Reagents and methods for detecting immune reconstitution status in HIV-infected individuals

By screening interferon-stimulated genes IFI27 and IFI6, designing specific primers and probes, and combining them with real-time quantitative PCR technology, the problem of the inability to evaluate the immune reconstitution status of HIV-infected individuals at an early stage in existing technologies has been solved, enabling the early detection of immune non-responders and the provision of targeted treatment.

CN113584149BActive Publication Date: 2026-05-26NAT CENT FOR AIDSSTD CONTROL & PREVENTION CHINESE CENT FOR DISEASE CONTROL & PREVENTION
View PDF 0 Cites 0 Cited by

Patent Information

Application Number
CN202110780911.0
Authority / Receiving Office
CN · China
Patent Type
Patents(China)
Current Assignee / Owner
Filing Date
2021-07-09
Publication Date
2026-05-26
Estimated Expiration
2041-07-09

Smart Images

  • Figure CN113584149B_ABST
    Figure CN113584149B_ABST
Patent Text Reader

Abstract

This invention provides primer sets, probes, kits for expressing interferon-stimulated genes IFI27 and IFI6, and their use in evaluating the immune reconstitution status of HIV-infected individuals.
Need to check novelty before this filing date? Find Prior Art

Description

Technical Field

[0001] This invention relates to the field of detecting the immune reconstitution status of HIV-infected individuals, and more specifically to a primer set, probe, kit for expressing interferon-stimulated genes IFI27 and / or IFI6, and their application in detecting the immune reconstitution status of HIV-infected individuals. Background Technology

[0002] Antiretroviral therapy for HIV can effectively suppress viral replication, but 20%-30% of treated individuals still fail to achieve effective immune reconstitution. Even though HIV viral load is effectively controlled, CD4+... + Individuals with persistently low T lymphocyte levels are termed "immune non-responders." These individuals have significantly higher rates of non-AIDS-related illnesses and mortality compared to those with an immune response. Currently, there are no well-established methods, either domestically or internationally, for early evaluation of immune reconstitution in HIV-infected individuals.

[0003] In existing technologies, viral load and CD4 + T-cell counts, two commonly used clinical indicators for evaluating treatment efficacy, are unsuitable for assessing immune reconstitution in HIV-infected individuals. Firstly, because HIV-infected individuals participating in clinical studies aimed at improving immune reconstitution have undergone long-term antiretroviral therapy, their viral loads are already very low, making viral load an inappropriate indicator of the efficacy of novel treatment regimens. Secondly, clinical evaluation of patient immune reconstitution primarily relies on CD4+. + T lymphocyte count, but most HIV-infected individuals have CD4 counts after treatment. + The number of T cells increases slowly, and CD4 is difficult to see in a short period of time. + Significant increases in T cells often mean that it takes many years of treatment to determine whether the patient's immune reconstitution is adequate, thus delaying CD4 cell therapy. + Adjuvant therapy for T-lymphocyte remodeling, coupled with the significantly increased costs associated with prolonged observation, severely restricts the conduct of clinical trials. To date, the evaluation of CD4+ in immune non-responders... + There are currently no specific clinical indicators or effective clinical testing tools for assessing the level of T cell reconstitution. Therefore, there is an urgent need to establish new methods for evaluating the status of immune reconstitution. Summary of the Invention

[0004] The purpose of this invention is to provide a novel method for detecting the immune reconstitution status of HIV-infected individuals. The inventors of this application combined humanized animal models and clinical cohort samples, and used flow cytometry and RNA-seq techniques to screen and identify interferon-stimulated genes (ISGs) most relevant to the clinical efficacy of HIV treatment. These ISGs were then used as indicators to evaluate non-specific immune activation in HIV-infected individuals. Specific primer sets and probes were designed, and appropriate internal standards were selected to establish a clinically applicable real-time quantitative PCR detection method. This provides a practical new means for evaluating the immune reconstitution status of HIV-infected individuals, thus yielding this invention.

[0005] Therefore, in a first aspect, the present invention provides a primer set targeting the interferon-stimulated gene IFI27, comprising:

[0006] IFI27 upstream primer: GGGAATCGCCTCGTCCTC (SEQ ID NO:1), and

[0007] IFI27 downstream primer: GTAGAACCTCGCAATGACAGC (SEQ ID NO:2).

[0008] In a second aspect, the present invention provides a probe targeting the interferon-stimulated gene IFI27, comprising:

[0009] IFI27 probe: CCCAGTGACTGCAGAGTAGCCACA (SEQ ID NO:3).

[0010] In a third aspect, the present invention provides a primer set targeting the interferon-stimulated gene IFI6, comprising:

[0011] IFI6 upstream primer: TGATGAGCTGGTCTGCGA (SEQ ID NO:4), and

[0012] IFI6 downstream primer: ATCAGGGCACCAATATTACCTA (SEQ ID NO:5).

[0013] In a fourth aspect, the present invention provides a probe targeting the interferon-stimulated gene IFI6, comprising:

[0014] IFI6 probe: CTGCCACCAGCCCCGAGG (SEQ ID NO:6).

[0015] In a fifth aspect, the present invention provides a kit for detecting the expression levels of interferon-stimulated genes IFI27 and / or IFI6, the kit comprising:

[0016] -The primer set of the first and / or third aspects of the present invention; and

[0017] - The probe of the second and / or fourth aspects of the present invention.

[0018] In a sixth aspect, the present invention provides the use of a detection agent for interferon-stimulated genes IFI27 and / or IFI6 in the preparation of a reagent for evaluating the immune reconstitution status of HIV-infected individuals.

[0019] The advantages of this invention are as follows: By screening the interferon-stimulated gene (ISG) most associated with HIV immune reconstitution, this invention uses it as an indicator to evaluate non-specific immune activation in HIV-infected individuals, and establishes a clinical detection technology that can evaluate the level of immune activation and immune reconstitution in HIV-infected individuals in the early stages of treatment, such as the 2nd to 3rd year after the start of treatment. This helps to detect poor immune reconstitution in immune non-responders in the early stages of antiviral treatment, thereby enabling timely and targeted treatment plans for immune non-responders. Attached Figure Description

[0020] The technical solutions and benefits of the present invention will become apparent to those skilled in the art from the following detailed embodiments and with reference to the accompanying drawings.

[0021] Figure 1 The expression of interferon-stimulated genes Siglec1, MX2, IFI6, and IFI27 under interferon stimulation conditions is shown in the THP-1 cell model.

[0022] Figure 2 The expression levels of interferon-stimulated genes IFI6 and IFI27 in hundreds of immune responders and non-responders were analyzed by real-time quantitative PCR (* represents p<0.05, ** represents p<0.01).

[0023] Figure 3 The expression levels of the interferon-stimulated genes MX2 and Siglec1 in hundreds of immune responders and non-responders were analyzed by real-time quantitative PCR. Detailed Implementation

[0024] The present invention will now be described in detail. It should be understood that the following description is merely illustrative and is not intended to limit the scope of the invention; the scope of protection of the invention is defined by the appended claims. Furthermore, those skilled in the art will understand that modifications can be made to the technical solutions of the present invention without departing from its spirit and intent. Unless otherwise specified, the technical means used in the embodiments are conventional means well known to those skilled in the art.

[0025] As mentioned above, there is a need in the art for a means to evaluate the level of immune activation and immune reconstitution in the early treatment of HIV-infected individuals, thereby providing practical and targeted treatment options for those who are immune non-responders.

[0026] Recent studies have shown that type I interferon (IFN-1) plays a crucial role in HIV-induced abnormal immune activation; however, the expression level of interferon in the peripheral blood of HIV-infected individuals is low, making direct detection difficult. Nevertheless, interferon induces the expression of a series of interferon-stimulating genes (ISGs), and the expression level of ISGs represents the activation level of the interferon signaling pathway. Previous studies have shown a correlation with abnormal immune activation and poor immune reconstitution in HIV-infected individuals. HIV-infected individuals treated with interferon will exhibit CD4+ expression. + T lymphocytes are reduced, while exogenous interferon in HIV-infected individuals who block antiretroviral therapy can increase CD4. + T lymphocytes. Furthermore, persistent abnormal expression of ISG was observed in some immune non-responders after antiretroviral therapy, indicating a correlation between ISG expression levels and immune reconstitution status after antiretroviral therapy.

[0027] For example, studies in humanized mouse models of HIV infection have shown that antiretroviral therapy combined with simultaneous blockade of type I interferon (IFN-1) can suppress non-specific immune activation and restore immune cell function. After blocking interferon, CD4+ in HIV-infected individuals... + Instead of decreasing, T lymphocytes increased. Therefore, interferon levels can affect CD4+ in infected individuals. + The number of T lymphocytes. Clinical studies have also found that when Tripterygium wilfordii is used to treat patients with poor immune reconstitution, the therapeutic effect is positively correlated with the decrease in interferon signaling pathway activation.

[0028] The above findings suggest that detecting the expression levels of IFN-1 pathway molecules may enable the evaluation of nonspecific immune activation levels and immune function impairment, and could potentially allow for the early assessment of immune reconstitution in HIV-infected individuals undergoing antiretroviral therapy.

[0029] Therefore, the expression level of interferon-stimulated genes in HIV-infected individuals undergoing antiretroviral therapy may serve as a clinical indicator for evaluating their immune activation level and immune reconstitution status in the early stages of treatment, thereby providing a new means to effectively control the disease progression of HIV / AIDS-infected individuals.

[0030] The inventors of this application used an HIV-infected humanized mouse model and screened four interferon-stimulated genes most relevant to immune activation—Siglec1, MX2, IFI6, and IFI27—using flow cytometry and RNA-seq techniques. However, not wanting to be bound by theory, the inventors found that although the interferon-stimulated genes Siglec1, MX2, IFI6, and IFI27 were experimentally verified to be well expressed under interferon stimulation, not all of their expression levels could be used to distinguish between well and poor immune reconstitution in HIV-infected individuals, i.e., to differentiate between immune responders and non-responders. Among the four interferon-stimulated genes, the inventors of this application discovered that, after treatment, there were statistically significant differences in the expression levels and distribution of genes IFI6 and IFI27 between immune responders and immune non-responders. This statistical difference enables the establishment of clinical detection techniques and evaluation methods for early assessment of immune activation and reconstitution status in HIV-infected individuals, facilitating the early detection of immune non-responders and providing feasible and targeted treatment options. In contrast, although the expression levels of genes Siglec1 and MX increased after interferon stimulation, there was no statistically significant difference in their expression distribution between immune responders and immune non-responders.

[0031] In this article, the terms "immune responder" and "immune non-responder" are used according to their commonly accepted definitions in the field. Specifically, "immune responder" refers to an individual with good immune reconstitution, specifically, an HIV-infected person who has undergone antiretroviral therapy for 2 years and whose CD4 count is [data missing]. + T cell count > 350 cells / μl; or HIV-infected individuals who have undergone antiretroviral therapy for 3 years, CD4 count > + T cell count > 400 cells / μl; or HIV-infected individuals who have undergone antiretroviral therapy for more than 5 years, CD4 count > + T cell count > 500 cells / μl; the term "immune non-responder" refers to individuals with poor immune reconstitution, specifically, HIV-infected individuals who, after 2 years of antiretroviral therapy, have a CD4 count > 500 cells / μl. + T cell count <350 cells / μl; or HIV-infected individuals who have undergone antiretroviral therapy for 3 years, CD4 count <350 cells / μl; + T cell count <400 cells / μl; or HIV-infected individuals who have undergone antiretroviral therapy for more than 5 years, CD4 count <400 cells / μl. + T cell count <500 cells / μl.

[0032] Therefore, in a first aspect, the present invention provides a primer set targeting the interferon-stimulated gene IFI27, comprising:

[0033] IFI27 upstream primer: GGGAATCGCCTCGTCCTC (SEQ ID NO:1), and

[0034] IFI27 downstream primer: GTAGAACCTCGCAATGACAGC (SEQ ID NO:2).

[0035] In a second aspect, the present invention provides a probe targeting the interferon-stimulated gene IFI27, comprising:

[0036] IFI27 probe: CCCAGTGACTGCAGAGTAGCCACA (SEQ ID NO:3).

[0037] In a third aspect, the present invention provides a primer set targeting the interferon-stimulated gene IFI6, comprising:

[0038] IFI6 upstream primer: TGATGAGCTGGTCTGCGA (SEQ ID NO:4), and

[0039] IFI6 downstream primer: ATCAGGGCACCAATATTACCTA (SEQ ID NO:5).

[0040] In a fourth aspect, the present invention provides a probe targeting the interferon-stimulated gene IFI6, comprising:

[0041] IFI6 probe: CTGCCACCAGCCCCGAGG (SEQ ID NO:6).

[0042] The primer and probe sequences of this invention can be synthesized using methods well known to those skilled in the art, and are not particularly limited thereto. However, it should be noted that the inventors have found through testing that the primers and probes listed herein have better amplification and detection efficiency compared to other designed primers and probes.

[0043] In a fifth aspect, the present invention provides a kit for detecting interferon-stimulated genes IFI27 and / or IFI6, the kit comprising:

[0044] - Primers for the first aspect and / or the third aspect of the present invention; and

[0045] - The probe of the second aspect and / or the fourth aspect of the present invention.

[0046] As will be known to those skilled in the art, the use of "and / or" herein requires a one-to-one correspondence. That is, when only interferon-stimulated gene IFI27 is detected, the primer set of the first aspect of the present invention and the probe of the second aspect of the present invention are used; when only interferon-stimulated gene IFI6 is detected, the primer set of the third aspect of the present invention and the probe of the fourth aspect of the present invention are used; when both interferon-stimulated gene IFI27 and interferon-stimulated gene IFI6 are detected simultaneously, the primer set of the first aspect of the present invention and the probe of the second aspect of the present invention are used to detect interferon-stimulated gene IFI27, and the primer set of the third aspect of the present invention and the probe of the fourth aspect of the present invention are used to detect interferon-stimulated gene IFI6.

[0047] In a sixth aspect, the present invention provides the use of a detection agent for interferon-stimulated genes IFI27 and / or IFI6 in the preparation of a reagent for evaluating the immune reconstitution status of HIV-infected individuals.

[0048] In one specific embodiment, the detection agent for the interferon-stimulated gene IFI27 may include primers targeting the gene. In a preferred embodiment, the primers are the upstream primer shown in SEQ ID NO:1 and the downstream primer shown in SEQ ID NO:2.

[0049] In another specific embodiment, the detection agent for the interferon-stimulated gene IFI27 further includes a probe targeting the gene. In yet another preferred embodiment, the probe targeting the interferon-stimulated gene IFI27 is the probe shown in SEQ ID NO:3.

[0050] In yet another specific embodiment, the detection agent for the interferon-stimulated gene IFI6 includes primers targeting the gene. In a preferred embodiment, the primers are the upstream primer shown in SEQ ID NO:4 and the downstream primer shown in SEQ ID NO:5.

[0051] In another specific embodiment, the detection agent for the interferon-stimulated gene IFI6 further includes a probe targeting the gene. In yet another preferred embodiment, the probe targeting the interferon-stimulated gene IFI6 is the probe shown in SEQ ID NO:6.

[0052] In another specific embodiment, the evaluation is performed by detecting the expression levels of the IFI27 gene and / or the IFI6 gene and analyzing the distribution of these expression levels. In a preferred embodiment, the evaluation is performed by real-time quantitative PCR.

[0053] In a further preferred embodiment, the real-time fluorescence quantitative PCR is single real-time fluorescence quantitative PCR or dual real-time fluorescence quantitative PCR. In yet another further preferred embodiment, the real-time fluorescence quantitative PCR simultaneously detects the expression of IFI27 gene and IFI6 gene. On the basis of successfully establishing a single real-time fluorescence quantitative PCR detection method for a single interferon-stimulated gene, by optimizing the primer and probe concentrations, reaction system and reaction conditions, a dual real-time fluorescence quantitative PCR detection method was established. The dual real-time fluorescence quantitative PCR detection enables the simultaneous quantitative detection of the expression of the above two interferon-stimulated genes in a single tube reaction, which not only improves the detection efficiency, but also saves the detection cost and reduces the sample consumption, providing a practical technical means for the early evaluation of the immune reconstruction level in clinical treatment. It is more practical and useful in future clinical applications.

[0054] In yet another specific embodiment, the evaluation of the immune reconstruction status of HIV-infected individuals includes detecting the expression levels of the IFI27 gene and / or the IFI6 gene and analyzing the distribution of the expression levels, and comparing with the expression levels and their distributions of the IFI27 gene and / or the IFI6 gene of known immune responders to determine the risk of poor immune reconstruction.

[0055] In a further specific embodiment, the determination of the risk of poor immune reconstruction is, for example: if the relative expression level of the IFI27 gene and / or the IFI6 gene falls within the relative expression level range corresponding to an OR value < 1, it is determined that the risk of poor immune reconstruction is low; if the relative expression level of the IFI27 and / or the IFI6 gene falls within the relative expression level range corresponding to 1 < OR value < 2, it is determined that the risk of poor immune reconstruction is moderate; if the relative expression level of the IFI27 and / or the IFI6 gene falls within the relative expression level range corresponding to an OR value > 2, it is determined that the risk of poor immune reconstruction is high.

[0056] For example, according to the expression level data of the clinical samples given in the following example section, for the IFI27 gene, when its relative expression level is between 0 - 40000, the OR value < 1, indicating a low risk of poor immune reconstruction; when its relative expression level is between 40000 - 80000, 1 < OR value < 2, indicating a moderate risk of poor immune reconstruction; and when its expression level > 80000, the OR value > 2, indicating a high risk of poor immune reconstruction; similarly, for the IFI6 gene, when its relative expression level is between 0 - 2000, the OR value < 1, indicating a low risk of poor immune reconstruction; when its relative expression level is between 2000 - 4000, 1 < OR value < 2, indicating a moderate risk of poor immune reconstruction; when its relative expression level > 4000, the OR value > 2, indicating a high risk of poor immune reconstruction.

[0057] The odds ratio (OR) is a commonly used indicator in case-control studies in epidemiological research. It represents the strength of the association between disease and exposure, similar to relative risk (RR), indicating how many times greater the risk of disease is for exposed individuals compared to unexposed individuals.

[0058] When the risk of poor immune reconstitution is moderate or high, it is believed that the HIV-infected person is more likely to experience immune non-response during antiretroviral therapy, and thus a more practical and targeted treatment plan can be provided to the infected person in the early stages of treatment.

[0059] As mentioned earlier, after treatment, there are statistically significant differences in the expression levels and distribution of IFI6 and IFI27 between immune responders and immune non-responders. These differences enable the development of clinical detection techniques and evaluation methods for early assessment of immune activation and reconstitution status in HIV-infected individuals. This facilitates the early detection of immune non-responders during HIV treatment, providing feasible and targeted treatment options. Therefore, using a large number of paired specimens from immune responders and immune non-responders, a comprehensive evaluation system for immune reconstitution status was established, assessing the immune reconstitution status based on the expression levels of interferon-stimulated genes in HIV-infected individuals during the early stages of treatment.

[0060] Example

[0061] The invention is described in more detail below with reference to exemplary embodiments. However, the exemplary embodiments disclosed herein are for illustrative purposes only and should not be considered as limiting the scope of the invention. The reagents used in the invention, such as common reagents used in real-time quantitative PCR detection, such as buffers and enzymes, are commercially available.

[0062] Example 1: Primer Design

[0063] The inventors of this application designed and screened a set of specific PCR primers and probes to express the interferon-stimulated genes Siglec1, MX2, IFI6, and IFI27, respectively, with the following sequences:

[0064] IFI27 upstream primer: GGGAATCGCCTCGTCCTC (SEQ ID NO:1);

[0065] IFI27 downstream primer: GTAGAACCTCGCAATGACAGC (SEQ ID NO:2);

[0066] IFI27 probe: CCCAGTGACTGCAGAGTAGCCACA (SEQ ID NO:3);

[0067] IFI6 upstream primer: TGATGAGCTGGTCTGCGA (SEQ ID NO:4).

[0068] IFI6 downstream primer: ATCAGGGCACCAATATTACCTA (SEQ ID NO:5);

[0069] IFI6 probe: CTGCCACCAGCCCCGAGG (SEQ ID NO:6).

[0070] MX2 upstream primer: GGCAGAAAGACTTACCACT (SEQ ID NO:7).

[0071] MX2 downstream primer: AACATCTTGTCGGCCTC (SEQ ID NO:8).

[0072] MX2 probe: CTGGTGGCTCTCCCTTATTTGTCCT (SEQ ID NO:9).

[0073] Siglec1 upstream primer: GGCCATTGCACCATCACAC (SEQ ID NO:10).

[0074] Siglec1 downstream primer: TTCGGAACCAGGAGAAGTTAGCA (SEQ ID NO:11).

[0075] Siglec1 probe: CCAGCAGCTTCCCGGCTCACGTT (SEQ ID NO:12).

[0076] Example 2: Detection of interferon-stimulated gene expression levels

[0077] In this embodiment, the expression levels of the four interferon-stimulated genes Siglec1, MX2, IFI6, and IFI27 involved in this application were validated using the THP-1 cell model. THP-1 is a human peripheral blood mononuclear cell line that is widely used in research on lymphocyte-related mechanisms, signaling pathways, and nutrient and drug transport.

[0078] In vitro, THP-1 cells were stimulated with recombinant human interferon β (IFN-beta, purchased from PeproTech, catalog number 300-02BC) to simulate a high-level interferon response in vivo, with unstimulated THP-1 cells serving as a control. After THP-1 cells recovered and their growth stabilized, in vitro IFN stimulation experiments were performed using 1.44 × 10⁻⁶ cells. 6 THP-1 cells were cultured at a density of 10 cells / ml in six-well plates, with a final volume of 2ml per well. A certain volume of interferon was added to achieve a final concentration of 4000 pg / ml. The control group received an equal volume of cell culture medium. Six hours after stimulation, total RNA was extracted from both the interferon-stimulated and control groups using the TIANGEN Total RNA Extraction Kit (DP419), strictly following the manufacturer's instructions. Glyceraldehyde phosphate dehydrogenase (GAPDH) was used as an internal control gene. The expression results of the interferon-stimulated genes Siglec1, MX2, IFI6, and IFI27 in THP-1 cells are shown below. Figure 1 As shown.

[0079] Depend on Figure 1 It can be seen that in the THP-1 cell model, compared with THP-1 cells that have not been stimulated by recombinant human interferon β, the expression of interferon-stimulating genes Siglec1, MX2, IFI6 and IFI27 in THP-1 cells stimulated by recombinant human interferon β is upregulated, which proves that genes Siglec1, MX2, IFI6 and IFI27 can indeed serve as biological indicators reflecting the level of interferon activation in the body.

[0080] Example 3: Dual Real-Time Quantitative PCR Detection of Interferon-Stimulated Gene Expression

[0081] In this embodiment, to shorten the experimental time and reduce the number of steps in clinical testing, a one-step RT-PCR amplification method was designed. This method eliminates the need for separate reverse transcription to detect gene expression levels after RNA extraction. The widely used amplification reagents and instruments selected were the Qiager QuantiNova Probe RT-PCR Kit #208352 and the Bio-rad CFX96 real-time quantitative PCR instrument. Based on the manufacturer's manual, the reaction conditions were optimized to obtain the optimal detection reaction system and detection conditions, as shown in Tables 1 and 2.

[0082] Table 1: One-step real-time quantitative PCR reaction system using RNA as template

[0083]

[0084] Table 2: Real-time Quantitative PCR Procedure

[0085]

[0086] Example 4: Analysis of PCR detection results of interferon-stimulated gene expression

[0087] Quantitative analysis was performed on four interferon-stimulated genes (IFI6, IFI27, Siglec1, and MX2) in multiple clinical samples (including those from immune responders and non-responders). The absolute copy numbers of the target and reference genes were calculated using a standard curve. The relative expression level of the target gene was calculated by dividing the target gene copy number by the reference gene copy number. Since the target gene expression level was lower than the reference gene, resulting in a smaller relative expression level, the relative expression level was uniformly inflated (e.g., by 10,000-fold) during data analysis to facilitate subsequent analysis.

[0088] The inventors analyzed the experimental data using the Mann-Whitney rank-sum test, and the results are as follows:

[0089] First, CD4 before treatment + In infected individuals with a baseline T count less than 200 cells / μL, immune responders (post-treatment CD4) + T>500 cells / μL) and immune non-responders (CD4+ after treatment) + There was a statistically significant difference in the expression levels of IFI6 and IFI27 in individuals with T < 200 cells / μL. The expression levels of IFI27 and IFI6 molecules were significantly higher in immune non-responders than in immune responders. Figure 2 As shown in the figure (* represents p<0.05, ** represents p<0.01).

[0090] The expression levels of IFI27 and IFI6 genes were stratified, and the distribution ratio of different expression levels of IFI27 and IFI6 in immune responders and non-responders was further analyzed. The results are shown in Tables 3 and 4 below. These tables reveal significant differences in the distribution of IFI27 and IFI6 gene expression levels between the two groups of infected individuals, with statistically significant differences. This indicates that IFI27 and IFI6 genes can serve as biomarkers for evaluating immune reconstitution status.

[0091] Table 3: Expression of IFI27 in different infected populations

[0092]

[0093] Table 4: Expression of IFI6 in different infected populations

[0094]

[0095] Second, for Siglec1 and MX2, which can also be used as biological indicators reflecting the interferon activation level of the body, in HIV-infected individuals with a pre-treatment CD4 + T baseline less than 200 cells / μL, no statistically significant differences were found in the expression levels of Siglec1 and MX2 between immune responders (post-treatment CD4 + T > 500 cells / μL) and non-responders (post-treatment CD4 + T < 200 cells / μL). The results are as shown in Figure 3 Figure. It can be seen that for Siglec1 and MX2, immune responders and non-responders cannot obtain the expression level ranges of Siglec1 and MX2 corresponding to OR values < 1, 1 < OR value < 2, and OR value > 2. Therefore, Siglec1 and MX2 cannot be used to evaluate the immune activation level and immune reconstitution status of HIV-infected individuals.

[0096] The technical solution of the present invention screens out two interferon-stimulated genes (IFI27 and IFI6) closely related to the immune reconstitution status of HIV-infected individuals, and is used to evaluate the immune activation level and immune reconstitution status of HIV-infected individuals. Without wishing to be bound by theory, technical solutions for detecting the expression levels of these two interferon-stimulated genes by other detection methods to evaluate the immune activation level and immune reconstitution status of HIV-infected individuals fall within the scope of protection of this patent.

[0097] In this specification, whenever reference is made to "exemplary embodiments", "preferred embodiments", "an embodiment", etc., it means that the specific features, structures, or characteristics described for that embodiment are included in at least one embodiment of the present invention. The appearance of these terms in different places in this specification does not necessarily refer to the same embodiment. In addition, when specific features, structures, or characteristics are described for any embodiment / embodiment, it should be considered that those skilled in the art can also implement such features, structures, or characteristics in other embodiments among all the described embodiments.

[0098] The embodiments of the present invention have been described in detail above. However, the aspects of the present invention are not limited to the above embodiments. Without departing from the scope of the present invention, various modifications and substitutions can be applied to the above embodiments. Sequence Listing <110> National Center for AIDS / STD Control and Prevention, Chinese Center for Disease Control and Prevention <120> Reagents and Methods for Detecting the Immune Reconstitution Status of HIV-Infected Individuals <160> 12 <170> SIPOSequenceListing 1.0 <210> 1 <211> 18 <212> DNA <213> Artificial Sequence <400> 1 gggaatcgcc tcgtcctc 18 <210> 2 <211> twenty one <212> DNA <213> Artificial Sequence <400> 2 gtagaacctc gcaatgacag c 21 <210> 3 <211> twenty four <212> DNA <213> Artificial Sequence <400> 3 cccagtgact gcagagtagc caca 24 <210> 4 <211> 18 <212> DNA <213> Artificial Sequence <400> 4 tgatgagctg gtctgcga 18 <210> 5 <211> twenty two <212> DNA <213> Artificial Sequence <400> 5 atcagggcac caatattacc ta 22 <210> 6 <211> 18 <212> DNA <213> Artificial Sequence <400> 6 ctgccaccag ccccgagg 18 <210> 7 <211> 19 <212> DNA <213> Artificial Sequence <400> 7 ggcagaaaga cttaccact 19 <210> 8 <211> 17 <212> DNA <213> Artificial Sequence <400> 8 aacatcttgt cggcctc 17 <210> 9 <211> 25 <212> DNA <213> Artificial Sequence <400> 9 ctggtggctc tcccttattt gtcct 25 <210> 10 <211> 19 <212> DNA <213> Artificial Sequence <400> 10 ggccattgca ccatcacac 19 <210> 11 <211> twenty three <212> DNA <213> Artificial Sequence <400> 11 ttcggaacca ggagaagtta gca 23 <210> 12 <211> twenty three <212> DNA <213> Artificial Sequence <400> 12 ccagcagctt cccggctcac gtt 23

Claims

1. The use of interferon-stimulated gene IFI27 and IFI6 detection reagents in the preparation of reagents for evaluating the immune reconstitution status of HIV-infected individuals, wherein, The evaluation of immune reconstitution status in HIV-infected individuals includes detecting the expression levels of the IFI27 and IFI6 genes and analyzing the distribution of these expression levels, and comparing them with the expression levels and distribution of the IFI27 and IFI6 genes in individuals known to be immune responders to determine the risk of poor immune reconstitution.

2. The use according to claim 1, wherein, The detection agent for the interferon-stimulated gene IFI27 includes primers targeting the gene, wherein the primers are the upstream primer shown in SEQ ID NO: 1 and the downstream primer shown in SEQ ID NO:

2.

3. The use according to claim 2, wherein, The detection agent for the interferon-stimulated gene IFI27 also includes a probe targeting the gene, the probe being shown in SEQ ID NO:

3.

4. The use according to any one of claims 1-3, wherein, The detection agent for the interferon-stimulated gene IFI6 includes primers targeting the gene, wherein the primers are the upstream primer shown in SEQ ID NO: 4 and the downstream primer shown in SEQ ID NO:

5.

5. The use according to claim 4, wherein, The detection agent for the interferon-stimulated gene IFI6 also includes a probe targeting the gene, the probe being shown in SEQ ID NO:

6.

6. The use according to any one of claims 1-3, wherein, The evaluation was conducted by detecting the expression levels of the IFI27 and IFI6 genes using real-time quantitative PCR and analyzing the distribution of these expression levels.

7. The use according to claim 6, wherein, The real-time quantitative PCR is either single real-time quantitative PCR or dual real-time quantitative PCR.