccgttga g 21 <210> 15 <211> twenty two <212> DNA <213> Artificial Sequence <400> 15 cgcgaggcac tcaaggtact ca 22 <210> 16 <211> twenty one <212> DNA <213> Artificial Sequence <400> 16 ttgcggtctc aatcgccact t 21 <210> 17 <211> twenty one <212> DNA <213> Artificial Sequence <400> 17 gattcctcac ggacgaactg c 21 <210> 18 <211> 20 <212> DNA <213> Artificial Sequence <400> 18 gcagcccgtg atcccgatgt 20 <210> 19 <211> 88 <212> DNA <213> Artificial Sequence <400> 19 gccttcgtag ctcaggggat agagcaccgc tctcctaaag cgggtgtcgc aggttcgaat 60 cctgccgggg gcacaacctg catcgcag 88 <210> 20 <211> 87 <212> DNA <213> Artificial Sequence <400> 20 gcaggtcagt agccggacac cccaccctct ctcctaaagc gggtgtcgca ggttcgaatc 60 ctgccggggg cacaacctgc atcgcag 87 <210> twenty one <211> 80 <212> DNA <213> Artificial Sequence <400> twenty one cggtgcgggt gccagggggt gcccttgagt tctctcagtt gggggcgtag ggtcgccgac 60 atgacacaag gggttgtgac 80 <210> twenty two <211> twenty two <212> DNA <213> Artificial Sequence <400> twenty two attcagccga tagcggtggt gg 22 <210> twenty three <211> twenty four <212> DNA <213> Artificial Sequence <400> twenty three atcctcgccg tcgttcggac cttc 24 <210> twenty four <211> twenty two <212> DNA <213> Artificial Sequence <400> twenty four gacgctgttc cactcctacg cc 22 <210> 25 <211> 88 <212> DNA <213> Artificial Sequence <400> 25 gccctcgtag ctcaggggat agagcaccgc tctcctaaag cgggtgtcgc aggttcgaat 60 cctgccgggg gcacaacctg catcgcag 88 <210> 26 <211> 76 <212> DNA <213> Artificial Sequence <400> 26 tcgggtgcca gggcgtgccc ttgagttctc tcagttgggg gcgtagggtc gccgacatga 60 cacaaggggt tgtgac 76 <210> 27 <211> 2341 <212> DNA <213> Artificial Sequence <400> 27 gtcgacctgc agcccaagct tcgcgccctc catgaggcgt acccgaagtt caccgaagag 60 cgcattttcg ccgcggcccg ccgggccgcg ccgggcccgc tcgacgagga cgccgaggaa 120 cgcctgctca ccctgttccg tggtctcacc gaggagcagc agcgttccaa gctgatcgag 180 atgagcgcgc tgaacgagtc caacaagcag tagccgacgc ccgtacaacc gtcggcctgc 240 ctcgcgggtc taacgaaaat ggactccacc actccccgtg attcctcggg cacttggtgc 300 acgcagagtg gtcgcatatt cacctacaag ggggtacggt cggtcgagcg gcctgccctc 360 ccccatggcc gacggtcaaa cgtcgcctgc ctgcccgggg gatacccatg tgcattcgtg 420 tccgcttcgc gcctctcgac ccgctcaact tccggccgta cgacgccgct ggaaacacgg 480 tcaccctgcc tgccaccctc ccccgggatg cttccctcgt agcccttcga gccgtccttg 540 aagaactggc tgtagagcag cccccggacg gtgcagtctg ctggtgtggg gcagccgtac 600 acatcctgcc ccgcgttccc gaacagcgga ggagcggaca ggtgacccat ggcgcctaga 660 gcgacgaaca acccacggca gttgagggcg aagagctgcg gctgccagct gtgcatggag 720 aagtacccgc ccgagaagta cggagagcgg aaccgccgac gcgactgcac cggctcgtgg 780 caggcgcgtt accgcgaccc ggccggcaac cagaagcaga aatgctttgc gatcaaggac 840 ggcggtaaga aggcagccga ggcgcacctc gacaagatcc gcacgcaggt ccgcgaacgg 900 acgtacgccg acccgaagcg tggcgagatc accctgtccc agtggtggaa actgtggtgg 960 gaggcgcagc cggaccgagc agtcacgacc gccaaccgga agcggtcgaa ctgggccgcg 1020 cacatcgagc cgaagtgggg gcagtggcgt ctctgcgact tggagtacat cgagctgcag 1080 gcgtggatca cgaaggaggt gaagggctac cacacccgga agaaggttca tgaggtgctg 1140 aactcgatgc tccgggccgc cgtcaaggac ggccggcgta tcccgttcaa cccggcggcc 1200 gacctggaca ttggcgaggc gccggcgaag catccggacg aactgatgcc gcccgaccgc 1260 gcgcagtgcg cgctgatcgt cagtcacctg ccgatgtact accggccgct cgtcgtcttc 1320 cttgaacaca ccggtctccg gtggggcgag gcgacggcgc tgcgctggga gaacgtcgac 1380 ctggacgccc actacctcaa ggtgaaggaa gtgctcagtg acgacgaagg caagctgttc 1440 cggaagcctg cgccgaagag caacgccggg ttccgcacgg tcccgctcac gccgcaggcc 1500 gaggacgcga tccgcaccat ggtcacccgg tggcggccga ctcccacgat caccccgatt 1560 ggcgaggacc cgtacgacct cgcgccggat gagctcgtgt tccgcggccc acagggcggc 1620 gtcctgaccc ggcacaactt ccggcgcaca tggatccctg caatcaaggc tgcaggcctc 1680 gcccgcgagg tgaagaaccg ggacaccggc cgcatggagt ggtggccgcg ggtgcacgac 1740 cttcgccacg tgttcgccac gtggctcaag gatgtgggca ttgacgagaa ggacacgcag 1800 accgtgatgg gtcacgagcg agggtcgaag gtgacgtggt tgtaccagca ttcgccggcc 1860 gacgtggcgg cgaaggtgcg ggcggcgatg gctcccgaga ccgagggtgt tcgaacgctg 1920 cgggcggtgt gacgccggat gccacgcaga tgccacaggg atgccacaac accccctcac 1980 tgagactcac cgagactcac tgaaactcat ttatgcaggt gaagccccta tggcgacagg 2040 ctcactgaga ctcactcaga ctcactgagg ctcatgatcg ctttacgttc tctcctaaag 2100 cgggtgtcgc aggttcgaat cctgccgggg gcacaacctg catcgcaggt cagggagtca 2160 acggcccccc gttccattcg aacggggggc cgttgtcgta cccggatgcc acatagatgc 2220 cacatcccca cggaatcctg cggatcacgt cgctcgaaag agtgatgtgc acagcagcca 2280 caatgcgtag agtgctgtct accgagcggg ccggcgtgct ccccacacgc gtcagacgga 2340 c 2341 <210> 28 <211> 2109 <212> DNA <213> Artificial Sequence <400> 28 aagctctagc gattccagac gtcccgaagg cgtggcgcgg cttccccgtg ccggagcaat 60 cgccctgggt gggttacacg acgcccctct atggcccgta ctgacggaca caccgaagcc 120 ccggcggcaa ccctcagcgg atgccccggg gcttcacgtt ttcccaggtc agaagcggtt 180 ttcgggagta gtgccccaac tggggtaacc tttgagttct ctcagttggg ggcgtagggt 240 cgccgacatg acacaagggg ttgtgaccgg ggtggacacg tacgcgggtg cttacgaccg 300 tcagtcgcgc gagcgcgaga attcgagcgc agcaagccca gcgacacagc gtagcgccaa 360 cgaagacaag gcggccgacc ttcagcgcga agtcgagcgc gacgggggcc ggttcaggtt 420 cgtcgggcat ttcagcgaag cgccgggcac gtcggcgttc gggacggcgg agcgcccgga 480 gttcgaacgc atcctgaacg aatgccgcgc cgggcggctc aacatgatca ttgtctatga 540 cgtgtcgcgc ttctcgcgcc tgaaggtcat ggacgcgatt ccgattgtct cggaattgct 600 cgccctgggc gtgacgattg tttccactca ggaaggcgtc ttccggcagg gaaacgtcat 660 ggacctgatt cacctgatta tgcggctcga cgcgtcgcac aaagaatctt cgctgaagtc 720 ggcgaagatt ctcgacacga agaaccttca gcgcgaattg ggcgggtacg tcggcgggaa 780 ggcgccttac ggcttcgagc ttgtttcgga gacgaaggag atcacgcgca acggccgaat 840 ggtcaatgtc gtcatcaaca agcttgcgca ctcgaccact ccccttaccg gacccttcga 900 gttcgagccc gacgtaatcc ggtggtggtg gcgtgagatc aagacgcaca aacaccttcc 960 cttcaagccg ggcagtcaag ccgccattca cccgggcagc atcacggggc tttgtaagcg 1020 catggacgct gacgccgtgc cgacccgggg cgagacgatt gggaagaaga ccgcttcaag 1080 cgcctgggac ccggcaaccg ttatgcgaat ccttcgggac ccgcgtattg cgggcttcgc 1140 cgctgaggtg atctacaaga agaagccgga cggcacgccg accacgaaga ttgagggtta 1200 ccgcattcag cgcgacccga tcacgctccg gccggtcgag cttgattgcg gaccgatcat 1260 cgagcccgct gagtggtatg agcttcaggc gtggttggac ggcagggggc gcggcaaggg 1320 gctttcccgg gggcaagcca ttctgtccgc catggacaag ctgtactgcg agtgtggcgc 1380 cgtcatgact tcgaagcgcg gggaagaatc gatcaaggac tcttaccgct gccgtcgccg 1440 gaaggtggtc gacccgtccg cacctgggca gcacgaaggc acgtgcaacg tcagcatggc 1500 ggcactcgac aagttcgttg cggaacgcat cttcaacaag atcaggcacg ccgaaggcga 1560 cgaagagacg ttggcgcttc tgtgggaagc cgcccgacgc ttcggcaagc tcactgaggc 1620 gcctgagaag agcggcgaac gggcgaacct tgttgcggag cgcgccgacg ccctgaacgc 1680 ccttgaagag ctgtacgaag accgcgcggc aggcgcgtac gacggacccg ttggcaggaa 1740 gcacttccgg aagcaacagg cagcgctgac gctccggcag caaggggcgg aagagcggct 1800 tgccgaactt gaagccgccg aagccccgaa gcttcccctt gaccaatggt tccccgaaga 1860 cgccgacgct gacccgaccg gccctaagtc gtggtggggg cgcgcgtcag tagacgacaa 1920 gcgcgtgttc gtcgggctct tcgtagacaa gatcgttgtc acgaagtcga ctacgggcag 1980 ggggcaggga acgcccatcg agaagcgcgc ttcgatcacg tgggcgaagc cgccgaccga 2040 cgacgacgaa gacgacgccc aggacggcac ggaagacgta gcggcgtagc gagacacccg 2100 ggaagcctg 2109 <210> 29 <211> 88 <212> DNA <213> Artificial Sequence <400> 29 tggtcctagc ccagggagtc ggcggccgga actcctaaag cgggtgtcgc aggttcgaat 60 cctgccgggg gcacaacctg catcgcag 88

Claims

1. A method for genetic recombination of Streptomyces lincomyces mediated by VWB-attP integrase, characterized in that: Including steps: (1) introducing an exogenous attB site recognized by VWB integrase into the CysteateNRPS gene cluster of the genome of Streptomyces lincolnensis NRRL2936 to replace the original SLINC0744 gene of the gene cluster, wherein the sequence of the attB site recognized by the exogenous VWB integrase is shown in SEQ ID NO:5; The genome of the Streptomyces lincomyces comprises an endogenous attB site selected from the group consisting of: (a) attB site 1′ recognized by the VWB integrase of Streptomyces lincomyces SLINC_t29, the sequence of which is shown in SEQ ID NO: 5; (b) an attB site 2′ recognized by the VWB integrase located in the spacer region between SLINC_3666 and SLINC_3667 of Streptomyces lincomyces, the sequence of which is shown in SEQ ID NO: 6; and (c) the attB site 3′ of the VWB integrase located in the spacer region between SLINC_3671 and SLINC_3672 of Streptomyces lincomycetes, the sequence of which is shown in SEQ ID NO: 7; (2) introducing a vector comprising (i) a VWB integrase module and (ii) a target gene or target gene cluster into the Streptomyces lincomyces of step (1), selecting Streptomyces in which the target gene or target gene cluster is integrated into the endogenous attB site and the exogenous attB site of the Streptomyces genome, thereby obtaining Streptomyces in which multiple copies of the gene or gene cluster are integrated. Wherein, the endogenous attB site is the endogenous attB site 1' recognized by the VWB integrase of Streptomyces lincomyces; And the target gene cluster is a lincomycin biosynthesis gene cluster.

2. A genetically engineered bacterium of Streptomyces lincomyces, wherein the genome of the genetically engineered bacterium comprises: (i) an exogenous VWB-attB site, the sequence of which is shown in SEQ ID NO: 5, and which is introduced into the Cysteate NRPS gene cluster of the Streptomyces lincomyces genome, replacing the original SLINC0744 gene of the gene cluster; The genome of the Streptomyces lincomyces contains an endogenous attB site selected from the group consisting of: (a) located at the 1′ attB site recognized by the VWB integrase of Streptomyces lincomyces SLINC_t29, the sequence of which is shown in SEQ ID NO: 5; (b) an attB site 2′ recognized by the VWB integrase located in the spacer region between SLINC_3666 and SLINC_3667 of Streptomyces lincomyces, the sequence of which is shown in SEQ ID NO: 6; and (c) the attB site 3′ recognized by the VWB integrase located in the spacer region between SLINC_3671 and SLINC_3672 of Streptomyces lincomycetes, the sequence of which is shown in SEQ ID NO: 7; Furthermore, the starting strain of the genetically engineered Streptomyces lincolnensis is Streptomyces lincolnensis NRRL2936.

3. A use of the genetically engineered Streptomyces lincomyces according to claim 2, characterized in that: Used to prepare engineered Streptomyces bacteria carrying multiple copies of target genes or target gene clusters.

4. An engineered strain of Streptomyces lincomyces with multiple copies of a target gene cluster integrated into its genome, characterized in that: The genome of the engineered Streptomyces lincomyces strain includes at least two copies of the target gene cluster located at the following positions: (a) located at the 1′ position of the attB site recognized by the VWB integrase of Streptomyces lincomyces SLINC_t29, and replacing the original attB site at this position, wherein the sequence of the original attB site is shown in SEQ ID NO: 5; (b) Cysteate NRPS gene cluster in the genome of Streptomyces lincomyces, and replaces the original SLINC0744 gene in the gene cluster; The target gene cluster is a lincomycin biosynthesis gene cluster, and the starting strain of the engineered Streptomyces lincolnensis is Streptomyces lincolnensis NRRL2936.

5. A method for efficiently expressing a target gene or target gene cluster using Streptomyces lincomyces, characterized in that: The method includes: (a) preparing an engineered Streptomyces lincomycin by the method of claim 1, so that multiple copies of the lincomycin biosynthetic gene cluster are integrated into the Streptomyces genome; (b) Cultivating the engineered Streptomyces lincomyces obtained in step (a) to efficiently express the target gene or target gene cluster.

Citation Information

Patent Citations

  • Gene recombination mediated by phiC312 and inheritance reformation for erythrocin producing bacterium

    CN101649326B

  • Method for improving yield of erythrocin

    CN102234674A

  • Gene recombination mediated by phiC312 and inheritance reformation for erythrocin producing bacterium

    CN101649326A

  • Multi-copy amplification method of antibiotic biosynthetic gene cluster of streptomycete and application

    CN106906238A

  • Construction and applications of a series of efficient heterologous expression hosts of Streptomyces coelicolor

    CN108251344A