Method for producing knock-in cells
Through the repair mechanism of site-specific nuclease system binding non-homologous terminal binding and homologous recombination, the problem of low or poor insertion efficiency or poor accuracy of long-chain donor DNA in the prior art is solved, achieving efficient and accurate genome editing.
Patent Information
- Application Number
- CN202080025993.1
- Authority / Receiving Office
- CN · China
- Patent Type
- Patents(China)
- Current Assignee / Owner
- Priority Date
- 2019-04-05
- Filing Date
- 2020-04-03
- Publication Date
- 2025-07-11
- Estimated Expiration
- 2040-04-03
AI Technical Summary
Existing genome editing techniques are difficult to efficiently and correctly insert long-chain donor DNA sequences, especially donor sequences of hundreds to tens of thousands of bases, in mammalian cells and fertilized eggs. The existing methods have problems of inefficiency or poor accuracy.
The site-specific nuclease system is used to combine the repair mechanism of non-homologous terminal binding and homologous recombination, and cleavage is achieved by targeting the homologous arm sequence of donor DNA and specific regions of genomic DNA to achieve efficient insertion of long-chain donor sequences.
The efficient and correct insertion of long-chain donor sequences on genomic DNA is achieved, improving the efficiency and accuracy of genome editing, especially for donor sequences above thousands of bases.
Smart Images

Figure CN113646429B_ABST
Abstract
Description
Technical Field
[0001] The present invention relates to a method for producing knock-in cells or knock-in organisms using a site-specific nuclease system and donor DNA, and a kit or composition for the method. Background Art
[0002] Genome editing techniques such as zinc finger nuclease (ZFN), transcription activator-like effector nuclease (TALEN), and CRISPR-Cas9 are techniques that specifically cleave genomic DNA sequences in animal and plant cells and then freely rewrite any sequence using the intrinsic repair mechanism. Their applications have been rapidly extended not only to bioscience research but also to variety improvement of crops / livestock, regenerative medicine, genome editing therapy, and the like.
[0003] If CRISPR / Cas9 (Non-Patent Document 1) is introduced into mouse fertilized eggs, the guide RNA binds to the target DNA sequence, and Cas9 complexed with the guide RNA cleaves the target DNA double strand. Then, a DNA repair mechanism called non-homologous end joining (NHEJ) acts at the cleavage site. Gene mutations are introduced into the genomic DNA of mouse fertilized eggs via this DNA repair mechanism, and thus knockout mice can be produced. On the other hand, if donor DNA having a sequence homologous to genomic DNA is introduced into mouse fertilized eggs together with CRISPR / Cas9, knock-in mice having a recombined gene can be produced via homologous recombination (HR).
[0004] In 2013, knockout mice and knock-in mice produced using CRISPR / Cas9 were reported (Non-Patent Documents 2 and 3). At present, gene knockout can be carried out very efficiently, but the efficiency of knock-in in cells and fertilized eggs is still low.
[0005] In recent years, various methods other than knock-in using homologous recombination with existing double-stranded DNA donor vectors have been developed. For example, it has been reported that by injecting single-stranded oligonucleotide donor DNA (ssODN) together with CRISPR / Cas9 into cells or fertilized eggs, a donor sequence of 1 to dozens of bases can be effectively knocked in (Non-Patent Documents 4 and 5). In addition, the present inventors have developed a method, the 2-Hit 2-Oligo (2H2OP) method, capable of knocking in plasmids of several thousand bases and BAC vectors of 200,000 bases by cutting a target DNA sequence and a donor vector with Cas9 and binding two ssODNs to the cutting positions (Non-Patent Document 6). Furthermore, the Easi-CRISPR method using long single-stranded donor DNA (Non-Patent Document 7) and the CLICK method combining long single-stranded donor DNA and electroporation method (Non-Patent Document 8) have been reported for producing conditional mice and GFP reporter knock-in mice. In addition, as methods for knock-in using double-stranded donor DNA, a cloning-free method using Cas9 protein and two molecules of guide RNA (Non-Patent Document 9), the PITCH method using the MMEJ repair mechanism mediated by microhomology (Non-Patent Document 10), the HITI method for knock-in non-homologous end-joining dependently (Non-Patent Document 11), the HMEJ method for knock-in homologous sequence dependently (Non-Patent Document 12), or the Tild-CRISPR method (Non-Patent Document 13), etc. have been reported.
[0006] It has been reported that these methods can efficiently knock in DNA of several thousand bases in cells, but sometimes the efficiency is low in fertilized eggs of animals and the knock-in cannot be correctly performed. This is because, in mammalian cells and fertilized eggs, non-homologous end joining predominantly functions during double-stranded DNA cleavage repair, and repair using homologous recombination occurs only rarely.
[0007] Prior Art Documents
[0008] Non-Patent Documents
[0009] Non-Patent Document 1: Jinek M, et al., Science. 337(6096):816 - 21(2012)
[0010] Non-Patent Document 2: Yang H, et al., Cell. 154(6):1370 - 9(2013)
[0011] Non-Patent Document 3: Wang H, et al., Cell. 153(4):910 - 8(2013)
[0012] Non-Patent Document 4: Sander JD, et al., Nat Biotechnol. 32(4):347 - 55(2014)
[0013] Non-Patent Document 5: Yoshimi K, et al., Nat Commun. 5:4240(2014)
[0014] Non-Patent Document 6: Yoshimi K, et al., Nat Commun. 7:10431(2016)
[0015] Non-Patent Document 7: Quadros RM, et al., Genome Biol. 18(1):92(2017)
[0016] Non-Patent Document 8: Miyasaka Y, et al., BMC Genomics. 19(1):318(2016)
[0017] Non-Patent Document 9: Aida T, et al., Genome Biol. 16:87(2015)
[0018] Non-Patent Document 10: Sakuma T, et al., Nat Protoc. 11(1):118 - 33(2016)
[0019] Non-Patent Document 11: Suzuki K, et al., Nature. 540(7631):144 - 9(2016)
[0020] Non-Patent Document 12: Yao X, et al., Cell Res. 27(6):801 - 14(2017)
[0021] Non-Patent Document 13: Yao X, et al., Dev Cell. 45(4):526 - 36(2018) Summary of the Invention
[0022] Problems to be Solved by the Invention
[0023] The present invention has been made in view of such circumstances, and its object is to provide a genome editing method capable of inserting a long-chain donor DNA into a genome with higher efficiency and accuracy than existing methods. A further object of the present invention is to provide a kit and a composition for the genome editing method.
[0024] Means for Solving the Problems
[0025] The present inventors conducted intensive studies to solve the above problems, and as a result, found that by using a site-specific nuclease system, it is possible to induce repair using both non-homologous end joining and homologous recombination between genomic DNA and donor DNA, and to produce cells and organisms into which a long donor sequence has been knocked in with high efficiency and accuracy, thereby completing the present invention. The site-specific nuclease system includes: a combination of a molecule that simultaneously targets and cleaves a homologous arm sequence on one side of the donor DNA and the genomic sequence corresponding to the homologous arm sequence, and a molecule that targets and cleaves a genomic region near the cleavage site of the molecule.
[0026] The present invention more specifically provides the following aspects.
[0027] [1] A method for producing a cell or non-human organism into which a donor sequence has been inserted into a genomic editing target region on genomic DNA, the method including the step of introducing a site-specific nuclease system and donor DNA into the cell or non-human organism,
[0028] The donor DNA is a DNA containing a base sequence in which a 5'-side homologous arm sequence, a donor sequence, and a 3'-side homologous arm sequence are arranged in order from the 5'-side,
[0029] The site-specific nuclease system is a system that targets and cleaves the sequences of (i) to (iii) in the following Group A or Group B. The sequences of (i) and (ii) in Group A or Group B are targeted by the same molecule constituting the site-specific nuclease system, and the sequence of (iii) is targeted by another molecule constituting the site-specific nuclease system.
[0030] Group A:
[0031] (i) The 5'-side homologous arm sequence
[0032] (ii) The corresponding sequence of the sequence of (i) in the genomic editing target region
[0033] (iii) The sequence on the 3'-side downstream of the cleavage site of the sequence of (ii) in the genomic editing target region by the site-specific nuclease system
[0034] Group B:
[0035] (i) The 3'-side homologous arm sequence
[0036] (ii) The corresponding sequence of the sequence of (i) in the genomic editing target region
[0037] (iii) The sequence on the 5'-side upstream of the cleavage site of the sequence of (ii) in the genomic editing target region by the site-specific nuclease system
[0038] [2] According to the method described in [1], the site-specific nuclease system is a CRISPR / Cas system that is a combination of a guide RNA targeting the sequences of (i) and (ii) of Group A or B and a guide RNA targeting the sequence of (iii).
[0039] [3] A kit or composition for producing a cell or organism in which a donor sequence is inserted into a genomic editing target region on genomic DNA, the kit or composition comprising a site-specific nuclease system and a donor DNA,
[0040] The donor DNA is a DNA comprising a base sequence in which a 5'-side homologous arm sequence, a donor sequence, and a 3'-side homologous arm sequence are arranged in sequence from the 5'-side.
[0041] The site-specific nuclease system is a system that targets the sequences of (i) to (iii) of the following Group A or B for cleavage, the sequences of (i) and (ii) of Group A or B are targeted by the same molecule constituting the site-specific nuclease system, and the sequence of (iii) is targeted by another molecule constituting the site-specific nuclease system.
[0042] Group A:
[0043] (i) The 5'-side homologous arm sequence
[0044] (ii) The corresponding sequence of the sequence of (i) in the genomic editing target region
[0045] (iii) The sequence downstream of the 3'-side of the cleavage site of the sequence of (ii) by the site-specific nuclease system in the genomic editing target region
[0046] Group B:
[0047] (i) The 3'-side homologous arm sequence
[0048] (ii) The corresponding sequence of the sequence of (i) in the genomic editing target region
[0049] (iii) The sequence upstream of the 5'-side of the cleavage site of the sequence of (ii) by the site-specific nuclease system in the genomic editing target region
[0050] [4] According to the kit or composition described in [3], the site-specific nuclease system is a CRISPR / Cas system that is a combination of a guide RNA targeting the sequences of (i) and (ii) of Group A or B and a guide RNA targeting the sequence of (iii).
[0051] Effects of the Invention
[0052] In the existing methods, by using single-stranded oligomeric donor DNA (ssODN), a donor sequence with a length of one to several tens of bases can be inserted into the genome. Additionally, if long single-stranded donor DNA is used, a donor sequence with a length of several tens to several hundreds of bases can be inserted into the genome. However, it is difficult to effectively insert a donor sequence with a length of several hundreds to tens of thousands of bases into the genome by these methods. The longer the single-stranded donor DNA is, the lower the efficiency and accuracy of knock-in become. On the other hand, regarding knock-in using homologous recombination with an existing double-stranded DNA donor vector, although the accuracy is high, the knock-in efficiency is low. The PITCH method, HITI method, and HMEJ method basically rely on non-homologous end joining, thus resulting in random integration, multiple copies, deletion mutations, etc., and the accuracy is reduced.
[0053] By the epoch-making idea of combining the repair using non-homologous end joining with high efficiency and the repair using homologous recombination with low efficiency but high accuracy, the present invention can insert a donor sequence into the genome with higher efficiency and accuracy than the existing methods.
[0054] For site-specific recombination systems (Cre-loxP system, CreERT2-loxP system, FLP-FRT system), various genes linked to promoters, etc., most of the donor sequences with the highest necessity for knock-in at present are more than two thousand bases in length. According to the present invention, even if the donor sequence is a long chain, high efficiency and accuracy can be shown. BRIEF DESCRIPTION OF THE DRAWINGS
[0055] Figure 1 is a diagram showing the principle of the genome editing system of the present invention that utilizes combined repair of non-homologous end joining and homologous recombination.
[0056] Figure 2A is a diagram showing the production of Kcnab1-ERT2-iCreERT2 mice using the method of the present invention.
[0057] Figure 2B is showing the Figure 2A photograph of the result of genotyping of the genomic editing target region in F1 mice obtained by mating F0 mice produced by the method.
[0058] Figure 3A is a diagram showing the production of Ctgf-ERT2-iCreERT2 mice using the method of the present invention.
[0059] Figure 3B is showing the Figure 3A photograph of the result of genotyping of the genomic editing target region in F1 mice obtained by mating F0 mice produced by the method.
[0060] Figure 4AThis is a figure showing the production of Tp53-CAG-CFP rats using the method of the present invention.
[0061] Figure 4B This is a photograph showing the Figure 4A results of genotyping of the genomic editing target region in F0 rats produced by the method of.
[0062] Figure 4C This is a photograph showing the results of detecting the expression of fluorescent protein (CFP) in F0 rats produced by the method of Figure 4A . Detailed implementation mode
[0063] The present invention provides a method for producing a cell or non-human organism into which a donor DNA has been inserted in a genomic editing target region on genomic DNA.
[0064] In the present invention, the so-called "genomic editing target region" refers to the genomic region corresponding to the 5' homologous arm of the donor DNA (hereinafter referred to as the "5' homologous arm corresponding genomic region") and the genomic region corresponding to the 3' homologous arm of the donor DNA (hereinafter referred to as the "3' homologous arm corresponding genomic region"), and the intermediate region sandwiched between these genomic regions (hereinafter referred to as the "genomic intermediate region") (for example, refer to Figure 4A ). When the 5' homologous arm and the 3' homologous arm of the donor DNA are set for two consecutive regions on the genomic DNA, there is no genomic intermediate region (for example, refer to Figure 2A and 3A ). The length of this genomic intermediate region is not particularly limited as long as genomic editing can be carried out using the method of the present invention. For example, it is 30,000 bases or less in length (for example, 10,000 bases or less, 5,000 bases or less, 3,000 bases or less, 1,000 bases or less, 500 bases or less, 300 bases or less, 100 bases or less, 50 bases or less, 30 bases or less, 10 bases or less, 5 bases or less, 3 bases or less). As the genomic editing target region, any region on the genomic DNA held by the cell or organism to be the target of genomic editing can be selected.
[0065] In the method of the present invention, it includes the steps of introducing a site-specific nuclease system and a donor DNA into a cell or non-human organism.
[0066] The "site-specific nuclease system" used in the present invention is not particularly limited as long as it is a system capable of specifically targeting and cleaving any site on genomic DNA. The site-specific nuclease system can be a guide RNA-induced nuclease system or an artificial nuclease system. The guide RNA-induced nuclease system is a system comprising a guide RNA targeting any site on genomic DNA and a protein having nuclease activity, and examples thereof include the CRISPR / Cas system. On the other hand, the artificial nuclease system is a system using a fusion protein comprising a DNA-binding domain and a nuclease domain, and examples thereof include the TALEN system, the ZFN system, and the PPR system.
[0067] In the site-specific nuclease system, since nucleic acid (guide RNA) is used for the recognition of the target DNA sequence, the CRISPR / Cas system is preferred from the viewpoint of being able to more freely select the target DNA sequence and its preparation being simple. Examples of the CRISPR / Cas system include the CRISPR / Cas9 system, the CRISPR / Cpf1 (Cas12a) system, and the CRISPR / Cas3 system.
[0068] The CRISPR / Cas system comprises a Cas component and a guide RNA component. The Cas component can be, for example, in the form of a protein, an mRNA encoding the protein, or a vector expressing the protein. Additionally, its source is arbitrary. The guide RNA component can be, for example, in the form of RNA or a vector expressing the RNA.
[0069] The Cas component and the guide RNA component can be prepared by known techniques (e.g., PCR, restriction enzyme digestion, DNA ligation techniques, in vitro transcription / translation techniques, recombinant protein production techniques, etc.) or can be purchased. The amino acid sequence of the Cas component and its encoding base sequence can be obtained from the literature or public databases (e.g., GenBank; http: / / www.ncbi.nlm.nih.gov).
[0070] In the CRISPR / Cas9 system, the Cas9 protein forms a complex with the guide RNA composed of crRNA and tracrRNA, and this complex targets the target DNA sequence to cleave the target DNA (for example, International Publication No. WO 2014 / 093712, International Publication No. WO 2013 / 176772, International Publication No. WO 2013 / 142578, etc.). The guide RNA can be in the form of a bimolecular structure formed by a crRNA fragment and a tracrRNA fragment, or in the form of a single molecule (sgRNA) in which crRNA and tracrRNA are bound via a spacer sequence. In the CRISPR / Cpf1 system, the Cpf1 protein forms a complex with crRNA, targets the target DNA sequence to cleave the target DNA (for example, International Publication No. WO 2016 / 205711, etc.). In addition, in the CRISPR / Cas3 system, the Cas3 protein and the Cascade protein form a complex with crRNA, target the target DNA sequence to cleave the target DNA (for example, International Publication No. WO 2018 / 225858, etc.).
[0071] In addition, in the present invention, newly emerging CRISPR / Cas systems such as the CRISPR / Cas12b system and the CRISPR / CasX (Cas12e) system can also be used (Strecker J, et al., Nature Communications 10:212 (2019); Liu JJ, et al., Nature 566:218 - 223 (2019)).
[0072] The sequence of the part of the crRNA sequence that binds to the target DNA has, for example, 90% or more, preferably 95% or more, more preferably 98% or more, further preferably 99% or more, and particularly preferably 100% identity with the target DNA sequence. The sequence identity can be calculated using BLAST, etc. (for example, default parameters).
[0073] For the targeting of a target DNA sequence by the CRISPR / Cas system, it is necessary for the Cas protein to recognize the PAM (proto-spacer adjacent motif) sequence adjacent to the target DNA sequence. The PAM sequence can vary depending on the type and origin of the Cas protein. Typical PAM sequences are, for example, "5'-NGG" for the Cas9 protein (type II) derived from Streptococcus pyogenes, "5'-CCN" for the Cas9 protein (type I-A1) derived from Sulfolobus solfataricus, "5'-TCN" for the Cas9 protein (type I-A2) derived from Sulfolobus solfataricus, "5'-TTC" for the Cas9 protein (type I-B) derived from H. walsbyi, "5'-AWG" for the Cas9 protein (type I-E) derived from Escherichia coli, "5'-CC" for the Cas9 protein (type I-F) derived from Escherichia coli, "5'-CC" for the Cas9 protein (type I-F) derived from Pseudomonas aeruginosa, "5'-NNAGAA" for the Cas9 protein (type II-A) derived from Streptococcus thermophilus, "5'-NGG" for the Cas9 protein (type II-A) derived from Streptococcus agalactiae, "5'-NGRRT" or "5'-NGRRN" for the Cas9 protein derived from Staphylococcus aureus, "5'-NNNNGATT" for the Cas9 protein derived from Neisseria meningitidis, and "5'-NAAAAC" for the Cas9 protein derived from Treponema denticola. In Cpf1, it is typically "5'-TTN" or "5'-TTTN". In the Cse1 (Cas8) protein (a type of Cascade protein that constitutes the I-E type CRISPR-Cas3 system), it is typically "5'-AAG", "5'-TAG", "5'-AAC", "5'-GAG", "5'-AGG", "5'-ATG", and in the Cas5d protein (a type of Cascade protein that constitutes the I-D type CRISPR-Cas3 system), it is typically "5'-GTH" (H is A, C, or T) (International Publication No. WO 2018 / 225858, International Publication No. WO 2019 / 039417).
[0074] In addition, by changing the Cas protein (e.g., introduction of mutations), it is also possible to change PAM recognition (Benjamin, P. et al., Nature 523, 481-485 (2015), Hirano, S. et al., Molecular Cell 61, 886-894 (2016), International Publication No. 2018 / 221685). Additionally, among Cas proteins, mutants (nCas, dCas) that have lost part or all of their nuclease activity are known. However, when using these mutants, a protein with other nuclease activity (e.g., FokI, etc.) can be fused, and by acting on the target as a fusion protein, the target can be cleaved. Furthermore, in the CRISPR-Cas3 system, a method of using a fusion protein of Cascade and another nuclease (FokI) instead of Cas3 is known (International Publication No. 2013 / 098244). When using such an artificial nuclease, the site-specific nuclease system of the present invention is constructed as a "guide RNA-induced artificial nuclease system" (one embodiment of a guide RNA-induced nuclease system).
[0075] In addition, within the limit that does not impair the object of the present invention, the Cas protein may have other mutations or other peptides may be added. Examples of other mutations include mutations for weakening or losing helicase activity. Additionally, examples of other peptides to be added include signal sequences (e.g., nuclear transfer signal, mitochondrial transfer signal, chloroplast transfer signal, etc.), marker proteins (e.g., fluorescent proteins, etc.), and tags (e.g., His tag, etc.).
[0076] On the other hand, the artificial nuclease constituting the artificial nuclease system is typically a fusion protein containing a DNA-binding domain and a nuclease domain. The fusion protein component can be, for example, in the form of a protein, in the form of an mRNA encoding the protein, or in the form of a vector expressing the protein.
[0077] The TALEN system is a fusion protein containing the DNA-binding domain and nuclease domain of a transcription activator-like (TAL) effector (for example, International Publication No. WO 2012 / 104729, International Publication No. WO 2011 / 072246, International Publication No. WO 2015 / 019672, etc.). In addition, the ZFN system is a fusion protein containing the DNA-binding domain containing a zinc finger array and a nuclease domain (for example, International Publication No. WO 2003 / 087341, etc.). In addition, the PPR system is a fusion protein containing a PPR (pentatricopeptide repeat) domain and a nuclease domain (Nakamura et al., Plant Cell Physiol 53: 1171-1179 (2012), International Publication No. WO 2014 / 175284). As the nuclease domain in these artificial nuclease systems, for example, FokI can be typically cited, but it is not limited thereto as long as it can cleave DNA. The nuclease domain may cleave the target DNA by forming a dimer, and in this case, two fusion proteins are used for one DNA cleavage. The nuclease domain may be bound to the C-terminal side or the N-terminal side of the DNA-binding domain (Beurdeley M, et al., Nat Commun. 2013; 4: 1762. doi: 10.1038).
[0078] These fusion proteins target a target DNA sequence by constructing a DNA-binding domain by linking modules (peptides) that recognize specific bases (or specific base sequences), and cleave the target DNA by a nuclease domain fused to the DNA-binding domain. An appropriate spacer peptide may be introduced between the DNA-binding domain and the nuclease domain in the fusion protein. Mutations may be introduced and / or other peptides may be added to the fusion protein within the limit that does not impair the object of the present invention. As the mutations, for example, mutations in the nuclease domain (for example, FokI) for forming a heterodimer can be cited. In addition, as the other peptides to be added, for example, signal sequences (for example, nuclear translocation signal, mitochondrial translocation signal, chloroplast translocation signal), marker proteins (for example, fluorescent proteins, etc.), tags (for example, His tag, etc.) can be cited.
[0079] As a constituent element of the site-specific nuclease system, in the case of adopting the form of an expression vector, it contains one or more regulatory elements that are functionally bound to the DNA to be expressed. The DNA to be expressed may also be changed to a base sequence suitable for expression in a host cell.
[0080] Here, "functionally combined" means that the regulatory element is expressibly combined with the above DNA. As the "regulatory element", promoters, enhancers, internal ribosome entry sites (IRES), and other expression control elements (e.g., transcription termination signals, polyadenylation signals, etc.) can be cited. As the regulatory element, depending on the purpose, for example, it can be for the constitutive expression of DNA in various host cells, or it can be only for the expression of DNA in specific cells, tissues, or organs. In addition, it can be for the expression of DNA only at a specific time, or it can be for the expression of DNA that can be artificially induced. As the promoter, for example, polIII promoters (e.g., U6 and H1 promoters, etc.), polII promoters (e.g., the Rous sarcoma virus (RSV) LTR promoter of retroviruses, cytomegalovirus (CMV) promoter, SV40 promoter, dihydrofolate reductase promoter, β-actin promoter, phosphoglycerate kinase (PGK) promoter, EF1α promoter, etc.), polI promoters, or combinations thereof can be cited. Those skilled in the art can select an appropriate expression vector according to the type of cells introduced, etc.
[0081] The "donor DNA" used in the present invention contains a base sequence in which a 5'-side homologous arm sequence, a donor sequence, and a 3'-side homologous arm sequence are arranged in sequence from the 5'-side. Within the limit that does not impair the object of the method of the present invention, the donor DNA may contain other base sequences.
[0082] In the case of design based on the sense strand of the genomic editing target region, the 5'-side homologous arm sequence is a base sequence having identity with the base sequence outside the 5'-end of the sense strand of the genomic editing target region, and the 3'-side homologous arm sequence is a base sequence having identity with the base sequence outside the 3'-end of the sense strand of the genomic editing target region. On the other hand, in the case of design based on the antisense strand of the genomic target region, the 5'-side homologous arm sequence is a base sequence having identity with the base sequence outside the 5'-end of the antisense strand of the genomic editing target region, and the 3'-side homologous arm sequence is a base sequence having identity with the base sequence outside the 3'-end of the antisense strand of the genomic editing target region.
[0083] The identity of the base sequence of the homologous arm sequence of the donor DNA with the corresponding sequence on the genomic DNA is, for example, 80% or more, preferably 85% or more, more preferably 90% or more, further preferably 95% or more, still further preferably 97% or more, still further preferably 98% or more, still further preferably 99% or more, and still further preferably 100%. The identity of the sequences can be calculated using BLAST, etc. (e.g., default parameters).
[0084] The length of the homologous arm sequence is not particularly limited. For example, it is 10 bases or longer (e.g., 30 bases or longer, 50 bases or longer, 100 bases or longer), and 2000 bases or shorter (e.g., 1000 bases or shorter, 500 bases or shorter).
[0085] By the method of the present invention, a donor sequence is inserted between the homologous arm corresponding genomic sequences on both sides. As the donor sequence, a desired DNA sequence can be selected. For example, a genomic sequence into which a mutation has been introduced or a foreign gene sequence can be used. When there is a base sequence to be removed later in the desired DNA, recognition sequences of recombinases (e.g., loxP sequence, FRT sequence), for example, can be added to both ends of the base sequence. The base sequence sandwiched by the recognition sequences of the recombinases can be removed by the action of the corresponding recombinase (e.g., Cre recombinase, FLP recombinase), an activity-inducible recombinase (e.g., CreERT2, etc.). In addition, for the purpose of confirming the success of knock-in, etc., for example, a selection marker sequence (e.g., fluorescent protein, drug resistance gene, negative selection marker gene, etc.) can be inserted into the desired DNA. When the desired DNA contains a gene, a promoter and other control sequences can be functionally linked. Examples of the promoter include a constitutive promoter, a tissue-specific promoter, a stage-specific promoter, an inducible promoter, and a CMV promoter. In addition, elements such as a terminator sequence can be appropriately added.
[0086] The length of the donor sequence is not particularly limited as long as it is within a range that does not hinder the construction of the donor DNA. For example, it is 3 bases or longer (e.g., 5 bases or longer, 10 bases or longer, 30 bases or longer), and 30000 bases or shorter (e.g., 10000 bases or shorter, 5000 bases or shorter, 3000 bases or shorter).
[0087] As the form of the donor DNA, double-stranded circular DNA is preferred. The double-stranded circular DNA can be prepared by known techniques (e.g., PCR, restriction enzyme digestion, DNA ligation techniques, etc.) or can be purchased.
[0088] In the method of the present invention, in order to generate knock-in of the donor sequence by the combined repair of non-homologous end joining and homologous recombination, the site-specific nuclease system targets and cleaves the sequences of (i) to (iii) in the following Group A or Group B.
[0089] Group A:
[0090] (i) 5'-side homologous arm sequence
[0091] (ii) The sequence of the genomic region corresponding to the 5'-side homologous arm (hereinafter referred to as "5'-side homologous arm corresponding genomic sequence")
[0092] (iii) The sequence downstream of the cleavage site of the sequence in (ii) by the site-specific nuclease system (hereinafter referred to as the "downstream genomic sequence on the 3' side")
[0093] Group B
[0094] (i) 3'-side homologous arm sequence
[0095] (ii) The sequence of the genomic region corresponding to the 3'-side homologous arm (hereinafter referred to as the "genomic sequence corresponding to the 3'-side homologous arm")
[0096] (iii) The sequence upstream of the cleavage site of the sequence in (ii) by the site-specific nuclease system in the genomic editing target region (hereinafter referred to as the "upstream genomic sequence on the 5' side")
[0097] Among them, the "5'-side homologous arm sequence" in Group A and the "genomic sequence corresponding to the 5'-side homologous arm" have homologous base sequences. Therefore, if a site-specific nuclease system targeting one of them is constructed, the system also targets the other. That is, it is targeted by the same molecule constituting the site-specific nuclease system. On the other hand, the "downstream genomic sequence on the 3' side" is targeted by other molecules constituting the site-specific nuclease system. Specifically, the "downstream genomic sequence on the 3' side" is the sequence downstream of the cleavage site in the genomic sequence corresponding to the 5'-side homologous arm, the sequence in the middle genomic region (if present), and the genomic sequence corresponding to the 3'-side homologous arm.
[0098] Similarly, the "3'-side homologous arm sequence" and the "genomic sequence corresponding to the 3'-side homologous arm" in Group B are targeted by the same molecule constituting the site-specific nuclease system, and the "upstream genomic sequence on the 5' side" is targeted by other molecules constituting the site-specific nuclease system. Specifically, the "upstream genomic sequence on the 5' side" is the genomic sequence corresponding to the 5'-side homologous arm, the sequence in the middle genomic region (if present), and the sequence upstream of the cleavage site in the genomic sequence corresponding to the 3'-side homologous arm.
[0099] For example, when the site-specific nuclease system is a CRISPR / Cas system, the following CRISPR / Cas system of (a) or (b) is used in the method of the present invention.
[0100] (a) A CRISPR / Cas system comprising a combination of a guide RNA targeting the "5'-side homologous arm sequence / genomic sequence corresponding to the 5'-side homologous arm" (hereinafter referred to as "guide RNA1") and a guide RNA targeting the "downstream genomic sequence on the 3' side" (hereinafter referred to as "guide RNA2")
[0101] (b) A CRISPR / Cas system comprising a combination of a guide RNA targeting the "3'-side homologous arm sequence / 3'-side homologous arm corresponding genomic sequence" (hereinafter referred to as "guide RNA1'") and a guide RNA targeting the "5'-side upstream genomic sequence" (hereinafter referred to as "guide RNA2'")
[0102] In addition, when the site-specific nuclease system is an artificial nuclease system, the following artificial nuclease systems (a) or (b) can be used in the method of the present invention.
[0103] (a) An artificial nuclease system comprising a combination of a fusion protein containing a DNA-binding domain targeting the "5'-side homologous arm sequence / 5'-side homologous arm corresponding genomic sequence" and a nuclease domain (hereinafter referred to as "fusion protein 1") and a fusion protein containing a DNA-binding domain targeting the "3'-side downstream genomic sequence" and a nuclease domain (hereinafter referred to as "fusion protein 2")
[0104] (b) An artificial nuclease system comprising a combination of a fusion protein containing a DNA-binding domain targeting the "3'-side homologous arm sequence / 3'-side homologous arm corresponding genomic sequence" and a nuclease domain (hereinafter referred to as "fusion protein 1'") and a fusion protein containing a DNA-binding domain targeting the "5'-side upstream genomic sequence" and a nuclease domain (hereinafter referred to as "fusion protein 2'")
[0105] The artificial nuclease may be one that dimerizes through its nuclease domain (e.g., FokI, etc.) to cleave the target. In this case, two fusion proteins are used to generate one cleavage. Such a design method of the fusion protein is well known (e.g., International Publication No. WO2011 / 072246, etc.).
[0106] The site-specific nuclease that cleaves by targeting the "3'-side downstream genomic sequence" is preferably a nuclease that targets the boundary region (including the boundary base sequence) between the genomic middle region in the genomic editing target region and the 3'-side homologous arm corresponding genomic region (see Figure 4A ). Since the donor DNA does not have the sequence of the genomic middle region, the site-specific nuclease in this scheme cannot target the donor DNA but specifically targets the "3'-side downstream genomic sequence". In addition, when there is no genomic middle region in the genomic editing target region, the site-specific nuclease is preferably a nuclease that targets the boundary region between the 5'-side homologous arm corresponding genomic region and the 3'-side homologous arm corresponding genomic region in the genomic editing target region (see Figure 2A , 3A)。Since the donor DNA has a donor sequence between the 5'-side homologous arm sequence and the 3'-side homologous arm sequence, the site-specific nuclease in this scheme cannot target the donor DNA, but specifically targets the "3'-side downstream genomic sequence" for cleavage.
[0107] Based on the same principle, the site-specific nuclease that targets the "5'-side upstream genomic sequence" for cleavage is preferably a nuclease that targets the boundary region between the genomic region corresponding to the 5'-side homologous arm and the genomic middle region in the genomic editing target region. Since the donor DNA does not have the sequence of the genomic middle region, the site-specific nuclease in this scheme cannot target the donor DNA, but specifically targets the "5'-side upstream genomic sequence". In addition, in the case where there is no genomic middle region in the genomic editing target region, the site-specific nuclease is preferably a nuclease that targets the boundary region between the genomic region corresponding to the 5'-side homologous arm and the genomic region corresponding to the 3'-side homologous arm in the genomic editing target region. Since the donor DNA has a donor sequence between the 5'-side homologous arm sequence and the 3'-side homologous arm sequence, the site-specific nuclease in this scheme cannot target the donor DNA, but specifically targets the "5'-side upstream genomic sequence" for cleavage.
[0108] In the site-specific nuclease system of the present invention, the homologous arm corresponding genomic region and the genomic intermediate region can be set by the following method. For example, a target DNA sequence of a targeting molecule (e.g., guide RNA2, fusion protein 2) is set on genomic DNA in a manner that generates a desired DNA cleavage. A 3'-side homologous arm is set for the downstream base sequence starting from a specific base within the target DNA sequence (e.g., in the case of guide RNA2 of the CRISPR-Cas9 system, the base on the 3'-side of the cleavage site within the target DNA sequence), so that the targeting molecule targets the boundary region between the genomic intermediate region and the genomic region corresponding to the 3'-side homologous arm. Similarly, a target DNA sequence of a targeting molecule (e.g., guide RNA2', fusion protein 2') is set on genomic DNA in a manner that generates a desired DNA cleavage. A 5'-side homologous arm is set for the upstream base sequence starting from a specific base within the target DNA sequence (e.g., in the case of guide RNA2' of the CRISPR-Cas9 system, the base on the 5'-side of the cleavage site within the target DNA sequence), so that the targeting molecule can target the boundary region between the genomic region corresponding to the 5'-side homologous arm and the genomic intermediate region. In addition, when there is no genomic intermediate region in the genomic editing target region, a target DNA sequence of a targeting molecule (e.g., guide RNA2, guide RNA2', fusion protein 2, fusion protein 2') is set on genomic DNA in a manner that generates a desired DNA cleavage. A 5'-side homologous arm is set for the 5'-side upstream base sequence starting from a specific base within the target DNA sequence, and a 3'-side homologous arm is set for the 3'-side downstream base sequence in a continuous manner with the base sequence where the 5'-side homologous arm is set, so that the targeting molecule can target the boundary region between the genomic region corresponding to the 5'-side homologous arm and the genomic region corresponding to the 3'-side homologous arm.
[0109] When the site-specific nuclease system of the present invention is a guide RNA-induced nuclease system, the site that is usually double-strand cut is inside the target DNA sequence or near the outside of the target DNA sequence. When the site-specific nuclease system is an artificial nuclease system, the site that is usually double-strand cut is outside the target DNA sequence.
[0110] When the site-specific nuclease system targets the boundary region, in the design of the system, the boundary region is usually within 50 bases, preferably within 40 bases (e.g., within 30 bases, within 20 bases) from the above-mentioned boundary. In this case, the site that is double-strand cut is usually within 100 bases, preferably within 50 bases (e.g., within 40 bases, within 30 bases, within 20 bases, within 10 bases, within 5 bases, within 3 bases) from the above-mentioned boundary.
[0111] In the case where a genomic intermediate region exists in the genomic editing target region, the site-specific nuclease can also target the genomic intermediate region (or the boundary region between the genomic intermediate region and the genomic region corresponding to the homologous arm that binds to generate non-homologous ends). Since the donor DNA does not have the sequence of the genomic intermediate region, the site-specific nuclease in this scheme does not target the donor DNA, but specifically targets the genomic intermediate region (or the boundary region between the genomic intermediate region and the genomic region corresponding to the homologous arm that binds to generate non-homologous ends).
[0112] For example, a targeting molecule (e.g., guide RNA2, fusion protein 2) is set in such a way as to generate a desired DNA cleavage, and a 3'-side homologous arm is set for the base sequence downstream of the target DNA sequence of the targeting molecule, so that the targeting molecule can target the genomic intermediate region. Similarly, a targeting molecule (e.g., guide RNA2', fusion protein 2') is set in such a way as to generate a desired DNA cleavage, and a 5'-side homologous arm is set for the base sequence upstream of the target DNA sequence of the targeting molecule, so that the targeting molecule can target the genomic intermediate region.
[0113] In addition, after cleavage with the site-specific nuclease, if a long genomic intermediate region remains uncut in the genomic region corresponding to the homologous arm that contributes to homologous recombination, the efficiency of homologous recombination may be reduced. Therefore, it is preferable to set the target DNA sequence on the genomic intermediate region in such a way that the remaining genomic intermediate region becomes shorter by cleavage with the site-specific nuclease.
[0114] The cells and organisms into which the site-specific nuclease system is introduced are not particularly limited as long as the site-specific nuclease system can function in them. The cells can be eukaryotic cells such as animal cells, plant cells, algal cells, fungal cells, etc., or prokaryotic cells such as bacteria and archaea. "Cells" include, for example, cells that make up an individual, cells that make up an organ / tissue removed from an individual, cultured cells derived from an individual's tissue, etc.
[0115] Examples of animal cells include blood cells, hematopoietic stem cells / precursor cells, gametes (sperm, eggs), fertilized eggs, embryonic cells at various stages of embryos (e.g., 1-cell stage embryo, 2-cell stage embryo, 4-cell stage embryo, 8-cell stage embryo, 16-cell stage embryo, morula stage embryo, etc.), fibroblasts, epithelial cells, vascular endothelial cells, nerve cells, liver cells, bone cells, keratin-producing cells, muscle cells, epidermal cells, endocrine cells, ES cells, iPS cells, tissue stem cells, cancer cells, etc.
[0116] Examples of animals that can be used as a source of animal cells include mammals (e.g., humans, monkeys, mice, rats, guinea pigs, hamsters, pigs, cows, goats, sheep, dogs, cats, rabbits, etc.), fish (e.g., Takifugu rubripes, tuna, red sea bream, mackerel, zebrafish, goldfish, medaka, etc.), birds (e.g., chickens, quails, turkeys, ducks, geese, long-tailed chickens, bantam chickens, pigeons, ostriches, pheasants, helmeted guinea fowls, etc.), reptiles (e.g., snakes, lizards, etc.), amphibians (e.g., frogs, salamanders, etc.), insects (e.g., flies, silkworms, etc.). When producing a knock-in animal as a model animal, the animal is preferably a rodent such as a mouse, rat, guinea pig, or hamster, and particularly preferably a mouse or a rat.
[0117] Examples of plants that can be used as a source of plant cells include cereals, oil crops, forage crops, fruits, and vegetables. Specific examples of plants include Arabidopsis thaliana, tomato, soybean, rice, wheat, barley, corn, rapeseed, tobacco, banana, peanut, sunflower, potato, cotton, carnation, etc.
[0118] In the production of knock-in animals, germ cells or pluripotent stem cells can be used. For example, by transplanting an oocyte prepared by introducing a site-specific nuclease system into an oocyte into the oviduct or uterus of a pseudopregnant animal, a cub into which a donor sequence has been inserted into the genome can be obtained. Offspring and clones can be obtained from the resulting individual.
[0119] Among them, if a fertilized egg containing an expression cassette of a recombinase (e.g., Cre, CreERT2, FLP, etc.) is used, and a desired gene flanked by the recognition sequence of the recombinase (e.g., loxP sequence, FRT sequence, etc.) is used as the donor sequence, and the donor sequence is inserted into the genome of the fertilized egg by the method of the present invention, a conditional knockout animal can be effectively produced. In the case of using a fertilized egg that does not contain an expression cassette of a recombinase (e.g., Cre, CreERT2, FLP, etc.), by mating an individual obtained by the method of the present invention (an individual that retains the desired gene flanked by the recognition sequence of the recombinase) with a recombinase-expressing individual, a conditional knockout animal can be produced. Such a conditional knockout technique is useful, for example, in the production of disease models.
[0120] On the other hand, for plants, it has been known since ancient times that their somatic cells have totipotency, and methods for regenerating plants from plant cells have been established in various plants. Therefore, for example, by introducing a site-specific nuclease system into plant cells and regenerating plants from the resulting plant cells, plants in which a donor sequence has been inserted into the genome can be obtained. Offspring, clones, or propagation materials (e.g., tubers, taproots, seeds, etc.) can also be obtained from the resulting plants. As a method for redifferentiating plant tissues through tissue culture to obtain individuals, methods established in the technical field can be used (Transformation Protocol [Plant Edition], Yutaka Tabuchi / Editor, Kagaku Dojin pp. 340-347 (2012)).
[0121] The methods for introducing a site-specific nuclease system and donor DNA into cells and organisms are not particularly limited and can be appropriately selected according to the type of target cells or organisms and the type of material (whether it is nucleic acid, protein, etc.). Examples include, but are not limited to, electroporation, microinjection, DEAE-dextran treatment, liposome transfection, nanoparticle-mediated transfection, virus-mediated nucleic acid delivery, etc. Each molecule constituting the site-specific nuclease system can be introduced simultaneously or separately.
[0122] In cells and organisms into which a site-specific nuclease system and donor DNA have been introduced in this way, through the combined repair of two DNA repair mechanisms, namely non-homologous end joining and homologous recombination, the donor sequence is inserted into the genomic editing target region on genomic DNA.
[0123] A typical principle of the method of the present invention (as an example, in the case where the genomic region corresponding to the 5'-homologous arm and the genomic intermediate region are used as targets of the site-specific nuclease system) is shown in Figure 1 . First, through the action of the site-specific nuclease system, one of the cleavage ends generated in the genomic region corresponding to the 5'-homologous arm on genomic DNA (the side not including the genomic intermediate region) binds to one of the cleavage ends of the 5'-homologous arm on the donor DNA (the side including the donor sequence) through non-homologous end joining repair. In this repair, if a base mutation (e.g., addition, deletion, etc.) occurs at the cleavage site, the site-specific nuclease system cannot target and re-cleavage has occurred. Then, through the repair mediated by non-homologous end joining, repair mediated by homologous recombination is induced between the 3'-homologous arm in the donor DNA tethered to the genomic DNA and the genomic region corresponding to the 3'-homologous arm near the cleavage end of the genomic intermediate region. As a result, the donor sequence is inserted into the genomic DNA.
[0124] The method of the present invention is a method that combines the advantages of "high frequency" of non-homologous end joining and the advantages of "high accuracy" of homologous recombination, and can insert a donor sequence into a genomic editing target region on genomic DNA with high efficiency and accuracy.
[0125] In addition, the present invention provides a kit or composition for producing a cell or organism into which a donor sequence has been inserted into a genomic editing target region on genomic DNA, and the kit or composition contains the above site-specific nuclease system and donor DNA.
[0126] In the kit of the present invention, the site-specific nuclease system and the donor DNA may be separate or integrated. Each element constituting the site-specific nuclease system may also be separate or integrated. The standard product constituting the kit of the present invention may further contain other components as needed. Examples of other components include, but are not limited to, a base agent, a carrier, a solvent, a dispersant, an emulsifier, a buffer, a stabilizer, an excipient, a binder, a disintegrant, a lubricant, a thickener, a humectant, a coloring agent, a fragrance, a chelating agent, etc. The kit may further contain additional elements. Examples of additional elements include, but are not limited to, a dilution buffer, a reconstitution solution, a washing buffer, a nucleic acid introduction reagent, a protein introduction reagent, a control reagent (for example, a control guide RNA, etc.). The kit may contain instructions for use for implementing the method of the present invention.
[0127] The composition of the present invention contains the site-specific nuclease system and the donor DNA as a single entity. Other components may be further contained in the composition of the present invention as needed. Examples of other components include, but are not limited to, a base agent, a carrier, a solvent, a dispersant, an emulsifier, a buffer, a stabilizer, an excipient, a binder, a disintegrant, a lubricant, a thickener, a humectant, a coloring agent, a fragrance, a chelating agent, etc. The composition of the present invention may also be the standard product constituting the kit of the present invention.
[0128] Examples
[0129] Hereinafter, the present invention will be described more specifically based on examples, but the present invention is not limited to the following examples.
[0130] [Example 1] Genome editing experiment 1 (wild-type mouse, Kcnab1 gene, microinjection)
[0131] Using the sequence around the stop codon of exon 14 of the mouse Kcnab1 (Potassium Voltage-Gated Channel Subfamily A Member Regulatory Beta Subunit 1) gene as the target DNA sequence for genome editing, a 3983-base donor sequence was incorporated ( Figure 2A ).
[0132] (1) Preparation of Cas9 mRNA
[0133] A plasmid (T7-NLS-hCas9-polyA, RIKEN BRC#RDB13130) containing a sequence with a polyA tail added downstream of the Cas9 coding sequence was linearized and used as the template DNA. It was synthesized using an in vitro transcription kit (MEGAshortscript T7 Transcription Kit, manufactured by Life Technologies) and purified using a purification kit (MEGAClear kit, manufactured by Life Technologies).
[0134] (2) Preparation of gRNA
[0135] The gRNA was designed using an assistant design tool (http: / / crispor.tefor.net / ). The gRNA1 (GTATAAATGACTGCTTAATG TGG / SEQ ID NO: 19, the underline is PAM) that cleaves both the target DNA sequence for genome editing and the 5' homologous arm of the donor DNA, and the gRNA2 (AAAGGACTATAGATCATA AGG / SEQ ID NO: 20, the underline is PAM) that cleaves the other target DNA sequence for genome editing were synthesized using a gRNA in vitro synthesis kit (GeneArt (registered trademark) Precision gRNA Synthesis Kit, manufactured by Life Technologies).
[0136] In addition, gRNA2 was set to span the genomic sequences corresponding to the 5' homologous arm and the 3' homologous arm on the genomic DNA. In the donor DNA, there is a donor sequence between the two homologous sequences, so gRNA2 cannot target the donor DNA.
[0137] (3) Preparation of donor DNA
[0138] The double-stranded circular DNA used as donor DNA was prepared by genetic engineering techniques such as PCR, restriction enzyme digestion, and DNA ligation. The two homologous arms were prepared using the C57BL / 6J system mouse genome as an amplification template. The P2A sequence was prepared by the formation of primer dimers in PCR. The ERT2 and iCre sequences were prepared using existing plasmids (Addgene #13777 and #51904) as amplification templates. The obtained fragments were ligated to the pGEM-T vector (manufactured by Promega) to produce the donor vectors "intron-Ctgf-P2A-ERT2iCreERT2-pGEM" and "Kcnab1-P2A-ERT2iCreERT2-stop-3UTR2polyA-pGEM".
[0139] (4) Introduction into fertilized eggs and genotyping
[0140] The C57BL / 6J Jcl pronuclear stage frozen embryos (manufactured by CLEA Japan) were thawed and cultured at a constant temperature in KSOM medium (manufactured by ARK Resource). The gRNA (25 ng / μL), Cas9 mRNA (50 ng / μL), and donor DNA (1 ng / μL) prepared in (2) above were microinjected into the male pronucleus in the embryo using a micromanipulator (manufactured by Narishige). The embryos were cultured at a constant temperature, and the two-cell stage embryos were transplanted into pseudopregnant female mice via the oviduct the next day. Genomic DNA was extracted from the tails of the born mice (F0 mice) using a kit (KAPA Express Extract DNA Extraction Kit, manufactured by Kapa Biosystems), and PCR screening was performed using primer sets designed outside the sequences corresponding to the homologous arms and inside the inserted sequence ("upstream ligation confirmation" and "downstream ligation confirmation" in Table 1), or inside the inserted sequences with respect to each other ("insertion confirmation" in Table 1). Genotyping was performed by sequencing the obtained PCR fragments. The primer sets are shown in Table 1.
[0141] Table 1
[0142]
[0143] (5) Results
[0144] The results of this example are shown in Table 2. F0 mice with an allele in which the ERT2-iCre-ERT2 sequence was inserted into the target DNA sequence for genome editing were obtained in 33.3% of the born mice (i.e., mice in which the desired genome editing was successful) (Table 2, "Combi" of "Kcnab1-ERT2iCreERT2"). In experiments conducted by different methods targeting the insertion of the same sequence, no mice with successful genome editing were obtained (Table 2, "lssDNA" of "Kcnab1-ERT2iCreERT2"). In addition, the method using lssDNA utilized the method reported in the literature (Miyasaka, Y. et al. BMC Genomics. 2018; 19(1): 318).
[0145] Table 2
[0146]
[0147] In addition, the F0 mice were mated with C57BL / 6J Jcl mice, and genotype analysis was also performed on the obtained F1 mice. As a result, it was confirmed that the allele with the desired genome editing was able to be transmitted through the germ cell line ( Figure 2B ). The fact that the inserted iCre had the desired function as a recombinase was confirmed by mating the F1 mice with Ai14 mice (Jackson Laboratory Stock No: 007914) that recombinantly expressed the tdTomato reporter. That is, for the offspring obtained by mating, tamoxifen was administered on the second day after birth, and then the brain tissue was removed on the fifth day after birth, and sections were prepared using a vibratome for observation. As a result, tdTomato-positive cells were confirmed in the expected region of the cerebral cortex.
[0148] [Example 2] Genome Editing Experiment 2 (Wild-Type Mice, Ctgf Gene, Microinjection)
[0149] The sequence around the stop codon of exon 5 of the mouse Ctgf (connective tissue growth factor) gene was used as the target DNA sequence for genome editing, and a 3556-base donor sequence was incorporated ( Figure 3A ). Preparation of Cas9 mRNA, preparation of gRNA, preparation of donor DNA, introduction into fertilized eggs, and genotype analysis were performed by the same methods as in Example 1. The gRNA sequences used were as follows. In addition, the primer sets used are shown in Table 1.
[0150] gRNA1: GACATAGGGCTAGTCTACAA AGG / Sequence number: 21, PAM underlined
[0151] gRNA2: CGGAGACATGGCGTAAAGCC AGG / Sequence number: 22, PAM underlined
[0152] In addition, gRNA2 is set to span the genomic sequences corresponding to the 5'-homologous arm and the 3'-homologous arm on genomic DNA. In the donor DNA, there is a donor sequence between the two homologous sequences, so gRNA2 cannot target the donor DNA.
[0153] The results of this example are shown in Table 2. F0 mice with an allele in which the P2A-ERT2-iCre-ERT2 sequence was inserted into the target DNA sequence for genome editing were obtained in 16.7% of the born mice (i.e., mice in which the target genome editing was successful) (Table 2, "Combi" of "Ctgf-ERT2iCreERT2"). In experiments conducted by different methods targeting the insertion of the same sequence, no mice with successful genome editing were obtained (Table 2, "lssDNA" of "Ctgf-ERT2iCreERT2").
[0154] In addition, the F0 mice were mated with C57BL / 6J Jcl mice, and genotyping was also performed on the obtained F1 mice. As a result, it was confirmed that the allele with the target genome editing was capable of germline transmission ( Figure 3B ).
[0155] In addition, the fact that the inserted iCre has the desired function as a recombinase was confirmed by mating the F1 mice with Ai14 mice (Jackson Laboratory Stock No: 007914) that recombinantly express the tdTomato reporter. Specifically, the pups obtained by mating were administered tamoxifen on the 2nd day after birth, and then the brain tissue was removed on the 5th day after birth and sections were prepared using a vibratome for observation. As a result, tdTomato-positive cells were confirmed in the expected region of the cerebral cortex.
[0156] [Example 3] Genome editing experiment 3 (wild-type rat, Tp53 gene, microinjection)
[0157] Using the sequences around exon 2 and exon 4 of the rat Tp53 (tumor protein p53) gene as the target DNA sequence for genome editing, a 4513-base donor sequence was incorporated ( Figure 4A ).
[0158] (1) Preparation of Cas9 protein-gRNA complex solution and donor DNA
[0159] gRNA was used to cleave both the target DNA sequence for genome editing within exon 2 and the 5' homologous arm of the donor DNA CCC (TGCCAGATAGTCCACCTTCT / SEQ ID NO: 23, with the PAM underlined), and a gRNA that cleaves the target DNA sequence for genome editing within exon 4 CCA (CAGCGACAGGGTCACCTAAT / SEQ ID NO: 24, with the PAM underlined). The design of the gRNA was carried out using an auxiliary design tool (http: / / crispor.tefor.net / ).
[0160] In addition, gRNA2 was set to span the genomic sequence corresponding to the 3' homologous arm and the genomic sequence upstream thereof (the 5' end portion of exon 4) on the genomic DNA. Since the sequence corresponding to the 5' end portion of exon 4 is not present in the donor DNA, gRNA2 cannot target the donor DNA.
[0161] 1.75 μL each of crRNA and tracrRNA (Alt-R® CRISPR / Cas9 System, manufactured by Integrated DNA Technologies) adjusted to 100 μM was mixed with 1.5 μL of the binding buffer in the same package. After heating it at 95 °C for 5 minutes, it was slowly cooled to allow complementary binding to serve as gRNA. 1250 ng of the above gRNA was mixed with 5000 ng of purified Cas9 protein (Alt-R® S.p.Cas9 Nuclease 3NLS, manufactured by Integrated DNA Technologies) to form a Cas9 protein / gRNA complex (ribonucleoprotein). As the donor DNA, the regions of exons 2 and 4 of rat Tp53 and the 5' and 3' homologous arms set from the surrounding sequences were selected, and the base sequence of the CAG promoter and the fluorescent protein (CFP) gene sandwiched by these homologous arms was designed. The construction of the plasmid containing the above donor DNA sequence was carried out using an artificial gene synthesis service (GeneArt® Gene Synthesis, manufactured by Life Technologies). The final concentrations in the microinjection solution were 100 ng / μL for Cas9 protein, 25 ng / μL for each gRNA, and 1 ng / μL for donor DNA.
[0162] (2) Introduction into fertilized eggs and genotyping
[0163] For Jcl:SD female rats, they were superovulated by intraperitoneal injection of 150 U / kg pregnant mare serum gonadotropin (manufactured by Asuka Pharmaceutical Co., Ltd.) and then 75 U / kg human chorionic gonadotropin (manufactured by Asuka Pharmaceutical Co., Ltd.), and mated with Jcl:SD male rats. On the next day, pronuclear stage embryos were collected from female rats in which mating was confirmed, and cultured at a constant temperature in rat KSOM medium (manufactured by ARK Resource Co., Ltd.). An injection solution containing 100 ng / μL of the Cas9 protein prepared above, 25 ng / μL of each gRNA, and 1 ng / μL of donor DNA was microinjected into the male pronucleus of the embryo using a micromanipulator (manufactured by Narishige Co., Ltd.). The embryos were cultured at a constant temperature, and the two-cell stage embryos were transplanted into pseudopregnant female rats through the oviduct. Genomic DNA was extracted from the tails of the born rats (F0 rats), and PCR screening was performed using a primer set designed outside the homologous arm equivalent sequence and inside the insertion sequence, or inside the insertion sequences. Genotyping was performed by sequencing the obtained PCR fragments. The primer sets are shown in Table 1.
[0164] No deletion was observed in the upstream connection entry ( Figure 4B ). In addition, the downstream connection entry was not detected by PCR, but fluorescence could be confirmed as a result of observing tissue sections under a fluorescence microscope ( Figure 4C ).
[0165] (3) Results
[0166] The results of this example are shown in Table 2. F0 rats having an allele in which the CFP sequence was inserted into the target DNA sequence for genome editing were obtained at 16.6% of the born rats (Table 2, "Combi" of "Tp53-CFP"). In an experiment conducted by a different method targeting the insertion of the same sequence, no rat with successful genome editing was obtained (Table 2, "3H2OP" of "Tp53-CFP"). In addition, for the 3H3OP method, the method reported in the literature (Yoshimi, K. et al, Nat Commun. 2016; 7: 10431) was used.
[0167] Industrial applicability
[0168] According to the present invention, cells and organisms into which a donor sequence is inserted into the genome can be produced with high efficiency and accuracy. The present invention can be used in, for example, the manufacture of pharmaceuticals, agricultural crops, processed foods, livestock products, fishery products, industrial products, experimental animals, etc., and basic research in the field of life sciences.
[0169] Sequence Listing Free Text
[0170] Sequence numbers 1 to 19
[0171] <223>Primer sequence
[0172] Sequence numbers 20 to 24
[0173] <223>Guide RNA sequence
Claims
1. A method for producing a cell or non-human organism in which a donor sequence is inserted into a genomic editing target region on genomic DNA, the method comprising the step of introducing a site-specific nuclease system and donor DNA into the cell or non-human organism, wherein the donor DNA is a DNA comprising a base sequence in which a 5'-side homologous arm sequence, a donor sequence, and a 3'-side homologous arm sequence are arranged in sequence from the 5'-side, the site-specific nuclease system is a system that cleaves by targeting the sequences of (i) to (iii) of the following Group A or B, and the sequences of (i) and (ii) of Group A or B are targeted by the same molecule constituting the site-specific nuclease system, and the sequence of (iii) is targeted by another molecule constituting the site-specific nuclease system, when the site-specific nuclease system cleaves by targeting the sequences of (i) to (iii) of the following Group A, the donor sequence is inserted into the genomic editing target region by non-homologous end joining repair of the cleavage of the sequences of (i) and (ii) of Group A and homologous recombination mediated by the 3'-side homologous arm sequence, when the site-specific nuclease system cleaves by targeting the sequences of (i) to (iii) of the following Group B, the donor sequence is inserted into the genomic editing target region by non-homologous end joining repair of the cleavage of the sequences of (i) and (ii) of Group B and homologous recombination mediated by the 5'-side homologous arm sequence, the site-specific nuclease system is a CRISPR / Cas9 system or a CRISPR / Cas3 system, and is a combination of a guide RNA targeting the sequences of (i) and (ii) of Group A or B and a guide RNA targeting the sequence of (iii) of Group A or B, Group A: (i) the 5'-side homologous arm sequence (ii) the corresponding sequence of the sequence of (i) in the genomic editing target region (iii) the sequence in the genomic editing target region that is downstream of the 3'-side of the cleavage site of the sequence of (ii) by the site-specific nuclease system and upstream of the 5'-side of the corresponding sequence of the 3'-side homologous arm sequence Group B: (i) the 3'-side homologous arm sequence (ii) the corresponding sequence of the sequence of (i) of Group B in the genomic editing target region (iii) the sequence in the genomic editing target region that is upstream of the 5'-side of the cleavage site of the sequence of (ii) of Group B by the site-specific nuclease system and downstream of the 3'-side of the corresponding sequence of the 5'-side homologous arm sequence.
2. A kit or composition for producing a cell or organism in which a donor sequence is inserted into a genomic editing target region on genomic DNA, the kit or composition comprising a site-specific nuclease system and donor DNA, wherein the donor DNA is a DNA comprising a base sequence in which a 5'-side homologous arm sequence, a donor sequence, and a 3'-side homologous arm sequence are arranged in sequence from the 5'-side, The site-specific nuclease system is a system that cuts by targeting the sequences of (i) to (iii) of the following Group A or Group B. The sequences of (i) and (ii) in Group A or Group B are targeted by the same molecule constituting the site-specific nuclease system, and the sequence of (iii) is targeted by other molecules constituting the site-specific nuclease system. When the site-specific nuclease system cuts by targeting the sequences of (i) to (iii) of the following Group A, the donor sequence is inserted into the genome editing target region by non-homologous end joining repair of the cuts of the sequences of (i) and (ii) in Group A and homologous recombination mediated by the 3'-side homologous arm sequence. When the site-specific nuclease system cuts by targeting the sequences of (i) to (iii) of the following Group B, the donor sequence is inserted into the genome editing target region by non-homologous end joining repair of the cuts of the sequences of (i) and (ii) in Group B and homologous recombination mediated by the 5'-side homologous arm sequence. The site-specific nuclease system is a CRISPR / Cas9 system or a CRISPR / Cas3 system, and includes a combination of a guide RNA targeting the sequences of (i) and (ii) of Group A or Group B and a guide RNA targeting the sequence of (iii) of Group A or Group B. Group A: (i) The 5'-side homologous arm sequence (ii) The corresponding sequence of the sequence of (i) in the genome editing target region (iii) The sequence in the genome editing target region, downstream of the 3'-side of the cleavage site of the sequence of (ii) by the site-specific nuclease system and upstream of the 5'-side of the corresponding sequence of the 3'-side homologous arm sequence Group B: (i) The 3'-side homologous arm sequence (ii) The corresponding sequence of the sequence of (i) in Group B in the genome editing target region (iii) The sequence in the genome editing target region, upstream of the 5'-side of the cleavage site of the sequence of (ii) in Group B by the site-specific nuclease system and downstream of the 3'-side of the corresponding sequence of the 5'-side homologous arm sequence.
Citation Information
Patent Citations
Targeted chromosomal mutagenesis using zinc finger nucleases
WO2003087341A2
TAL effector-mediated DNA modification
WO2011072246A2
Modular DNA-binding domains and methods of use
WO2012104729A1
Modified cascade ribonucleoproteins and uses thereof
WO2013098244A1
RNA-DIRECTED DNA CLEAVAGE BY THE Cas9-crRNA COMPLEX
WO2013142578A1