Compositions and methods for treating, preventing or reversing age-related inflammation and diseases
By administering a reverse transcriptase inhibitor to patients, the treatment and prevention of age-related inflammation is solved, and effective reduction of age-related inflammation and relief of related disease symptoms is achieved.
Patent Information
- Application Number
- CN202080010653.1
- Authority / Receiving Office
- CN · China
- Patent Type
- Patents(China)
- Current Assignee / Owner
- Priority Date
- 2019-09-27
- Filing Date
- 2020-01-24
- Publication Date
- 2025-07-18
- Estimated Expiration
- 2040-01-24
AI Technical Summary
The prior art has limited understanding of the mechanisms of age-related inflammation and lack of effective treatment and prevention methods, resulting in chronic inflammation accelerating aging and associated with a variety of chronic diseases.
By administering to the patient a therapeutically effective amount of a reverse transcriptase inhibitor (RTI), such as seshafdine and evcitabine, inhibit L1 reverse transcriptase activity, reduce IFN-I response and SASP proinflammatory state, thereby alleviating or reversing age-related inflammation.
Effectively prevent and treat age-related inflammation, reduce symptoms of related diseases, such as Alzheimer's disease and amyotrophic lateral sclerosis, delay pathological progression, and improve patients' quality of life.
Smart Images

Figure BDA0003176753390000731 
Figure BDA0003176753390000741 
Figure BDA0003176753390000751
Abstract
Description
Field of the Invention
[0001] The present invention belongs to the field of medicinal chemistry. Specifically, the present invention relates to methods for treating, preventing, and reversing age-related inflammation by administering a reverse transcriptase inhibitor (RTI) to a patient in need thereof. Age-related inflammation may occur in patients suffering from Alzheimer's disease, amyotrophic lateral sclerosis (ALS), Parkinson's disease, Huntington's disease, vision loss, hearing loss, peripheral degenerative diseases or cardiovascular dysfunction, frontotemporal dementia (FTD), multiple sclerosis (MS), Aicardi Goutiere syndrome, progressive supranuclear palsy (PSP), osteoarthritis, skin aging, atherosclerosis, adverse reactions caused by chemotherapy, hematopoietic stem cell function, osteoporosis, physical function, and / or pulmonary fibrosis, or in patients in need of wound healing or tissue regeneration.
[0002] Statement Regarding Federally Sponsored Research or Development in the United States
[0003] The present invention was developed using the following grants: Glenn / AFAR Postdoctoral Fellowship, NIH P20 GM119943 COBRE Pilot Award; NIH F31 AG043189; NIH T32 AG041688; NIH F31 AG050365; Biotechnology and Sports Medicine Scholarship of the School of Pharmacy, University of Bologna, Bologna, Italy; NIH R37 AG016667, R01 AG024353, P01AG051449, Glenn-AFAR Geriatrics Breakthrough Award; NIH R01 AG050582, P20 GM109035; NIH R37AG016694, P01 AG051449. Background of the Invention
[0005] The number of people worldwide living to 60 years of age or older is increasing. Between 2012 and 2050, the proportion of people aged 60 and over is expected to increase from 809 million to 2 billion (or from 11% to 22% of the population). 1 The main causes of death in the elderly are several chronic diseases, including heart disease, cancer, diabetes, Alzheimer's disease, and infections. Importantly, many age-related diseases and aging itself are closely associated with low levels of chronic inflammation. 2,3,4 Systemic chronic inflammation can accelerate aging. 5 In fact, many inflammatory markers are important predictors of mortality in the elderly. 6
[0006] Despite this common link between aging, inflammation, and chronic diseases, progress in understanding the mechanisms that control age-related inflammation has been limited, and the causal relationship between these regulators and chronic degenerative diseases has not been fully understood. A better understanding of the role of these regulators in age-related inflammation should lead to new strategies for extending the healthspan of the elderly population.
[0007] Accordingly, there is a need in the art for better treatments and prevention of age-related inflammation and age-related disorders. SUMMARY OF THE INVENTION
[0009] The present invention provides a better understanding of the underlying mechanisms of age-related inflammation and its role in aging, as well as compositions and methods for preventing and alleviating age-related inflammation and disorders.
[0010] Retrotransposable elements (RTEs) are deleterious at multiple levels, and thus failure of the host surveillance system can have negative consequences. However, the contribution of RTE activity to aging and age-related diseases is not well understood. The present invention is based on several empirical observations, including that during cellular senescence, LINE-1 (L1) elements become transcriptionally upregulated and activate the type I interferon (IFN-I) response. The IFN-I response is a novel late senescence phenotype and contributes to the maintenance of the senescence-associated secretory phenotype (SASP). The IFN-I response is triggered by cytoplasmic L1 cDNA and is antagonized by reverse transcriptase inhibitors (RTIs) that inhibit L1 reverse transcriptase (RT). Treatment of aged mice with the RTI lamivudine downregulates IFN-I activation and age-related inflammation in several tissues. Thus, RTE activation is an important component of sterile inflammation, which is a hallmark of aging, and L1 RT is a relevant target for treating age-related diseases.
[0011] The present invention provides a method for treating, preventing, and / or reversing age-related inflammation in a patient in need thereof by administering to the patient a therapeutically effective amount of at least one reverse transcriptase inhibitor (RTI).
[0012] In a comparative evaluation of several RTI drugs in a dose-response assay for the inhibition of L1 activity, two RTI drugs, censavudine and elvucitabine, showed unexpectedly excellent ability to inhibit L1 activity in mice and humans. The present invention further provides a method for treating, preventing, and / or reversing age-related inflammation in a patient in need thereof by administering to the patient a therapeutically effective amount of censavudine and / or elvucitabine.
[0013] Age-related inflammation is associated with upregulation of L1, accumulation of cytoplasmic L1 cDNA, activation of the IFN-I response, and / or enhancement of the pro-inflammatory state of the SASP. An RTI drug is administered in an amount sufficient to prevent or reverse at least one of the upregulation of L1, accumulation of cytoplasmic L1 cDNA, activation of the IFN-I response, and / or pro-inflammatory state of the SASP.
[0014] The age-related inflammation that can be prevented, treated, or reversed by the methods of the present invention occurs in patients suffering from diseases or conditions including but not limited to the following, or in patients in need of wound healing or tissue regeneration: Alzheimer's disease, amyotrophic lateral sclerosis (ALS), Parkinson's disease, Huntington's disease, vision loss, hearing loss, peripheral degenerative diseases or cardiovascular dysfunction, frontotemporal dementia (FTD), multiple sclerosis (MS), Aicardi Goutiere syndrome, progressive supranuclear palsy (PSP), osteoarthritis, skin aging, atherosclerosis, adverse reactions caused by chemotherapy, hematopoietic stem cell function, osteoporosis, physical function, and / or pulmonary fibrosis. In one embodiment, the age-related inflammation occurs in a patient suffering from Alzheimer's disease. In an alternative embodiment, the age-related inflammation occurs in a patient suffering from ALS.
[0015] The present invention also provides methods for delaying or reversing the progression of the underlying pathology of conditions caused by age-related inflammation, including administering to a patient in need thereof a therapeutically effective amount of at least one RTI. In some embodiments, the patient suffers from Alzheimer's disease or ALS and experiences a reduction in one or more symptoms of Alzheimer's disease or ALS as compared to before the first administration to the patient. In some embodiments, one or more symptoms of Alzheimer's disease include memory loss, misplacing objects, forgetting the names of places or objects, repeating questions, lack of flexibility, confusion, disorientation, obsessive behavior, compulsive behavior, delusions, aphasia, sleep disturbances, mood swings, depression, anxiety, apathy, agitation, difficulty performing spatial tasks, agnosia, difficulty walking, weight loss, loss of language ability, short-term memory loss, or long-term memory loss.
[0016] In some embodiments, the reduction in one or more symptoms of Alzheimer's disease is evaluated according to DSM-5 7 . In some embodiments, the reduction in symptoms is determined using the cognitive subscale of the Alzheimer's Disease Assessment Scale (ADAS-cog). In some embodiments, the reduction in symptoms is determined using the Clinician's Interview-Based Impression of Change (CIBIC-plus). In some embodiments, the reduction in symptoms is determined using the Activities of Daily Living Scale (ADL). In some embodiments, the reduction in symptoms persists for 1-36 months.
[0017] In some embodiments, any changes in potential pathology are identified by detecting biomarkers before and after RTI administration. In some embodiments, the biomarker is beta-amyloid or Tau protein. In some embodiments, the biomarker is detected by PET imaging. In some embodiments, potential pathology is identified by measuring beta-amyloid or Tau protein in cerebrospinal fluid. In some embodiments, potential pathology is identified by measuring brain volume before and after RTI administration. In some embodiments, the potential pathology is reversed or delayed for 1 - 36 months.
[0018] In some embodiments, at least one RTI is a nucleoside reverse transcriptase inhibitor (NRTI). In some embodiments, at least one NRTI is selected from: abacavir (ZIAGEN TM ), abacavir / lamivudine (Epzicom), abacavir / lamivudine / zidovudine (TRIZIVIR TM ), adefovir, alovudine, amdoxovir, apricitabine, ceftazidime, COVIRACIL TM , DAPD / DXG, D-D4FC, dexelvucitabine, didanosine (VIDEX TM ), sustained-release didanosine (Videx EC), dOTC, EFdA, emtricitabine (EMTRIVA TM ), emtricitabine / tenofovir alafenamide, emtricitabine / tenofovir disoproxil fumarate, elvucitabine, fosalvudine, lamivudine / zidovudine (COMBIVIR TM ), EVIPLERA, TM , HIVID, TM KIVEXA, TM lamivudine (EPIVIR TM ), LODENOSINE, TM , racivir, stampidine, stavudine (ZERIT TM ), TENOFOVIR, TM tenofovir disoproxil fumarate (VIREAD TM ), Trizivir, and / or zidovudine (RETROVIR TM)。In some embodiments, at least one NRTI is sesefovir. In some embodiments, at least one NRTI is evofosfamide.
[0019] In some embodiments, at least one RTI is a non-nucleoside reverse transcriptase inhibitor (NNRTI). In some embodiments, at least one NNRTI is selected from: delavirdine (DLV), efavirenz (EFV), etravirine, nevirapine (NVP), and / or rilpivirine.
[0020] In some embodiments, the patient has Alzheimer's disease and the method further comprises administering at least one second therapeutic agent for treating symptoms of Alzheimer's disease. In some embodiments, at least one second therapeutic agent is selected from: donepezil, galantamine, memantine, and / or rivastigmine. In some embodiments, at least one second therapeutic agent is an antibody that binds to amyloid-β or Tau protein. In some embodiments, the antibody binds to amyloid-β and is bapineuzumab. In some embodiments, the antibody binds to Tau protein and is ABBV-8E12. In some embodiments, at least one second therapeutic agent is a vaccine against amyloid-β or Tau protein. In some embodiments, at least one second therapeutic agent is an agent that reduces or modifies the brain content of amyloid-β or Tau. In some embodiments, the second therapeutic agent reduces or modifies the brain content of amyloid-β and is a β-secretase 1 (BACE) inhibitor. In some embodiments, the BACE inhibitor is selected from: CTS-21166, lanabecestat (AZD3293), LY2886721, and verubecestat (MK8931). In some embodiments, the second agent reduces or modifies the brain content of Tau and is nicotinamide or MPT0G211.
[0021] In some embodiments, the patient has ALS and the method further comprises administering at least one second therapeutic agent for treating the symptoms of ALS. In some embodiments, at least one second agent for treating ALS is edaravone and / or riluzole. In other embodiments, at least one second agent is an integrase inhibitor. In some embodiments, the integrase inhibitor is selected from: aurintricarboxylic acid, aurintricarboxylic acid derivatives, BMS-538158, caffeic acid phenethyl ester, caffeic acid phenethyl ester derivatives, curcumin, curcumin derivatives, chicoric acid, chicoric acid derivatives, 3,5-dicaffeoylquinic acid, 3,5-dicaffeoylquinic acid derivatives, GSK364735C, L-870812 and L-25 870810, MK-0518, quercetin, quercetin derivatives, raltegravir, S-1360, tyrphostin, tyrphostin derivatives and / or sintetovir (AR-177).
[0022] In some embodiments, one or more symptoms or disease pathologies of the patient are evaluated within 1 to 36 months after the first administration of the RTI to the patient.
[0023] In some embodiments, the RTI inhibits L1 reverse transcriptase activity in the patient's cells.
[0024] The present invention also provides a method for preventing the onset of Alzheimer's disease in a patient suspected of having mild cognitive impairment or preclinical Alzheimer's disease, comprising administering to a patient in need thereof a therapeutically effective amount of at least one RTI.
[0025] Other embodiments are also described and recited herein.
[0026] Brief Description of the Drawings
[0027] For purposes of illustration, certain embodiments of the present invention are shown in the drawings described below. Like numbers in the drawings always represent like elements. However, it should be understood that the present invention is not limited to the exact arrangements, dimensions, and instruments shown. In the drawings:
[0028] Figure 1 Activation of L1, IFN-I, and SASP in senescent cells is shown. Gene expression was evaluated by RT-qPCR. Poly(A)-purified RNA was used for all L1 assays. Figure 1 a, Time course of L1 activation. P values were calculated relative to EP (early passage control). Figure 1 b, Schematic of the L1 RT-PCR strategy. Blue, sense; red, antisense (AS). For primer specificity, see Figure 6 f-h; for primer design, see Methods. Primers for amplicon F were used in (a) and (e).Figure 1 c, Strand-specific L1 transcription was evaluated using amplicons A-F. Transcription from the 5'UTR antisense promoter was also detected. SEN(L), late senescence (16 weeks). Figure 1 d, Induction of IFN-α and IFN-β1 mRNA levels. Figure 1 e, Temporal induction of genes associated with DNA damage (p21, also known as CDKN1A), SASP (IL-1β, CCL2, IL-6, MMP3), and IFN-I response (IRF7, IFN-α, IFN-β1, OAS1). Row clustering was calculated as 1 - Pearson correlation. RS, replicative senescence; OIS, oncogene-induced senescence (induced by Ha-RAS infection); SIPS, stress-induced premature senescence (gamma irradiation). Controls: EP, early passage; EV, empty vector infection; CTR, non-irradiated. (a, c-e), n = 3 independent biological samples, repeated in two independent experiments. (a, c, d) Data are mean ± s.d. *P ≤ 0.05, **P ≤ 0.01, unpaired two-tailed t test.
[0029] Figure 2 Regulation of L1 activation and IFN-I induction is shown. Figure 2 a, RB1 and Figure 2 b, Expression and ChIP of FOXA1. Expression was measured by RT-qPCR and immunoblotting (left panels). Binding to L1 elements was evaluated using ChIP-qPCR (right panels). For primer specificity, see Figure 6 b RB1: 5'UTR, ORF1, and ORF2, primers for amplicons A, E, and F, respectively. FOXA1: primers for amplicons A-E. qPCR was normalized to input chromatin. SEN(E), early senescence (8 weeks). For gel source, data are shown in Figure 16. Figure 2 c-e, RB1, FOXA1, or TREX1 was overexpressed (OE) or depleted with shRNA, and the effects on L1, IFN-α, and IFN-β1 expression were determined by RT-qPCR of poly(A)-purified RNA. In all cases, lentiviral vectors were used to deliver the intervention directly to senescent cells at 12 weeks (point D, Figure 6 a), and cells were harvested 4 weeks later (point E, 16 weeks) for analysis. Controls were uninfected senescent cells harvested at the same time (point E, 16 weeks). Two different shRNAs (a, b) were used for each gene. Primers for amplicon F were used for L1. Figure 2 f, RB1 was overexpressed as described above, and its binding to the 5'UTR was evaluated by ChIP-qPCR (amplicon A). Figure 2g, Activation of L1, IFN-α, and IFN-β1 expression after triple (3X) intervention using shRB1(a), shTREX1(a), and FOXA1-OE in early passage cells. Lentiviral infections were performed sequentially with drug selection at each step (shRB1, puromycin -> shTREX1, hygromycin -> FOXA1-OE, blasticidin). Figure 2 h, Expression of IFN-1 pathway genes was measured using the RT2 Profiler PCR Array (Qiagen). Normalized mean expression of all 84 genes in the array is shown. Red symbols: genes significantly upregulated. Dashed lines demarcate the ±2-fold range. (a, b, h), n = 3 independent biological samples, repeated in 2 independent experiments. (c-g), n = 3 independent experiments. (a-g) Data are mean ± s.d. *P ≤ 0.05, **P ≤ 0.01, unpaired two-tailed t test.
[0030] Figure 3 Shown is that elimination of L1 alleviates IFN-I activation and attenuates the SASP response. Figure 3 a, Cells were examined by immunofluorescence (IF) microscopy using antibodies against single-stranded DNA (ssDNA) or L1 ORF1 protein. Note the bright ssDNA foci that co-localize with prominent foci of ORF1 in senescent cells. Experiments were independently repeated 3 times with similar results. Scale bar = 10 μm. Figure 3 b, Senescent cells were treated with L1 shRNA (using the lentiviral vector described in Figure 2 c, e, f) or 3TC (7.5 μM) between 12 and 16 weeks of senescence. The effect on the IFN-I response was determined by RT-qPCR, ELISA, or immunoblotting. For gel source data, see Fig. 16. Figure 3 c, Cells were labeled with BrdU for 2 weeks (with or without 7.5 μM 3TC), and the labeled DNA was immunoprecipitated and its L1 sequence content was quantified using TaqMan multiplex qPCR 16( Figure 1 b, amplicon F). EP(qui), early passage quiescent cells. Figure 3 d, Left panel, RS cells: The IFNAR1 and IFNAR2 genes were mutagenized using the CRISPR / Cas9 system delivered directly into senescent cells together with the lentiviral vector. As with the shRNA intervention, cells were infected at 12 weeks and harvested at 16 weeks of senescence (see Figure 1 d-f, see Methods). Right panel, SIPS cells: CRISPR / Cas9 intervention was performed in early passage cells, and validated clones were irradiated to induce SIPS. Figure 3 e, Induction of OIS and SIPS was as in Figure 1As shown in d, cells were harvested after 20 days (OIS) or 30 days (SIPS). 3TC (7.5 μM) was present throughout. IFN-I gene expression (IFN-α, IRF7, OAS1) was measured by RT-qPCR. Figure 3 f, Cells were serially passaged into replicative senescence (RS) in which 3TC (10 μM) was present throughout, and the temporal induction of SASP response genes (IL-1β, CCL2, IL-6, MMP3) was evaluated. (b-d, f), n = 3 independent experiments. (e) n = 3 independent biological samples, repeated in 2 independent experiments. (b-f) Data are mean ± s.d.. *P ≤ 0.05, **P ≤ 0.01. (b, d-f) Unpaired two-tailed t-test, (c) One-way ANOVA using Tukey's multiple comparison test.
[0031] Figure 4 It is shown that L1 is activated with aging in murine tissues and the IFN-1 pro-inflammatory response is attenuated by RTI treatment. Figure 4 a, The presence of L1 ORF1 protein in tissues was examined by IF microscopy. Quantification of ORF1-expressing cells is shown in the right panel; each condition was scored for three animals and at least 200 cells per animal. Scale bar = 4 μm. Figure 4 b, Activation of L1 in senescent cells was examined by co-staining for SA-β-Gal activity and Orf1 protein by IF (male liver, 5 months and 26 months). Scale bar = 4 μm. The experiment was independently repeated 3 times with similar results. Figure 4 c, Mice were administered 3TC (2 mg / ml) in drinking water for two weeks at the indicated ages and sacrificed after treatment. Expression of p16, IFN-I response gene (IFN-α) and pro-inflammatory status marker (Il-6) was evaluated by RT-qPCR. See Figure 14 for additional tissues and genes. Box plots show the range of the data (whiskers), 25th and 75th percentiles (box), mean (dashed line) and median (solid line). Each point represents one animal. 5 months, n = 8; 26 months, n = 12; 29 months, n = 6. Figure 4 d, Six-month-old mice were subjected to non-lethal irradiation and the expression of L1, p16 and representative IFN-I response genes (Ifn-α, Oas1) was evaluated by RT-qPCR at the indicated times after irradiation. Graphical representation is as in (c); non-irradiated, n = 3 three-month-old animals, n = 5 six-month-old animals; irradiated, n = 4 three-month-old animals, n = 5 six-month-old animals. Figure 4e, Macrophage infiltration into white adipose tissue and the kidney was scored as the percentage of F4 / 80-positive cells (total cell nuclei). n = 5 animal groups (adipose); n = 8 (kidney). Skeletal muscle fiber diameter was measured (see Methods for details) and plotted as a combined box plot. n = 5 animals per group, a total of 500 fibers. Glomerulosclerosis was scored as the sum of all glomeruli in periodic acid–Schiff (PAS)-stained sections (see Methods for details), where a score of 3 or 4 was divided by the total number. n = 7 animals per group, 40 glomeruli per animal. Graphical representation was as in (c). 3TC treatment was for 2 weeks for white adipose and 6 months (20–26 months) for other tissues. Dashed circles demarcate individual glomeruli. Scale bar = 50 μm. Figure 4 f, Collapse of the L1 surveillance mechanism leads to chronic activation of the IFN-I response. ISD: interferon-stimulated DNA pathway. *P ≤ 0.05, **P ≤ 0.01, unpaired two-tailed t test (a, d, e) or one-way ANOVA with Tukey's multiple comparison test (c, e white adipose).
[0032] Figure 5 is a flow chart outlining the molecular pathways of cellular senescence leading to age-related “sterile” inflammation.
[0033] Figure 6 shows the establishment of senescent cultures and the analysis of L1 and IFN-I activation. Figure 6 a, Passage protocol for obtaining long-term replicative senescent cells (details in Methods). Point A was designated as senescence time zero. Figure 6 b–d, Confirmation of the senescent state of the cultures. A representative experiment is shown; other experiments were monitored in the same way and generated data that conformed to these benchmarks. EP, early passage control; SEN(E), early senescence (8 weeks); SEN(L), late senescence (16 weeks). Figure 6 b, Cells were labeled with BrdU for 6 hours. BrdU incorporation 8 and senescence-associated β-galactosidase (SA-β-Gal) activity 9 were determined as shown. DNA damage foci were visualized using a γ-H2AX antibody and immunofluorescence microscopy (IF) 10 . Figure 6 c, Expression of p21 (CDKN1A) and p16 (CDKN2A) proteins was determined by immunoblotting. GAPDH was the loading control. For gel source data, see Fig. 16. Figure 6 d, Expression of SASP signature genes was determined by RT-qPCR. Figure 6e, Assessment of L1 activation during senescence of IMR-90 and WI38 strains of fibroblasts using poly(A)-purified RNA and primers for amplicon F Figure 1 b). Figure 6 f, Long-distance RT-PCR was performed using primers A-forward and C-reverse (amplicon G) and primers A-forward and D-reverse (amplicon H) Figure 1 b, Table 1) and the cDNA was cloned and sequenced. Several attempts using the same protocol on early passage proliferating cells did not yield any L1 clones. Sequences were mapped to the unmasked reference genome, requiring 100% identity. Thus, 658 clones could be mapped, another 51 clones contained at least 1 mismatch and thus may represent polymorphic elements in the cell line, and 58 were cloning artifacts. Among the 658 mappable clones, 224 unique elements were delineated (Table 3). Full-length elements are a subset of full-length elements annotated without ORF-inactivating mutations. The size of the feature corresponds to the number of times that element appears among the 658 clones. Figure 6 g, Figure 6 f and summary of the long-range PCR data presented in Table 3. Figure 6 h, Epigenomic copy number of elements detected with our amplicons (see position of amplicons in Figure 1 b, and primer design strategy see Methods). Predicted: in silico PCR (see Methods for details). Observed: qPCR was performed on 1 ng of genomic DNA and normalized to a known single-copy locus. Figure 6 i, Activation of IFN-α and IFN-β1 genes during senescence of WI-38 and IMR-90 cells was determined by RT-qPCR. Figure 6 j, Senescence status of cells in OIS (20 days, Figure 6 e) and SIPS (30 days, Figure 6 e) was confirmed by SA-β-Gal activity. EV, empty vector control; CTR, unirradiated cells. Figure 6 k, Full-length L1 mRNA expression in all forms of senescence was confirmed on poly(A)-purified RNA using primers for amplicons A and F by RT-qPCR. Delayed activation was shown by comparing day 9 and day 20 of OIS and day 12 and day 30 of SIPS. (b-e, i-k), n = 3 independent biological samples, repeated in 2 independent experiments. Data are mean ± s.d. *P ≤ 0.05, **P ≤ 0.01, unpaired two-tailed t-test.
[0034] Figure 7 Localization of transcription start sites in L1 elements activated during cellular senescence is shown. Late senescent cells (16 weeks, Figure 1 a, Table 1) were used with primers C and DFigure 6 Perform 5' RACE on the D point in a), clone the products, and perform Sanger sequencing on individual clones (see Methods for details). Figure 7 a, A multiple sequence alignment of 50 mappable clones against the L1HS consensus sequence was generated using the MAFFT software. The L1HS consensus sequence is shown at the top. The blue shading of the aligned clones shows their degree of identity with the consensus sequence. The green vertical line marks the start of the L1HS consensus sequence (position 1). The red vertical lines mark the short gaps (1 - 4 nucleotides) opened by individual clones in the L1HS consensus sequence. The consensus sequence of the 50 clones is shown at the bottom and was generated using Jalview. The start of L1 transcription is known to be imprecise, with most start sites occurring at + / - 50 bp from the consensus sequence start site, and a subset extending as far as +180 bp 11 。 Figure 7 b, Summary of mapping data and clone classification for the L1 element family. The relative start sites were calculated relative to the L1HS consensus sequence start site. The RepEnrich software 12 was used to assign clones to the L1 family.
[0035] Figure 8 Shows the evolution of transcriptomic changes during the cellular senescence process. At week 8 (SEN - E) and week 16 (SEN - L) of senescence (points C and D in Extended Data Figure 6 a, respectively), RNA - seq was performed on early proliferative LF1 cells (EP) and cultures. The data were analyzed using three - way comparisons: EP vs. SEN - E, EP vs. SEN - L, and SEN - E vs. SEN - L (see Methods for details). Figure 8 a, An area - proportion generalized Venn diagram depicting the intersections of three comparisons of the following datasets. i - ii, Significantly up - and down - regulated genes (2x row in Fig. b). iii - iv, Key KEGG pathways identified by GSEA. Note the significant evolution of the late - senescence transcriptome, exemplified by the large changes (especially up - regulation) in differentially expressed genes and pathways. v - vi, Significantly altered genes in the IFN - I and SASP gene sets (annotations of the gene sets are shown in Table 4). Note that most of the changes in SASP genes occur early, while a large part of the IFN - I changes are specific to late senescence. Figure 8 b, Summary of significantly altered genes using a fixed FDR (<0.05) and variable fold - change cut - off values (2x, 1.75x, and 1.5x). Figure 8c, GSEA analysis of KEGG pathways. Heatmaps show significantly upregulated pathways in red (see also Fig. e) and downregulated pathways in blue. Non-significant comparisons are shown in black; vertical annotations refer to the Venn diagrams in (a, iii-iv). Note that the SASP genome is upregulated earlier, while the IFN-I genome is upregulated later. Figure 8 d, Heatmap of significantly altered genes in the IFN-I and SASP genomes. Vertical annotations refer to the Venn diagrams in (a, v-vi). Figure 8 e, List of significantly upregulated KEGG pathways identified using GSEA (the list of all pathways is shown in Table 5). NES, normalized enrichment score. The IFN-I and SASP genomes are highlighted in yellow. Note the significant upregulation of IFN-I between early and late senescence. Red type identifies KEGG pathways indicative of cytosolic DNA sensing and the late type I interferon response. Figure 8 f - g, GSEA signature plots for the IFN-I and SASP gene sets for all comparisons; FDR is highlighted in yellow. Note that the upregulation of IFN-I is significant for EP_SEN-L and SEN-E_SEN-L, but not for EP_SEN-E, and the upregulation of SASP is significant for EP_SEN-E and EP_SEN-L, but not for SEN-E_SEN-L. n = 3 independent biological samples. Significance of differential expression data was analyzed using the GSEA GenePattern interface, and the output of multiple comparisons was corrected by adjusting the nominal p-values using the Benjamini-Hochberg method (see Methods for details).
[0036] Figure 9 Characterization of L1 effectors and IFN-1 responses is shown. Figure 9 a, Expression of TREX1 was determined by RT-qPCR and immunoblotting. For gel source data, see Fig. 16. Figure 9 b, Expression of RB family genes was compared by RT-qPCR. Primer pairs for all genes were confirmed to have equal efficiency. Figure 9 c, Enrichment of H3K9me3 and H3K27me3 on L1 elements was detected by ChIP-qPCR (using the Figure 1 PCR primers shown in b: 5'UTR, amplicon A; ORF1, amplicon E; ORF2, amplicon F). Figure 9 d, ChIP-seq data from ENCODE were examined for transcription factors that bind to L1 consensus sequences. Log2 fold change enrichment relative to an input control is shown for the indicated cell lines. Binding of YY1 to the L1 promoter has been documented 13and used as the positive control. CEBPB was used as the negative control. A schematic diagram showing the L1 coordinates and relevant features is shown above. Amplicons A - E are the same as Figure 1 shown in panel b. Figure 9 e, The transcriptional activity of the full-length L1 5'UTR or the UTR lacking the FOXA1 binding site (UTR-Δ) was determined using sense and antisense reporter constructs co-transfected with the FOXA1 expression plasmid or empty vector (EV) into early passage LF1 cells. Figure 9 f, Knockdown of FOXA1 in senescent cells using shFOXA1 (a) (see also Figure 2 panel e and Figure 10 panel a), and binding to the L1 5'UTR (amplicon B) was determined by ChIP-qPCR. Figure 9 g, Knockdown of RB1, TREX1 and ectopic expression of FOXA1 were performed in all single (1X), double (2X) and triple (3X) recombinations of early passage cells, and activation of L1, IFN-α and IFN-β1 expression was evaluated by RT-qPCR using poly(A)-purified RNA (primers for amplicon F). Three controls are shown: cells infected with an irrelevant shRNA (shGFP), an expression construct (LacZ), or uninfected early passage cells (EP). Figure 9 h, The L1 5’UTR occupancy of RB1 and FOXA1 in 3X cells was determined by ChIP-qPCR as performed in Figure 2 panels a, b. Primers for amplicons A and B were used for RB1 and FOXA1, respectively. For comparison, single interventions on early passage cells with shRB1 (a) or FOXA1 cDNA expression (EP FOXA1-OE) are also shown. Figure 9 i, Expression of full-length L1 mRNA in 3X cells was confirmed using RT-qPCR, where primers were used for amplicons A and F on poly(A)-purified RNA. CTR, cells infected with an irrelevant shRNA (shGFP). Figure 9 j, Heatmap representation showing all biological replicates of 67 genes with significantly altered expression in SEN and / or 3X cells ( Figure 2 panel h, Table 6). Column clustering was calculated as 1 - Pearson correlation. Rows were grouped into functional subsets of the IFN-I response. Figure 9 k, Venn diagram showing the overlap between 67 significantly altered genes. (a - f, h) n = 3 independent biological samples, repeated in two independent experiments. (g, i), n = 3 independent experiments. (a - i) Data are mean ± s.d. *P ≤ 0.05, **P ≤ 0.01, unpaired two-tailed t-test.
[0037] Figure 10Shows the efficacy of genetic and pharmacological interventions. Figure 10 a, knockdown with two different shRNAs (a, b), or Figure 10 b, ectopic cDNA expression was performed as shown in Figure 2 d, e, g (see also Methods). The effectiveness of these manipulations on their targets was evaluated by RT-qPCR and immunoblotting. For gel source data, see Figure 16. Figure 10 c, RB1, TREX1, and FOXA1 mRNA and protein expression after triple (3X) intervention ( Figure 2 f). Figure 10 d, The effect of 3TC treatment on the relative abundance of L1HS sequences in senescent cells was determined by multiplex TaqMan qPCR of total DNA (primer set 6, Table 1). SEN entry, week 0 of senescence ( Figure 1 a; Figure 6 point A in a). 3TC was continuously administered from SEN entry until harvest after 16 weeks. Figure 10 e, A dual-luciferase L1 reporter system was used to determine the effect of 3TC dose on retrotransposition. The L1 reporter factor was introduced into early passage cells using a lentiviral vector (see Methods for details), and the cells were treated with 3TC for 4 days before harvest and assay. JM111, a defective reporter factor carrying a mutation in ORF1 (without 3TC); L1RP, a reporter factor capable of retrotransposition. Figure 10 f, The effect of 3TC dose on the IFN-I response. The experiment in (d) above was processed by RT-qPCR to determine the expression of IFN-α and IFN-β1. Figure 10 g, Knockdown of L1 was performed with two different shRNAs (a, b) in senescent cells (as in Figure 2 d, e, g) or 3X cells (as in Figure 2 g). The effectiveness on L1 expression was evaluated by RT-qPCR using poly(A)-purified RNA and primer F. Figure 10 h, The ORF1 protein level of the cells in the experiment in (g) was examined by immunofluorescence (IF). Image analysis was performed using CellProfiler software (see Methods for details). >200 cells were examined for each condition (a.f.u., arbitrary fluorescence units). Figure 10 i, The L1 shRNA treatment in the experiment in (g) was replaced with 3TC treatment (10 μM) for the same time. Figure 10j, The effects of five different RTIs (or combinations) on IFN-I responses were tested. AZT (zidovudine, 15 μM), ABC (abacavir, 15 μM), FTC (emtricitabine, 10 μM), 3TC (also known as lamivudine or Epivir, 10 μM), TZV (Trizivir, a combination of 15 μM AZT, 15 μM ABC, and 7.5 μM 3TC). Cells were treated for 4 weeks between 12 and 16 weeks of senescence ( Figure 1 a; Figure 1 points D and E in a). 3X cells ( Figure 2 f) were treated with 3TC for 48 h after the last drug selection was completed. IFN-α expression was determined by RT-qPCR. Figure 10 k, The native L1 reporter (pLD143) 15 was co-transfected into HeLa cells with shRNA plasmid vectors (see Methods for details). Retrotransposition was scored as GFP-positive cells, and shL1 knockdown was normalized to the shLuc negative control. The absolute mean retrotransposition frequency (percentage of GFP-positive cells) was 4.1, which matched the published value of 53 for the reporter used (pLD143). Figure 10 l, Knockout of cGAS and STING was performed in senescent or 3X cells as with other shRNAs ( Figure 2 d, e, g, and a, g above). Figure 10 m, Downregulation of interferon signaling after CRISPR-mediated inactivation of the IFNAR1 and IFNAR2 genes was confirmed by the absence of IRF9 nuclear translocation and STAT2 phosphorylation in response to interferon stimulation. Cells were infected with lentiviral vectors expressing Cas9 and gRNAs against IFNAR1 and IFNAR2 (ΔIFNAR, see Methods). After infection, the cells were re-plated on coverslips, treated with interferon for 2 h, and examined by IF microscopy. The experiment was repeated 3 times with similar results. (a-i, l) n = 3 independent experiments. (k) n = 3 independent biological samples, repeated in 2 independent experiments. (a-l) Data are mean ± s.d. *P ≤ 0.05, **P ≤ 0.01, unpaired two-tailed t test.
[0038] Figure 11 Characterization of cytoplasmic DNA in senescent cells is shown. Figure 11 a, Quiescent and senescent cells were treated with BrdU as in Figure 3 a, and the cellular localization of BrdU incorporation was observed by IF microscopy. Proliferating cells EP (Prol) served as a positive control for nuclear BrdU incorporation. Signals were quantified using CellProfiler software (right panel, see Methods). >200 cells were examined under each condition (a.f.u., arbitrary fluorescence units). Figure 11b, Senescent (and EP control) cells (both not labeled with BrdU) were fractionated into nuclear and cytoplasmic fractions, and the presence of L1 sequences in these compartments (as well as whole cells) was evaluated by qPCR as in Figure 3 a (TaqMan Multiplex qPCR Assay 16, amplicon F, Figure 1 b). Note that the Y-axis units differ by a factor of 10 between the left and right panels. Figure 11 c, Cells were examined by IF microscopy for the presence of ORF1 protein, RNA-DNA hybrids, and single-stranded DNA (ssDNA). For antibodies, see Methods and Table 2. The RNA-DNA signal in senescent cells mainly co-localized with the ORF1 signal and was lost after RNase A treatment. The ssDNA signal also co-localized with the ORF1 signal and was exposed by RNase treatment. The experiment was repeated 3 times with similar results. Figure 11 d, The pulled-down DNA containing BrdU ( Figure 3 c, upper panel (a), see Methods) was cloned and subjected to Sanger sequencing. Among the 96 total clones examined, 37 mapped to L1. The red boxes represent the relative positions of these clones on the L1 consensus sequence. Figure 11 e, Senescent cells labeled with BrdU ( Figure 3 c, upper panel (a) above) were immunoprecipitated with an anti-BrdU antibody, and the presence of L1 sequences in the pulled-down DNA was evaluated by qPCR using primers spanning the entire L1 element ( Figure 1 b, c). Figure 11 f, Senescent cells were treated with L1 shRNA (using the lentiviral vector described in Figure 10 g) between 12 and 16 weeks of senescence, and the expression of SASP genes was measured. Figure 11 g, The transcription of the entire murine L1 element was evaluated in a strand-specific manner using the same strategy applied to the human L1 element ( Figure 1 b, c). The amplicons (designated W-Z to distinguish them from the human-specific primers) correspond to the 5'UTR (W), Orf1 (X), Orf2 (Y), and 3'UTR (Z). For primer sequences (primer sets 37, 48 - 50), see also Methods and Table 1. Poly(A) RNA was prepared from male white adipose tissue. A total of 12 animals (3 groups of 4 animals each) were evaluated in three independent experiments. Figure 11h, Expression of the three currently active families of murine L1 elements. Primers were designed to distinguish 5'UTR polymorphisms of the MdA, MdN, and Tf families (see Methods, primer set 51 - 53 in Table 1). RT-qPCR was performed as described in (f) above (non-strand specific). (a, b, e) n = 3 independent biological samples, repeated in two independent experiments. (f), n = 3 independent experiments. (a, e - h) Data are mean ± s.d. *P ≤ 0.05, **P ≤ 0.01. (a) One-way ANOVA using Tukey's multiple comparison test, (b, e - h) unpaired two-tailed t test.
[0039] Figure 12 The effects of eliminating L1 activation, the cytoplasmic DNA sensing pathway, or interferon signaling on the expression of IFN-I and SASP responses were shown. Figure 12 a, 3X cells were treated with L1 shRNA or 3TC for 48 h as described in Figure 10 g, i. The effects on IFN-I responses were determined by RT-qPCR, ELISA, or immunoblotting. For gel source data, see Fig. 16. Figure 12 b, Cells were serially passaged into replicative senescence (RS), with Figure 3 3TC (10 μM) always present as in Figure 12 f, and the expression of the Cdk inhibitors p21 and p16 was evaluated by RT-qPCR. Figure 10 c, Senescent cells were treated with shRNA against cGAS or STING between 12 and 16 weeks of senescence (as described in Figure 12 l), and the expression of IFN-I response genes (IFN-α, IRF7, OAS1) was measured. Figure 12 d, cGAS and STING were knocked down with shRNA in 3X cells (as in (c) above), and the expression of IFN-I genes was examined by RT-qPCR. Figure 12 e, cGAS and STING were knocked down with shRNA in senescent cells (as shown in (c) above), and the expression of SASP response genes (IL-1β, CCL2, IL-6, MMP3) was determined by RT-qPCR. Figure 3The cells in b) and the 3X cultures (as in panel (a) above) were treated for 48 h. The effects on the expression of IFN-I genes (IFN-α, IRF7, OAS1) and SASP genes (IL-1β, IL-6, MMP3) were evaluated by RT-qPCR. (a - g), n = 3 independent experiments. (a - g) Data are mean ± s.d. *P ≤ 0.05, **P ≤ 0.01, unpaired two-tailed t-test.
[0040] Figure 13 Evaluations of the expression of p16, L1ORF1, and pSTAT1 in senescent cells and skin samples from the elderly are shown. Figure 13 a, Immunofluorescence (IF) detection of p16 and ORF1 in early passage, 3X, and senescent cells. Figure 13 b, Representative images of combined ORF1 and p16 or ORF1p and pSTAT1 staining in human skin. The experiments shown in panels (a, b) were independently repeated 3 times with similar results. Figure 13 c, Cells were plated on coverslips and stained and quantified as described in the methods. 200 cells in multiple fields of view were scored for each condition. a.f.u., arbitrary fluorescence unit. The insets show the percentage of cells found in each quadrant. Figure 13 d, e, Abundance of ORF1 and p16 or pSTAT1 cells in human skin. Skin biopsies were cryosectioned and stained as described in the methods. 200 skin fibroblasts in multiple fields of view for each subject were scored. Summary data for four subjects (800 cells) are shown. Figure 13 f, The data in (c) and (d) were recalculated to show the relative abundance of p16+ cells in all cells, and the relative abundance of ORF1+ cells in the p16+ cell population. Figure 13 g, The data in (e) were recalculated as described in (f). Figure 13 h, Characteristics of human subjects used for skin fibroblast analysis. These samples were collected as part of the ongoing Leiden Longevity Study 16 . The samples used here were randomly selected from the remaining materials. TIF assay 17 Relies on telomere-dependent two-parameter (color) visualization (using FISH probes) and immunofluorescent detection of DNA damage foci (using an antibody against 53BP1). Due to limited material, it was not possible to combine the detection of p16 with TIF in a three-color experiment.
[0041] Figure 14 The effects of 3TC or K-9 treatment on the expression of L1, p16, IFN-1, and SASP genes in mouse tissues are shown. Figure 14 a - c, Mice of the indicated age were treated continuously with 3TC for two weeks (see also Figure 4c, e, Figure 15 d-f and method). For all conditions, the expression of L1 mRNA, p16, three representative IFN-I response genes (Ifn-α, Irf7, Oas1), and three representative SASP genes (Il-6, Mmp3, Pai1) was evaluated by RT qPCR. In any case, the expression at 5 months + 3TC was not significantly different from the drug-free control; therefore, these data are not shown in the figure (all collected data are shown in Table 7). Box plots show the range of the data (whiskers), the 25th and 75th percentiles (box), the mean (dashed line), and the median (solid line). Each point represents one animal. Figure 14 a, visceral white fat, male mice. 5 months, n = 8 animals; 26 months, n = 12 animals; 26 months + 3TC, n = 12 animals. Figure 14 b, visceral white fat, female mice. 5 months, n = 8 animals; 26 months, n = 12 animals; 26 months + 3TC, n = 12 animals. Figure 14 c, liver, male mice. 5 months, n = 8 animals; 26 months, n = 10 animals; 26 months + 3TC, n = 10 animals. Figure 14 d, 26-month-old mice were treated with K-9 or 3TC in drinking water for two weeks and assayed by RT-qPCR as described above. NT, untreated. Visceral white fat, male mice, n = 7 animals per group. Data are mean ± s.d. *P ≤ 0.05, **P ≤ 0.01, one-way ANOVA using Tukey's multiple comparison test.
[0042] Figure 15 Combined assessment of senescence, IFN-1, SASP, and L1 markers and the effect of 3TC on age-related phenotypes in mouse tissues are shown. Figure 15 a, b, Whole-mount IF of white fat from 5- and 26-month-old (with and without 2-week 3TC treatment) male mice. In (a), loss of lamin B1 (senescence marker) co-localizes with IL-6 (SASP marker). In (b), pStat1 (IFN-I marker) co-localizes with Orf1 (L1 marker). Figure 15 c, Quantification of the experiments shown in (a) and (b). Four animals per condition and at least 200 cells per animal were scored. Figure 15 d, Neutral lipids were stained with BODIPY to visualize mature adipocytes in whole-mount preparations, and macrophages were detected by IF using an F4 / 80 antibody. Figure 15e, The effects of 3TC treatment for 2 weeks on adipogenesis were evaluated by measuring mean adipocyte size (left panel) and determining the expression of key adipogenic genes by RT-qPCR (right panel; Acaca, acetyl-CoA carboxylase 1; Cebpa, CCAAT / enhancer-binding protein α; Fasn, fatty acid synthase; Srebp1, sterol regulatory element-binding protein 1). Box plots show the range of the data (whiskers), 25th and 75th percentiles (box), mean (dashed line), and median (solid line). Adipocyte size (BODIPY staining area) was calculated using CellProfiler; pooled data from 5 animals and 500 total cells are shown. For RT-qPCR data, each point represents one animal; n = 6 animals. Figure 15 f, The expression of the Ucp1 gene (thermogenin) in brown adipose tissue was determined by RT-qPCR and presented as in (e). n = 5 animals. Figure 15 g, The expression of L1 mRNA was measured by RT-qPCR and presented as in (e). At 5 months, n = 8 animals; at 26 months, n = 12 animals; at 29 months, n = 6 animals. (e–g) Data are mean ± s.d. *P ≤ 0.05, **P ≤ 0.01. (c, left panel of e, f, g) One-way ANOVA using Tukey's multiple comparison test, (right panel of e) unpaired two-tailed t test.
[0043] Figure 16 shows a scan of the original immunoblot. Figure 16A : Figure a shows blot 1 - RB1: 1. EP; 2. SEN(L); 3. OE–SEN; 4. SEN(E); Figure b shows blot 2 - TREX1: 1. EP; 2. SEN(E); 3. SEN(L); and Figure c shows blot 3 - FOXA1: 1. EP; 2. Arrest; 3. SEN(E); 4. SEN(L). Figure 16B : Figure d shows blot 4 - RB1: 1. EP; 2. 3X; Figure e shows blot 5 - TREX1: 1. EP; 2. 3X; and Figure f shows blot 6 - FOXA1: 1. EP; 2. 3X. Figure 16C : Figure g shows blot 7 - RB1: 1. SEN(L); 2. shRB1(b); 3. shRB1(a); 4. OE-RB1; Figure h shows blot 8 - TREX1: 1. SEN(L); 2. shTREX1(b); 3. shTREX1(a); 4. OE-TREX1; and Figure i shows blot 9 - FOXA1: 1. shFOXA1(a); 2. shFOXA1(b); 3. SEN(L); 4. OE-FOXA1. Figure 16D:Figure j, showing blot 10 - STAT2: 1.3X; 2.shL1; 3.NRTI; 4.ΔIFNAR; 5.EP; Figure k, showing blot 11 - IRF7: 1.EP; 2.shL1; 3.3X; 4.shL1; 5.ΔIFNAR; Figure l, showing blot 12 - STAT2: 1.SEN(L); 2.ΔIFNAR; 3.shL1; 4.NRTI; and Figure m, showing blot 13 - IRF7: 5.SEN(L); 6.ΔIFNAR; 7.shL1; 8.NRTI. Figure 16E Showing: Figure n, showing blot 14–p16(CDKN2A): 1.EP; 2.SEN(E); 3.SEN(L); and Figure o, showing blot 15–p21(CDKN1A): 1.EP; 2.SEN(E); 3.SEN(L).
[0044] Figure 17 Shows the effect of adefovir and lamivudine on the senescence-induced increase in L1 sequence abundance, interferon gene expression, and SASP gene expression. Figure 17 a depicts the effect of 5 μM adefovir and lamivudine on the L1 sequence abundance (copy number) in three different human fibroblast cell lines: LF1, IMR90, WI38 using a qPCR assay. Figure 17 b depicts the effect of 5 μM adefovir and lamivudine on the interferon gene expression of two interferon genes (IFN-α and IFN-β1) in two cell lines (LF1 and IMR90). Figure 17 c depicts the effect of 5 μM adefovir and lamivudine on two SASP genes (IL-6 and MMP3) in the LF1 cell line. Figure 17 d depicts the effect of higher doses of adefovir and lamivudine (10 μM and 50 μM) on the interferon gene expression (IFN-α and IFN-β1) in the LF1 cell line.
[0045] Figure 18 shows the inhibition of mouse L1 activity by eight RTI compounds: lamivudine (3TC); stavudine; emtricitabine; apricitabine; tenofir disiproxil; elsulfavir; elvucitabine; and tenofovir. A dose response of the retrotransposition activity of active mouse LINE1 was obtained using HeLa cells in the first experiment ( Figure 18A ) and a second independent experiment ( Figure 18B ).
[0046] Figure 19 Shows the inhibition of human L1 activity by three RTI compounds: lamivudine (3TC); elsulfavir; and elvucitabine. In the first experiment using lamivudine (3TC); elsulfavir; and elvucitabine (Figure 19 A); and in a second experiment using lamivudine (3TC) and evofosfamide ( Figure 19 B), a dose response of retrotransposition activity of active human LINE1 was obtained using HeLa cells.
[0047] Figure 20 Cell viability of HeLa cells treated with 10 different RTI compounds was shown: lamivudine (3TC); stavudine; emtricitabine; apricitabine; tenofovir disoproxil fumarate; sectravudine; evofosfamide; tenofovir; and staurosporine. DETAILED DESCRIPTION OF THE INVENTION
[0049] It should be understood that certain aspects, modes, embodiments, variations, and features of the present invention are described below in various levels of detail to provide a substantial understanding of the present invention.
[0050] The following description of specific aspects is exemplary only in nature and is in no way intended to limit the scope, its application, or uses of the present invention, which can of course vary. The present invention is described in terms of non - limiting definitions and terms included herein. These definitions and terms are not intended to limit the scope or practice of the present invention, but are for illustrative and descriptive purposes only. Although a composition or process is described as using specific materials or a particular order of individual steps, it should be understood that the materials or steps can be interchangeable, such that the description of the present invention can include multiple parts or steps arranged in various ways, as will be readily understood by those skilled in the art.
[0051] DEFINITIONS
[0052] Definitions of certain terms as used in this specification and the appended claims are provided below. Unless otherwise defined, all technical and scientific terms used herein generally have the same meaning as commonly understood by one of ordinary skill in the art to which this invention pertains.
[0053] As used in this specification and the appended claims, the singular forms "a", "an", and "the" include plural referents unless the context clearly dictates otherwise. For example, a reference to "a cell" includes a combination of two or more cells, etc.
[0054] The term "about" or "approximately" with respect to a value or parameter is generally considered to include within a range of 5%, 10%, 15%, or 20% in either direction (greater than or less than) of the value, unless otherwise stated or apparent from the context (unless such a value is less than 0% of a possible value or exceeds 100%). As used herein, a reference to "about" or "approximately" a value or parameter includes (and describes) embodiments involving that value or parameter. For example, a description of "about X" includes a description of "X".
[0055] As used herein, the term "or" means "and / or". The term "and / or" used in phrases such as "A and / or B" herein is intended to include A and B; A or B; A alone; and B alone. Similarly, the term "and / or" used in phrases such as "A, B, and / or C" is intended to cover each of the following embodiments: A, B, and C; A, B, or C; A or C; A or B; B or C; A and C; A and B; B and C; A alone; B alone; and C alone.
[0056] It should be understood that wherever an embodiment is described herein in the language "comprising", other similar embodiments described in the terms "consisting of" and / or "consisting essentially of" are also provided. It should also be understood that wherever an embodiment is described herein in the language "consisting essentially of", other similar embodiments described in the term "consisting of" are also provided.
[0057] It should be understood that, for clarity, certain features of the invention described herein in the context of separate embodiments may also be provided in combination in a single embodiment. Conversely, for brevity, the various features of the invention described in the context of a single embodiment may also be provided separately or in any sub-combination. Additionally, references to values stated in a range include each value within that range.
[0058] The term "subject" refers to a mammal, including but not limited to dogs, cats, horses, cows, pigs, sheep, goats, chickens, rodents, or primates. The subject can be a domestic pet (e.g., dog, cat), agricultural livestock (e.g., cow, horse, pig, chicken, etc.), a laboratory animal (e.g., mouse, rat, rabbit, etc.), but is not limited thereto. The subject includes human subjects. The human subject can be a pediatric, adult, or geriatric subject. The human subject can be of any gender.
[0059] The terms "effective amount" and "therapeutically effective amount" include an amount sufficient to prevent or improve the manifestation of a disease or medical condition such as an age-related disorder. It should be understood that there will be many known methods in the art to determine the effective amount for a given application. For example, pharmacological methods for determining dosage can be used in a therapeutic context. In the context of a therapeutic or prophylactic application, the amount of the composition administered to a subject will depend on the type and severity of the disease and the characteristics of the subject, such as general health, age, gender, weight, and drug tolerance. It will also depend on the extent, severity, and type of the disease. Those skilled in the art will be able to determine the appropriate dosage based on these and other factors. The composition can also be administered in combination with one or more additional therapeutic compounds.
[0060] As used herein, the terms "treatment" or "therapy" or "healing" or "alleviation" or "remission" refer to (1) therapeutic measures that cure, slow down, alleviate the symptoms of a diagnosed disease or infection and / or halt the progression of a diagnosed disease or infection, and (2) preventive or prophylactic measures that prevent or slow down the development of a disease or infection.
[0061] As used herein, the term "long-term" administration means the administration of a therapeutic agent or drug for a period of at least 12 weeks. This includes the administration of a therapeutic agent or drug such that it is effective or its effectiveness persists for at least 12 weeks, and does not necessarily mean that the administration itself lasts for 12 weeks, for example, if a sustained-release composition or a long-acting therapeutic agent or drug is used. Thus, the subject receives treatment for at least 12 weeks. In many cases, long-term administration is at least 4, 5, 6, 7, 8, 9 months or longer, or at least 1, 2, 3, 5, 7 or 10 years or longer.
[0062] As used herein, the term "age-related inflammation" (or "inflammation related to age") is inflammation that occurs with increasing age, typically chronic, especially chronic systemic inflammation. Such inflammation can be observed in subjects 30, 35 or 40 years of age or older, but is typically seen in subjects 45, 50, 55 or 60 years of age or older. In many cases, this may be a low-level inflammation.
[0063] As used herein, the term "chronic inflammation" means inflammation (e.g., an inflammatory condition) that has a continuous or extended duration in a subject. Generally, this means an inflammatory response or condition with a duration of 20, 25 or 30 days or longer or 1 month or longer, more specifically at least 2 or 3 months or longer. Chronic inflammation results in a gradual change in the cell types present at the site of inflammation. Chronic inflammation may be a factor in the development of many diseases or disorders, particularly including degenerative diseases, or diseases or conditions associated with loss of youthful function or aging.
[0064] As used herein, the term "systemic inflammation" is inflammation that is not limited to a specific tissue or site or location in the body. The inflammation can spread throughout the body. Systemic inflammation typically involves the endothelium and other organ systems.
[0065] As used herein, the term "low-grade inflammation" (which is used herein as a synonym for "low-level inflammation") is characterized by a 2- to 3-fold increase in the systemic concentration of cytokines such as TNFα, IL-6, and CRP, e.g., as measured in plasma or serum. The increase can be relative to a normal concentration or a reference concentration or compared to a normal concentration or a reference concentration (e.g., a concentration determined in a specific reference cohort or group of subjects such as young subjects (e.g., young adults) or healthy subjects such as subjects not suffering from any disease or condition including any inflammatory disease or without inflammation). The increase can also be relative to the concentration level in the subject prior to the development of inflammation. Low-grade inflammation can be observed in the absence of overt signs or symptoms of disease. Thus, low-grade inflammation may be subclinical inflammation. Alternatively, a subject with low-grade inflammation may not have a clinically diagnosed condition or disease but may exhibit some signs or symptoms of an inflammatory response or inflammatory condition. In other words, there may be features or symptoms of inflammation present in the body, but this may not have progressed to an overt or recognized disease.
[0066] As used herein, the term "cancer inflammation" is inflammation that occurs in the context of cancer and can alternatively be defined as "cancer-associated inflammation". Inflammation has been identified as a hallmark of cancer and may be required for tumorigenesis and the maintenance of the cancer state. Cancer symptoms are associated with inflammation. Thus, a subject with cancer may have or exhibit inflammation, which can be low-grade or peripheral inflammation as described above, particularly chronic or systemic inflammation as described above.
[0067] Unless otherwise defined, all terms used herein (including technical and scientific terms) have the same meaning as commonly understood by one of ordinary skill in the art to which this disclosure belongs. It should also be understood that terms such as those defined in commonly used dictionaries should be interpreted as having a meaning consistent with their meaning in the context of the relevant art and this disclosure and will not be interpreted in an idealized or overly formal sense unless expressly so defined in this document.
[0068] Pharmaceutical composition
[0069] The compositions and methods of the present invention can be used to treat individuals in need thereof. In certain embodiments, the individual is a mammal such as a human, or a non-human mammal. When administered to an animal such as a human, the composition or compound is preferably administered as a pharmaceutical composition comprising, for example, a compound of the present invention and a pharmaceutically acceptable carrier. Pharmaceutically acceptable carriers are well known in the art and include, for example, aqueous solutions such as water or physiological buffer saline, or other solvents or vehicles such as ethylene glycol, glycerol, oils such as olive oil, or injectable organic esters. In a preferred embodiment, when such pharmaceutical compositions are for human administration, particularly for invasive routes of administration (i.e., routes that avoid transport or diffusion through an epithelial barrier, such as injection or implantation), the aqueous solution is pyrogen-free, or substantially pyrogen-free. For example, excipients can be selected to achieve delayed release of the medicament or to selectively target one or more cells, tissues, or organs. The pharmaceutical composition can be in dosage unit form such as tablets, capsules (including sprinkle capsules and gelatin capsules), granules, lyophiles for reconstitution, powders, solutions, syrups, suppositories, injections, etc. The composition can also be present in a transdermal delivery system, such as a skin patch. The composition can also be present in a solution suitable for topical application, such as a lotion, cream, or ointment.
[0070] The pharmaceutically acceptable carrier can comprise physiologically acceptable agents that are, for example, used to stabilize a compound such as a compound of the present invention, increase the solubility of a compound such as a compound of the present invention, or increase the absorption of a compound such as a compound of the present invention. Such physiologically acceptable agents include, for example, carbohydrates such as glucose, sucrose, or dextran, antioxidants such as ascorbic acid or glutathione, chelating agents, low molecular weight proteins, or other stabilizers or excipients. The choice of the pharmaceutically acceptable carrier (including the physiologically acceptable agents) depends, for example, on the route of administration of the composition. The formulation or pharmaceutical composition can be a self-emulsifying delivery system or a self-microemulsifying delivery system. The pharmaceutical composition (formulation) can also be a liposome or other polymeric matrix in which, for example, a compound of the present invention can be incorporated. For example, liposomes (such as those comprising phospholipids or other lipids) are non-toxic, physiologically acceptable, and metabolizable carriers that are relatively simple to prepare and administer.
[0071] The phrase "pharmaceutically acceptable" is used herein to refer to those compounds, materials, compositions, and / or dosage forms that, within the scope of reasonable medical judgment, are suitable for use in contact with the tissues of humans and animals and that do not have excessive toxicity, irritation, allergic response, or other problems or complications commensurate with a reasonable benefit / risk ratio.
[0072] As used herein, the phrase "pharmaceutically acceptable carrier" refers to a pharmaceutically acceptable material, composition, or vehicle, such as a liquid or solid filler, diluent, excipient, solvent, or encapsulating material. Each carrier must be "acceptable" in the sense of being compatible with the other ingredients of the formulation and not injurious to the patient. Some examples of materials that can be used as pharmaceutically acceptable carriers include: (1) sugars, such as lactose, glucose, and sucrose; (2) starches, such as corn starch and potato starch; (3) cellulose and its derivatives, such as sodium carboxymethyl cellulose, ethyl cellulose, and cellulose acetate; (4) powdered tragacanth; (5) malt; (6) gelatin; (7) talc; (8) excipients, such as cocoa butter and suppository waxes; (9) oils, such as peanut oil, cottonseed oil, safflower oil, sesame oil, olive oil, corn oil, and soybean oil; (10) glycols, such as propylene glycol; (11) polyols, such as glycerin, sorbitol, mannitol, and polyethylene glycol; (12) esters, such as ethyl oleate and ethyl laurate; (13) agar; (14) buffering agents, such as magnesium hydroxide and aluminum hydroxide; (15) alginic acid; (16) pyrogen-free water; (17) isotonic saline; (18) Ringer's solution; (19) ethanol; (20) phosphate buffer solutions; and (21) other non-toxic compatible substances for pharmaceutical formulations.
[0073] The pharmaceutical composition (formulation) can be administered to a subject by any of a variety of routes of administration, including, for example, orally (e.g., as an elixir, tablet, capsule (including sprinkle capsules and gelatin capsules), pill, powder, granule, paste for application to the tongue, in an aqueous or non-aqueous solution or suspension); by absorption through the oral mucosa (e.g., sublingually); subcutaneously; transdermally (e.g., as a patch applied to the skin); and topically (e.g., as a cream, ointment, or spray applied to the skin). The compounds can also be formulated for inhalation. In certain embodiments, the compounds can simply be dissolved or suspended in sterile water. Details of suitable routes of administration and the compositions suitable for them can be found, for example, in U.S. Patent Nos. 6,110,973; 5,763,493; 5,731,000; 5,541,231; 5,427,798; 5,358,970; and 4,172,896 and the patents cited therein.
[0074] The formulations can conveniently be presented in unit dosage form and can be prepared by any methods well known in the pharmaceutical art. The amount of active ingredient that can be combined with a carrier material to produce a single dosage form will vary depending upon the host being treated, the particular mode of administration. The amount of active ingredient that can be combined with a carrier material to produce a single dosage form is generally the amount of the compound that produces a therapeutic effect. Generally, in 100%, the amount will be about 1% to about 99% of the active ingredient, preferably about 5% to about 70%, and most preferably about 10% to about 30%.
[0075] The methods for preparing these preparations or compositions include the step of combining the active compound, such as a compound of the present invention, with a carrier and optionally one or more auxiliary ingredients. Generally, the preparations are prepared by uniformly and intimately combining the compound of the present invention with a liquid carrier or a finely divided solid carrier or both, and then, if necessary, shaping the product.
[0076] Preparations suitable for oral administration according to the present invention may be capsules (including sprinkle capsules and gelatin capsules), cachets, pills, tablets, lozenges (using flavored bases, usually sucrose and gum arabic or tragacanth), lyophilizates, powders, granules, or as solutions or suspensions in aqueous or non-aqueous liquids, or as water-in-oil or oil-in-water liquid emulsions, or as elixirs or syrups, or as lozenges (using inert bases such as gelatin and glycerin, or sucrose and gum arabic) and / or as mouthwashes, etc., each containing a predetermined amount of the compound of the present invention as an active ingredient. The composition or compound may also be administered as pills, troches or pastes.
[0077] For preparing solid dosage forms for oral administration (capsules (including sprinkle capsules and gelatin capsules), tablets, pills, dragees, powders, granules, etc.), the active ingredient is mixed with one or more pharmaceutically acceptable carriers such as sodium citrate or calcium phosphate dibasic and / or any of the following: (1) fillers or extenders such as starch, lactose, sucrose, glucose, mannitol and / or silicic acid; (2) binders such as carboxymethylcellulose, alginates, gelatin, polyvinylpyrrolidone, sucrose and / or gum arabic; (3) humectants such as glycerol; (4) disintegrants such as agar, calcium carbonate, potato or tapioca starch, alginic acid, certain silicates and sodium carbonate; (5) solution retarders such as paraffin wax; (6) absorption promoters such as quaternary ammonium compounds; (7) wetting agents such as cetyl alcohol and glycerol monostearate; (8) adsorbents such as kaolin and bentonite; (9) lubricants such as talc, calcium stearate, magnesium stearate, solid polyethylene glycol, sodium lauryl sulfate and mixtures thereof; (10) complexing agents such as modified and unmodified cyclodextrins; and (11) coloring agents. In the case of capsules (including sprinkle capsules and gelatin capsules), tablets and pills, the pharmaceutical composition may also contain buffering agents. Solid compositions of a similar type may also be used as fillers in soft and hard gelatin capsules using excipients such as lactose or milk sugar and high molecular weight polyethylene glycols and the like.
[0078] Tablets can be prepared by compression or molding, optionally with one or more accessory ingredients. Compressed tablets can be prepared using binders (e.g., gelatin or hydroxypropylmethylcellulose), lubricants, inert diluents, preservatives, disintegrants (e.g., sodium starch glycolate or croscarmellose sodium), surfactants or dispersing agents. Molded tablets can be prepared by molding in a suitable machine a mixture of the powdered compound moistened with an inert liquid diluent.
[0079] Tablets and other solid dosage forms of the pharmaceutical composition, such as dragees, capsules (including sprinkle capsules and gelatin capsules), pills and granules, can be optionally scored or prepared with coatings and shells such as enteric coatings and other coatings well known in the pharmaceutical formulation art. They can also be formulated using, for example, different proportions of hydroxypropylmethylcellulose to provide the desired release profile, other polymeric matrices, liposomes and / or microspheres to provide slow or controlled release of the active ingredient therein. They can be sterilized, for example, by filtration through a bacteria-retaining filter or by the addition of a sterilizing agent in the form of a sterile solid composition soluble in sterile water or some other sterile injectable medium immediately prior to use. These compositions can also optionally contain opacifying agents and can be compositions that release the active ingredient only or preferably in a particular part of the gastrointestinal tract, optionally in a delayed manner. Examples of embedding compositions that can be used include polymeric materials and waxes. If appropriate, the active ingredient can also be in the form of microcapsules containing one or more of the above excipients.
[0080] Liquid dosage forms for oral administration include pharmaceutically acceptable emulsions, lyophilized agents for reconstitution, microemulsions, solutions, suspensions, syrups and elixirs. In addition to the active ingredient, the liquid dosage forms may contain inert diluents commonly used in the art, such as water or other solvents, cyclodextrins and their derivatives, solubilizing agents and emulsifying agents, such as ethanol, isopropanol, ethyl carbonate, ethyl acetate, benzyl alcohol, benzyl benzoate, propylene glycol, 1,3-butanediol, oils (especially cottonseed, peanut, corn, germ, olive, castor and sesame oils), glycerol, tetrahydrofurfuryl alcohol, polyethylene glycol and fatty acid esters of sorbitan, and mixtures thereof.
[0081] In addition to the inert diluent, oral compositions may also include adjuvants such as wetting agents, emulsifying agents and suspending agents, sweetening agents, flavoring agents, coloring agents, perfuming agents and preservatives.
[0082] In addition to the active compound, suspensions may also contain suspending agents such as ethoxylated isostearyl alcohol, polyoxyethylene sorbitol and sorbitan esters, microcrystalline cellulose, aluminum hydroxide, bentonite, agar and tragacanth, and mixtures thereof.
[0083] Dosage forms for topical or percutaneous administration include powders, sprays, ointments, pastes, creams, lotions, gels, solutions, patches, and inhalants. The active compounds can be mixed under sterile conditions with a pharmaceutically acceptable carrier and any preservatives, buffers, or propellants as may be required.
[0084] In addition to the active compound, ointments, pastes, creams, and gels may also contain excipients such as animal and vegetable fats, oils, waxes, paraffin, starch, tragacanth, cellulose derivatives, polyethylene glycols, silicones, bentonite, silicic acid, talc, and zinc oxide, or mixtures thereof.
[0085] In addition to the active compound, powders and sprays may also contain excipients such as lactose, talc, silicic acid, aluminum hydroxide, calcium silicate, and polyamide powder, or mixtures of these substances. Sprays may additionally contain conventional propellants such as chlorofluorocarbons and volatile unsubstituted hydrocarbons such as butane and propane.
[0086] Transdermal patches have the additional advantage of providing controlled delivery of the compounds of the present invention to the body. Such dosage forms can be prepared by dissolving or dispersing the active compound in a suitable medium. Penetration enhancers can also be used to increase the flux of the compound across the skin. The rate of such flux can be controlled by providing a rate-controlling membrane or by dispersing the compound in a polymer matrix or gel.
[0087] As used herein, the phrases "parenteral administration" and "parenterally administered" refer to modes of administration other than enteral and topical administration, typically by injection, including but not limited to intravenous, intraocular (e.g., intravitreal), intramuscular, intraarterial, intrathecal, intracapsular, intraorbital, intracardiac, intradermal, intraperitoneal, intratracheal, subcutaneous, subepidermal, intraarticular, subcapsular, subarachnoid, intraspinal, and intrasternal injection and infusion. Pharmaceutical compositions suitable for parenteral administration comprise one or more active compounds in combination with one or more pharmaceutically acceptable sterile isotonic aqueous or non-aqueous solutions, dispersions, suspensions, or emulsions or sterile powders that can be reconstituted into sterile injectable solutions or dispersions before use, which may contain antioxidants, buffers, bacteriostatic agents, solutes that render the formulation isotonic with the blood of the intended recipient, or suspending or thickening agents.
[0088] Examples of suitable aqueous and non-aqueous carriers for the pharmaceutical compositions of the present invention include water, ethanol, polyols (such as glycerol, propylene glycol, polyethylene glycol, etc.) and suitable mixtures thereof, vegetable oils such as olive oil, and injectable organic esters such as ethyl oleate. Examples of suitable aqueous and non-aqueous carriers for the pharmaceutical compositions of the present invention include water, ethanol, polyols (such as glycerol, propylene glycol, polyethylene glycol, etc.) and suitable mixtures thereof, vegetable oils such as olive oil, and injectable organic esters such as ethyl oleate. Appropriate fluidity can be maintained, for example, by using coating materials such as lecithin, by maintaining the desired particle size in the case of dispersions, and by using surfactants. For example, appropriate fluidity can be maintained, for example, by using coating materials such as lecithin, by maintaining the desired particle size in the case of dispersions, and by using surfactants.
[0089] These compositions may also contain adjuvants such as preservatives, wetting agents, emulsifying agents, and dispersing agents. By including various antibacterial and antifungal agents such as parabens, chlorobutanol, phenol, sorbic acid, etc., the action of microorganisms can be ensured to be prevented. It may also be desirable to include isotonic agents such as sugars, sodium chloride, etc. in the compositions. In addition, prolonged absorption of injectable pharmaceutical forms can be achieved by including agents that delay absorption such as aluminum monostearate and gelatin.
[0090] In some cases, in order to prolong the action of the drug, it is desirable to slow down the absorption of the drug from subcutaneous or intramuscular injection. This can be achieved by using a liquid suspension of a poorly water-soluble crystalline or amorphous material. The absorption rate of the drug depends on its dissolution rate, which in turn may depend on crystal size and crystal form. Alternatively, delayed absorption of parenterally administered pharmaceutical forms is achieved by dissolving or suspending the drug in an oily carrier.
[0091] Injectable depot forms are prepared by forming a microencapsulation matrix of the subject compound in a biodegradable polymer such as poly(lactide-co-glycolide). Depending on the ratio of the drug to the polymer and the nature of the particular polymer used, the drug release rate can be controlled. Other biodegradable polymers include, for example, poly(orthoesters) and poly(anhydrides). Depot injectable formulations can also be prepared by encapsulating the drug in liposomes or microemulsions that are compatible with body tissues.
[0092] For use in the methods of the present invention, the active compound can be administered per se or as a pharmaceutical composition containing, for example, 0.1 to 99.5% (more preferably, 0.5 to 90%) of the active ingredient in combination with a pharmaceutically acceptable carrier.
[0093] The introduction method can also be provided by rechargeable or biodegradable devices. In recent years, various sustained-release polymer devices have been developed and tested in vivo for the controlled delivery of drugs (including proteinaceous biopharmaceuticals). A variety of biocompatible polymers (including hydrogels), including biodegradable and non-biodegradable polymers, can be used to form implants for the sustained release of compounds at specific target sites.
[0094] The actual dosage level of the active ingredient in the pharmaceutical composition can vary to obtain an amount of the active ingredient that effectively achieves the desired therapeutic response for a particular patient, composition, and mode of administration without being toxic to the patient.
[0095] The selected dosage level will depend on a variety of factors, including the activity of the specific compound or combination of compounds used or their esters, salts, or amides, the route of administration, the time of administration, the excretion rate of the specific compound used, the duration of treatment, other drugs, compounds, and / or materials used in combination with the specific compound, the age, sex, weight, condition, general health, and medical history of the patient being treated, and similar factors well known in the medical arts.
[0096] A physician or veterinarian having ordinary skill in the art can readily determine the therapeutically effective amount of the pharmaceutical composition and prescribe it. For example, the physician or veterinarian can start the dosage of the pharmaceutical composition or compound at a level below that required to achieve the desired therapeutic effect and gradually increase the dosage until the desired effect is achieved. A "therapeutically effective amount" means a concentration of the compound sufficient to cause the desired therapeutic effect. It is generally understood that the effective amount of a compound will vary depending on the weight, sex, age, and medical history of the subject. Other factors that can affect the effective amount can include, but are not limited to, the severity of the patient's condition, the disorder being treated, the stability of the compound, and, if desired, another type of therapeutic agent administered in combination with the compounds of the present invention. Larger total doses can be delivered by multiple administrations of the medicament. Methods for determining efficacy and dosage are known to those of skill in the art 18 。
[0097] Generally speaking, a suitable daily dose of the active compound for the compositions and methods of the present invention will be an amount of such compound that is the lowest dose effective to produce a therapeutic effect. Such effective dose generally depends on the factors described above.
[0098] If desired, the effective daily dose of the active compound can be administered as one, two, three, four, five, six, or more sub-doses at appropriate intervals throughout the day, optionally in unit dosage forms. In certain embodiments of the present invention, the active compound can be administered two or three times a day. In other embodiments, the active compound will be administered once a day.
[0099] The patients receiving this treatment are any animals in need thereof, generally including primates, especially humans; and other mammals such as horses, cows, pigs, sheep, cats and dogs; poultry; and pets.
[0100] In certain embodiments, the compounds of the present invention can be used alone or administered in combination with another type of therapeutic agent.
[0101] The present disclosure includes the use of pharmaceutically acceptable salts of the compounds of the present invention in the compositions and methods of the present invention. In certain embodiments, the expected salts of the present invention include, but are not limited to, alkyl, dialkyl, trialkyl or tetraalkylammonium salts. In certain embodiments, the expected salts of the present invention include, but are not limited to, L-arginine, benenthamine, benzathine, betaine, calcium hydroxide, choline, dimethylethanolamine, diethanolamine, diethylamine, 2-(diethylamino)ethanol, ethanolamine, ethylenediamine, N-methylglucamine, hydrabamine, 1H-imidazole, lithium, L-lysine, magnesium, 4-(2-hydroxyethyl)morpholine, piperazine, potassium, 1-(2-hydroxyethyl)pyrrolidine, sodium, triethanolamine, tromethamine and zinc salts. In certain embodiments, the expected salts of the present invention include, but are not limited to, Na, Ca, K, Mg, Zn or other metal salts. In certain embodiments, the expected salts of the present invention include, but are not limited to, salts of 1-hydroxy-2-naphthoic acid, 2,2-dichloroacetic acid, 2-hydroxyethanesulfonic acid, 2-oxoglutaric acid, 4-acetamidobenzoic acid, 4-aminosalicylic acid, acetic acid, adipic acid, L-ascorbic acid, L-aspartic acid, benzenesulfonic acid, benzoic acid, (+)-camphoric acid, (+)-camphor-10-sulfonic acid, capric acid, caproic acid, caprylic acid, carbonic acid, cinnamic acid, citric acid, cyclamic acid, dodecylsulfuric acid, ethane-1,2-disulfonic acid, ethanesulfonic acid, formic acid, fumaric acid, galactaric acid, gentisic acid, D-glucoheptonic acid, D-gluconic acid, D-glucuronic acid, glutamic acid, glutaric acid, glycerophosphoric acid, glycolic acid, hippuric acid, hydrobromic acid, hydrochloric acid, isobutyric acid, lactic acid, lactobionic acid, lauric acid, maleic acid, L-malic acid, malonic acid, mandelic acid, methanesulfonic acid, naphthalene-1,5-disulfonic acid, naphthalene-2-sulfonic acid, nicotinic acid, nitric acid, oleic acid, oxalic acid, palmitic acid, pamoic acid, phosphoric acid, propionic acid, L-pyroglutamic acid, salicylic acid, sebacic acid, stearic acid, succinic acid, sulfuric acid, L-tartaric acid, thiocyanic acid, p-toluenesulfonic acid, trifluoroacetic acid and undecylenic acid.
[0102] Pharmaceutically acceptable acid addition salts can also exist in various solvated forms, such as solvates formed with water, methanol, ethanol, dimethylformamide, etc. Mixtures of such solvates can also be prepared. The sources of such solvates can come from the crystallization solvent, be inherent in the preparation or crystallization solvent, or be foreign to such a solvent.
[0103] Wetting agents, emulsifying agents and lubricants, such as sodium lauryl sulfate and magnesium stearate, as well as colorants, release agents, coating agents, sweetening agents, flavoring agents and fragrances, preservatives and antioxidants may also be present in the composition.
[0104] Examples of pharmaceutically acceptable antioxidants include: (1) water-soluble antioxidants such as ascorbic acid, cysteine hydrochloride, sodium bisulfate, sodium metabisulfite, sodium sulfite, etc.; (2) oil-soluble antioxidants such as ascorbyl palmitate, butylated hydroxyanisole (BHA), butylated hydroxytoluene (BHT), lecithin, propyl gallate, α-tocopherol, etc.; and (3) metal chelating agents such as citric acid, ethylenediaminetetraacetic acid (EDTA), sorbitol, tartaric acid, phosphoric acid, etc.
[0105] The role of cellular senescence in aging and age-related diseases
[0106] Figure 5 A flow chart is provided that outlines the molecular pathways of cellular senescence that lead to age-related sterile inflammation, which is described in further detail below.
[0107] Upregulation of retrotransposable elements (RTEs)
[0108] RTEs are known to be transcriptionally activated in senescent cells 19 and in some mouse tissues 20 Previously, three regulators have been shown to be involved in the regulation of L1: FOXA1, RB, TREX1. FOXA1 has been reported to be upregulated in senescent cells 21 and binds to the L1 promoter 22 . RB has been reported to inhibit L1 elements 23 . Complete loss (germline deletion) of TREX1 has been reported to result in an autoimmune disease (Aicardi-Gutierrez syndrome, AGS), which is associated with L1 activation 24 .
[0109] Although these three regulators have been reported to play a role in the regulation of L1, the data in the present disclosure demonstrate for the first time that misregulation of the combination of these three factors is sufficient to allow activation of endogenous L1 elements in normal cells. See Example 2. In addition, the present disclosure provides the first description of late senescence as a discrete time and hitherto unknown stage of aging and characterized by upregulation of L1 elements and triggering of an IFN-I response. See Example 1.
[0110] Accumulation of cytoplasmic L1 cDNA
[0111] The presence of cytoplasmic L1 cDNA is known. One source has been shown to be from mitochondria 25。It has been reported that in senescent cells, the nucleus "leaks" chromosomal DNA into the cytoplasm 26 。These are subsequently referred to as "cytoplasmic chromatin fragments" (CCFs) 27 and were later described in senescent cells 28 。However, none of these reports mentioned RTE and L1 as components of CCFs
[0112] The data in this disclosure not only show that L1 DNA sequences are found in the cytoplasm of senescent cells, but they are enriched relative to nuclear DNA sequences. See Example 3. Thus, the simple extrusion of large amounts of chromosomal DNA from the nucleus to the cytoplasm reported previously cannot explain the enrichment of L1 sequences observed herein
[0113] Although the enrichment of L1 DNA in TREX1-null cells (AGS) has been reported previously 29 and the accumulated L1 cDNA in TREX1 knockout cells is cytoplasmic in localization 30 AGS is in a rare autoimmune disease that is not age-related. In contrast, the data in this disclosure generalizes the presence of cytoplasmic L1 DNA to cellular senescence, which is one of the major drivers of aging and age-related diseases
[0114] Induction of IFN-I and crosstalk with the immune system, enhancement of SASP
[0115] It has been previously reported that cytoplasmic DNA (and especially CCFs) are recognized by the cGAS / STING sensor pathway, which thus promotes an inflammatory state 31 。In the context of cellular senescence, this pro-inflammatory state is called the senescence-associated secretory phenotype (SASP). These reports show that SASP depends at least in part on CCFs, as knockdown of cGAS / STING pathway components reduces SASP. It has also been reported that the IFN-1 response is part of this pro-inflammatory cascade 32 。As described above, none of these previous reports addressed the L1 element in CCF-facilitated SASP
[0116] The data in the present disclosure confirm that L1 DNA not only contains a significant proportion of CCFs that are enriched in cytoplasmic DNA relative to nuclear sequences, but is also functionally associated with the promotion of SASP. Specifically, the data in the present disclosure show that reducing the amount of cytoplasmic L1 DNA by shRNA against L1 or by blocking L1 reverse transcription with RTI drugs reduces the IFN-I response and SASP in senescent cells. Importantly, the data in the present disclosure represent the first evidence that RTI treatment can effectively reverse IFN-I and pro-inflammatory SASP after IFN-I and pro-inflammatory SASP are fully established in senescent cells. See Examples 3 and 4.
[0117] All previous work related to treatment was limited to interfering with the cGAS / STING sensor pathway, for example showing that shRNAs against components of the cGAS / STING pathway downregulated the IFN-I response and SASP 33,34 . While it is conceivable to use small molecule inhibitors of the cGAS / STING pathway to downregulate SASP, such treatment would lead to increased sensitivity to viral, bacterial, and other pathogen infections.
[0118] The method of the present invention that targets L1 DNA synthesis with RTI drugs locates the root of the problem because it targets the primary pathogen (L1 DNA itself), rather than downstream processing events such as the cGAS / STING sensor pathway, or even more downstream interferon or immune signaling components. It has been recognized in the present invention that all of these downstream components have essential cellular functions, and thus targeting them in some aspects would impair normal physiological processes. On the other hand, L1 DNA is a unique "non-self" component, and its pharmacological targeting would only be impaired by "off-target" effects.
[0119] In recent years, it has become clear that cellular senescence is one of the major drivers of organismal aging and aging-related diseases 35 . Therefore, there has been considerable interest in "seno-therapies" that block the harmful effects of senescent cells 36 . The major efforts have been directed at "senolytic" drugs, which selectively kill (and thus remove) senescent cells in tissues. "Senomorphics" are classified as small molecules that inhibit the senescent phenotype without killing cells. We prefer to refer to such drugs as "senostatic" drugs to emphasize that their main action is to stop or block the harmful effects of senescent cells, especially SASP.
[0120] Data of the present disclosure indicate that in human cells and mouse models, RTI is a senostatic drug that reverses the SASP of senescent cells and thus alleviates age-related pro-inflammatory states. The data of the present disclosure also describe which specific RTIs and which doses are particularly effective in reversing the SASP. The broad efficacy of RTI as a senostatic drug that can treat multiple age-related conditions has not been described in the art before.
[0121] Promotion of age-related "sterile" inflammation
[0122] Sterile inflammation, also known as inflammaging, is a hallmark of aging and a contributing factor to many age-related diseases. 37,38 . Data of the present disclosure indicate that the activation of L1 elements (and possibly other RTEs) promotes inflammaging, and L1 RT is a relevant target for treating age-related inflammation and disorders.
[0123] Data of the present disclosure provide specific examples of age-related pathologies that can be reversed or at least downregulated by administering RTI in aged mice. For example, the NRTI lamivudine (also known as 3TC or Epivir) has been shown to reverse or downregulate:
[0124] · A panel of IFN-I and SASP markers, measured by RT-qPCR in multiple tissues;
[0125] · Macrophage infiltration into white adipose and kidney tissues, measured by IF microscopy;
[0126] · Muscle atrophy, measured by muscle fiber diameter;
[0127] · Renal glomerulosclerosis, measured by pathological evaluation of PAS-stained sections;
[0128] · Adipocyte atrophy, measured by cell size microscopy and by RT-qPCR determination of key adipogenic genes; and
[0129] · Thermogenesis, measured by RT-qPCR analysis of Ucp1 expression.
[0130] Accordingly, the present invention provides that RTI can be used as a "senostatic" drug that is capable of halting or blocking the deleterious effects of senescent cells, particularly the SASP, and preventing or reversing age-related inflammation and disorders.
[0131] Nucleoside reverse transcriptase inhibitor (NRTI)
[0132] NRTIs are inhibitors of the activity of reverse transcriptase, which is found in retroviruses such as human immunodeficiency virus (HIV). Different nucleoside reverse transcriptase inhibitors may be activated in different ways, but they have the same mechanism of action. NRTIs are generally activated by phosphorylation by cellular enzymes to the triphosphate form. It then competes with cellular triphosphates, which are the substrates for viral reverse transcriptase for proviral DNA. NRTIs were the first drugs available for the treatment of human immunodeficiency virus (HIV infection) and acquired immunodeficiency syndrome (AIDS).
[0133] Table 8 provides a list of commonly approved NRTI drugs or NRTI combination drugs for the treatment of HIV infection and AIDS. As described above, according to the methods of the present invention, NRTIs can be used as "senostatic" drugs, which are capable of halting or blocking the deleterious effects of senescent cells, particularly the SASP, and preventing or reversing age-related inflammation and disorders.
[0134] NRTI drugs that can be used in the methods of the present invention include, but are not limited to: amdoxovir, apricitabine (ATC), (efavirenz / emtricitabine / tenofovir disoproxil fumarate), (entecavir; ETV), (bictegravir / emtricitabine / tenofovir alafenamide), sesofovir (INN; BMS-986001; OBP-601; festinavir), COMBIVIR TM (zidovudine / lamivudine), COVIRACIL TM (emtricitabine, FTC), DAPD / DXG (active metabolite of DAPD - 2,6-diaminopurine dioxolane), (emtricitabine / tenofovir alafenamide), D-D4FC (Dexelvucitabine; Reverset; INCB-8721; DPC 817), dOTC (2'-deoxy-3'-oxa-4'-thiocytidine; BCH-10652), avicitabine, EMTRIVA TM (emtricitabine), EPIVIR TM (lamivudine; 3TC), EFdA (4'-ethynyl-2-fluoro-2'-deoxyadenosine; MK-8591), EVIPLERA TM (rilpivirine / emtricitabine / tenofovir disoproxil fumarate), (elvitegravir / cobicistat / emtricitabine / tenofovir alafenamide), HIVID TM (zalcitabine; ddC), KIVEXA TM (abacavir / lamivudine), LODENOSINE TM(F-ddA), (Rilpivirine / tenofovir alafenamide / emtricitabine), (Adefovir dipivoxil), Racivir (RCV; (+ / -)-emtricitabine), RETROVIR TM (Zidovudine; ZDV; azidothymidine; AZT), Stampidine, (Elvitegravir / cobicistat / emtricitabine / tenofovir disoproxil fumarate), TENOFOVIR TM (TDF, bis-POC ), (Dolutegravir / abacavir / lamivudine), TRIZIVIR TM (Abacavir / lamivudine / zidovudine), (Emtricitabine / tenofovir disoproxil fumarate), (Tenofovir alafenamide; TAF), VIDEX TM (Didanosine ddl), VIREAD TM (Tenofovir disoproxil fumarate), ZIAGEN TM (Abacavir; 159U89) and ZERIT TM (Stavudine; d4T).
[0135] At doses used for the treatment of HIV / AIDS, these drugs can cause a wide range of side effects. Common side effects of NRTIs include, in particular, mitochondrial toxicity (associated with the inhibition of mitochondrial polymerase), neuropathy, pancreatitis, hepatic steatosis and lactic acidosis, bone marrow suppression, symptomatic myopathy and cardiomyopathy 39 . Although NRTIs can be used at doses approved for the treatment of HIV / AIDS, lower doses can be used to prevent or treat age-related inflammation and disorders to avoid side effects associated with higher doses. In one embodiment, the dose used to prevent or treat age-related inflammation and disorders is half (50%) of the dose approved for the treatment of HIV / AIDS (see Table 9). In an alternative embodiment, the dose used is 75% of the dose approved for the treatment of HIV / AIDS. In another alternative embodiment, the dose used is 25% of the dose approved for the treatment of HIV / AIDS. In other alternative embodiments, the dose used is 90%, 80%, 70%, 60%, 40%, 30%, 20% or 10% of the dose approved for the treatment of HIV / AIDS. In other alternative embodiments, the dose used is 0.1 to 99.5%, 10 to 90%, 20 to 80%, 25 to 75%, 30 to 70%, 40 to 60% or 45 to 55% of the dose approved for the treatment of HIV / AIDS.
[0136] In some embodiments, a subject receives long-term administration of one or more RTI drugs as defined herein. In one embodiment, the subject receives treatment for at least 12 weeks. In many cases, the long-term administration is at least 4, 5, 6, 7, 8, 9 months or longer, or at least 1, 2, 3, 5, 7 or 10 years or longer.
[0137] Age-related disorders
[0138] Given that cellular senescence is one of the main drivers of organismal aging and aging-related diseases 40 , the methods of the invention can be used to prevent or treat disorders or diseases associated with cellular senescence by administering one or more senostatic RTI drugs, particularly those in which the presence of senescent cells is likely to have a deleterious effect.
[0139] Disorders or diseases associated with cellular senescence include, but are not limited to, Alzheimer's disease 41 , amyotrophic lateral sclerosis (ALS), atherosclerosis 42 , Huntington's disease, vision loss, hearing loss, peripheral degenerative diseases, cardiovascular dysfunction 43 , atherosclerosis, frontotemporal dementia (FTD), multiple sclerosis (MS), Aicardi Goutiere syndrome, progressive supranuclear palsy (PSP), adverse effects caused by chemotherapy (e.g., myelosuppression, cardiotoxicity, cancer recurrence, thrombosis, fatigue) 44 , hematopoietic stem cell function 45 , osteoarthritis 46 , osteoporosis 47 , osteoporosis, Parkinson's disease 48 , physical function 49 , pulmonary fibrosis 50 , skin aging, wound healing and / or tissue regeneration 51 .
[0140] Methods for treating, preventing and reversing age-related inflammation using RTI
[0141] Provided is a method for treating, preventing and reversing age-related inflammation in a patient in need thereof by administering a reverse transcriptase inhibitor (RTI) to a patient in need thereof. Age-related inflammation may occur in patients suffering from Alzheimer's disease, amyotrophic lateral sclerosis, Parkinson's disease, Huntington's disease, vision loss, hearing loss, peripheral degenerative diseases and cardiovascular dysfunction.
[0142] In one embodiment, a method is provided for delaying or reversing the progression of the underlying pathology of age-related inflammatory disorders, comprising administering to a patient in need thereof a therapeutically effective amount of at least one reverse transcriptase inhibitor (RTI). In some embodiments, the patient experiences a reduction in one or more symptoms of Alzheimer's disease as compared to before the first administration of RTI to the patient.
[0143] In another embodiment, a method is provided for preventing the onset of age-related inflammatory disorders in a patient suspected of having mild cognitive impairment, comprising administering to a patient in need thereof at least one RTI.
[0144] In some embodiments, the NRTI is abacavir, lamivudine, zidovudine, emtricitabine, tenofovir disoproxil fumarate, tenofovir alafenamide, didanosine, stavudine, apricitabine, alovudine, dexelvucitabine, amdoxovir, fosalvudine, or elsulfavir. In other embodiments, the RTI is abacavir (Ziagen), abacavir / lamivudine (Epzicom), abacavir / lamivudine / zidovudine (Trizivir), lamivudine / zidovudine (Combivir), lamivudine (Epivir), zidovudine (Retrovir), emtricitabine / tenofovir disoproxil fumarate (Truvada), emtricitabine (Emtriva), tenofovir disoproxil fumarate (Viread), emtricitabine / tenofovir alafenamide (Descovy), didanosine (Videx), didanosine extended release (Videx EC), or stavudine (Zerit). In another embodiment, the NRTI is sesefovir.
[0145] In some embodiments, at least one RTI is a non-nucleoside reverse transcriptase inhibitor (NNRTI). In some embodiments, at least one NRTI is efavirenz (EFV), nevirapine (NVP), delavirdine (DLV), etravirine, or levaprine.
[0146] In another embodiment, the RTI inhibits L1 reverse transcriptase activity in the patient's cells, such as brain cells.
[0147] When the RTI is an FDA-approved drug, the RTI can be administered in a therapeutically effective amount approved for therapeutic use. In other embodiments, the effective amount can be determined only by routine experimentation. For example, the effective amount can be in the range of about 1 ng / kg to about 200 mg / kg, about 1 μg / kg to about 100 mg / kg, or about 1 mg / kg to about 50 mg / kg. The dose of the composition can be any dose, including but not limited to about 1 μg / kg. The dose of the composition can be any dose, including but not limited to about 1 μg / kg, about 10 μg / kg, about 25 μg / kg, about 50 μg / kg, about 75 μg / kg, about 100 μg / kg, about 125 μg / kg, about 150 μg / kg, about 175 μg / kg, about 200 μg / kg, about 225 μg / kg, about 250 μg / kg, about 275 μg / kg, about 300 μg / kg, about 325 μg / kg, about 350 μg / kg, about 375 μg / kg, about 400 μg / kg, about 425 μg / kg, about 450 μg / kg, about 475 μg / kg, about 500 μg / kg, about 525 μg / kg, about 550 μg / kg, about 575 μg / kg, about 600 μg / kg, about 625 μg / kg, about 650 μg / kg, about 675 μg / kg, about 700 μg / kg, about 725 μg / kg, about 750 μg / kg, about 775 μg / kg, about 800 μg / kg, about 825 μg / kg, about 850 μg / kg, about 875 μg / kg, about 900 μg / kg, about 925 μg / kg, about 950 μg / kg, about 975 μg / kg, about 1 mg / kg, about 5 mg / kg, about 10 mg / kg, about 15 mg / kg, about 20 mg / kg, about 25 mg / kg, about 30 mg / kg, about 35 mg / kg, about 40 mg / kg, about 45 mg / kg, about 50 mg / kg, about 60 mg / kg, about 70 mg / kg, about 80 mg / kg, about 90 mg / kg, about 100 mg / kg, about 125 mg / kg, about 150 mg / kg, about 175 mg / kg, about 200 mg / kg or more. In other embodiments, the dose is 1 mg - 500 mg. In some embodiments, the dose is 10, 20, 30, 40, 50, 60, 70, 80, 90, 100, 110, 120, 130, 140 or 150 mg. These doses can be single or divided and can be administered one or more times per day. The above doses are examples of average cases, but there are individual cases where higher or lower doses should be used, which are within the scope of this disclosure. In practice, the physician determines the therapeutically effective amount and the actual administration regimen that is most suitable for the individual subject, which can vary with the age, weight and response of the particular subject.
[0148] RTI can be administered once, twice, or three times daily for 1 day to the end of life, or for 1 day to 1, 2, 3, 4, 5, 6, 7, 8, 9, or 10 or more years, or until RTI causes unacceptable side effects or is no longer useful.
[0149] Monitor changes in the symptoms of the patient's age-related inflammatory disease. In one embodiment, the symptoms are reduced. In another embodiment, the symptoms remain roughly the same and there is no evidence of progression. In relation to Alzheimer's disease, such symptoms include memory loss, misplacing items, forgetting the names of places or objects, repeating questions, lack of flexibility, confusion, disorientation, obsessive behavior, compulsive behavior, delusions, aphasia, sleep disorders, mood swings, depression, anxiety, apathy, agitation, difficulty performing spatial tasks, agnosia, difficulty walking, weight loss, loss of language ability, short-term memory loss, or long-term memory loss. Methods for monitoring and quantifying any changes in these symptoms can be by conventional methods or by conventional experiments.
[0150] In one embodiment, any changes in the symptoms of mild cognitive impairment and Alzheimer's disease symptoms are determined using the criteria set forth in DSM-5. In another embodiment, any changes in the symptoms of mild cognitive impairment and Alzheimer's disease symptoms are determined using Clinician's Interview-Based Impression of Change (CIBIC-plus). In another embodiment, any changes in the symptoms of mild cognitive impairment and symptoms are determined using Clinician's Interview-Based Impression of Change (CIBIC-plus).
[0151] Any changes in the symptoms can be monitored for 1 - 36 months or longer, such as 1, 2, 3, 4, 5, 6, 7, 8, 9, 10, 11, 12, 13, 14, 15, 16, 17, 18, 19, 20, 21, 22, 23, 24, 25, 26, 27, 28, 29, 30, 31, 32, 33, 34, 35, or 36 months.
[0152] In another embodiment, monitor changes in the underlying pathology of the patient's Alzheimer's disease. In one embodiment, there is a reduction in the underlying pathology. In another embodiment, the underlying pathology remains roughly the same and there is no evidence of progression.
[0153] In some embodiments, any changes in the underlying pathology are identified by detecting biomarkers before and after RTI administration. In one embodiment, the biomarker is beta-amyloid or Tau protein. In another embodiment, the biomarker is detected by PET imaging. In another embodiment, the underlying pathology is identified by measuring brain volume before and after RTI administration.
[0154] In some embodiments, the reduction of the underlying pathology after the first administration of the RTI is reversed or delayed for 1 - 36 months, such as 1, 2, 3, 4, 5, 6, 7, 8, 9, 10, 11, 12, 13, 14, 15, 16, 17, 18, 19, 20, 21, 22, 23, 24, 25, 26, 27, 28, 29, 30, 31, 32, 33, 34, 35, or 36 months.
[0155] In some embodiments, at least one second therapeutic agent for treating the symptoms of an age - related inflammatory disorder is also administered to the patient. In one embodiment, at least one second therapeutic agent for treating Alzheimer's disease is administered to the patient. In some embodiments, at least one second therapeutic agent is donepezil, galantamine, rivastigmine, or memantine. In another embodiment, at least one second therapeutic agent is an antibody that binds to beta - amyloid or Tau protein. In another embodiment, the antibody binds to beta - amyloid and is bapineuzumab. In another embodiment, the antibody binds to Tau protein and is ABBV - 8E12. In another embodiment, at least one second therapeutic agent is a vaccine against beta - amyloid or Tau protein. In another embodiment, at least one second therapeutic agent is an agent that reduces or alters the brain content of beta - amyloid or Tau. In another embodiment, the second therapeutic agent reduces or alters the brain content of beta - amyloid and is a beta - secretase 1 (BACE) inhibitor. In another embodiment, the BACE inhibitor is CTS - 21166, verubecestat (MK8931), lanabecestat (AZD3293), or LY2886721. In another embodiment, the second agent reduces or alters the brain content of beta - amyloid or Tau and is nicotinamide or MPT0G211.
[0156] At least one RTI and at least one second therapeutic agent can be administered separately or together as part of a single pharmaceutical composition.
[0157] When the age-related inflammatory disorder is ALS, at least one second agent for treating ALS symptoms can be administered to a patient. In some embodiments, the at least one second agent is an integrase inhibitor. In some embodiments, the integrase inhibitor is raltegravir, curcumin, curcumin derivative, chicoric acid, chicoric acid derivative, 3,5-dicaffeoylquinic acid, 3,5-dicaffeoylquinic acid derivative, aurintricarboxylic acid, aurintricarboxylic acid derivative, caffeic acid phenethyl ester, derivative of caffeic acid phenethyl ester, caseinophosphopeptide, derivative of caseinophosphopeptide, quercetin, derivative of quercetin, S-1360, sintetovir (AR-177), L-870812 and L-25 870810, MK-0518, BMS-538158 or GSK364735C 52 .
[0158] Improvement of the patient's ALS symptoms can be monitored. Such symptoms include one or more of the following: difficulty walking or performing normal daily activities, tripping and falling, weakness in the legs, feet or ankles, weakness or clumsiness in the hands, slurred speech or difficulty swallowing, muscle spasms, twitching in the arms, shoulders or tongue, inappropriate crying, cognitive changes and behavioral changes.
[0159] Any change in symptoms can be monitored for 1 - 36 months or longer, such as 1, 2, 3, 4, 5, 6, 7, 8, 9, 10, 11, 12, 13, 14, 15, 16, 17, 18, 19, 20, 21, 22, 23, 24, 25, 26, 27, 28, 29, 30, 31, 32, 33, 34, 35 or 36 months. In some embodiments, after the first administration of the RTI, the reduction of the underlying pathology is reversed or delayed for 1 - 36 months, such as 1, 2, 3, 4, 5, 6, 7, 8, 9, 10, 11, 12, 13, 14, 15, 16, 17, 18, 19, 20, 21, 22, 23, 24, 25, 26, 27, 28, 29, 30, 31, 32, 33, 34, 35 or 36 months.
[0160] Salts, pharmaceutical compositions and kits
[0161] The methods of the present disclosure can be achieved by administering at least one RTI as a pure compound or as a pharmaceutical composition. Administration of the pharmaceutical composition or the pure compound of the RTI can be carried out before or after the clinical diagnosis of the age-related inflammation-related disorder. Generally, the pharmaceutical composition is sterile and does not contain toxic, carcinogenic or mutagenic compounds that would cause adverse reactions upon administration.
[0162] The present invention also provides a kit, which comprises at least one RTI, alone or in combination with at least one second therapeutic agent optionally for treating or preventing a disorder associated with age-related inflammation, and an insert having instructions for using these active agents. In one embodiment, at least one RTI is packaged separately with the instructions for administration with at least one second therapeutic agent. The at least one RTI and the at least one second therapeutic agent can be administered simultaneously or sequentially to achieve the desired effect. Additionally, the RTI and the at least one second therapeutic agent can be administered by a single composition or two separate compositions.
[0163] Examples of at least one second therapeutic agent for treating Alzheimer's disease that can be in the kit include donepezil, galantamine, rivastigmine, and memantine. Other optional therapeutic agents that can be in the kit include antibodies that bind to β-amyloid or Tau protein. In one embodiment, the antibody binds to β-amyloid and is bapineuzumab. In another embodiment, the antibody binds to Tau and is ABBV-8E12.
[0164] In another embodiment, the kit can comprise at least one second therapeutic agent that is a vaccine against β-amyloid or Tau protein.
[0165] In another embodiment, the kit can comprise at least one second therapeutic agent that reduces or modifies the brain content of β-amyloid or Tau protein. In some embodiments, the second therapeutic agent that modifies or reduces the brain content of β-amyloid is a β-secretase 1 (BACE) inhibitor. In some embodiments, the BACE inhibitor is CTS21166, verubecestat (MK-8931), lanabecestat (AZD3293), or LY2886721, each of which has been used in clinical trials for treating Alzheimer's disease.
[0166] In another embodiment, the kit can comprise a second agent that reduces or modifies the brain content of Tau and is nicotinamide or MPT0G211.
[0167] In some embodiments, the patient has ALS and the kit further comprises at least one second agent for treating ALS. In other embodiments, the RTI is packaged separately with the instructions for administering at least one second therapeutic agent for treating ALS. In some embodiments, at least one second therapeutic agent for treating ALS is edaravone or riluzole.
[0168] In some embodiments, at least one second agent is an integrase inhibitor. In some embodiments, the integrase inhibitor is raltegravir, curcumin, curcumin derivatives, chicoric acid, chicoric acid derivatives, 3,5-dicaffeoylquinic acid, 3,5-dicaffeoylquinic acid derivatives, aurintricarboxylic acid, aurintricarboxylic acid derivatives, phenethyl caffeate, phenethyl caffeate derivatives, tyrosine phosphorylation inhibitors, tyrosine phosphorylation inhibitor derivatives, quercetin, quercetin derivatives, S-1360, sintetovir (AR-177), L-870812, and L-25 870810, MK-0518, BMS-538158 or GSK364735C 53 .
[0169] The second therapeutic agent is administered in an amount effective to provide its desired therapeutic effect. The effective dosage ranges for each optional therapeutic agent are known in the art, and the optional therapeutic agents are administered to an individual in need thereof within such established ranges.
[0170] The present disclosure includes the preparation and use of salts of RTI. As used herein, "pharmaceutically acceptable salts" refers to salts or zwitterionic forms of RTI. The salts of RTI can be prepared during the final isolation and purification of the compound, or can be prepared separately by reacting the compound with a suitable acid. Pharmaceutically acceptable salts of RTI can be acid addition salts formed with pharmaceutically acceptable acids. Examples of acids useful for forming pharmaceutically acceptable salts include inorganic acids such as nitric acid, boric acid, hydrochloric acid, hydrobromic acid, sulfuric acid, and phosphoric acid, and organic acids such as oxalic acid, maleic acid, succinic acid, and citric acid. Non-limiting examples of salts of RTI include, but are not limited to, hydrochloride, hydrobromide, hydroiodide, sulfate, bisulfate, 2-hydroxyethanesulfonate, phosphate, hydrogen phosphate, acetate, adipate, alginate, aspartate, benzoate, bisulfate, butyrate, camphorate, camphorsulfonate, digluconate, glycerophosphate, hemisulfate, heptanoate, hexanoate, formate, succinate, fumarate, maleate, ascorbate, isethionate, salicylate, methanesulfonate, mesylate, naphthalenesulfonate, nicotinate, 2-naphthalenesulfonate, oxalate, pamoate, pectinate, persulfate, 3-phenylpropionate, picrate, pivalate, propionate, trichloroacetate, trifluoroacetate, phosphate, glutamate, bicarbonate, p-toluenesulfonate, undecanoate, lactate, citrate, tartrate, gluconate, methanesulfonate, ethanedisulfonate, benzenesulfonate, and p-toluenesulfonate. In addition, available amino groups present in RTI can be quaternized with methyl, ethyl, propyl, and butyl chlorides, bromides, and iodides; dimethyl, diethyl, dibutyl, and dipentyl sulfates; decyl, lauryl, myristyl, and stearyl chlorides, bromides, and iodides; and benzyl and phenethyl bromides. In view of the foregoing, any reference to RTI herein is intended to include RTI as well as its pharmaceutically acceptable salts, hydrates, or solvates.
[0171] The present disclosure includes the preparation and use of solvates of RTI. Solvates generally do not significantly alter the physiological activity or toxicity of a compound and can thus be used as pharmacological equivalents. As used herein, the term "solvate" refers to a combination, physical association, and / or solvation of a compound of the present disclosure with solvent molecules, such as a disolvate, monosolvate, or hemisolvate, wherein the ratio of solvent molecules to the compound of the present disclosure is about 2:1, about 1:1, or about 1:2, respectively. Such physical associations involve varying degrees of ionic and covalent bonding, including hydrogen bonding. In some cases, solvates can be isolated, such as when one or more solvent molecules are incorporated into the lattice of a crystalline solid. Thus, "solvate" includes solution-phase and isolable solvates. RTI can exist in solvated forms with pharmaceutically acceptable solvents such as water, methanol, and ethanol, and it is contemplated that the present disclosure includes both solvated and unsolvated forms of RTI. One type of solvate is a hydrate. "Hydrate" refers to a specific subgroup of solvates in which the solvent molecule is water. Solvates can generally be used as pharmacological equivalents. The preparation of solvates is known in the art. See, e.g., Caira et al. (2004) 54 , which describes the preparation of solvates of fluconazole with ethyl acetate and water. Van Tonder et al. (2004) 55 and Bingham et al. (2001) 56 describe similar preparations of solvates, hemisolvates, hydrates, etc. Typical non-limiting methods for preparing solvates include dissolving at least one RTI or at least one second therapeutic agent in a desired solvent (organic, aqueous, or a mixture thereof) at a temperature above 20 °C to about 25 °C, then cooling the solution at a rate sufficient to form crystals, and separating the crystals by known methods such as filtration. Analytical techniques such as infrared spectroscopy can be used to confirm the presence of the solvate in the solvate crystals.
[0172] At least one RTI and at least one second therapeutic agent are generally administered in a mixture with a pharmaceutical carrier to obtain a pharmaceutical composition selected according to the intended route of administration and standard pharmaceutical practice. The pharmaceutical compositions used according to the present disclosure are formulated in a conventional manner using one or more physiologically acceptable carriers comprising excipients and / or auxiliaries that facilitate the processing of at least one RTI and at least one second therapeutic agent.
[0173] These pharmaceutical compositions can be manufactured by, for example, conventional mixing, dissolving, granulating, pill manufacturing, emulsifying, encapsulating, entrapping, or lyophilization processes. Appropriate formulation depends on the chosen route of administration. When administering a therapeutically effective amount of at least one RTI and / or at least one second therapeutic agent orally, the composition is generally in the form of tablets, capsules, powders, solutions, or elixirs. When administered in tablet form, the composition may also contain solid carriers such as gelatin or adjuvants. Tablets, capsules, and powders contain from about 0.01% to about 95%, preferably from about 1% to about 50%, of at least one RTI and at least one second therapeutic agent. When administered in liquid form, liquid carriers such as water, petroleum, or oils of animal or vegetable origin may be added. The liquid form of the composition may further contain saline solutions, glucose, or other sugar solutions, or glycols. When administered in liquid form, the composition contains from about 0.1% to about 90%, preferably from about 1% to about 50% by weight of at least one RTI and at least one second therapeutic agent.
[0174] When administering a therapeutically effective amount of at least one RTI and at least one second therapeutic agent by intravenous, cutaneous, or subcutaneous injection, the composition is in the form of a pyrogen-free, parenterally acceptable aqueous solution. The preparation of such parenterally acceptable solutions with due consideration of pH, isotonicity, stability, etc. is within the purview of those skilled in the art. Preferred compositions for intravenous, cutaneous, or subcutaneous injection generally contain an isotonic vehicle.
[0175] At least one RTI and at least one second therapeutic agent can be readily combined with pharmaceutically acceptable carriers well known in the art. Standard pharmaceutical carriers are described in Remington's Pharmaceutical Sciences 57 . Such carriers enable the active agent to be formulated into tablets, pills, capsules, liquids, gels, syrups, slurries, suspensions, etc. for oral ingestion by the subject to be treated. Pharmaceutical preparations for oral use can be obtained by incorporating at least one RTI and / or at least one second therapeutic agent into a solid excipient, optionally grinding the resulting mixture, and processing the granule mixture, if necessary with the addition of suitable auxiliaries, to obtain tablets or pill cores. Suitable excipients include, for example, fillers and cellulose preparations. Disintegrating agents can be added if desired.
[0176] At least one RTI and at least one second therapeutic agent can be formulated for parenteral administration by injection, for example, by bolus injection or continuous infusion. Preparations for injection can be in unit dosage forms, for example, in ampoules or multi-dose containers with added preservatives. The composition can take such forms as suspensions, solutions, or emulsions in oily or aqueous vehicles, and may contain formulating agents such as suspending, stabilizing, and / or dispersing agents.
[0177] A pharmaceutical composition for parenteral administration comprises an aqueous solution of an active agent in water-soluble form. In addition, a suspension of at least one RTI and at least one second therapeutic agent can be prepared as a suitable oily injection suspension. Suitable lipophilic solvents or vehicles include fatty oils or synthetic fatty acid esters. An aqueous injection suspension may contain substances that increase the viscosity of the suspension. Optionally, the suspension may also contain suitable stabilizers or agents that increase the solubility of the compound and permit the preparation of highly concentrated solutions. Alternatively, the compositions of the invention may be in powder form for constitution with a suitable vehicle such as sterile pyrogen-free water before use.
[0178] At least one RTI and at least one second therapeutic agent can also be formulated as a rectal composition, such as a suppository or a retention enema, for example comprising a conventional suppository base. In addition to the formulations previously described, at least one RTI and at least one second therapeutic agent can also be formulated as a depot formulation. Such long-acting formulations can be administered by implantation (e.g., subcutaneously or intramuscularly) or by intramuscular injection. Thus, for example, at least one RTI and at least one second therapeutic agent can be formulated with a suitable polymeric material or a hydrophobic material (e.g., as an emulsion in an acceptable oil) or an ion exchange resin.
[0179] Specifically, at least one RTI and at least one second therapeutic agent can be administered orally, buccally or sublingually in the form of tablets containing excipients such as starch or lactose, or in the form of capsules or ovules, either alone or mixed with excipients, or in the form of elixirs or suspensions containing flavoring or coloring agents. Such liquid formulations can be prepared with pharmaceutically acceptable additives such as suspending agents. At least one RTI and at least one second therapeutic agent can also be injected parenterally, such as intravenously, intramuscularly, subcutaneously or intracoronarily. For parenteral administration, at least one RTI and at least one second therapeutic agent are generally used in the form of a sterile aqueous solution, which may contain other substances such as salts or monosaccharides, such as mannitol or glucose, to prepare a solution isotonic with blood.
[0180] Some embodiments of the techniques described herein can be defined according to any one of the following numbered paragraphs:
[0181] 1. A method of treating, preventing, and / or reversing age-related inflammation in a patient in need thereof, comprising administering to the patient in need thereof a therapeutically effective amount of a reverse transcriptase inhibitor (RTI), wherein the RTI comprises sesofudine or elsulfavirine.
[0182] 2. The method of paragraph 1, wherein age-related inflammation occurs in patients with Alzheimer's disease, amyotrophic lateral sclerosis (ALS), Parkinson's disease, Huntington's disease, vision loss, hearing loss, peripheral degenerative diseases or cardiovascular dysfunction, frontotemporal dementia (FTD), multiple sclerosis (MS), Aicardi Goutiere syndrome, progressive supranuclear palsy (PSP), osteoarthritis, skin aging, atherosclerosis, adverse reactions caused by chemotherapy, hematopoietic stem cell function, osteoporosis, physical function and / or pulmonary fibrosis, or in patients in need of wound healing or tissue regeneration.
[0183] 3. The method of paragraph 1, wherein age-related inflammation occurs in patients with Alzheimer's disease.
[0184] 4. The method of paragraph 1, wherein age-related inflammation occurs in patients with ALS.
[0185] 5. A method for delaying or reversing the underlying pathological progression of a disorder caused by age-related inflammation, comprising administering to a patient in need thereof a therapeutically effective amount of a reverse transcriptase inhibitor (RTI), wherein the RTI comprises sesefudine or evofosfamide.
[0186] 6. The method of paragraph 5, wherein the patient has Alzheimer's disease or ALS and experiences a reduction in one or more symptoms of Alzheimer's disease or ALS as compared to before the first administration to the patient.
[0187] 7. The method of paragraph 6, wherein the patient has Alzheimer's disease and the one or more symptoms include memory loss, misplacing items, forgetting the names of places or objects, repeating questions, lack of flexibility, confusion, disorientation, obsessive behavior, compulsive behavior, delusions, aphasia, sleep disturbances, mood swings, depression, anxiety, apathy, agitation, difficulty performing spatial tasks, agnosia, difficulty walking, weight loss, loss of language ability, short-term memory loss or long-term memory loss.
[0188] 8. The method of paragraph 6, wherein the patient has Alzheimer's disease and a reduction in one or more symptoms is evaluated according to DSM-5.
[0189] 9. The method of paragraph 6, wherein the patient has Alzheimer's disease and a reduction in symptoms is determined using the cognitive subscale of the Alzheimer's Disease Assessment Scale (ADAS-cog).
[0190] 10. The method of paragraph 6, wherein the patient has Alzheimer's disease and a reduction in symptoms is determined using Clinician's Interview-Based Impression of Change (CIBIC-plus).
[0191] 11. The method of paragraph 6, wherein the patient has Alzheimer's disease and the reduction of symptoms is determined using the Activities of Daily Living Scale (ADL).
[0192] 12. The method of any one of paragraphs 6-11, wherein the reduction of symptoms persists for 1-36 months.
[0193] 13. The method of any one of paragraphs 6-11, wherein any changes in the underlying pathology are identified by detecting biomarkers before and after RTI administration.
[0194] 14. The method of paragraph 13, wherein the biomarker is beta-amyloid or Tau protein.
[0195] 15. The method of paragraph 13 or 14, wherein the biomarker is detected by PET imaging.
[0196] 16. The method of paragraph 13 or 14, wherein the biomarker is detected by measurement in cerebrospinal fluid.
[0197] 17. The method of any one of paragraphs 6-11, wherein the underlying pathology is identified by measuring brain volume before and after RTI administration.
[0198] 18. The method of any one of paragraphs 6-17, wherein the reduction of the underlying pathology is reversed or delayed for 1-36 months.
[0199] 19. A method for preventing the onset of Alzheimer's disease in a patient suspected of having mild cognitive impairment, comprising administering to a patient in need thereof a therapeutically effective amount of a reverse transcriptase inhibitor (RTI), wherein the RTI comprises sesavirine or evofosfamide.
[0200] 20. The method of any one of paragraphs 1-19, wherein the patient has Alzheimer's disease or mild cognitive impairment, and further comprises administering at least one second therapeutic agent for treating the symptoms of Alzheimer's disease.
[0201] 21. The method of paragraph 20, wherein the at least one second therapeutic agent is donepezil, galantamine, rivastigmine or memantine.
[0202] 22. The method of paragraph 20, wherein the at least one second therapeutic agent is an antibody that binds to beta-amyloid or Tau protein.
[0203] 23. The method of paragraph 22, wherein the antibody binds to beta-amyloid and is bapineuzumab.
[0204] 24. The method of paragraph 22, wherein the antibody binds to Tau protein and is ABBV-8E12.
[0205] 25. The method of paragraph 20, wherein the at least one second therapeutic agent is a vaccine directed against β-amyloid or Tau protein.
[0206] 26. The method of paragraph 20, wherein the at least one second therapeutic agent is an agent that reduces or alters the brain content of β-amyloid or Tau.
[0207] 27. The method of paragraph 26, wherein the second therapeutic agent reduces or alters the brain content of β-amyloid and is a β-secretase 1 (BACE) inhibitor.
[0208] 28. The method of paragraph 27, wherein the BACE inhibitor is CTS-21166, verubecestat (MK-8931), lanabecestat (AZD3293), or LY2886721.
[0209] 29. The method of paragraph 26, wherein the second agent reduces or alters the brain content of Tau and is nicotinamide or MPT0G211.
[0210] 30. The method of any one of paragraphs 1, 2, or 4, wherein the patient has ALS, and further comprises administering at least one second agent for treating ALS.
[0211] 31. The method of paragraph 30, wherein the agent for treating ALS is edaravone or riluzole.
[0212] 32. The method of paragraph 30, wherein the at least one second agent is an integrase inhibitor.
[0213] 33. The method of paragraph 32, wherein the integrase inhibitor is raltegravir, curcumin, curcumin derivative, chicoric acid, chicoric acid derivative, 3,5-dicaffeoylquinic acid, 3,5-dicaffeoylquinic acid derivative, aurintricarboxylic acid, aurintricarboxylic acid derivative, caffeic acid phenethyl ester, caffeic acid phenethyl ester derivative, caseinophosphopeptide, caseinophosphopeptide derivative, quercetin, quercetin derivative, S-1360, sintetovir (AR-177), L-870812 and L-25 870810, MK-0518, BMS-538158, or GSK364735C.
[0214] 34. The method of any one of paragraphs 1-33, wherein one or more symptoms or disease pathologies of the patient are evaluated 1-36 months after the first administration of the RTI to the patient.
[0215] 35. The method of any one of paragraphs 1-34, wherein the RTI inhibits L1 reverse transcriptase activity in the patient's cells.
[0216] The method of any one of paragraphs 1-35, wherein the RTI is avicitidine.
[0217] 37. The method of any one of paragraphs 1-35, wherein the RTI is sesofudine.
[0218] 38. The method of any one of paragraphs 1-35, further comprising administering to the patient at least one second therapeutic agent.
[0219] 39. The method of paragraph 38, wherein the patient has Alzheimer's disease and the at least one second therapeutic agent is for treating the symptoms of Alzheimer's disease.
[0220] 40. The method of paragraph 38, wherein the patient has amyotrophic lateral sclerosis (ALS) and the at least one second therapeutic agent is useful for treating ALS. Examples
[0221] The present invention will now be described generally, and will be more readily understood by reference to the following examples, which are included for the purpose of illustrating certain aspects and embodiments of the invention only and are not intended to limit the invention.
[0222] Methods
[0223] Cell culture
[0224] Several different normal human fibroblast cell lines were used in this study. LF1 cells were derived from embryonic lung tissue as described 58 . These cells have been continuously used in our laboratory since their isolation in 1996. For this study, the original samples frozen and continuously stored in our laboratory in 1996 were retrieved and used. IMR-90 and WI-38 cells were obtained from ATCC. None of these cell lines are listed in the International Cell Line Authentication Committee (ICLAC) database. These normal fibroblast cell lines were cultured in Ham's F-10 nutrient mixture (Thermo Scientific) containing 15% fetal bovine serum (FBS, Hyclone) under physiological oxygen conditions (92.5% N2, 5% CO2, 2.5% O2). The medium was additionally supplemented with L-glutamine (2 mM), penicillin, and streptomycin 59 . Mycoplasma contamination of the cell cultures was regularly detected using a mycoplasma detection kit (Lonza).
[0225] To obtain replicative senescence (RS) cells, the LF1 culture was propagated continuously until proliferation ceased. At each passage, after reaching 80% confluence, the cells were trypsinized and diluted 1:4. Thus, each passage corresponded to approximately two population doublings. In early passage cultures, the time between passages was constant at approximately 3 days. As the culture approached senescence, the time between passages gradually increased. An interval of 2 - 3 weeks indicated that the culture was in the penultimate generation. At this point, after reaching 80% confluence, the cells were re - seeded at a 1:2 dilution and this was designated as the last passage ( Figure 2 point A in a). Some cell growth typically occurred over the next 2 - 3 weeks, but the culture did not reach 80%. Under this experimental protocol, most cells in the culture entered senescence within a 3 - 4 - week window centered around the time of the last passage ( Figure 2 grey bars in a). At point B (4 weeks), the culture was trypsinized and re - seeded as described 60 to eliminate a small fraction of cells with persistent contact inhibition. The culture was re - seeded again at point C (8 weeks).
[0226] Oncogene - induced senescence (OIS) was induced by infecting proliferating LF1 cells with pLenti CMV RasV12 Neo (Addgene plasmid #22259). The production and infection procedures of lentiviral particles were as described below. At the end of infection, the cells were re - seeded at 15 - 20% confluence and selected with G418 (250 μg / ml) and maintained until the end of the experiment, with the medium changed every 3 days until the cultures were harvested at the designated time points. Stress - induced premature senescence (SIPS) was induced by X - ray irradiation with 20 Gy at a rate of 87 cGy / min in one fraction using a cesium 137 gamma source (Nordion Gammacell 40). The cell confluence at the time of irradiation was 15 - 20%. The medium was changed immediately after irradiation and then every 3 days thereafter. 293T cells (Clontech) were used for packaging lentiviral vectors and were cultured at 37 °C in DMEM containing 10% FBS under normoxic conditions (air supplemented with 5% CO2).
[0227] Reverse transcriptase inhibitors (RTIs)
[0228] All RTIs (lamivudine, 3TC; zidovudine, AZT; abacavir, ABC; emtricitabine, FTC) used in this study were USP grade and obtained from Aurobindo Pharma, Hyderabad, India. For Trizivir (TZV), its components (ABC, AZT, and 3TC) were mixed in appropriate amounts.
[0229] Mouse Breeding
[0230] C57BL / 6J mice of both sexes were obtained from the NIA Aging Rodent Colony at 5 months and 18 months of age. 61 . Five-month-old animals were sacrificed after a short (1-week) acclimation period, and various tissues were harvested, snap-frozen in LN2, and stored at -80°C. The 18-month-old animals were maintained until they reached the desired age. The mice were housed in a specific pathogen-free AAALAC-accredited barrier facility. Cages, bedding (Sani-chip hardwood bedding), and food (Purina Lab Chow 5010) were autoclaved for disinfection. Food and water (also disinfected) were provided ad libitum. A 12-hour light / dark cycle (lights on at 7:00 am and off at 7:00 pm) was used. The temperature was maintained at 70°F, and the humidity was maintained at 50%. All animals were observed daily and weighed once a week. In a pilot experiment, groups of 10 animals in each of three groups were treated continuously with 3TC (1.5 mg / ml, 2.0 mg / ml, 2.5 mg / ml) dissolved in drinking water from 18 months until they were sacrificed at 24 months. A fourth group (control) was provided with the same water without the drug. No significant differences in behavior, body weight, or survival rate were observed among the four cohorts throughout the experiment. Once during the experiment (at 20 months of age), the animals underwent a single tail bleed of approximately 70 μL. The plasma collected was transported to the University of North Carolina CFAR Clinical Pharmacology and Analytical Chemistry Core for 3TC analysis. For the 2 mg / mL cohort, the average concentration of 3TC in plasma was 7.2 μM. This dose of the drug was selected for further experiments to mimic the human HIV treatment dose (300 mg per day, 5 - 8 μM in plasma). 62 . For the experiments presented in this communication, the animals were aged in-house until they reached 26 months of age. Then they were randomly assigned by a technician, who was unaware of the appearance or other characteristics of the animals, to two cohorts. One cohort was treated with 2 mg / ml of 3TC in drinking water for 2 weeks, and the other cohort (control) was treated in the same manner with the same water without the drug. At the end of the treatment period, all animals were sacrificed and tissues were harvested as described above. All animals in both cohorts were included in all subsequent analyses. The experiment was conducted on male and female animals on different occasions. As described 63 Non-lethal whole-body irradiation (6 Gy) was performed, and tissue samples were stored on dry ice.
[0231] PCR
[0232] The ABI ViiA 7 instrument (Applied Biosystems) was used for all experiments. As described by Coufal et al. (2009) 64 , qPCR of DNA was performed using the TaqMan system (Applied Biosystems). 100 pg of purified genomic DNA was used together with the specified primers (see Table 1). Reverse transcription qPCR (RT-qPCR) of RNA was performed using the SYBR Green system (Applied Biosystems). Polyadenylated RNA was used for all experiments evaluating L1 element transcription, and total RNA was used for all other genes. Total RNA was collected using Trizol reagent (Invitrogen). Poly(A) RNA was isolated from total RNA using the NEBNext Poly(A) mRNA Magnetic Isolation Module (New England Biolabs). 1 μg of total RNA or 10 ng of poly(A) RNA was reverse transcribed into cDNA in a 50 μL reaction using the TaqMan kit (Applied Biosystems). To evaluate strand-specific transcription, random primers in the RT reaction were replaced with strand-specific primers for the target RNA. 1 μL of each RT reaction was used for subsequent qPCR reactions. GAPDH was used as a normalization control in human cell experiments. The arithmetic mean of Gapdh and two additional controls (Hsp90 and GusB) was used to normalize RT-qPCR experiments in murine tissues, except for the liver, which was normalized to Hsp90 and GusB. To measure L1 transcription, poly(A) RNA samples were thoroughly digested with RNase-free DNase (Qiagen) before cDNA synthesis. The effectiveness of DNase digestion was evaluated using a control omitting the RT enzyme.
[0233] Design of PCR primers
[0234] Primer sets 1 to 5 for human L1 (Table 1, Figure 1 amplicons A to E in b) were designed to preferentially amplify elements of the human-specific L1HS and the evolutionarily most recent primate-specific L1PA(2-6) subfamilies, as described below. First, the consensus sequences of L1HS and L1PA2 to L1PA6 elements were obtained from Repbase (Genetic Information Research Institute 65 ). Second, the consensus sequence of these six sequences was generated using the Clustal Omega multiple sequence alignment tool 66,67 . Then the NCBI Primer-BLAST tool 68,69Primer design was performed on the consensus sequences using Primer3 and BLAST. The L1 primer pairs were evaluated for their targets against the most recent genome assembly (hg38) using in silico PCR 70 tools with a minimum perfect match of 15 at the 3' end of each primer. The primers for ORF2 (primer set 6, amplicon F in Figure 1 b) were developed by Coufal et al. (2009) to preferentially target L1HS. Primers for evaluating the transcription of active murine L1 elements (primer set 37, Table 1) were designed on a consensus sequence of the L1MdA and L1Tf families obtained from Repbase and validated as described above. Full-length L1 primer pairs spanning these elements (primer sets 48 - 50) were designed using the same strategy. Primer pairs specific to three active families of murine L1 elements were designed using polymorphisms in the 5' UTR region (primer sets 51 - 53). RT-qPCR analysis of L1 transcription was performed on poly(A)-purified RNA using the SYBR Green method. For all other (non-L1) genes, whenever possible, primers were separated by at least one intron in the genomic DNA sequence (as shown in Table 1). Primers for the human IFN-α family were designed on the consensus sequence of all human IFN-α gene sequences (IFNA1, IFNA2, IFNA4, IFNA5, IFNA6, IFNA7, IFNA8, IFNA10, IFNA13, IFNA14, IFNA16, IFNA17, IFNA21) generated using the Clustal Omega multiple sequence alignment tool. All primers for murine targets were designed as described above and listed in Table 1. Primer sequences corresponding to the consensus sequences of all murine IFN-α family genes as well as the IFNB1 gene were obtained from the publication of Gautier et al. 71 . To quantify the relative L1 genomic copy number (human cells), the TaqMan multiplex method developed by Coufal et al. (2009) 72 was used. These primers are listed as sets 6 and 7 (and their corresponding VIC and 6FAM probes) in Table 1.
[0235] Chromatin immunoprecipitation
[0236] All ChIP experiments were performed using the Chromatrap Spin Column ChIP Kit (Porvair). Briefly, 2×10 6Cells were crosslinked with 1% formaldehyde (10 minutes, room temperature) in their culture dishes, quenched with glycine, washed twice with ice-cold PBS (containing protease inhibitors), and finally scraped into microcentrifuge tubes. The cell pellet was resuspended in 0.4 mL of hypotonic buffer and incubated on ice for 10 minutes. The nuclei were centrifuged, resuspended in 0.3 mL of lysis buffer, and sonicated for a total of 10 minutes using a Bioruptor UCD-200 instrument (Diagenode) set to high pulses (30 seconds, then 30 seconds rest). The extract was centrifuged in a microcentrifuge (top speed, 5 minutes, 4 °C) to remove debris, the supernatant was transferred to a new tube, and stored at -80 °C. Extracts containing 2 μg of DNA were mixed with 4 μg of antibody and loaded onto Chromatrap solid-phase protein A matrix. Immunocomplexes were allowed to form overnight at 4 °C with gentle stirring, and then the samples were washed and eluted according to the manufacturer's protocol. Rabbit IgG and 1% input were used as controls. 1 μL of immunoprecipitated DNA was used in each qPCR reaction.
[0237] BrdU pull-down
[0238] To obtain quiescent cells, proliferating cells were grown to 50% confluence, the serum supplement of the medium was changed to 0.1% FBS, and incubation was continued until harvest. Quiescent and senescent cells were continuously labeled with BrdU (BrdU Labeling Reagent, Thermo Fisher) for two weeks according to the manufacturer's protocol for labeling cultured cells. Cells were harvested and counted: 5×10 5 cells per condition were treated. Genomic DNA was purified by phenol:chloroform extraction, treated with RNase A, and subsequently sheared using a Bioruptor UCD-200 instrument (low pulses, 30 seconds on and 30 seconds off, for a total of 10 minutes). The DNA tubes were incubated in a heating block (100 °C) for exactly one minute, then quickly frozen in liquid nitrogen. The tubes were thawed at room temperature, and 1 μg of purified anti-BrdU antibody (BD Pharmingen, catalog number 555627), as well as magnetic protein A / G beads and ChIP dilution buffer, were added to each tube. The immunoprecipitates were incubated overnight at 4 °C with continuous rotation. According to Magna ChIP TMThe A / G chromatin immunoprecipitation kit (Millipore Sigma) was used to purify the immunocaptured BrdU-labeled DNA. The unbound DNA was retained as input. 1 μL of the immunoprecipitated DNA was used per qPCR reaction. Alternatively, to enrich for single-stranded BrdU-labeled DNA, heat-mediated denaturation was omitted and samples were processed as described above for BrdU pull-down. The second strand of DNA was then generated by adding a mixture of random primers (Thermo Fisher), second strand synthesis reaction buffer, dNTPs, and DNA Pol I (New England Biolabs). The reaction was incubated at 16 °C for 4 h and subsequently purified by phenol-chloroform extraction. After second strand synthesis, the dsDNA was end-repaired using the End-It DNA End-Repair Kit (Epicenter, catalog number ER0720). The blunt-ended fragments were cloned using the Zero Blunt TOPO PCR Cloning Kit (Thermo Fisher) and then used to transform One Shot TOP10 chemically competent E. coli (Thermo Fisher, catalog number C404010). Individual colonies were picked and Sanger sequenced using T7 promoter primers in Beckman Coulter Genomics.
[0239] RNA-seq
[0240] Total RNA was extracted from early passage, early and deeply senescent cells ( Figure 6 a) as described above. The total RNA was processed using the Illumina TruSeq Stranded Total RNA Ribo-Zero kit and sequenced on an Illumina HiSeq2500 2×125bp paired-end using v4 chemistry at Beckman Coulter Genomics Inc. Over 70 million reads were obtained for each sample. The RNA-seq experiments were performed in three biological replicates.
[0241] Using HiSat2 73 the raw RNA sequencing reads were aligned to the GrCh38 build of the human genome. FeatureCounts 74 was used to determine the counts mapped to the genome. EdgeR 75The trimmed mean of M values (TMM) method in edgeR was used to normalize the counts. EdgeR was also used to derive differential expression from the normalized dataset. The differential expression data were then sorted by log2 fold change and input into the GenePattern interface of GSEA Preranked, using 1000 permutations, to determine the enrichment of KEGG pathways, SASP, and interferon response 76,77 . Then, the nominal p-values were adjusted using the Benjamini-Hochberg method 78 to correct the output for multiple comparisons. The GENE-E software 79 was used to display the data.
[0242] In silico analysis of transcription factors binding to L1
[0243] Transcription factor signatures were created using ChIP-seq data from the ENCODE project (GEO accession numbers GSE2961 and GSE32465). The transcription factor ChIP-seq and input control reads were aligned to the consensus sequence of L1HS using bowtie1 80 The log2 fold change enrichment of each base pair of the L1HS consensus sequence was calculated as the ratio of the transcription factor ChIP-seq read coverage per million mapped reads (RPM) relative to the input control RPM value and smoothed by using LOESS smoothing with the parameter α = 0.1. The total number of mapped reads used in RPM normalization was determined by a separate bowtie1 alignment to the human genome (hg19).
[0244] Construction of the FOXA1 reporter
[0245] The L1 promoter reporter plasmids L1WT and L1 del(390-526) were obtained from Sergey Dmitriev, Institute of Bioorganic Chemistry, Moscow 81,82。Both contain luciferase as a reporter factor cloned in the sense orientation. To determine antisense transcription from the same plasmid, EYFP was inserted in the reverse orientation upstream of the L1 5’UTR as follows. The EYFP sequence was excised from pEYFP-N1 (Clontech, catalog number 6006-1) with AgeI and NotI and was blunt-ended. Plasmids L1WT and L1del were digested with XbaI, blunt-ended and treated with FastAP (Fermentas). Successful insertion of antisense EYFP was verified using the PCR primers AAAGTTTCTTATGCCGGGC (in EYFP) and GCTGAACTTGTGGCCGTTTA (in the L1 promoter) and Sanger sequencing. The plasmid pcDNA3.1 / LacZ was used as a co-transfection control. As described 83 Luciferase and β-galactosidase assays were performed. EYFP-N1 was used as a positive control for detecting EYFP signal. Early passage LF1 cells were co-transfected using Lipofectamine with Plus Reagent (Invitrogen) according to the manufacturer's instructions.
[0246] Lentiviral vector
[0247] Constructs were obtained from public repositories as follows. As described 84 Virions were produced and used to infect target cells. shRNA sequences were obtained from The RNAi Consortium (TRC) 85 and cloned into the third-generation pLKO.1 vector and their efficacy was tested. Four selectable markers were used to allow for multiple drug selections: pLKO.1puro (2 μg / ml) and pLKO.1hygro (200 μg / ml) (Addgene plasmid #8453, 24150), pLKO.1blast (5 μg / ml)) (Addgene plasmid #26655), pLKO.1neo (250 μg / ml) (Addgene plasmid 13425). pLKO-RB1-shRNA63 and pLKO-RB1-shRNA19 (Addgene plasmid #25641 and 25640) 86。For FOXA1 shRNA, TRCN0000014881 (a) and TRCN0000014882 (b) were used. For TREX1 shRNA, TRCN0000007902 (a) and TRCN0000011206 (b) were used. For knockdown of L1, nine shRNAs were designed and tested, and two of them (shL1_11 to ORF1, AAGACACATGCACACGTATGT and shL1_44 to ORF2 AAGACACATGCACACGTATGT) showed significant knockdown ( Figure 10 g) and were selected for further work. The remaining seven shRNAs did not produce or produced minimal knockdown. For cGAS shRNA, TRCN0000128706 (a) and TRCN0000128310 (b) were used. For STING shRNA, TRCN0000161345 (a) and TRCN0000135555 (b) were used.
[0248] All ectopic expression experiments were performed using constructs generated in the lentiviral vector pLX304 (blasticidin resistance, Addgene plasmid 25890) by the ORFeome Collaboration 87 and obtained from the DNASU plasmid repository 88 RB1 (ccsbBroad304_06846, HsCD00434323), TREX1 (ccsbBroad304_02667, HsCD00445909), FOXA1 (ccsbBroad304_06385, HsCD00441689).
[0249] All interventions in senescent cells were initiated by infecting the cells at 12 weeks of senescence ( Figure 6 point D in a). After appropriate drug selection, the cells were cultured until 16 weeks of senescence ( Figure 6 point E in a), at which point they were harvested for further analysis.
[0250] 3X interventions were performed by sequentially infecting early passage LF1 cells with the vectors pLKO.1puro shRB, pLKO.1hygro shTREX1, and pLX304 blast FOXA1 Figure 10c). After each infection, the generated drug-resistant cell pool was immediately infected with the next vector. After the third infection, cells were harvested 48 hours after drug selection for further analysis. Infections were also performed in various combinations, which in each case led to the activation of L1 expression, entry into senescence, and induction of the IFN-I response. The above sequences were chosen because they provided the most efficient cell selection for further analysis. To allow for an additional (fourth) intervention on the 3X cells (shL1, shSTING, or shCGAS), the hairpin targeting RB1 was recloned into pLKO.1neo, thereby releasing pLKO.1puro for the fourth gene of interest. This allowed for an efficient drug selection process and sample harvest 48 hours after the last selection.
[0251] Retrotransposition reporter
[0252] Xie et al. (2011) 89 The dual-vector dual-luciferase reporter system reported by was adapted for lentiviral delivery. The L1RP-Fluc reporter was recloned from plasmids pWA355 and pWA366 into the lentiviral backbone pLX304. pWA355 contains a functional, active L1 RP element, while pWA366 contains L1RP (JM111), a mutant element carrying two missense mutations in ORF1 that cannot retrotranspose. Early passage LF1 cells were infected with a puromycin-resistant lentivirus expressing Rluc. The pooled drug-resistant cells were then infected with high-titer particles of the pLX304-WA355 or pLX304-WA366 construct. Cells were treated with 3TC (specified concentration) for four days immediately after infection. Cells were then harvested and Rluc and Fluc luciferase activities were measured. The native L1 retrotransposition reporter pLD143 90 was co-transfected with pLKO vectors (shLuc, shL1_11, and shL1_44) into HeLa cells. Cell culture, transfection, and retrotransposition assays were performed as described above. Retrotransposition activity was normalized to the activity of L1 co-transfected with shLuc. RP Three independent experiments were performed for each construct.
[0253] The expressed L1 elements were identified by long-range RT-PCR and 5' RACE
[0254] Total RNA was harvested from cells using Trizol reagent (Invitrogen). RNA was further purified using the Purelink RNA Mini kit (Invitrogen) and Dnase I digestion. Poly(A) RNA was isolated from the eluted total RNA using the NEBNext Poly(A) mRNA Magnetic Isolation Module (New England Biolabs). The forward primer (MDL15UTRPRAF, primer set 1, Table 1) was used with either of two reverse primers (MDL15UTRPRCR, primer set 3, amplicon size 537 bp) or MDL15UTRPRDR, primer set 4, amplicon size 654 bp). Using a high-fidelity thermostable reverse transcriptase (PyroScript RT-PCR Master Mix Kit, Lucigen), 10 ng of poly(A) mRNA was used per reaction and amplified for 10 cycles. Template-free and RNaseA-treated samples were used as negative controls. The resulting amplicons were cloned into the TOPO-TA (Invitrogen) vector and the resulting plasmids were used to transform One Shot TOP10 chemically competent Escherichia coli. Individual colonies were picked and Sanger sequenced using T7 promoter primers in Beckman Coulter Genomics. For a total of 768 sequenced clones, 96 sequencing reactions (1 plate) were performed for each primer pair in four experiments. Sequencing data were trimmed to remove RT-PCR primers and BLASTed against the human genome (GRCh38) using a match / mismatch cost of +1, -4 and allowing species-specific repeats for Homo sapiens. Only perfect hits were scored and genomic coordinates were annotated. 658 clones could be mapped to the reference genome, 51 contained at least 1 mismatch and thus potentially represented polymorphic elements in the cell line, and 58 were cloning artifacts. Whenever a clone presented multiple instances of exactly the same, fractional counting was employed, dividing the count by the number of elements with the same sequence. Using L1Xplorer 91 Each mappable clone was further analyzed to recover the classification features of the L1 element and to analyze whether it was complete.
[0255] Alternatively, rapid amplification of cDNA ends (RACE) was performed on the poly(A) RNA isolated as above. Each reaction contained 10 ng of poly(A) RNA and was processed using the 5' RACE System kit (Thermo Fisher, product number 18374-041). The two antisense gene-specific primers (GSPs) for 5' RACE were: for GSP1, MDL15UTRPRDR (primer set 4, Table 1) and for nested GSP2, MDL15UTRPRCR (primer set 3, Table 1). The amplification products were cloned and sequenced as above using the T7 promoter sequencing primer. A total of 94 clones were sequenced; 26 mainly contained poly-G fragments generated by the tailing step in the RACE protocol and 18 could not be mapped to the human genome. The remaining 50 mappable clones contained L1 sequences and were aligned to the L1HS consensus sequence using a setting of >95% identity at positions 1-450 92 . The mappable clones were also assigned to individual L1 families using RepEnrich software 93 . Pairwise alignment against the consensus sequence was performed using LALIGN 94 . Multiple sequence alignment was calculated using MAFFT (multiple alignment using fast Fourier transform) with the L-INS-i algorithm (accurate for alignments of <200 sequences) 95 . Alignment visualization, % identity coloring, and consensus sequence were generated by Jalview 96 .
[0256] Generation and analysis of CRISPR-Cas9 knockout
[0257] The GeCKO v2.0 source (Feng Zhang Lab, MIT was tested 97 ) 98Three different gRNA sequences for each chain of the IFNAR receptor (IFNAR1 and IFNAR2) listed in 99,100 were used, and the following sequences were selected: IFNAR1 (HGLibA_29983) AACAGGAGCGATGAGTCTGTA; IFNAR2 (HGLibA_29985) GTGTATATCAGCCTCGTGTT. Cas9 and gRNA were delivered using a single lentiviral vector (LentiCRISPR_v2, Feng Zhang Lab, MIT; Addgene plasmid #52961), carrying a puromycin resistance gene. The efficacy of CRISPR-Cas9 mutagenesis was evaluated by treating infected and drug-selected cells with interferon (generic type I interferon, PBL Assay Science, catalog number 11200-1) and monitoring the nuclear translocation of phosphorylated STAT2 and IRF9 by immunofluorescence. Based on this, the above two gRNAs were selected. The absence of translocation means the lack of IFN-I reactivity and thus the loss of IFNAR function. The experimental procedures followed the protocol provided by the Zhang laboratory 99,100 . In the experiments shown in Figure 3 h(RS) and Figure 10 k, both IFNAR1 and IFNAR2 gRNAs were used to treat the same cells to further enhance the efficacy of eliminating INF-I reactivity. For early passage and senescent cells, co-infection with IFNAR1 and IFNAR2 vectors was performed, followed by selection with puromycin. For senescent cells, high-titer lentiviral particles were applied to senescent cells at week 12 of senescence (point D, Figure 6 a), and the cells were assayed 4 weeks later (point E, Figure 6 a). For the experiments shown in Figure 3 h(SIPS), the edited early passage cells were subjected to single cell cloning. Twenty-four single cells were isolated and amplified using the CellRaft technology (Cell Microsystems). Genomic screening of the CRISPR cleavage sites was performed by the CRISPR Sequencing Service (CCIB DNA Core, Massachusetts General Hospital) 101 . Successful knockout of IFNAR1 and IFNAR2 was confirmed in 4 out of 24 amplified clonal cell lines.
[0258] Immunoblot
[0259] Cells were harvested in Laemmli sample buffer (60 mM Tris pH 6.8, 2% SDS, 10% glycerol, 100 mM DTT) and boiled at 100 °C for 5 minutes. Whole cell extracts (60 μg protein) were separated by SDS-PAGE and transferred to Immobilon-FL membranes (Millipore). Nonspecific binding was blocked by incubating for 1 hour at room temperature in 4% bovine serum albumin (BSA; ThermoFisher) and 0.1% Tween-20 in PBS. Primary antibodies were diluted in the blocking solution and incubated overnight at 4 °C. A list of all primary antibodies is provided in Table 2. Secondary antibodies were diluted in the blocking solution and incubated for 1 hour at room temperature. Signals were detected using a LI-COR Odyssey infrared imaging system (LI-COR Biosciences). To quantify the signals, all samples to be compared were run on the same gel. Loading standards were visualized on the same blot as the test samples using the LI-COR 2-color system. Bands were imaged and quantified using LI-COR software. All bands to be compared were quantified on the same image and within the linear detection range of the instrument.
[0260] Immunofluorescence microscopy was performed on cultured cells
[0261] Cells were grown on glass coverslips and samples were processed as previously described 102 One primary antibodies are listed in Table 2. Staining of ssDNA was performed according to Thomas et al. 103 Briefly, cells seeded on coverslips were fixed with 4% paraformaldehyde (PFA) on ice for 20 minutes and then incubated overnight at -20 °C in 100% methanol. Cells were then treated with 200 mg / mL RNase A at 37 °C for 4 hours. Cells were blocked with 3% BSA and incubated overnight at 4 °C with primary antibodies diluted in 3% BSA. Images were acquired using a Zeiss LSM 710 confocal laser scanning microscope or a Nikon Ti-S inverted fluorescence microscope. As previously described 104 , all microscope settings were set to collect images below saturation and remained constant for all images taken in one experiment. Image analysis of tissues was performed as described below.
[0262] PCR array
[0263] Total RNA was harvested from cells as described above (quantitative PCR) and analyzed using the Qiagen RT 2 Profiler TM Human type I interferon response PCR array (catalog number PAHS-016ZE-4). Using Qiagen RT 2The first strand kit (Catalog No. 330404) uses 1 μg of total RNA as the starting material for the reverse transcription reaction. 102 μL of the completed reaction was mixed with 650 μL of Qiagen RT2 SYBR Green ROX qPCR Mastermix (Catalog No. 330521) and 548 μL of RNase-free molecular grade water and run in the 384-well module on a ViiA 7 Applied Biosystems instrument. All procedures followed the manufacturer's protocol. All conditions were run in triplicate. The results were analyzed using the Qiagen GeneGlobe Data Analysis Center 105 Analyze the results. Briefly, the C t values were normalized to a set of housekeeping genes (HKG). The ΔC t values were calculated between the gene of interest (GOI) and the average HKG value. Then the fold change was calculated using the 2 -ΔΔCT formula. The lower limit of detection was set to a C t of 35. For any GOI considered to be significant, the following filters were set: (i) >2-fold change in expression; and (ii) p-value > 0.05. In addition, genes with an average C t > 32 in the control and test samples were also eliminated.
[0264] Enzyme-linked immunosorbent assay (ELISA)
[0265] Interferon β levels were quantified using the VeriKine-HS human IFN-β serum ELISA kit (PBL Assay Science, Catalog No. 41415). The cell culture medium was conditioned for 48 hours before harvest. To remove particulates and debris, 1 mL aliquots were spun at 5,000 x g for 5 minutes. All incubations were performed in a closed chamber at room temperature (22 - 25 °C) with the plates away from temperature fluctuations. 50 μL of sample buffer was added to each well, followed by 50 μL of diluted antibody solution. Finally, 50 μL of test sample, standard, or blank was added to each well. The plates were sealed and shaken at 450 rpm for 2 hours. At the end of the incubation period, the contents of the plates were removed and the wells were washed 3 times with 300 μL of diluted wash solution. 100 μL of HRP solution was added to each well and incubated for 30 minutes with continuous shaking. The wells were emptied and washed four times with the wash solution. 100 μL of TMB substrate solution was added to each well. The plates were incubated in the dark for 30 minutes. Finally, 100 μL of stop solution was added to each well and the absorbance at 450 nm was recorded within 5 minutes. The values recorded for the blank control were subtracted from the standard and sample values to eliminate background. The optical density (OD) units were plotted using a 4-parameter fit to the standard curve and used to calculate the interferon titer in the samples.
[0266] Human tissue samples
[0267] Human skin samples were collected as part of the Leiden Longevity Study 106,107 and provided by the Leiden University Medical Centre, Netherlands. Informed consent was obtained and all protocols were approved by the ethics committee of the Leiden University Medical Centre. Samples were collected as 4-mm thick full-depth punch biopsies, embedded in optimal cutting compound (OCT), snap-frozen, and stored at -80 °C. The investigators were blinded to all except the age and sex of the subjects. OCT-embedded samples were cryosectioned at 8-μm thickness using a Leica CM3050S cryostat. Slides were fixed with 4% PFA and 0.5% Triton X-100 in PBS (pre-warmed to 37 °C) for 20 min at room temperature. No further permeabilization was performed. A blocking step with 4% bovine serum albumin (BSA; fraction V, Thermo Fisher), 2% donkey serum, 2% rabbit serum, and 0.1% Triton X-100 in PBS was performed for 1 h at room temperature prior to antibody incubation. Primary antibodies were diluted in the above blocking solution (1:200) and incubated overnight at 4 °C with shaking in a humid chamber. Secondary antibodies (Alexa Fluor 546 and Alexa Fluor 647, Life Technologies) were also diluted in the blocking solution and incubated for 2 h at room temperature. After each antibody incubation, three 15-min wash steps were performed in PBS containing 0.2% Triton X-100. Nuclei were counterstained with 2 μg / mL DAPI in PBS containing 0.2% Triton X-100 for 15 min. Stained slides were mounted with ProLong Antifade Mountant (Life Technologies) without DAPI and imaged on a Zeiss LSM 710 confocal laser scanning microscope. A z-series encompassing the full thickness of the tissue was collected for each field of view. All microscope settings and exposure times were set to collect images below saturation and were kept constant for all images taken in one experiment. Using CellProfiler software 108 or the open-source software ImageJ from NIH 109Perform image analysis. The cell nuclei are defined using the DAPI channel. The cell outlines are defined by radially expanding the nuclear masks using the propagation function until the intensity thresholds in the Alexa Fluor 546 and Alexa Fluor 647 channels are reached. The fluorescence intensities within these regions are then recorded in both channels. For each sample, a total of 200 cell nuclei were recorded in multiple fields of view. Mouse tissue sections were processed and analyzed in the same manner as described above.
[0268] Mouse tissue samples
[0269] Total RNA was extracted from 50 mg of visceral fat, small intestine, skeletal muscle, brown fat, or liver tissue by mincing and then homogenizing in Trizol (Invitrogen) using a Power Gen 125 homogenizer (Fischer Scientific). After phase separation, the RNA in the aqueous layer was purified using a Purelink RNA Mini kit (Invitrogen) in the presence of DNase I digestion. To assess gene expression by RT-qPCR, 1 μg of total RNA was reverse transcribed as described above. In each individual experiment, all samples were processed in parallel and no blinding was introduced.
[0270] Imaging of whole-mounted white adipose tissue follows the method described by 110 et al. (2014) 3Fragments of the appropriate size were incubated in 10 mL of fresh fixation buffer (1% PFA in PBS pH 7.4) at room temperature for 30 minutes with gentle agitation. After three washing steps with PBS, the tissue blocks were cut into six equal parts. All subsequent incubations were carried out in 2 mL cylindrical microcentrifuge tubes. Before incubation with the primary antibody, the samples were blocked with 5% BSA, 0.1% saponin in PBS for 30 minutes at room temperature. The primary antibody was diluted in the above blocking solution (1:200) and incubated overnight at 4°C with gentle agitation. The secondary antibodies (AlexaFluor 546, AlexaFluor 594, and AlexaFluor 647, Life Technologies) were also diluted in the blocking solution and incubated for 2 hours at room temperature. After each antibody incubation, three 10-minute washing steps were performed in PBS. After immunostaining, non-antibody-dependent staining of nuclei and lipids was carried out: DAPI and BODIPY (Thermo Fisher) were diluted in PBS containing 5% BSA and incubated with the tissue samples for 20 minutes, followed by the three washing steps described above. The stained samples were carefully placed on #1.5 borosilicate glass chamber slides optimized for confocal imaging. A small drop of PBS was added to prevent drying. The images obtained were analyzed as described above.
[0271] Co-staining of SA-β-Gal activity and ORF1 protein in liver sections was performed by first performing SA-β-Gal staining as described 111 Subsequently, the samples were subjected to heat-induced epitope retrieval by steaming in antigen retrieval buffer (10 mM Tris, 1 mM EDTA, 0.05% Tween 20, pH 9.0) for 20 minutes. The samples were then processed for immunofluorescence staining as described above (human tissue samples).
[0272] Frozen kidney tissue sections stored in OCT were treated with 0.5% (w / v) periodic acid for 10 minutes and then stained with periodic acid-Schiff (PAS) reagent (Fisher Scientific, catalog number SS32-500) for 10 minutes. The stained tissue sections were mounted with Shandon Aqua Mount (Fisher Scientific, catalog number 14-390-5) and then imaged under bright-field illumination. Glomerulosclerosis was scored as described 112 Briefly, 40 glomeruli from each animal were evaluated in a blinded manner and assigned a score of 1-4: score 1, <25% sclerosis; 2, 25-50% sclerosis; 3, 50-75% sclerosis; 4, >75% sclerosis. The features used to evaluate sclerosis were the intensity and prevalence of PAS-positive lesions within the glomeruli. As Figure 4As shown in e, the sclerosed glomeruli are more severely atrophied and stain more strongly with PAS.
[0273] Quadriceps muscles were embedded in OCT, sectioned at 12 μm thickness and mounted onto positively charged glass slides. Sections were stained with H&E (hematoxylin, 3 minutes, followed by eosin for 30 seconds). Mounted glass slides were imaged on a Zeiss Axiovert 200M microscope equipped with a Zeiss MRC5 color camera. To measure muscle fiber diameter, the shortest distance in approximately 100 muscle fibers per animal was measured using ImageJ software as described 113 The Kolmogorov-Smirnov test was used to evaluate the statistical significance of differences between the resulting distributions.
[0274] Statistical processing
[0275] Excel was used for general statistical analysis (means, s.d., t-tests, etc.). R software (64-bit version 3.3.2) for statistical calculations was used for one-way ANOVA and Tukey's multiple comparison post hoc tests. To maintain consistency in comparisons, significance in all figures is represented as follows: *P < 0.05, **P < 0.01. Sample sizes were based on previously published experiments and the experience of previously observed differences. No statistical tests were used to predetermine sample sizes. No samples were excluded. All replicate attempts were successful. No irreproducibility or non-replicability was found. The nature and number of samples (defined as n) analyzed in each experiment are listed in the legend. The number of independent experiments is also listed in the legend. The researchers were blinded when quantifying immunofluorescence results. Using the methods indicated for individual experiments, fields of view or sections of tissue used for quantification were randomly selected and scored. The researchers were also blinded when scoring glomerulosclerosis and muscle fiber diameter. For RNA-seq and PCR array experiments, statistical processing was described under those sections (above).
[0276] Example 1: Activation of L1 and interferon in cellular senescence
[0277] RTE activity can promote aberrant transcription, alternative splicing, insertional mutagenesis, DNA damage, and genomic instability 114 . RTE-derived sequences account for two-thirds of the human genome 115 , but the vast majority were active millions of years ago and are no longer intact. The only human RTE capable of autonomous retrotransposition is the long interspersed nuclear element-1 (LINE-1 or L1). However, the germline activity of L1 is a major source of human structural polymorphisms 116 . Increasing evidence points to the activation of RTEs in certain cancers, the adult brain, and the aging process 117,118,119,120。Cellular defenses include heterochromatinization of elements, the small RNA pathway for targeted transcripts, and antiviral innate immune mechanisms 121 。The somatic activation of RTEs is conserved in yeast and Drosophila with aging, and reducing RTE activity has beneficial effects 122 。
[0278] As Figure 1 a and Figure 6 a-e show, L1 transcription is exponentially activated during replicative senescence (RS) of human fibroblasts, increasing 4-5 fold 16 weeks after proliferation arrest, called late senescence. Multiple RT-qPCR primers were designed to detect the most evolutionarily recent L1 elements (L1HS-L1PA5; Figure 1 b, Figure 6 h). The levels of L1 polyA+ RNA increased 4-5 fold in the sense but not the antisense direction across the entire element in late senescent cells (RS)( Figure 1 c). Sanger sequencing of long-range RT-PCR amplicons( Figure 1 b) was performed to identify 224 elements dispersed throughout the genome; one-third (75, 33.5%) were L1HS, of which 19 (25.3%, 8.5% of the total) were full-length (i.e., annotated as having no inactivating ORF mutations; Figure 6 f, g). 5' RACE was also performed with the same primers, and most L1 transcripts were found to be upregulated in senescent cells initiating within or near the 5' UTR( Figure 7 ).
[0279] L1 elements can stimulate the IFN-I response 123 。As Figure 1 d and Figure 6 i show, interferons IFN-α and IFN-β1 are induced to high levels in late senescent cells. Cellular senescence proceeds through an early DNA damage response phase, followed by the SASP response 124 。What is documented here with the current data is a third and even later phase, characterized by the upregulation of L1 and the IFN-1 response( Figure 1 e), which has not been previously noted, perhaps because most studies have focused on earlier periods. Whole transcriptome RNA-seq analysis confirmed that the SASP and IFN-I responses are temporally distinct( Figure 8 )。The late phases of L1 activation and IFN-I induction were also observed in oncogene-induced senescence (OIS) and stress-induced premature senescence (SIPS)( Figure 1 e, Figure 1 j, k).
[0280] Example 2: Mechanisms of L1 activation
[0281] To explore how surveillance fails during aging, three factors were examined: TREX1, RB1, and FOXA1. TREX1 is a 3'-exonuclease that degrades foreign invading DNA, and its loss is associated with the accumulation of cytoplasmic L1 cDNA. 125 . As Figure 9 shown in 126 . As Figure 2 a, the expression of TREX1 was significantly reduced in senescent cells. RB1 has been shown to bind to repetitive elements (including L1) and promote their heterochromatinization. Figure 9 b). The enrichment of RB1 in the 5'UTR of the L1 element was evident in proliferating cells, decreased in early senescence, and became undetectable in late senescence Figure 2 a). This was consistent with the decrease in H3K9me3 and H3K27me3 marks in these regions Figure 9 c).
[0282] To identify new factors that interact with the L1 5’UTR, we examined the ENCODE ChIP-seq database and found that the pioneer transcription factor FOXA1 binds to this region in several cell lines Figure 9 d). FOXA1 was upregulated in senescent cells 127 . As Figure 2 shown in 128 ( Figure 9 e), FOXA1 binds to the central region of the L1 5’UTR. By using transcriptional reporter factors, we found that the deletion of the FOXA1 binding site reduced sense and antisense transcription from the L1 5’UTR
[0283] Thus, the effects of manipulating the expression of RB1, FOXA1, or TREX1 in fully senescent cells were tested using lentiviral vectors Figure 10 a, b). Ectopic expression of RB1 inhibited the elevated expression of L1, IFN-α, and IFN-β1 in senescent cells, while its knockdown further enhanced their expression Figure 2 d). RB1 overexpression also restored its occupancy of the L1 5’UTR Figure 2 c). In contrast, knockdown of FOXA1 reduced its binding to the L1 5’UTR Figure 9f) and decreased the expression of L1, IFN-α, and IFN-β1, while overexpression of FOXA1 increased the levels of L1, IFN-α, and IFN-β1 ( Figure 2 e). Consistent results were also obtained by manipulating TREX1 ( Figure 2 g). Thus, each of these factors has a significant effect on regulating L1 and IFN-I responses in senescent cells.
[0284] Single or dual interventions targeting these factors only caused modest changes in L1 and IFN-I expression in early passage cells. Although some of these effects were statistically significant, they were dwarfed by the triple intervention (3X) of RB1 and TREX1 knockdown combined with FOXA1 overexpression, resulting in a large induction of L1 and IFN-1 expression ( Figure 2 f, Figure 9 g-i and Figure 10 c). Thus, in normal healthy cells, all three effectors must be impaired to effectively release L1.
[0285] Example 3: Consequences of L1 activation
[0286] To more thoroughly evaluate the activation of IFN-1 by L1, we examined the expression of 84 genes in this pathway using a PCR array. We observed a widespread response, with most genes being upregulated ( Figure 2 h, Figure 9 j, k): 68% (57 / 84) were significantly upregulated in senescent cells and 52% (44 / 84) were upregulated in 3X cells. These data validate and further expand upon the RNA-seq transcriptomic analysis ( Figure 8 ).
[0287] Some NRTIs developed for HIV have also been found to inhibit L1 RT activity 129 . We also developed shRNAs against L1, two of which reduced the transcript levels by 40 - 50% and 70 - 90% in deeply senescent and 3X cells, respectively ( Figure 10 g). The ORF1 protein level was correspondingly reduced in deeply senescent cells ( Figure 5 h). Finally, the shRNAs also reduced the retrotransposition of the recombinant L1 reporter construct ( Figure 10 k).
[0288] Cells lacking TREX1 showed cytoplasmic L1 DNA, the accumulation of which could be inhibited by NRTIs 130 . Although lack of BrdU incorporation is a typical feature of senescent cells ( Figure 6 b), long-term labeling showed that for L1 sequences, the DNA was mainly cytoplasmic and highly enriched ( Figure 11a, b). The use of the NRTI lamivudine (3TC) or shRNA against L1 almost completely blocks the synthesis of cytoplasmic L1 DNA ( Figure 3 a, c). Antibodies against DNA:RNA hybrids detect cytoplasmic signals in senescent cells that mainly co-localize with the ORF1 protein and are converted to ssDNA signals after RNase digestion ( Figure 11 c). Analysis of BrdU-labeled L1 sequences in senescent cells shows that they are localized throughout the L1 element ( Figure 11 d, e). By qPCR, determination of 6, 16 131,132 A relative increase in the L1HS sequence in total cellular DNA can also be detected. 3TC in the range of 7.5 - 10 μM completely blocks this increase in senescent cells and also quenches the activity of the L1 retrotransposition reporter factor ( Figure 10 d, e).
[0289] Knockdown of L1 with shRNA or treatment of cells with 3TC significantly reduces interferon levels and more broadly reduces the IFN-I response in late senescence and 3X cells ( Figure 3 b, Figure 12 a). 3TC in the range of 7.5 - 10 μM optimally inhibits the IFN-I response and is the most effective among the 4 NRTIs tested ( Figure 10 f, j). The relative efficacy of NRTIs is consistent with their ability to inhibit human L1 RT15. 3TC also antagonizes the IFN-I response in other forms of senescence, OIS, and SIPS ( Figure 3 e).
[0290] Cells were passaged from the proliferative phase to deep senescence in the continuous presence of 3TC. 3TC did not significantly affect the time to enter senescence, the induction of p21 or p16, or the early SASP response, such as the upregulation of IL-β ( Figure 3 f, Figure 12 b). However, the amplitude of the late SASP response (such as the induction of CCL2, IL-6, and MMP3) was significantly attenuated. Treatment with L1 shRNA also reduced the expression levels of IL-6 and MMP3 in late senescent cells ( Figure 11 f). Thus, although L1 activation and the subsequent IFN-I response occur relatively late, they make important contributions to the mature SASP and the pro-inflammatory phenotype of senescent cells.
[0291] 3TC does not affect L1 transcript levels ( Figure 10 i), indicating that the INF-1 response is triggered by L1 cDNA. As predicted by this model, knockdown of the cytosolic DNA-sensing pathway components cGAS or STING 133 inhibits the IFN-1 response in late senescence and 3X cells (Figure 10 l and Figure 12 c, d), and also downregulated the SASP response in late senescent cells ( Figure 12 e).
[0292] NRTIs alkyl-modified at the 5'-ribose position cannot be phosphorylated and thus do not inhibit RT enzyme. However, they have intrinsic anti-inflammatory activity by inhibiting P2X7-mediated events that activate the NLRP3 inflammasome pathway 134 . Trimethoxy-3TC (K-9), 10 μM or 100 μM, did not inhibit the IFN-I response in late senescent or 3X cells ( Figure 12 f). Thus, the effect of 3TC on the IFN-I pathway requires RT inhibition. At high concentration (100 μM), K-9 had some inhibitory activity on inflammatory markers ( Figure 12 g).
[0293] To test the role of interferon signaling in the SASP, the IFN-α / β receptor (IFNAR1 and 2) was inactivated using CRISPR / Cas9. Efficient elimination of IFN-I signaling was achieved in both early passage and deeply senescent cells ( Figure 10 m). In replicative and SIPS forms of senescence, loss of interferon signaling antagonized late (CCL2, IL-6, MMP3) but not early (IL-1β) SASP markers ( Figure 3 d). This further demonstrates that IFN-I signaling contributes to the establishment of a complete and mature SASP response in senescent cells.
[0294] Example 4: Activation of L1 in human and mouse tissues
[0295] Activation of L1 expression in human cancers has been detected using an ORF1 antibody 135 . This same reagent showed widespread ORF1 expression in both senescent cells and 3X cells ( Figure 8 a, c, f). In skin biopsies from normal elderly individuals, we found that 10.7% of skin fibroblasts were positive for the senescence marker p16, which is within the range recorded in senescent primates 136 ( Figure 13 b, d, f, h). Some p16-positive skin fibroblasts were also positive for ORF1 (10.3%). Notably, we never observed ORF1 in the absence of p16 expression. We also detected the presence of phosphorylated STAT1 at the single-cell level, which is consistent with the presence of interferon signaling in the tissue microenvironment 137 consistent ( Figure 13b, e, g). Thus, a subset of senescent cells in normal human individuals shows activation of L1, consistent with these events accumulating during the aging process.
[0296] We next examined mice and found that L1 mRNA was gradually upregulated with age in several tissues ( Figure 15 g). The L1 RNA sequences detected were mainly sense strands, present throughout the element, and all three active L1 families were detectable ( Figure 11 g, h). At the protein level, the frequency of L1 ORF1-positive cells increased with age in tissues ( Figure 4 a). The regions stained for Orf1 co-localized with senescence-associated β-galactosidase (SA-β-Gal) activity ( Figure 4 b). Several IFN-I response genes (IFN-α, Irf7, Oas1) and pro-inflammatory and SASP markers (Il-6, Mmp3, Pai1, also known as Serpine1) were upregulated in the tissues of old mice ( Figure 4 c, Figure 14 ). In an experimentally induced cellular senescence model (young animals receiving sublethal irradiation; Figure 4 d), an increase in L1 expression and IFN-I response genes (IFN-α, Oas1) was also observed.
[0297] Old animals (26 months) were treated with 3TC (administered in water at the human therapeutic dose) for two weeks. We found a widespread and significant downregulation of IFN-1 response and alleviation of the SASP pro-inflammatory state ( Figure 4 c; for the complete dataset, see Figure 14 and Table 7). The expression of L1 mRNA and p16 was weakly downregulated, but in most cases, it did not reach statistical significance. K-9 did not affect the IFN-I or SASP response. Immunofluorescence analysis of tissue sections confirmed that senescent cells expressed SASP and that cells expressing Orf1 activated IFN-1 signaling ( Figure 15 a-c). Treatment with 3TC significantly reduced IFN-I and SASP, but not L1 expression or the presence of senescent cells. Thus, NRTIs can be classified as "senostatic" drugs to contrast them with "senolytic" therapies that remove senescent cells from tissues 138,139 ).
[0298] Reduced adipogenesis 140 and thermogenesis 141 are characteristics of natural aging, and both increased in old animals with 2 weeks of 3TC treatment ( Figure 15 d-f). As Figure 4As shown in e, long-term treatment (from 20 to 26 months old) effectively counteracts several known aging phenotypes: (i) macrophage infiltration of tissues, a hallmark of chronic inflammation 142,143 , (ii) glomerulosclerosis of the kidney 144 , and (iii) skeletal muscle atrophy 145 . Macrophage infiltration of white adipose tissue is particularly responsive and returns to young (5-month) levels after only 2 weeks of 3TC treatment.
[0299] Activation of endogenous L1 elements and subsequent strong activation of the IFN-I response are new phenotypes of senescent cells, including naturally occurring senescent cells in tissues. This phenotype evolves gradually during the senescence response and appears to be an important but hitherto unappreciated component of the SASP. We show that the expression of three regulators, RB1, FOXA1, and TREX1, changes during senescence and that these changes are sufficient and necessary to permit transcriptional activation of L1 ( Figure 4 g). Thus, multiple surveillance mechanisms need to be defeated to release L1, highlighting the importance of suppressing these elements in somatic cells.
[0300] In response to L1 activation during cellular senescence and aging, activation of innate immune signaling proceeds through the interferon-stimulated DNA (ISD) pathway. Cytoplasmic DNA can originate from multiple sources, such as mtDNA released from stressed mitochondria 146 or cytoplasmic chromatin fragments (CCFs) released from damaged nuclei 147,148 . Current results indicate that L1 cDNA is an important inducer of IFN-I in senescent cells. Notably, NRTI treatment not only effectively antagonized the IFN-I response but also more broadly reduced age-related chronic inflammation in multiple tissues.
[0301] Sterile inflammation, also known as inflammaging, is a hallmark of aging and a contributing factor to many age-related diseases 149,150 . Current data suggest that activation of L1 elements (and possibly other RTEs) promotes inflammaging and that L1 RT is a relevant target for treating age-related inflammation and disorders.
[0302] Example 5: Effects of adefovir and lamivudine on senescence-induced increases in L1 sequence abundance, interferon gene expression, and SASP gene expression
[0303] The effects of adefovir and lamivudine on senescence-induced increases in Ll sequence abundance, interferon gene expression, and SASP gene expression were evaluated in a human fibroblast cell line.
[0304] The L1 sequence abundance (copy number) was evaluated in three different human fibroblast cell lines: LF1, IMR90, WI38 using qPCR assays. The assays were normalized to 5S rDNA abundance. Controls (CTRL) were untreated, early passage, proliferating cells. The drugs were applied continuously in the medium starting from several generations before senescence through senescence and then to late senescence. "Senescence" samples were harvested four months after the onset of senescence. Both drugs were supplemented to the medium at a concentration of 5 μM. Red bars in the "senescence" condition: cultures without drugs at four months of senescence. As Figure 17 shown in
[0305] a, the L1 copy number increased during senescence in all three cell lines, and both drugs significantly blocked this increase, with adefovir being more effective than lamivudine. Figure 17 The effects of 5 μM adefovir and lamivudine on interferon gene expression were evaluated in two cell lines (LF1 and IMR90) and two interferon genes (IFN-α and IFN-β1), performed as described in Figure 17 a, except that the expression of the indicated genes was measured by RT qPCR. As
[0306] shown in Figure 17 b, both drugs significantly reduced the high interferon gene expression in senescent cells in all cases, and adefovir was again more effective than lamivudine. Red bars are cultures without drugs at four months of senescence.
[0307] Finally, the effects of high concentrations of lamivudine and emtricitabine (10 μM and 50 μM) on interferon gene expression (IFN-α and IFN-β1) were evaluated in the LF1 cell line. This was done by passaging LF1 cells into senescence, keeping them in the senescent state for three months, adding the drugs, keeping the cells in the presence of the drugs for 1 month, and then harvesting at four months. Interferon gene expression was evaluated by RT qPCR. Controls (CTRL) were cells treated as described above without drugs. As Figure 17As shown in d, at 10 μM, lamivudine reduced IFN-I induction and was more effective than emtricitabine. At 50 μM, lamivudine actually induced an increase in interferon expression, even exceeding the levels seen in untreated cells. This increase is thought to be caused by the toxicity of the drug at these high levels. In contrast, 50 μM emtricitabine reduced interferon expression even below the reduction observed with 10 μM.
[0308] Thus, at high doses, the toxicity of RTIs can impair their ability to stop or block the harmful effects of senescent cells and their ability to prevent or reverse age-related inflammation and diseases.
[0309] Example 6: Comparative evaluation of several RTIs in a dose-response assay for the inhibition of L1 activity in mouse and human cells
[0310] The ability of eight RTI compounds to inhibit LINE-1 (L1) activity was evaluated in a mouse L1 retrotransposition assay: lamivudine (3TC); stavudine; emtricitabine; apricitabine; tenofovir disoproxil fumarate; sectravudine; elsulfavirine; and tenofovir. Three RTI compounds were evaluated in a human L1 retrotransposition assay: lamivudine (3TC); sectravudine; and elsulfavirine.
[0311] Mouse LINE-1 retrotransposition assay
[0312] The dual luciferase-encoding plasmid pYX016 containing the mouse L1 element was described in Xie et al., 2011 151 . Lamivudine (3TC), stavudine (d4T), emtricitabine, apricitabine, tenofovir disoproxil fumarate, and tenofovir were purchased from AKScience. Elsulfavirine was obtained by custom synthesis. Sectravudine was synthesized by Oncolys BioPharma. HeLa cervical cancer cells were cultured at 37 °C in Dulbecco's modified Eagle's medium (DMEM)-high glucose containing 4500 mg / L glucose, L-glutamine, sodium pyruvate, and sodium bicarbonate (Sigma) and supplemented with 10% heat-inactivated fetal bovine serum (Thermo Fisher) in a humidified 5% CO2 incubator.
[0313] As in Xie et al., 2011 151It was measured as described, with several modifications. The reporter factor assay was performed in a 96-well white Optical bottom plate. 6000 HeLa cells were seeded in each well 24 hours before transfection and compound treatment. All compounds were resuspended in DMSO. The stock solution concentrations varied from 50 mM to 1.25 mM depending on the solubility of the compound. Serial dilutions (1:3) were prepared in DMSO. Ten different concentrations of each compound were tested in triplicate. Media containing different concentrations of the compound were prepared by adding 2 μL of the compound dilution to 1 mL of media. The final concentration of DMSO in the media was 0.2%. The HD transfection reagent (Promega) was used to transfect the plasmid pYX016 into the cells. According to the manufacturer's instructions, a transfection mixture was prepared in OpiMEM (Thermo Fisher) using a reagent to DNA ratio of 3.5:1. The media was removed from the cells and discarded. The transfection mixture (5 μL) was mixed with the media containing the compound (100 μL / well) and added to the cells in each well. The cells were incubated at 37 °C / 5% CO2 for 48 hours.
[0314] The luciferase reporter factor activity was quantified using the Reporter Assay System (Promega) according to the manufacturer's instructions, with the following modifications: The cells were lysed directly on the multi-well plate with 30 μL of passive lysis buffer (PLB) for 20 minutes at room temperature, gently shaken to ensure complete lysis of the cells (instead of 20 μL of PLB for 15 minutes). The Firefly and Renilla luciferase signals were measured using a SpectraMax i3x Multi-Mode Microplate Reader. Integration times of 100 ms and 10 ms were used to measure the Firefly and Renilla signals, respectively. The relative L1 activity was calculated as Firefly / Renilla * 10,000. The dose-response inhibition data was fitted to a four-parameter logistic equation using non-linear regression (using Graphpad Prism8) to determine the IC 50 value. This experiment was performed independently twice.
[0315] Results
[0316] The inhibitory dose-response curves of eight RTI compounds in two independent experiments are provided in Figure 18A and Figure 18B respectively. The IC 50 values are summarized in Table 10. Surprisingly, two RTI compounds, sesefudine and evofosfavir, had much lower IC 50The value (about 100 nM), thus showing unexpected mouse L1 inhibitory activity.
[0317] Human LINE-1 retrotransposition assay
[0318] Given their unexpected ability to inhibit mouse L1 activity, the ability of sesofovir and emtricitabine to inhibit human L1 activity was tested. Lamivudine was also tested for comparison.
[0319] The assay for human L1 was performed in a manner very similar to that for mice. pYX017 encoding the human LINE-1 sequence was used 151 instead of pYX016. Since the human construct produced a lower signal, the compounds were incubated with the cells for 72 hours instead of 48 hours, and the cells were seeded at a density of 2000 cells / well instead of 6000 cells / well. In addition, the ratio of transfection reagent to DNA was 2:1 instead of 3.5:1.
[0320] Results
[0321] The inhibitory dose-response curves of the three RTI compounds are provided in Figure 19 A - B and the IC 50 values are summarized in Table 11. Similarly, when compared with lamivudine (IC 50 > 800 nM), sesofovir and emtricitabine showed surprising human L1 inhibitory activity (IC 50 about 100 nM).
[0322] Cell viability assay
[0323] As mentioned above, the toxicity of RTI may impair their ability to stop or block the harmful effects of senescent cells and their ability to prevent or reverse age-related inflammation and diseases. The potential toxicity of lamivudine (3TC); stavudine; emtricitabine; apricitabine; tenofovir disoproxil fumarate; sesofovir; emtricitabine; and tenofovir was evaluated in a cell viability assay at the doses used to generate the L1 inhibitory dose-response curves.
[0324] HeLa cells were treated with different concentrations of the eight RTI compounds for 48 hours. Cell viability was measured using a luminescent cell viability assay and expressed as the percentage of cell viability relative to untreated cells. Staurosporine, which is known to induce cell death, was used as a control.
[0325] Results
[0326] As Figure 20 shown, compared with the control staurosporine, the eight RTI compounds did not induce any significant level of cell death.
[0327] In summary, at doses up to 2 μM, in the cell viability assay, both sesofuvir and evofosfavir showed the unexpected ability to inhibit murine and human L1 activity (IC 50 ~100 nM) without inducing toxicity.
[0328] The tables described in the present disclosure are provided below.
[0329] Table 1: List of primers used in PCR analysis
[0330]
[0331]
[0332]
[0333]
[0334] 1 All sequences are listed in the 5'->3' direction. Primer sets 1-30 are specific to the human genes listed; primer sets 31-53 are mouse-specific.
[0335] 2 All LINE-1 positions are relative to the L1Hs consensus sequence (Repbase, http: / / www.girinst.org / repbase / ).
[0336] 3 See Coufal, N.G. et al. L1 retrotransposition in human neural progenitor cells. Nature 460, 1127-31 (2009).
[0337] 4 See Gautier, G. et al. A type I interferon autocrine-paracrine loop is involved in Toll-like receptor-induced interleukin-12p70 secretion by dendritic cells. J. Exp. Med. 201, 1435-46 (2005).
[0338] Table 2: List of antibodies
[0339]
[0340] 1See Rodic, N., et al. Long interspersed element-1 protein expression is a hallmark of many human cancers. Am. J. Pathol. 184, 1280-6 (2014)
[0341] Table 3: List of expressed L1 elements identified by long-range RT-PCR
[0342]
[0343]
[0344]
[0345]
[0346]
[0347] Table 4: List of genes used in GSEA for IFN-I (50 genes)
[0348]
[0349] Table 5: GSEA analysis comparing KEGG pathways of early passage vs. early senescence
[0350]
[0351]
[0352]
[0353] Table 6: Summary of Qiagen PCR array analysis
[0354]
[0355] 1 All percentages are calculated based on the total number of genes found on the array (84). Data for all 84 genes shown in scatter plots are as Figure 2 h shown.
[0356] 2 The sum of up- and down-regulated genes passing a set of significance filters. See Methods for filter definition.
[0357] 3 Genes unique to SEN(L) or 3X cells that pass the significance filter are altered.
[0358] 4Alter the genes that are common to SEN(L) and 3X cells (present in both) passing through the significance filter.
[0359] 5 Alter the genes found in SEN(L) and / or 3X cells passing through the significance filter. The heatmap representation of this set of genes (67) is shown in the extended Figure 4 j, k.
[0360] Table 7
[0361] Age group fold change
[0362]
[0363] t-test
[0364]
[0365] Individual fold change
[0366]
[0367] Table 8: NRTIs Approved as Anti-HIV Therapies
[0368]
[0369] Table 9: Lower Doses (50%) of NRTIs
[0370]
[0371] Table 10: Inhibition of Mouse L1 Activity
[0372]
[0373] IC of the Retrotransposition Activity of Nine Compounds in Inhibiting Mouse LINE-1 Activity in HeLa Cells 50 Determination. The retrotransposition activity was measured using the dual luciferase pYX016 reporter. Cells were treated with different concentrations of each compound and transfected with pYX016 simultaneously. Luminescence was measured 48 hours after transfection. The experiment was conducted independently twice.
[0374] Table 11: Inhibition of Human L1 Activity
[0375]
[0376] IC of the Retrotransposition Activity of Three Compounds in Inhibiting Human LINE-1 Activity in HeLa Cells 50 Determination. The retrotransposition activity was measured using the dual luciferase pYX017 reporter. Cells were treated with different concentrations of each compound and transfected with pYX017 simultaneously. Luminescence was measured 72 hours after transfection. The experiment was conducted independently twice.
[0377] References
[0378] 1 Engel, P. (2014). These Staggering Maps Show How Much The World's Population Is Aging. Business Insider, May 16, 2014.
[0379] 2 Chung H Y, et al., (2009). Molecular inflammation: underpinnings of aging and age-related diseases. Ageing Res. Rev. 8(1):18 - 30
[0380] 3
[0381] 4 Pawelec G, et al., (2014). Inflammation, ageing and chronic disease. Current Opinion in Immunology. 29:23–28.
[0382] 5 Jurk, D. et al., (2014). Chronic inflammation induces telomere dysfunction and accelerates ageing in mice. Nature Communications, Vol 5, Article: 4172.
[0383] 6 Singh, T. & Newman, A. B. (2011). Inflammatory markers in population studies of aging. Ageing Res Rev. 10(3):319–329.
[0384] 7Diagnostic and Statistical Manual of Mental Disorders, Fifth Edition, pp.602 - 614, American Psychiatric Association Publishing, Washington, DC(2013).
[0385] 8 Schorl, C. & Sedivy, J.M. (2007). Analysis of cell cycle phases and progression in cultured mammalian cells. Methods 41, 143 - 50.
[0386] 9 Itahana, K., Campisi, J. & Dimri, G.P. (2007). Methods to detect biomarkers of cellular senescence: the senescence - associated beta - galactosidase assay. Methods Mol. Biol. 371, 21 - 31.
[0387] 10 Herbig, U. et al. (2004). Telomere shortening triggers senescence of human cells through a pathway involving ATM, p53, and p21(CIP1), but not p16(INK4a). Mol. Cell 14, 501 - 513.
[0388] 11 Rangwala, S.H., et al. (2009). Many LINE1 elements contribute to the transcriptome of human somatic cells. Genome Biol 10, R100.
[0389] 12Criscione, S.W., et al. (2014). Transcriptional landscape of repetitive elements in normal and cancer human cells. BMC Genomics 15, 583.
[0390] 13 Athanikar, J.N., et al. (2004). A YY1-binding site is required for accurate human LINE-1 transcription initiation. Nucleic Acids Res. 32, 3846 - 55.
[0391] 14 Xie, Y., et al. (2011). Characterization of L1 retrotransposition with high-throughput dual-luciferase assays. Nucleic Acids Res 39, e16.
[0392] 15 An, W., et al. (2011). Characterization of a synthetic human LINE-1 retrotransposon ORFeus-Hs. Mob DNA 2, 2.
[0393] 16 Schoenmaker, M., et al. (2006). Evidence of genetic enrichment for exceptional survival using a family approach: the Leiden Longevity Study. Eur. J. Hum. Genet. 14, 79 - 84.
[0394] 17Herbig,U.,et al.(2004).Telomere shortening triggers senescence of human cells through a pathway involving ATM,p53,and p21(CIP1),but not p16(INK4a).Mol.Cell 14,501-13.
[0395] 18 See,e.g.,Isselbacher et al.(1996)Harrison’s Principles of Internal Medicine 13 ed.,1814-1882.
[0396] 19 De Cecco,M.,et al.(2013).Genomes of replicatively senescent cells undergo global epigenetic changes leading to gene silencing and activation of transposable elements.Aging Cell 12,247-256.
[0397] 20 De Cecco,M.,et al.(2013).Transposable elements become active and mobile in the genomes of aging mammalian somatic tissues.Aging(Albany NY).
[0398] 21 Li,Q.,et al.(2013)FOXA1 mediates p16(INK4a)activation during cellular senescence.EMBO J 32,858-873.
[0399] 22Sun, X., et al. (2018). Transcription factor profiling reveals molecular choreography and key regulators of human retrotransposon expression. Proc Natl Acad Sci U S A 115, E5526 - E5535.
[0400] 23 Montoya - Durango, D. E., et al. (2009). Epigenetic control of mammalian LINE - 1 retrotransposon by retinoblastoma proteins. Mutat Res 665, 20 - 28.
[0401] 24 Stetson, D. B., et al. (2008). Trex1 prevents cell - intrinsic initiation of autoimmunity. Cell 134, 587 - 598.
[0402] 25 West, A. P., et al. (2015). Mitochondrial DNA stress primes the antiviral innate immune response. Nature 520, 553 - 557.
[0403] 26 Ivanov, A., et al. (2013). Lysosome - mediated processing of chromatin in senescence. J Cell Biol 202, 129 - 143.
[0404] 27 Dou, Z., et al. (2017). Cytoplasmic chromatin triggers inflammation in senescence and cancer. Nature 550, 402 - 406.
[0405] 28Takahashi, A., et al. (2018). Downregulation of cytoplasmic DNases is implicated in cytoplasmic DNA accumulation and SASP in senescent cells. Nat Commun 9, 1249.
[0406] 29 Stetson, D. B., et al. (2008). Trex1 prevents cell-intrinsic initiation of autoimmunity. Cell 134, 587-598.
[0407] 30 Thomas, C. A., et al. (2017). Modeling of TREX1-dependent autoimmune disease using human stem cells highlights L1 accumulation as a source of neuroinflammation. Cell Stem Cell 21, 319-331e318.
[0408] 31 Dou, Z., et al. (2017). Cytoplasmic chromatin triggers inflammation in senescence and cancer. Nature 550, 402-406.
[0409] 32 Takahashi, A., et al. (2018). Downregulation of cytoplasmic DNases is implicated in cytoplasmic DNA accumulation and SASP in senescent cells. Nat Commun 9, 1249.
[0410] 33Dou, Z., et al. (2017). Cytoplasmic chromatin triggers inflammation insenescence and cancer. Nature 550, 402 - 406.
[0411] 34 Takahashi, A., et al. (2018). Downregulation of cytoplasmic DNases isimplicated in cytoplasmic DNA accumulation and SASP in senescent cells. NatCommun 9, 1249.
[0412] 35 Lopez - Otin, C., et al. (2013). The hallmarks of aging. Cell 153, 1194 - 1217.
[0413] 36 https: / / en.wikipedia.org / wiki / Senotherapy
[0414] 37 Franceschi, C. & Campisi, J. (2014). Chronic inflammation (inflammaging) and its potential contribution to age - associated diseases. J. Gerontol. A Biol. Sci. Med. Sci. 69 Suppl. 1, S4 - 9.
[0415] 38 Lopez - Otin, C. et al. (2013). The hallmarks of aging. Cell 153, 1194 - 217.
[0416] 39Safrin, S., (2012). Antiviral Agents (Chapter 49). In: Basic and Clinical Pharmacology. 12e. Katzung BG, Masters SB, Trevor AJ (Editors). McGraw-Hill / Lange. (Access-Medicine).
[0417] 40 Lopez-Otin, C., et al. (2013). The hallmarks of aging. Cell 153, 1194 - 1217.
[0418] 41 Bussian, T. J., et al. (2018). Clearance of senescent glial cells prevents tau-dependent pathology and cognitive decline. Nature 562, 578 - 582.
[0419] 42 Childs, B. G., et al. (2016). Senescent intimal foam cells are deleterious at all stages of atherosclerosis. Science 354, 472 - 477.
[0420] 43 Baker, D. J., et al. (2016). Naturally occurring p16(Ink4a)-positive cells shorten healthy lifespan. Nature 530, 184 - 189.
[0421] 44 Demaria, M., et al. (2017). Cellular Senescence Promotes Adverse Effects of Chemotherapy and Cancer Relapse. Cancer Discov 7, 165 - 176.
[0422] 45Chang, J., et al. (2016). Clearance of senescent cells by ABT263 rejuvenates aged hematopoietic stem cells in mice. Nat Med 22, 78 - 83.
[0423] 46 Schafer, M. J., et al. (2017). Cellular senescence mediates fibrotic pulmonary disease. Nat Commun 8, 14532.
[0424] 47 Farr, J. N., et al. (2017). Targeting cellular senescence prevents age - related bone loss in mice. Nat Med 23, 1072 - 1079.
[0425] 48 Chinta, S. J., et al. (2018). Cellular Senescence Is Induced by the Environmental Neurotoxin Paraquat and Contributes to Neuropathology Linked to Parkinson's Disease. Cell Rep 22, 930 - 940.
[0426] 49 Xu, M., et al. (2018). Senolytics improve physical function and increase lifespan in old age. Nat Med 24, 1246 - 1256.
[0427] 50 Schafer, M. J., et al. (2017). Cellular senescence mediates fibrotic pulmonary disease. Nat Commun 8, 14532.
[0428] 51Demaria, M., et al. (2014). An essential role for senescent cells in optimal wound healing through secretion of PDGF-AA. Dev Cell 31, 722-733.
[0429] 52 See, U.S. Published Patent Application 2018 / 0050000.
[0430] 53 See, U.S. Published Patent Application 2018 / 0050000.
[0431] 54 Caira M., et al. (2004). Preparation and crystal characterization of a polymorph, a monohydrate, and an ethyl acetate solvate of the antifungal fluconazole. J. Pharmaceut. Sci., 93(3):601-611.
[0432] 55 Van Tonder E.C., et al. (2004). Preparation and Physicochemical Characterization of 5 Niclosamide Solvates and 1 Hemisolvate. AAPS Pharm. Sci. Tech., 5(1):Article 12.
[0433] 56 Bingham A.L., et al. (2001). Over one hundred solvates of sulfathiazole: solvates and adducts of sulfathiazole. Chem. Commun. 7:603-604.
[0434] 57Remington's Pharmaceutical Sciences,Mack Publishing Co.,Easton,PA,19th ed.1995.
[0435] 58 Brown,J.P.,et al.,(1997).Bypass of senescence after disruption ofp21CIP1 / WAF1 gene in normal diploid human fibroblasts.Science 277,831-834.
[0436] 59 Herbig,U.et al.,(2004).Telomere shortening triggers senescence ofhuman cells through a pathway involving ATM,p53,and p21(CIP1),but not p16(INK4a).Mol.Cell 14,501-513.
[0437] 60 Fumagalli,M.,et al.,(2014).Stable cellular senescence is associatedwith persistent DDR activation.PLoS One 9,e110969.
[0438] 61 www.nia.nih.gov / research / dab / aged-rodent-colonies-handbook
[0439] 62 Else,L.J.et al.(2012).Pharmacokinetics of lamivudine andlamivudine-triphosphate after administration of 300 milligrams and 150milligrams once daily to healthy volunteers:results of the ENCORE 2study.Antimicrob.Agents Chemother.56,1427-1433.
[0440] 63 Le, O.N. et al. (2010). Ionizing radiation-induced long-term expression of senescence markers in mice is independent of p53 and immune status. Aging Cell 9, 398-409.
[0441] 64 Coufal, N.G. et al. (2009). L1 retrotransposition in human neural progenitor cells. Nature 460, 1127-1131.
[0442] 65 http: / / www.girinst.org / repbase / update / browse.php
[0443] 66 http: / / www.ebi.ac.uk / Tools / msa / clustalo /
[0444] 67 Li, W. et al. (2015). The EMBL-EBI bioinformatics web and programmatic tools framework. Nucleic Acids Res. 43, W580-584.
[0445] 68 http: / / www.ncbi.nlm.nih.gov / primer-blast /
[0446] 69 Ye, J. et al. (2012). Primer-BLAST: a tool to design target-specific primers for polymerase chain reaction. BMC Bioinf. 13, 134.
[0447] 70 https: / / genome.ucsc.edu / cgi-bin / hgPcr
[0448] 71 Gautier, G., et al. (2005). A type I interferon autocrine - paracrine loop is involved in Toll - like receptor - induced interleukin - 12p70 secretion by dendritic cells. J. Exp. Med. 201, 1435 - 1446.
[0449] 72 Coufal, N. G., et al. (2009). L1 retrotransposition in human neural progenitor cells. Nature 460, 1127 - 1131.
[0450] 73 Kim, D., et al. (2015). HISAT: a fast spliced aligner with low memory requirements. Nat Methods 12, 357 - 360.
[0451] 74 Liao, Y., et al. (2014). featureCounts: an efficient general purpose program for assigning sequence reads to genomic features. Bioinformatics 30, 923 - 930.
[0452] 75 Robinson, M. D., et al. (2010). edgeR: a Bioconductor package for differential expression analysis of digital gene expression data. Bioinformatics 26, 139 - 140.
[0453] 76 Reich, M. et al. (2006). GenePattern 2.0. Nat Genet 38, 500 - 501.
[0454] 77Subramanian,A.et al.(2005).Gene set enrichment analysis:aknowledge-based approach for interpreting genome-wide expressionprofiles.Proc Natl Acad Sci U S A 102,15545-15550.
[0455] 78 Benjamini,Y.&Hochberg,Y.(1995).Controlling the false discoveryrate:a practical and powerful approach to multiple testing.J Roy Stat Soc B57,289-300.
[0456] 79 http: / / www.broadinstitute.org / cancer / software / GENE-E
[0457] 80 Langmead,B.(2010).Aligning short sequencing reads with Bowtie.Curr.Protoc.Bioinformatics Chapter 11,Unit 11.7.
[0458] 81 Alexandrova,E.A.et al.(2012).Sense transcripts originated from aninternal part of the human retrotransposon LINE-1 5'UTR.Gene 511,46-53.
[0459] 82 Olovnikov,I.A.et al.(2007).A key role of the internal region of the5'-untranslated region in the human L1 retrotransposon transcriptionactivity.Mol.Biol.(Mosk)41,508-514.
[0460] 83 Alexandrova, E.A. et al. (2012). Sense transcripts originated from an internal part of the human retrotransposon LINE-1 5'UTR. Gene 511, 46-53.
[0461] 84 https: / / www.addgene.org / tools / protocols / plko /
[0462] 85 http: / / www.broad.mit.edu / genome_bio / trc / rnai.html
[0463] 86 Michaud, K. et al. (2010). Pharmacologic inhibition of cyclin-dependent kinases 4 and 6 arrests the growth of glioblastoma multiforme intracranial xenografts. Cancer Res. 70, 3228-3238.
[0464] 87 http: / / www.orfeomecollaboration.org /
[0465] 88 https: / / dnasu.org / DNASU / Home.do
[0466] 89 Xie, Y. et al. (2011). Characterization of L1 retrotransposition with high-throughput dual-luciferase assays. Nucleic Acids Res 39, e16.
[0467] 90An, W., et al. (2011). Characterization of a synthetic human LINE-1 retrotransposon ORFeus-Hs. Mob DNA 2, 2.
[0468] 91 Penzkofer, T., et al. (2005). L1 Base: from functional annotation to prediction of active LINE-1 elements. Nucleic Acids Res 33, D498-500.
[0469] 92 http: / / www.girinst.org / repbase / update / browse.php
[0470] 93 Criscione, S.W., et al. (2014). Transcriptional landscape of repetitive elements in normal and cancer human cells. BMC Genomics 15, 583.
[0471] 94 Childs, B.G., et al. (2015). Cellular senescence in aging and age-related disease: from mechanisms to therapy. Nat. Med. 21, 1424-1435.
[0472] 95 Katoh, K. & Standley, D.M. (2013). MAFFT multiple sequence alignment software version 7: improvements in performance and usability. Mol Biol Evol 30, 772-780.
[0473] 96Waterhouse, A.M. et al. (2009). Jalview Version 2--a multiple sequence alignment editor and analysis workbench. Bioinformatics 25, 1189-1191.
[0474] 97 http: / / genome-engineering.org / gecko / ?page_id=15
[0475] 98 Sanjana, N.E., et al. (2014). Improved vectors and genome-wide libraries for CRISPR screening. Nat. Methods 11, 783-784.
[0476] 99 http: / / genome-engineering.org / gecko / wp-content / uploads / 2013 / 12 / lentiCRISPRv2-and-lenti Guide-oligo-cloning-protocol.pdf
[0477] 100 Shalem, O. et al. (2014). Genome-scale CRISPR-Cas9 knockout screening in human cells. Science 343, 84-87.
[0478] 101 https: / / dnacore.mgh.harvard.edu /
[0479] 102 Kreiling, J.A. et al. (2011). Age-associated increase in heterochromatic marks in murine and primate tissues. Aging Cell 10, 292-304.
[0480] 103Thomas, C. A. et al. (2017). Modeling of TREX1-dependent autoimmune disease using human stem cells highlights L1 accumulation as a source of neuroinflammation. Cell Stem Cell 21, 319 - 331 e8.
[0481] 104 Kreiling, J. A. et al. (2011). Age-associated increase in heterochromatic marks in murine and primate tissues. Aging Cell 10, 292 - 304.
[0482] 105 http: / / www.qiagen.com / us / shop / genes-and-pathways / data-analysis-center-overview-page /
[0483] 106 Schoenmaker, M. et al. (2006). Evidence of genetic enrichment for exceptional survival using a family approach: the Leiden Longevity Study. Eur. J. Hum. Genet. 14, 79 - 84.
[0484] 107 Waaijer, M. E. et al. (2012). The number of p16INK4a positive cells in human skin reflects biological age. Aging Cell 11, 722 - 725.
[0485] 108Kamentsky, L., et al. (2011). Improved structure, function and compatibility for CellProfiler: modular high-throughput image analysis software. Bioinformatics 27, 1179-1180.
[0486] 109 http: / / rsbweb.nih.gov / ij /
[0487] 110 Martinez-Santibanez, G., et al. (2014). Imaging white adipose tissue with confocal microscopy. Methods Enzymol 537, 17-30.
[0488] 111 Itahana, K., Campisi, J. & Dimri, G. P. Methods to detect biomarkers of cellular senescence: the senescence-associated beta-galactosidase assay. Methods Mol. Biol. 371, 21-31(2007).
[0489] 112 Baker, D. J., et al. (2016). Naturally occurring p16(Ink4a)-positive cells shorten healthy lifespan. Nature 530, 184-189.
[0490] 113 Baker, D. J., et al. (2011). Clearance of p16Ink4a-positive senescent cells delays ageing-associated disorders. Nature 479, 232-236.
[0491] 114Huang, C.R., et al. (2012). Active transposition in genomes. Annu. Rev. Genet. 46, 651 - 675.
[0492] 115 de Koning, A.P., et al. (2011). Repetitive elements may comprise over two - thirds of the human genome. PLoS Genet. 7, e1002384.
[0493] 116 Hancks, D.C. & Kazazian Jr, H.H. (2012). Active human retrotransposons: variation and disease. Curr. Opin. Genet. Dev. 22, 191 - 203.
[0494] 117 Rodic, N., et al. (2014). Long interspersed element - 1 protein expression is a hallmark of many human cancers. Am. J. Pathol. 184, 1280 - 1286.
[0495] 118 Erwin, J.A., et al. (2014). Mobile DNA elements in the generation of diversity and complexity in the brain. Nat. Rev. Neurosci. 15, 497 - 506.
[0496] 119 De Cecco, M., et al. (2013). Genomes of replicatively senescent cells undergo global epigenetic changes leading to gene silencing and activation of transposable elements. Aging Cell 12, 247 - 256.
[0497] 120Van Meter, M., et al. (2014). SIRT6 represses LINE1 retrotransposons by ribosylating KAP1 but this repression fails with stress and age. Nat Commun 5, 5011.
[0498] 121 Kreiling, J.A., et al. Contribution of retrotransposable elements to aging. in Human Retrotransposons in Health and Disease (ed. Cristofari, G.) 297 - 321 (Springer International, 2017).
[0499] 122 The same as above
[0500] 123 Volkman, H.E. & Stetson, D.B. (2014). The enemy within: endogenous retroelements and autoimmune disease. Nat. Immunol. 15, 415 - 422.
[0501] 124 Salama, R., et al. (2014). Cellular senescence and its effector programs. Genes Dev 28, 99 - 114.
[0502] 125 Thomas, C.A., et al. (2017). Modeling of TREX1 - dependent autoimmune disease using human stem cells highlights L1 accumulation as a source of neuroinflammation. Cell Stem Cell 21, 319 - 331e8.
[0503] 126Ishak, C.A. et al. (2016). An RB-EZH2 complex mediates silencing of repetitive DNA sequences. Mol Cell 64, 1074-1087.
[0504] 127 Li, Q., et al. (2013). FOXA1 mediates p16(INK4a) activation during cellular senescence. EMBO J. 32, 858-873.
[0505] 128 Denli, A.M., et al. (2015). Primate-specific ORF0 contributes to retrotransposon-mediated diversity. Cell 163, 583-593.
[0506] 129 Dai, L., et al. (2011). Effect of reverse transcriptase inhibitors on LINE-1 and Ty1 reverse transcriptase activities and on LINE-1 retrotransposition. BMC Biochem. 12, 18.
[0507] 130 Thomas, C.A., et al. (2017). Modeling of TREX1-dependent autoimmune disease using human stem cells highlights L1 accumulation as a source of neuroinflammation. Cell Stem Cell 21, 319-331 e8.
[0508] 131De Cecco, M., et al. (2013). Genomes of replicatively senescent cells undergo global epigenetic changes leading to gene silencing and activation of transposable elements. Aging Cell 12, 247-256.
[0509] 132 Coufal, N.G., et al. (2009). L1 retrotransposition in human neural progenitor cells. Nature 460, 1127-1131.
[0510] 133 Dhanwani, R., et al. (2017). Cytosolic sensing of immuno-stimulatory DNA, the enemy within. Curr Opin Immunol 50, 82-87.
[0511] 134 Fowler, B.J., et al. (2014). Nucleoside reverse transcriptase inhibitors possess intrinsic anti-inflammatory activity. Science 346, 1000-1003.
[0512] 135 Rodic, N., et al. (2014). Long interspersed element-1 protein expression is a hallmark of many human cancers. Am. J. Pathol. 184, 1280-1286.
[0513] 136 Herbig, U., et al. (2006). Cellular senescence in aging primates. Science 311, 1257.
[0514] 137Coppe, J.P., et al. (2010). The senescence-associated secretory phenotype: the dark side of tumor suppression. Annu. Rev. Pathol. 5, 99-118.
[0515] 138 Chang, J., et al. (2016). Clearance of senescent cells by ABT263 rejuvenates aged hematopoietic stem cells in mice. Nat Med 22, 78-83.
[0516] 139 Zhu, Y., et al. The Achilles' heel of senescent cells: from transcriptome to senolytic drugs. Aging Cell 14, 644-58(2015).
[0517] 140 Tchkonia, T., et al. (2010). Fat tissue, aging, and cellular senescence. Aging Cell 9, 667-684.
[0518] 141 Mattson, M.P. (2010). Perspective: Does brown fat protect against diseases of aging?Ageing Res Rev 9, 69-76.
[0519] 142 Tchkonia, T., et al. (2010). Fat tissue, aging, and cellular senescence. Aging Cell 9, 667-684.
[0520] 143Frasca, D. & Blomberg, B. B. (2016). Inflammaging decreases adaptive and innate immune responses in mice and humans. Biogerontology 17, 7 - 19.
[0521] 144 Baker, D. J., et al. (2016). Naturally occurring p16(Ink4a)-positive cells shorten healthy lifespan. Nature 530, 184 - 189.
[0522] 145 Baker, D. J., et al. (2011). Clearance of p16Ink4a-positive senescent cells delays ageing-associated disorders. Nature 479, 232 - 236.
[0523] 146 West, A. P. & Shadel, G. S. (2017). Mitochondrial DNA in innate immune responses and inflammatory pathology. Nat Rev Immunol 17, 363 - 375.
[0524] 147 Dou, Z., et al. (2017). Cytoplasmic chromatin triggers inflammation in senescence and cancer. Nature 550, 402 - 406.
[0525] 148 Takahashi, A., et al. (2018). Downregulation of cytoplasmic DNases is implicated in cytoplasmic DNA accumulation and SASP in senescent cells. Nat Commun 9, 1249.
[0526] 149Franceschi, C., & Campisi, J. (2014). Chronic inflammation (inflammaging) and its potential contribution to age-associated diseases. J. Gerontol. A Biol. Sci. Med. Sci. 69 Suppl 1, S4-9.
[0527] 150 Lopez-Otin, C., et al. (2013). The hallmarks of aging. Cell 153, 1194-1217.
[0528] 151 Xie Y., Rosser J. M., Thompson T. L., Boeke J. D. (2011). AnW. Characterization of L1 retrotransposition with high-throughput dual-luciferase assays. Nucleic Acids Res. 39:e16.
[0529] All patents, patent applications, and publications cited herein are hereby incorporated by reference in their entirety.
[0530] It should be understood that the detailed description section, rather than the overview and abstract sections, is intended to be used to interpret the claims. The overview and abstract sections may set forth one or more but not all exemplary embodiments of the invention as contemplated by the inventors, and thus are not intended to limit the invention and the appended claims in any way.
[0531] The foregoing description of the specific embodiments will so fully reveal the general nature of the invention that others can, by applying knowledge within the skill of the art, readily modify and / or adapt various applications of such specific embodiments, without undue experimentation and without departing from the general concept of the invention. Therefore, such modifications and adaptations are intended to be within the meaning and range of equivalents of the disclosed embodiments based on the teachings and guidance presented herein. It should be understood that the terminology or phraseology herein is for the purpose of description and not of limitation, such that the terminology or phraseology of the present specification will be interpreted by those skilled in the art in light of the teachings and guidance.
[0532] The breadth and scope of the present invention should not be limited by any of the above-described exemplary embodiments, but should be defined only in accordance with the following claims and their equivalents.
Claims
1. Use of a reverse transcriptase inhibitor (RTI) in the preparation of a medicament for treating, preventing and / or reversing Alzheimer's disease, amyotrophic lateral sclerosis (ALS), Parkinson's disease, Huntington's disease, cardiovascular dysfunction, frontotemporal dementia (FTD), multiple sclerosis (MS), Aicardi Goutiere syndrome, progressive supranuclear palsy (PSP), osteoarthritis, atherosclerosis, osteoporosis or pulmonary fibrosis in a patient in need thereof, wherein the reverse transcriptase inhibitor (RTI) is sesofudine or elsulfavirine.
2. The use according to claim 1, wherein the medicament is for treating Alzheimer's disease.
3. The use according to claim 1, wherein the medicament is for treating amyotrophic lateral sclerosis (ALS).
4. The use according to claim 1, wherein the medicament is for treating Parkinson's disease.
5. The use according to claim 1, wherein the medicament is for treating frontotemporal dementia (FTD).
6. The use according to claim 1, wherein the medicament is for treating multiple sclerosis (MS).
7. The use according to claim 1, wherein the medicament is for treating Aicardi Goutiere syndrome.
8. The use according to claim 1, wherein the medicament is for treating progressive supranuclear palsy (PSP).
9. The use according to claim 1, wherein the patient has Alzheimer's disease or amyotrophic lateral sclerosis (ALS) and experiences a reduction in one or more symptoms of Alzheimer's disease or amyotrophic lateral sclerosis (ALS) compared to before administration of the reverse transcriptase inhibitor (RTI) to the patient; and wherein the one or more symptoms include memory loss, misplacing objects, forgetting the names of places or objects, repeating questions, lack of flexibility, confusion, disorientation, obsessive behavior, compulsive behavior, delusions, aphasia, sleep disorders, mood swings, depression, anxiety, apathy, agitation, difficulty performing spatial tasks, agnosia, difficulty walking, weight loss, loss of language ability, short-term memory loss or long-term memory loss; and wherein the reduction in the one or more symptoms is evaluated according to the Diagnostic and Statistical Manual of Mental Disorders, 5th Edition (DSM-5); or wherein the reduction in symptoms is determined using the cognitive subscale of the Alzheimer's Disease Assessment Scale (ADAS-cog); or wherein the reduction in symptoms is determined using the Clinician's Interview-Based Impression of Change Plus (CIBIC-plus); or wherein the reduction in symptoms is determined using the Activities of Daily Living Scale (ADL).
10. The use according to claim 1, wherein the treating, preventing and / or reversing further comprises administering to the patient at least one second therapeutic agent.
11. The use according to claim 10, wherein the patient has Alzheimer's disease and the at least one second therapeutic agent is for treating the symptoms of Alzheimer's disease.
12. The use according to claim 10, wherein the patient has amyotrophic lateral sclerosis (ALS) and the at least one second therapeutic agent is for treating amyotrophic lateral sclerosis (ALS).
13. Use according to any one of claims 1 - 12, wherein the reverse transcriptase inhibitor (RTI) is sesofudine.
Citation Information
Patent Citations
Methane-sulfonamide derivatives, the preparation thereof and composition comprising the same
US4172896A
Pharmaceutical composition containing bupropion hydrochloride and a stabilizer
US5358970A
Controlled sustained release tablets containing bupropion
US5427798A
Stabilized Pharmaceutical
US5541231A
Stabilized pharmaceutical composition containing bupropion
US5731000A