Tn-MUC1 chimeric antigen receptor (CAR) T cell therapy
By designing chimeric antigen receptor T cells targeting Tn-MUC1, the off-target activity and immunosuppressive problems of CAR T therapy in solid tumors are solved, and effective treatment of cancers such as breast cancer is achieved.
Patent Information
- Application Number
- CN202080025068.9
- Authority / Receiving Office
- CN · China
- Patent Type
- Patents(China)
- Current Assignee / Owner
- Priority Date
- 2019-07-31
- Filing Date
- 2020-03-26
- Publication Date
- 2025-08-26
- Estimated Expiration
- 2040-03-26
AI Technical Summary
The effectiveness of CAR T therapy in the treatment of solid tumors such as breast cancer is still uncertain, mainly because the tumor-expressed cell surface antigens are also expressed by normal tissues, resulting in off-target activity. Solid tumors have an immunosuppressive tumor microenvironment, and the persistence of CAR T cells in solid tumors does not reach the level of hematologic malignant tumors.
Chimeric antigen receptor (CAR) T cells targeting Tn-MUC1 were developed to specifically recognize MUC1 antigens, including specific antigen binding domains, transmembrane domains, costimulatory signaling domains and intracellular signaling domains, enhancing their cell lytic activity in vitro and in vitro.
It showed effective cell lytic activity on a variety of cancer cell lines in vitro and significantly eradicated tumors in vivo, overcoming the immunosuppressive tumor microenvironment of solid tumors, and achieving significant therapeutic effects on MUC1-related cancers such as breast cancer.
Smart Images

Figure CN113661180B_ABST
Abstract
Description
[0001] CROSS-REFERENCE TO RELATED APPLICATIONS
[0002] This application claims priority under 35 U.S.C. §119(e) to U.S. Provisional Patent Application No. 62 / 824,532, filed on March 27, 2019, and U.S. Provisional Patent Application No. 62 / 881,269, filed on July 31, 2019, which are hereby incorporated by reference in their entireties. Technical Background
[0003] Chimeric antigen receptor (CAR) T cells are effector immune cells that are genetically modified to recognize specific tumor-associated antigens and subsequently kill tumor cells. Although the success of CAR T therapy has led to approval for use in hematological malignancies, the effectiveness of CAR T therapy in treating solid tumors (such as breast cancer) remains uncertain. There are several obstacles to CAR T therapy in solid tumors. Most importantly, most of the cell surface antigens expressed by the most identified and best-studied tumors are also expressed by normal tissues, which leads to non-specific targeting (off-target activity) of CAR T cells. Second, solid tumors often have an immunosuppressive tumor microenvironment that may inhibit the activity of CAR T cells once the cells arrive at the tumor and recognize the antigen. Third, the durability of the anti-tumor response is highly correlated with the persistence of adoptively transferred cells, and the optimal persistence of CAR T cells in solid tumors has not yet matched the persistence observed in hematopoietic malignancies.
[0004] Identifying tumor-specific antigens is crucial for the continued application of CAR T cell therapy for solid tumors. New compositions and methods for treating solid tumors, such as breast cancer, are needed. The present invention satisfies this need. Summary of the Invention
[0005] Mucin 1 (MUC1) is a cell surface mucin that normally undergoes continuous addition of glycans to form a highly glycosylated protein ( Figure 1 The O-glycosylation process begins with the addition of GalNAc to serine and threonine residues. Elongation begins with the addition of galactose by core 1 synthase (composed of C1GalT1 and its chaperone C1GalT1C1 (Cosmc)) or GlcNAc by core 3 synthase (B3GNT6). Abnormalities in this continuous glycosylation, such as epigenetic silencing of Cosmc, produce a hypoglycosylated product, Tn-MUC1, to which sialic acid is added by (ST6GALNAC-1) to form STn-MUC1.
[0006] The present disclosure is based on the following findings: CAR T cells directed against Tn-MUC1 exhibit potent cytolytic activity against a variety of cancer cell lines in vitro and significantly eradicate tumors in vivo. In one aspect, a modified immune cell or its precursor cell is provided, which includes a chimeric antigen receptor (CAR) that specifically binds to MUC1, wherein the CAR includes: a MUC1-specific antigen binding domain comprising a heavy chain variable (VH) domain and a light chain variable (VL) domain, wherein the VH domain includes a heavy chain complementary determining region (CDR) sequence recited in SEQ ID NOs: 22, 23, and 24, wherein the VL domain includes a light chain complementary determining region (CDR) sequence recited in SEQ ID NOs: 19, 20, and 21; a transmembrane domain; a costimulatory signaling domain; and an intracellular signaling domain.
[0007] In certain exemplary embodiments, the MUCl-specific antigen binding domain is specific for a carbohydrate epitope of MUCl. In certain exemplary embodiments, the MUCl-specific antigen binding domain is specific for a truncated carbohydrate epitope of MUCl.
[0008] In certain exemplary embodiments, the VH domain comprises the amino acid sequence set forth in SEQ ID NO: 5. In certain exemplary embodiments, the VL domain comprises the amino acid sequence set forth in SEQ ID NO: 6. In certain exemplary embodiments, the VH domain comprises the amino acid sequence set forth in SEQ ID NO: 5, and the VL domain comprises the amino acid sequence set forth in SEQ ID NO: 6. In certain exemplary embodiments, the MUCl-specific antigen-binding domain comprises the amino acid sequence set forth in SEQ ID NO: 4.
[0009] In certain exemplary embodiments, the transmembrane domain comprises a transmembrane region of a protein selected from the group consisting of type I transmembrane proteins, α, β or ζ chains of T cell receptors, CD28, CD2, CD3ε, CD45, CD4, CD5, CD7, CD8, CD9, CD16, CD22, CD33, CD37, CD64, CD80, CD86, CD134 (OX-40), CD137 (4-1BB), CD154 (CD40L), CD278 (ICOS), CD357 (GITR), Toll-like receptor 1 (TLR1), TLR2, TLR3, TLR4, TLR5, TLR6, TLR7, TLR8 and TLR9. In certain exemplary embodiments, the transmembrane domain comprises a CD8 transmembrane region. In certain exemplary embodiments, the transmembrane domain comprises the amino acid sequence recited in SEQ ID NO: 7.
[0010] In certain exemplary embodiments, the costimulatory signaling domain comprises a costimulatory domain of a protein selected from the group consisting of a TNFR superfamily member, CD27, CD28, 4-1BB (CD137), OX40 (CD134), CD30, CD40, PD-1, ICOS, lymphoid function-associated antigen-1 (LFA-1), CD2, CD5, CD7, LIGHT, NKG2C, B7-H3, a ligand that specifically binds to CD83, DAP10, DAP12, Lck, Fas, and any derivative or variant thereof. In certain exemplary embodiments, the costimulatory signaling domain is a CD2 costimulatory signaling domain. In certain exemplary embodiments, the costimulatory signaling domain comprises the amino acid sequence set forth in SEQ ID NO: 28.
[0011] In certain exemplary embodiments, the intracellular signaling domain comprises a signaling domain of a protein selected from the group consisting of CD3ζ, FcγRIII, FcsRI, the cytoplasmic tail of an Fc receptor, a cytoplasmic receptor with an immunoreceptor tyrosine-based activation motif (ITAM), TCRζ, FcRγ, FcRβ, CD3γ, CD3δ, CD3ε, CD5, CD22, CD79a, CD79b, and CD66d. In certain exemplary embodiments, the intracellular signaling domain comprises the signaling domain of CD3ζ. In certain exemplary embodiments, the intracellular signaling domain comprises the amino acid sequence set forth in SEQ ID NO: 30.
[0012] In certain exemplary embodiments, the CAR further comprises a leader sequence. In certain exemplary embodiments, the leader sequence is a CD8 leader sequence. In certain exemplary embodiments, the leader sequence comprises the amino acid sequence recited in SEQ ID NO: 48.
[0013] In certain exemplary embodiments, the CAR further includes a hinge domain. In certain exemplary embodiments, the hinge domain is from a protein selected from the group consisting of an Fc fragment of an antibody, a hinge region of an antibody, a CH2 region of an antibody, a CH3 region of an antibody, an artificial spacer sequence, a hinge comprising a CD8 amino acid sequence, and any combination thereof. In certain exemplary embodiments, the hinge domain is a CD8 hinge domain. In certain exemplary embodiments, the hinge domain includes the amino acid sequence recited in SEQ ID NO: 13.
[0014] In certain embodiments, the modified immune cell further comprises a dominant negative receptor and / or a switch receptor.
[0015] In certain embodiments, the dominant negative receptor is a truncated variant of a wild-type protein associated with a negative signal. In one embodiment, the truncated variant of a wild-type protein associated with a negative signal comprises the amino acid sequence recited in SEQ ID NO:76.
[0016] In certain embodiments, the conversion receptor comprises: a first domain, wherein the first domain is derived from a first polypeptide associated with a negative signal; and a second domain, wherein the second domain is derived from a second polypeptide associated with a positive signal. In one embodiment, the first domain comprises at least a portion of the extracellular domain of the first polypeptide associated with the negative signal, and the second domain comprises at least a portion of the intracellular domain of the second polypeptide associated with the positive signal. In one embodiment, the conversion receptor further comprises a conversion receptor transmembrane domain. In one embodiment, the conversion receptor transmembrane domain comprises: a transmembrane domain of a first polypeptide associated with a negative signal; or a transmembrane domain of a second polypeptide associated with a positive signal. In one embodiment, the first polypeptide associated with a negative signal is selected from CTLA4, PD-1, BTLA, TIM-3, and TGFβR. In one embodiment, the second polypeptide associated with a positive signal is selected from CD28, ICOS, 4-1BB, and IL-12R.
[0017] In one embodiment, the switch receptor comprises: a first domain comprising at least a portion of the extracellular domain of PD1; a switch receptor transmembrane domain comprising at least a portion of the transmembrane domain of CD28; and a second domain comprising at least a portion of the intracellular domain of CD28. In one embodiment, the switch receptor comprises the amino acid sequence recited in SEQ ID NO: 78. In one embodiment, the switch receptor comprises: a first domain comprising at least a portion of the extracellular domain of PD1; a switch receptor transmembrane domain comprising at least a portion of the transmembrane domain of PD1; and a second domain comprising at least a portion of the intracellular domain of CD28.
[0018] In one embodiment, the switch receptor comprises the amino acid sequence set forth in SEQ ID NO:80.
[0019] In one embodiment, the first domain includes at least a portion of the extracellular domain of PD1 comprising a substitution of alanine (A) with leucine (L) at amino acid position 132.
[0020] In one embodiment, the switch receptor comprises the amino acid sequence set forth in SEQ ID NO:82.
[0021] In one embodiment, the switch receptor comprises a first domain comprising at least a portion of the extracellular domain of PD1 comprising a substitution of alanine (A) with leucine (L) at amino acid position 132 and a second domain comprising at least a portion of the intracellular domain of CD28.
[0022] In one embodiment, the switch receptor comprises a first domain comprising at least a portion of the extracellular domain of PD1 comprising a substitution of alanine (A) with leucine (L) at amino acid position 132, and a second domain comprising at least a portion of the intracellular domain of 4-1BB.
[0023] In one embodiment, the switch receptor comprises the amino acid sequence set forth in SEQ ID NO:86.
[0024] In one embodiment, the switch receptor comprises a first domain comprising at least a portion of the extracellular domain of TIM-3 and a second domain comprising at least a portion of the intracellular domain of CD28.
[0025] In one embodiment, the switch receptor comprises the amino acid sequence set forth in SEQ ID NO:92.
[0026] In one embodiment, the switch receptor comprises a first domain comprising at least a portion of the extracellular domain of TGFβR and a second domain comprising at least a portion of the intracellular domain of IL12Rα1.
[0027] In one embodiment, the switch receptor comprises the amino acid sequence set forth in SEQ ID NO:88.
[0028] In one embodiment, the switch receptor comprises a first domain comprising at least a portion of the extracellular domain of TGFβR and a second domain comprising at least a portion of the intracellular domain of IL12Rβ1.
[0029] In one embodiment, the switch receptor comprises the amino acid sequence set forth in SEQ ID NO:90.
[0030] In certain exemplary embodiments, the modified cells are modified natural killer (NK) cells, modified natural killer T (NKT) cells, or modified T cells. In certain exemplary embodiments, the modified immune cells are modified T cells. In certain exemplary embodiments, the modified immune cells are autologous.
[0031] In another aspect, a modified T cell is provided that includes a chimeric antigen receptor (CAR) that specifically binds to MUC1, wherein the CAR includes: a MUC1-specific antigen binding domain including a heavy chain variable (VH) domain and a light chain variable (VL) domain, wherein the VH domain includes the heavy chain complementary determining region (CDR) sequence recited in SEQ ID NOs: 22, 23, and 24, and wherein the VL domain includes the light chain complementary determining region (CDR) sequence recited in SEQ ID NOs: 19, 20, and 21; a hinge domain; a transmembrane domain; a CD2 co-stimulatory signaling domain; and an intracellular signaling domain.
[0032] In another aspect, a modified T cell is provided that includes a chimeric antigen receptor (CAR) that specifically binds to MUC1, wherein the CAR includes: a MUC1-specific antigen binding domain including a heavy chain variable (VH) domain and a light chain variable (VL) domain, wherein the VH domain includes the heavy chain complementary determining region (CDR) sequence recited in SEQ ID NOs: 22, 23, and 24, and wherein the VL domain includes the light chain complementary determining region (CDR) sequence recited in SEQ ID NOs: 19, 20, and 21; a hinge domain; a transmembrane domain; a CD2 costimulatory signaling domain comprising the amino acid sequence recited in SEQ ID NO: 28; and an intracellular signaling domain.
[0033] In another aspect, a modified T cell is provided that includes a chimeric antigen receptor (CAR) that specifically binds to MUC1, wherein the CAR includes: a MUC1-specific antigen binding domain including a heavy chain variable (VH) domain and a light chain variable (VL) domain, wherein the VH domain includes the heavy chain complementary determining region (CDR) sequence recited in SEQ ID NOs: 22, 23, and 24, and wherein the VL domain includes the light chain complementary determining region (CDR) sequence recited in SEQ ID NOs: 19, 20, and 21; a CD8 hinge domain; a CD8 transmembrane domain; a CD2 costimulatory signaling domain comprising the amino acid sequence recited in SEQ ID NO: 28; and a CD3 zeta intracellular signaling domain.
[0034] In another aspect, a modified T cell is provided, comprising a chimeric antigen receptor (CAR) that specifically binds to MUCl, the chimeric antigen receptor (CAR) comprising the amino acid sequence set forth in SEQ ID NO: 2, 39, 41, 43, 45 or 47.
[0035] In another aspect, an isolated nucleic acid sequence is provided that encodes a chimeric antigen receptor comprising: a MUCl-specific antigen binding domain comprising a heavy chain variable (VH) domain and a light chain variable (VL) domain, wherein the VH domain comprises the heavy chain complementarity determining region (CDR) sequences recited in SEQ ID NOs: 22, 23, and 24, and wherein the VL domain comprises the light chain complementarity determining region (CDR) sequences recited in SEQ ID NOs: 19, 20, and 21; a transmembrane domain; a costimulatory signaling domain; and an intracellular signaling domain.
[0036] In certain exemplary embodiments, the MUCl-specific antigen binding domain is specific for a carbohydrate epitope of MUCl. In certain exemplary embodiments, the MUCl-specific antigen binding domain is specific for a truncated carbohydrate epitope of MUCl.
[0037] In certain exemplary embodiments, the VH domain comprises the amino acid sequence set forth in SEQ ID NO: 5. In certain exemplary embodiments, the VL domain comprises the amino acid sequence set forth in SEQ ID NO: 6. In certain exemplary embodiments, the VH domain comprises the amino acid sequence set forth in SEQ ID NO: 5, and the VL domain comprises the amino acid sequence set forth in SEQ ID NO: 6. In certain exemplary embodiments, the MUC1-specific antigen-binding domain comprises the amino acid sequence set forth in SEQ ID NO: 4.
[0038] In certain exemplary embodiments, the MUCl -specific antigen binding domain is encoded by a nucleic acid sequence comprising the nucleotide sequence set forth in SEQ ID NO:3.
[0039] In certain exemplary embodiments, the transmembrane domain includes a transmembrane region selected from the group consisting of type I transmembrane proteins, α, β or ζ chains of T cell receptors, CD28, CD2, CD3ε, CD45, CD4, CD5, CD7, CD8, CD9, CD16, CD22, CD33, CD37, CD64, CD80, CD86, CD134 (OX-40), CD137 (4-1BB), CD154 (CD40L), CD278 (ICOS), CD357 (GITR), Toll-like receptor 1 (TLR1), TLR2, TLR3, TLR4, TLR5, TLR6, TLR7, TLR8 and TLR9. In certain exemplary embodiments, the transmembrane domain includes a CD8 transmembrane region. In certain exemplary embodiments, the transmembrane domain is encoded by a nucleic acid sequence comprising the nucleotide sequence recited in SEQ ID NO:8.
[0040] In certain exemplary embodiments, the costimulatory signaling domain comprises a costimulatory domain of a protein selected from the group consisting of a TNFR superfamily member, CD27, CD28, 4-1BB (CD137), OX40 (CD134), CD30, CD40, PD-1, ICOS, lymphoid function-associated antigen-1 (LFA-1), CD2, CD5, CD7, LIGHT, NKG2C, B7-H3, a ligand that specifically binds to CD83, DAP10, DAP12, Lck, Fas, and any derivative or variant thereof. In certain exemplary embodiments, the costimulatory signaling domain is a CD2 costimulatory signaling domain. In certain exemplary embodiments, the costimulatory signaling domain comprises the amino acid sequence set forth in SEQ ID NO: 28. In certain exemplary embodiments, the costimulatory signaling domain is encoded by a nucleic acid sequence comprising the nucleotide sequence set forth in SEQ ID NO: 29.
[0041] In certain exemplary embodiments, the intracellular signaling domain comprises the signaling domain of CD3ζ. In certain exemplary embodiments, the intracellular signaling domain is encoded by a nucleic acid sequence comprising the nucleotide sequence recited in SEQ ID NO: 31.
[0042] In certain exemplary embodiments, the CAR further comprises a CD8 leader sequence. In certain exemplary embodiments, the leader sequence comprises the amino acid sequence recited in SEQ ID NO:48.
[0043] In certain exemplary embodiments, the CAR further comprises a CD8 hinge domain. In certain exemplary embodiments, the hinge domain is encoded by a nucleic acid sequence comprising a nucleic acid sequence recited in SEQ ID NO: 14.
[0044] In another aspect, an isolated nucleic acid sequence is provided that encodes a chimeric antigen receptor comprising: a MUCl-specific antigen binding domain comprising a heavy chain variable (VH) domain and a light chain variable (VL) domain, wherein the VH domain comprises the heavy chain complementarity determining region (CDR) sequences recited in SEQ ID NOs: 22, 23, and 24, and wherein the VL domain comprises the light chain complementarity determining region (CDR) sequences recited in SEQ ID NOs: 19, 20, and 21; a hinge domain; a transmembrane domain; a CD2 costimulatory signaling domain; and an intracellular signaling domain.
[0045] In another aspect, an isolated nucleic acid sequence is provided that encodes a chimeric antigen receptor comprising: a MUCl-specific antigen binding domain comprising a heavy chain variable (VH) domain and a light chain variable (VL) domain, wherein the VH domain comprises the heavy chain complementarity determining region (CDR) sequences recited in SEQ ID NOs: 22, 23, and 24, and wherein the VL domain comprises the light chain complementarity determining region (CDR) sequences recited in SEQ ID NOs: 19, 20, and 21; a hinge domain; a transmembrane domain; a CD2 costimulatory signaling domain comprising a nucleic acid sequence comprising the nucleotide sequence recited in SEQ ID NO: 29; and an intracellular signaling domain.
[0046] In another aspect, an isolated nucleic acid sequence is provided that encodes a chimeric antigen receptor comprising: a MUCl-specific antigen binding domain comprising a heavy chain variable (VH) domain and a light chain variable (VL) domain, wherein the VH domain comprises the heavy chain complementarity determining region (CDR) sequences recited in SEQ ID NOs: 22, 23, and 24, and wherein the VL domain comprises the light chain complementarity determining region (CDR) sequences recited in SEQ ID NOs: 19, 20, and 21; a CD8 hinge domain; a CD8 transmembrane domain; a CD2 costimulatory signaling domain comprising a nucleic acid sequence comprising the nucleotide sequence recited in SEQ ID NO: 29; and a CD3 zeta intracellular signaling domain.
[0047] In another aspect, an isolated nucleic acid sequence encoding a chimeric antigen receptor comprising a nucleic acid sequence comprising the nucleotide sequence set forth in SEQ ID NO: 1, 38, 40, 42, 44, or 46 is provided.
[0048] In another aspect, an isolated nucleic acid sequence is provided that encodes an ICOS costimulatory signaling domain comprising the nucleotide sequence set forth in SEQ ID NO:27.
[0049] In another aspect, a chimeric antigen receptor (CAR) that specifically binds to MUCl is provided, which is encoded by the nucleic acid of any of the preceding embodiments.
[0050] In another aspect, a chimeric antigen receptor (CAR) that specifically binds to MUC1 is provided, comprising: a MUC1-specific antigen binding domain comprising a heavy chain variable (VH) domain and a light chain variable (VL) domain, wherein the VH domain comprises the heavy chain complementarity determining region (CDR) sequences recited in SEQ ID NOs: 22, 23, and 24, and wherein the VL domain comprises the light chain complementarity determining region (CDR) sequences recited in SEQ ID NOs: 19, 20, and 21; a hinge domain; a transmembrane domain; a costimulatory signaling domain; and an intracellular signaling domain.
[0051] In another aspect, a chimeric antigen receptor (CAR) that specifically binds to MUC1 is provided, comprising: a MUC1-specific antigen binding domain comprising a heavy chain variable (VH) domain and a light chain variable (VL) domain, wherein the VH domain comprises the heavy chain complementarity determining region (CDR) sequences recited in SEQ ID NOs: 22, 23, and 24, and wherein the VL domain comprises the light chain complementarity determining region (CDR) sequences recited in SEQ ID NOs: 19, 20, and 21; a hinge domain; a transmembrane domain; a CD2 costimulatory signaling domain comprising the amino acid sequence recited in SEQ ID NO: 28; and an intracellular signaling domain.
[0052] In another aspect, a chimeric antigen receptor (CAR) that specifically binds to MUC1 is provided, comprising: a MUC1-specific antigen binding domain comprising a heavy chain variable (VH) domain and a light chain variable (VL) domain, wherein the VH domain comprises the heavy chain complementarity determining region (CDR) sequences recited in SEQ ID NOs: 22, 23, and 24, and wherein the VL domain comprises the light chain complementarity determining region (CDR) sequences recited in SEQ ID NOs: 19, 20, and 21; a CD8 hinge domain; a CD8 transmembrane domain; a CD2 costimulatory signaling domain comprising the amino acid sequence recited in SEQ ID NO: 28; and a CD3 zeta intracellular signaling domain.
[0053] In another aspect, a chimeric antigen receptor (CAR) that specifically binds to MUCl is provided, comprising the amino acid sequence set forth in SEQ ID NO:47.
[0054] In another aspect, an expression construct is provided, which includes the isolated nucleic acid of any one of the aforementioned embodiments. In certain exemplary embodiments, the expression construct further includes the EF-1α promoter. In certain exemplary embodiments, the expression construct further includes the rev response element (RRE). In certain exemplary embodiments, the expression construct further includes the woodchuck hepatitis virus post-transcriptional regulatory element (WPRE). In certain exemplary embodiments, the expression construct further includes a cPPT sequence. In certain exemplary embodiments, the expression construct further includes the EF-1α promoter, the rev response element (RRE), the woodchuck hepatitis virus post-transcriptional regulatory element (WPRE) and the cPPT sequence.
[0055] In certain exemplary embodiments, the expression construct is a viral vector selected from a retroviral vector, a lentiviral vector, an adenoviral vector, and an adeno-associated viral vector. In certain exemplary embodiments, the expression construct is a lentiviral vector. In certain exemplary embodiments, the expression construct is a self-inactivating lentiviral vector.
[0056] In another aspect, a method is provided for generating the modified immune cell or a precursor cell thereof of any of the preceding embodiments, comprising introducing the isolated nucleic acid of any of the preceding embodiments, or the expression construct of any of the preceding embodiments, into an immune cell or a precursor cell thereof.
[0057] In another aspect, a method of treating a MUCl -related cancer in a subject in need thereof is provided, the method comprising administering to the subject a therapeutically effective composition comprising the modified immune cells of any of the preceding embodiments.
[0058] In certain exemplary embodiments, the MUCl -associated cancer is selected from multiple myeloma, non-small cell lung cancer, breast cancer, pancreatic cancer, ovarian cancer, and fallopian tube cancer.
[0059] In certain exemplary embodiments, the MUC1-associated cancer is breast cancer. In certain exemplary embodiments, the breast cancer is characterized by abnormal glycosylation of MUC1. In certain exemplary embodiments, the breast cancer is selected from hormone receptor-positive breast cancer, hormone receptor-negative breast cancer, estrogen receptor-negative breast cancer, progesterone receptor-negative breast cancer, and Her2 receptor-negative breast cancer. In certain exemplary embodiments, the breast cancer is metastatic breast cancer. In certain exemplary embodiments, the breast cancer is triple-negative breast cancer.
[0060] In another aspect, a method of treating a MUC1-associated cancer in a subject in need thereof is provided, comprising: administering to the subject a therapeutically effective composition comprising modified T cells comprising: a MUC1-specific antigen binding domain comprising a heavy chain variable (VH) domain and a light chain variable (VL) domain, wherein the VH domain comprises the heavy chain complementarity determining region (CDR) sequences recited in SEQ ID NOs: 22, 23, and 24, and wherein the VL domain comprises the light chain complementarity determining region (CDR) sequences recited in SEQ ID NOs: 19, 20, and 21; an optional hinge domain; a transmembrane domain; a costimulatory signaling domain; and an intracellular signaling domain.
[0061] In another aspect, a method of treating MUC1-associated multiple myeloma in a subject in need thereof is provided, comprising: administering to the subject a therapeutically effective composition comprising modified T cells comprising: a MUC1-specific antigen binding domain comprising a heavy chain variable (VH) domain and a light chain variable (VL) domain, wherein the VH domain comprises the heavy chain complementarity determining region (CDR) sequences recited in SEQ ID NOs: 22, 23, and 24, and wherein the VL domain comprises the light chain complementarity determining region (CDR) sequences recited in SEQ ID NOs: 19, 20, and 21; an optional hinge domain; a transmembrane domain; a costimulatory signaling domain; and an intracellular signaling domain.
[0062] In another aspect, a method of treating MUC1-associated non-small cell lung cancer in a subject in need thereof is provided, comprising: administering to the subject a therapeutically effective composition comprising modified T cells comprising: a MUC1-specific antigen binding domain comprising a heavy chain variable (VH) domain and a light chain variable (VL) domain, wherein the VH domain comprises the heavy chain complementarity determining region (CDR) sequences recited in SEQ ID NOs: 22, 23, and 24, and wherein the VL domain comprises the light chain complementarity determining region (CDR) sequences recited in SEQ ID NOs: 19, 20, and 21; optionally, a hinge domain; a transmembrane domain; a costimulatory signaling domain; and an intracellular signaling domain.
[0063] In another aspect, a method of treating MUC1-associated triple-negative breast cancer in a subject in need thereof is provided, comprising: administering to the subject a therapeutically effective composition comprising modified T cells comprising: a MUC1-specific antigen binding domain comprising a heavy chain variable (VH) domain and a light chain variable (VL) domain, wherein the VH domain comprises the heavy chain complementarity determining region (CDR) sequences recited in SEQ ID NOs: 22, 23, and 24, and wherein the VL domain comprises the light chain complementarity determining region (CDR) sequences recited in SEQ ID NOs: 19, 20, and 21; optionally, a hinge domain; a transmembrane domain; a costimulatory signaling domain; and an intracellular signaling domain.
[0064] In another aspect, a method of treating MUC1-associated pancreatic cancer in a subject in need thereof is provided, comprising: administering to the subject a therapeutically effective composition comprising modified T cells comprising: a MUC1-specific antigen binding domain comprising a heavy chain variable (VH) domain and a light chain variable (VL) domain, wherein the VH domain comprises the heavy chain complementarity determining region (CDR) sequences recited in SEQ ID NOs: 22, 23, and 24, and wherein the VL domain comprises the light chain complementarity determining region (CDR) sequences recited in SEQ ID NOs: 19, 20, and 21; an optional hinge domain; a transmembrane domain; a costimulatory signaling domain; and an intracellular signaling domain.
[0065] In another aspect, a method of treating MUC1-associated ovarian and fallopian tube cancer in a subject in need thereof is provided, comprising: administering to the subject a therapeutically effective composition comprising modified T cells comprising: a MUC1-specific antigen binding domain comprising a heavy chain variable (VH) domain and a light chain variable (VL) domain, wherein the VH domain comprises the heavy chain complementarity determining region (CDR) sequences recited in SEQ ID NOs: 22, 23, and 24, and wherein the VL domain comprises the light chain complementarity determining region (CDR) sequences recited in SEQ ID NOs: 19, 20, and 21; an optional hinge domain; a transmembrane domain; a costimulatory signaling domain; and an intracellular signaling domain.
[0066] In certain exemplary embodiments, the method of any of the preceding embodiments further comprises administering lymphodepleting chemotherapy to the subject. In certain exemplary embodiments, the lymphodepleting chemotherapy comprises administering to the subject a therapeutically effective amount of cyclophosphamide. In certain exemplary embodiments, the lymphodepleting chemotherapy comprises administering to the subject a therapeutically effective amount of fludarabine. In certain exemplary embodiments, the lymphodepleting chemotherapy comprises administering to the subject a therapeutically effective amount of cyclophosphamide and a therapeutically effective amount of fludarabine.
[0067] In certain exemplary embodiments, the method of any one of the foregoing embodiments further includes administering a cytokine release syndrome (CRS) management regimen to the subject. In certain exemplary embodiments, the CRS management regimen includes a therapeutically effective amount of tocilizumab. In certain exemplary embodiments, the CRS management regimen includes a therapeutically effective amount of tocilizumab and / or a corticosteroid.
[0068] In certain exemplary embodiments, the modified immune cells or modified T cells are autologous.
[0069] In certain exemplary embodiments, the modified immune cells or modified T cells are administered via intratumoral delivery. In certain exemplary embodiments, the modified immune cells or modified T cells are administered via intravenous delivery. In certain exemplary embodiments, the modified immune cells or modified T cells are administered via intraperitoneal delivery.
[0070] The modified immune cell or precursor cell thereof according to any of the preceding embodiments, for use in the method according to any of the preceding embodiments. The isolated nucleic acid sequence according to any of the preceding embodiments, for use in the method according to any of the preceding embodiments. The chimeric antigen receptor according to any of the preceding embodiments, for use in the method according to any of the preceding embodiments. The expression vector according to any of the preceding embodiments, for use in the method according to any of the preceding embodiments. BRIEF DESCRIPTION OF THE DRAWINGS
[0071] The following detailed description of specific embodiments of the present invention will be better understood when read in conjunction with the accompanying drawings. For the purpose of illustrating the present invention, exemplary embodiments are shown in the accompanying drawings. However, it should be understood that the present invention is not limited to the precise arrangements and means of the embodiments shown in the accompanying drawings.
[0072] Figure 1 is a schematic diagram illustrating the initiation of O-glycan biosynthesis, highlighting the core glycan and associated glycosyltransferases.
[0073] Figure 2A and 2B Figure 1 is a set of graphs illustrating gene expression analysis of MUC1 and glycosylases by qPCR. Gene expression was measured in four breast cancer cell lines (BT-20, MCF7, MDA-MB-231, and MDA-MB-453) and compared to gene expression in the non-tumorigenic breast epithelial cell line MCF10A.
[0074] Figure 3A and 3Bis a set of images depicting the expression of Tn-MUC1 in breast cancer tissues assessed by immunohistochemistry using anti-5E5 antibody. Figure 3A Illustrates 3+ staining in breast cancer tissue without staining of the surrounding stroma. Figure 3B Illustrates 2+ staining in breast cancer tissue without staining of the surrounding stroma.
[0075] Figure 4 Figure 1 is a series of graphs illustrating the results of cytotoxicity assays using anti-Tn-MUC1 CAR T cells and four breast cancer cell lines. 5E5-CAR, CD19-specific CAR, or NTD T cells were co-cultured with breast cancer cell lines at a 10:1 effector:target ratio. Cytolysis was measured by real-time impedance measurement every 15 minutes for 100 hours after T cell addition.
[0076] Figures 5A-5C is a series of charts and images illustrating the discovery that intraperitoneal and intratumoral delivery of 5E5-CAR T cells enhances anti-tumor efficacy.
[0077] Figure 6A and 6B is a series of graphs and images illustrating the finding that intraperitoneal delivery of murine HMFG1-CAR T cells in human MUC1 transgenic mice results in off-target toxicity not observed from murine 5E5-CAR T cells.
[0078] Figures 7A-7C is a series of graphs illustrating gene expression of MUC1, ST6GALNAC1, B3GNT6, C1GALT1, and C1GALT1C1 in 50 patient-derived breast cancer samples compared to the average gene expression in 10 matched patient-derived normal breast tissue samples.
[0079] Figure 8 is a set of flow cytometry graphs showing expression of the various TnMUCl CAR transgenes as indicated.
[0080] Figure 9 Shown are the results of a CFSE assay demonstrating that the indicated various TnMUC1 CAR-T cells proliferated in response to MCF7 cells.
[0081] Figure 10 is a set of three graphs showing, from left to right, the levels of IL-2, TNFa, and IFNg secretion by the various TnMUC1 CAR-T cells indicated.
[0082] Figure 11 is a graph showing the total photon flux per second measured over time in mice after intravenous administration of the indicated various TnMUC1 CAR-T cells.
[0083] Figure 12A and 12B is a graph showing the levels of various TnMUC1 CAR-T cells measured in the peripheral blood of infused mice on day 42 after infusion.
[0084] Figure 13 is a graph demonstrating the cytotoxicity of CART-TnMUC1, CART-TnMUC1-BBz, and negative control cells (CART-19 and NTD) against the Hs766T pancreatic cancer cell line.
[0085] Figures 14A-14C is a series of graphs showing targeted cell killing by CART-TnMUC1 cells of the various cell lines indicated.
[0086] Figure 15A and 15B is a series of graphs showing targeted cell killing by CART-TnMUC1 cells in response to Tn antigens of various cell lines as indicated.
[0087] Figure 16 Shown are a series of graphs depicting bioluminescent imaging of tumor burden in a mouse model of pancreatic cancer.
[0088] Figures 17A-17C is a series of graphs and images showing proliferation of CART-TnMUC1 cells in response to antigen-expressing target cells.
[0089] Figure 18 is a series of graphs showing the production of cytokines and chemokines in various cell lines as indicated.
[0090] Figure 19 is a graph showing data obtained from IFNγ ELISA experiments.
[0091] Figure 20 is a series of graphs showing the quantification of various T cells shown in the peripheral blood of mice on days 21 and 42 after T cell infusion.
[0092] Figure 21 are micrographs of Jurkat CBG / GFP CD19-P2A-Cosmc cells (left) and MCF-7 cells (right) stained with anti-TnMUC1 antibody.
[0093] Figure 22 is a schematic diagram showing the experimental setup used to test the reproducibility of the TnMUC1 CTA assay.
[0094] Figure 23 This is a schematic diagram of the plasmid map of pTRPE_5E5(H2L)_CD2z.
[0095] Figure 24 This is a schematic diagram of the plasmid map of pGEM-SS1-CD2z.
[0096] Figure 25 This is a schematic diagram of the plasmid map of pTRPE_5E5-BBz.
[0097] Figure 26 is a schematic diagram showing the backbone of the pTRPE_5E5(H2L) vector.
[0098] Figure 27 is a schematic diagram showing the study design for the Phase 1 and Phase 1a portions of the clinical trial.
[0099] Figure 28 is a schematic diagram showing the overall patient pathway for a clinical trial.
[0100] Figure 29 is a schematic diagram showing the dose escalation scheme for a clinical trial.
[0101] Figure 30 is a schematic diagram showing the dose escalation cohorts of the clinical trial.
[0102] Figure 31 is a series of graphs showing the total cell number of T cells from 5 different normal healthy donors transduced with the indicated CARs.
[0103] Figure 32 is a series of graphs showing population doublings of T cells from five different normal healthy donors transduced with the indicated CARs.
[0104] Figure 33 is a series of graphs showing the average cell volume of T cells from four different normal healthy donors transduced with the indicated CARs.
[0105] Figure 34 is a set of flow cytometry graphs showing expression of the indicated CARs in T cells from five different normal healthy donors. DETAILED DESCRIPTION
[0106] definition
[0107] Unless otherwise defined, all technical and scientific terms used herein have the same meaning as commonly understood by one of ordinary skill in the art to which the invention belongs. Although any methods and materials similar or equivalent to those described herein can be used to test the practice of the present invention, preferred materials and methods are described herein. In describing and claiming the present invention, the following terminology will be used.
[0108] It is also to be understood that the terminology used herein is for the purpose of describing particular embodiments only and is not intended to be limiting.
[0109] The articles "a" and "an" are used herein to refer to one or to more than one (ie, to at least one) of the grammatical object of the article. By way of example, "an element" means one element or more than one element.
[0110] As used herein, "about," when referring to a measurable value such as an amount, a time period, and the like, is meant to include variations of ±20% or ±10%, more preferably ±5%, even more preferably ±1%, and still more preferably ±0.1% from the given value, as long as such variations are appropriate to practice the disclosed methods.
[0111] "Activation," as used herein, refers to a state of T cells that have been sufficiently stimulated to induce detectable cell proliferation. Activation can also be associated with induced cytokine production and detectable effector function. The term "activated T cell" and the like refer to a T cell that has undergone cell division.
[0112] As used herein, the term "alleviating" a disease means reducing the severity of one or more symptoms of a disease.
[0113] "Allogeneic" refers to any material derived from different animals of the same species.
[0114] The term "antibody", as used herein, refers to an immunoglobulin molecule that specifically binds to an antigen. An antibody can be a complete immunoglobulin derived from a natural source or from a recombinant source, and can be an immunoreactive portion of a complete immunoglobulin. An antibody is typically a tetramer of an immunoglobulin molecule. The antibodies of the present invention can exist in various forms, including, for example, polyclonal antibodies, monoclonal antibodies, Fv, Fab and F(ab)2, as well as single-chain antibodies (scFv) and humanized antibodies (Harlow et al., 1999, In: Using Antibodies: A Laboratory Manual, Cold Spring Harbor Laboratory Press, NY; Harlow et al., 1989, In: Antibodies: A Laboratory Manual, Cold Spring Harbor, New York; Houston et al., 1988, Proc. Natl. Acad. Sci. USA 85: 5879-5883; Bird et al., 1988, Science 242: 423-426).
[0115] The term "antibody fragment" refers to a portion of an intact antibody and refers to the antigen-determining variable region of an intact antibody. Examples of antibody fragments include, but are not limited to, Fab, Fab', F(ab')2, and Fv fragments, linear antibodies formed from antibody fragments, scFv antibodies, and multispecific antibodies.
[0116] "Antibody heavy chain," as used herein, refers to the larger of the two types of polypeptide chains present in their naturally occurring conformation in all antibody molecules.
[0117] "Antibody light chain," as used herein, refers to the smaller of the two types of polypeptide chains present in their naturally occurring conformations in all antibody molecules, alpha and beta light chains referring to the two major antibody light chain isotypes.
[0118] The term "synthetic antibody," as used herein, refers to an antibody produced using recombinant DNA technology, such as, for example, an antibody expressed by a bacteriophage as described herein. The term should also be construed to refer to an antibody that has been produced by the synthesis of a DNA molecule encoding the antibody and expressing the antibody protein or an amino acid sequence specifying the antibody, wherein the DNA or amino acid sequence has been obtained using synthetic DNA or amino acid sequence technology available and widely known in the art.
[0119] As used herein, the term "antigen" or "Ag" is defined as a molecule that stimulates an immune response. The immune response may involve antibody production, or the activation of specific immune competent cells, or both. The skilled person will understand that any macromolecule, including virtually all proteins or peptides, can be used as an antigen. In addition, antigens can be derived from recombinant or genomic DNA. The skilled person will understand that any DNA, including a nucleotide sequence or partial nucleotide sequence encoding a protein that causes an immune response, therefore encodes the term "antigen" as used herein. In addition, those skilled in the art will understand that an antigen need not be encoded solely by the full-length nucleotide sequence of a gene. It will be readily apparent that the present invention includes, but is not limited to, the use of partial nucleotide sequences of more than one gene, and that these nucleotide sequences are arranged in different combinations to elicit a desired immune response. Moreover, the skilled person will understand that an antigen need not be encoded by a "gene" at all. It will be readily apparent that an antigen can be produced, synthesized, or can be derived from a biological sample. Such a biological sample may include, but is not limited to, a tissue sample, a tumor sample, a cell, or a biological fluid.
[0120] As used herein, the term "autologous" refers to any substance originating from the same individual that is subsequently reintroduced into that individual.
[0121] As used herein, the term "chimeric antigen receptor" or "CAR" refers to an artificial T cell receptor that is engineered to be expressed on immune effector cells and specifically binds to an antigen. CAR can be used as adoptive cell transfer therapy. T cells are removed from the patient's body and modified to express receptors that are specific for a specific form of the antigen. In some embodiments, CAR is specific for a selected target. CAR may also include an intracellular activation domain, a transmembrane domain, and an extracellular domain that includes an antigen binding region.
[0122] The term "cleavage" refers to the rupture of a covalent bond (e.g., in the backbone of a nucleic acid molecule) or the hydrolysis of a peptide bond. Cutting can be initiated by a variety of methods, including but not limited to enzymatic or chemical hydrolysis of a phosphodiester bond. Both single-stranded and double-stranded cleavage are possible. Double-stranded cleavage can occur as a result of two different single-stranded cleavage events. DNA cleavage can result in the production of blunt ends or staggered ends. In some embodiments, fusion polypeptides can be used for targeted cleavage of double-stranded DNA.
[0123] As used herein, the term "conservative sequence modification" is intended to refer to amino acid modifications that do not significantly affect or change the binding characteristics of the antibody containing the amino acid sequence. Such conservative modifications include amino acid substitutions, additions and deletions. Modifications can be introduced into the antibodies of the present invention by standard techniques known in the art, such as site-directed mutagenesis and PCR-mediated mutagenesis. Conservative amino acid substitutions are substitutions in which an amino acid residue is replaced by an amino acid residue with a similar side chain. Families of amino acid residues with similar side chains have been defined in the art. These families include amino acids with basic side chains (e.g., lysine, arginine, histidine), acidic side chains (e.g., aspartic acid, glutamic acid), uncharged polar side chains (e.g., glycine, asparagine, glutamine, serine, threonine, tyrosine, cysteine, tryptophan), non-polar side chains (e.g., alanine, valine, leucine, isoleucine, proline, phenylalanine, methionine), β-branched side chains (e.g., threonine, valine, isoleucine) and aromatic side chains (e.g., tyrosine, phenylalanine, tryptophan, histidine). Thus, one or more amino acid residues within the CDR regions of an antibody can be replaced with other amino acid residues from the same side chain family, and the altered antibody can be tested for its ability to bind antigen using the functional assays described herein.
[0124] As used herein, the term "costimulatory ligand" includes molecules on antigen presenting cells (e.g., aAPCs, dendritic cells, B cells, etc.) that specifically bind to cognate costimulatory molecules on T cells, thereby providing signals that mediate T cell responses, including but not limited to proliferation, activation, differentiation, etc., in addition to the primary signal provided by, for example, binding of the TCR / CD3 complex to an MHC molecule loaded with a peptide. Costimulatory ligands may include, but are not limited to, CD7, B7-1 (CD80), B7-2 (CD86), PD-L1, PD-L2, 4-1BBL, OX40L, inducible co-stimulatory ligand (ICOS-L), intercellular adhesion molecule (ICAM), CD30L, CD40, CD70, CD83, HLA-G, MICA, MICB, HVEM, lymphotoxin beta receptor, 3 / TR6, ILT3, ILT4, HVEM, agonists or antibodies that bind to Toll ligand receptors, and ligands that specifically bind to B7-H3. Co-stimulatory ligands also include, in particular, antibodies that specifically bind to co-stimulatory molecules present on T cells, such as, but not limited to, CD27, CD28, 4-1BB, OX40, CD30, CD40, PD-1, ICOS, lymphoid function-associated antigen-1 (LFA-1), CD2, CD7, LIGHT, NKG2C, B7-H3, and ligands that specifically bind to CD83.
[0125] "Costimulatory molecule" refers to a cognate binding partner on a T cell that specifically binds to a costimulatory ligand, thereby mediating a costimulatory response of the T cell, such as, but not limited to, proliferation. Costimulatory molecules include, but are not limited to, MHC class I molecules, BTLA, and Toll ligand receptors.
[0126] As used herein, "co-stimulatory signal" refers to a signal that, in conjunction with a primary signal (such as TCR / CD3 ligation), results in T cell proliferation and / or up-regulation or down-regulation of key molecules.
[0127] A "disease" is a health state in an animal in which the animal is unable to maintain homeostasis, and in which the animal's health continues to deteriorate if the disease is not ameliorated. In contrast, a "disorder" in an animal is a health state in which the animal is able to maintain homeostasis, but in which the animal's health state is less favorable than it would be if it were not in the disorder. Remaining untreated, the disorder does not necessarily cause a further deterioration in the animal's health state.
[0128] "Donor antigen" refers to an antigen expressed by the donor tissue to be transplanted into the recipient.
[0129] "Recipient antigen" refers to the target of the immune response to the donor antigen.
[0130] As used herein, the term "downregulate" refers to reducing or eliminating gene expression of one or more genes.
[0131] "Effective amount" or "therapeutically effective amount" are used interchangeably herein and refer to an amount of a compound, formulation, material or composition as described herein that is effective to achieve a specific biological result, or to provide a therapeutic or preventive benefit. Such results may include, but are not limited to, an amount of the composition that, when administered to a mammal, causes a detectable level of immunosuppression or immune tolerance compared to the immune response detected in the absence of the composition of the invention. The immune response can be readily assessed using a number of methods recognized in the art. It will be understood by those skilled in the art that the amount of the composition administered herein varies and can be readily determined based on many factors, such as the disease or condition being treated, the age and health and physical condition of the mammal being treated, the severity of the disease, and the specific compound being administered.
[0132] "Coding" refers to the intrinsic properties of a specific nucleotide sequence in a polynucleotide (such as a gene, cDNA or mRNA) as a template for synthesizing other polymers and macromolecules with a definite nucleotide sequence (e.g., rRNA, tRNA and mRNA) or a definite amino acid sequence in a biological process, and the resulting biological properties. Therefore, if transcription and translation of the mRNA corresponding to a gene produce a protein in a cell or other biological system, the gene encodes the protein. Coding strands (whose nucleotide sequence is identical to the mRNA sequence and is generally provided in a sequence table) and non-coding strands (used as templates for gene or cDNA transcription) can be referred to as coded proteins or other products of the gene or cDNA.
[0133] As used herein, "endogenous" refers to any substance that originates from or is produced within an organism, cell, tissue, or system.
[0134] As used herein, the term "epitope" is defined as a small chemical molecule on an antigen that can trigger an immune response, inducing a B and / or T cell response. An antigen may have one or more epitopes. Most antigens have multiple epitopes; that is, they are multivalent. Typically, an epitope is about 10 amino acids and / or sugars in size. In certain exemplary embodiments, an epitope is about 4 to 18 amino acids, about 5 to 16 amino acids, about 6 to 14 amino acids, about 7 to 12 amino acids, or about 8 to 10 amino acids. It will be understood by those skilled in the art that, in general, the overall three-dimensional structure of the molecule, rather than its specific linear sequence, is the primary criterion for antigen specificity, thereby distinguishing different epitopes. Based on the present disclosure, the peptides used in the present invention can be epitopes.
[0135] As used herein, the term "exogenous" refers to any substance that is introduced from or produced outside an organism, cell, tissue, or system.
[0136] As used herein, the term "expand" refers to an increase in number, such as an increase in the number of T cells. In one embodiment, the number of T cells expanded ex vivo is increased relative to the number initially present in the culture medium. In another embodiment, the number of T cells expanded ex vivo is increased relative to other cell types in the culture medium. As used herein, the term "ex vivo" refers to cells that have been removed from a living organism (such as a human) and propagated outside the organism (e.g., in a culture dish, test tube, or bioreactor).
[0137] As used herein, the term "expression" is defined as the transcription and / or translation of a specific nucleotide sequence driven by its promoter.
[0138] "Expression vector" refers to a vector comprising a recombinant polynucleotide comprising an expression control sequence operably linked to a nucleotide sequence to be expressed. An expression vector comprises sufficient cis-acting elements for expression; other elements for expression may be supplied by the host cell or in an in vitro expression system. Expression vectors include all those known in the art, such as cosmids, plasmids (e.g., naked or contained in liposomes), and viruses (e.g., Sendai virus, lentivirus, retrovirus, adenovirus, and adeno-associated virus) that incorporate a recombinant polynucleotide.
[0139] As used herein, "homologous" refers to the subunit sequence identity between two polymeric molecules, such as between two nucleic acid molecules, such as between two DNA molecules or two RNA molecules, or between two polypeptide molecules. When a subunit position in the two molecules is occupied by the same monomeric subunit; for example, if a position in each of the two DNA molecules is occupied by adenine, then they are homologous at that position. The homology between two sequences is a direct function of the number of matching or homologous positions; for example, if half of the positions in the two sequences (e.g., five positions in a polymer that is ten subunits in length) are homologous, then the two sequences are 50% homologous; if 90% of the positions (e.g., 9 out of 10) are matched or homologous, then the two sequences are 90% homologous.
[0140] " humanized " form of non-human (such as murine) antibody is chimeric immunoglobulin, immunoglobulin chain or its fragment (such as Fv, Fab, Fab ', F (ab ') 2 or other antigen binding subsequences of antibody), which contains the minimum sequence from non-human immunoglobulin. In most cases, humanized antibody is human immunoglobulin (receptor antibody), wherein the residues from the complementary determining region (CDR) of receptor are replaced by the residues of CDR with required specificity, affinity and ability from non-human species (such as mouse, rat or rabbit) (donor antibody). In some cases, the Fv framework region (FR) residues of human immunoglobulin are replaced by corresponding non-human residues. In addition, humanized antibody can include residues that are neither found in the CDR or framework sequence of receptor antibody nor in the imported one. These modifications can further improve and optimize antibody performance. Generally, a humanized antibody will include substantially all of the following: at least one and typically two variable domains, wherein all or substantially all of the CDR regions correspond to those of a non-human immunoglobulin, and all or substantially all of the FR regions are those of a human immunoglobulin sequence. The humanized antibody will also optimally include at least a portion of an immunoglobulin constant region (Fc), typically at least a portion of a human immunoglobulin constant region. For further details, see Jones et al., Nature, 321: 522-525, 1986; Reichmann et al., Nature, 332: 323-329, 1988; Presta, Curr. Op. Struct. Biol., 2: 593-596, 1992.
[0141] "Fully human" refers to an immunoglobulin, such as an antibody, in which the entire molecule is of human origin or consists of an amino acid sequence identical to the human form of an antibody.
[0142] As used herein, the term "identity" refers to the subunit sequence identity between two polymeric molecules, particularly between two amino acid molecules, such as two polypeptide molecules. When the same position of two amino acid sequences has the same residue, for example, if a position in each of the two polypeptide molecules is occupied by arginine, then they are identical at that position. The identity or degree to which two amino acid sequences have the same residue in the same aligned position is usually expressed as a percentage. The identity between two amino acid sequences is a direct function of the number of matching or identical positions, for example, if half of the positions in the two sequences (e.g., 5 positions in a polymer of 10 amino acids in length) are identical, then the two sequences are 50% identical; if 90% of the positions (e.g., 9 out of 10) are matched or identical, then the two amino acid sequences are 90% identical.
[0143] As used herein, the term "immunoglobulin" or "Ig" is defined as a class of proteins that act as antibodies. Antibodies expressed by B cells are sometimes referred to as BCRs (B cell receptors) or antigen receptors. The five members included in this class of proteins are IgA, IgG, IgM, IgD, and IgE. IgA is a primary antibody found in body secretions such as saliva, tears, breast milk, gastrointestinal secretions, and mucous secretions of the respiratory and urogenital tracts. IgG is the most common circulating antibody. IgM is the main immunoglobulin produced in the primary immune response of most subjects. It is the most effective immunoglobulin in agglutination reactions, complement fixation, and other antibody responses, and is important in resisting bacteria and viruses. IgD is an immunoglobulin that does not have a known antibody function but can be used as an antigen receptor. IgE is an immunoglobulin that mediates immediate allergic reactions after exposure to allergens by causing the release of mediators from mast cells and basophils.
[0144] As used herein, the term "immune response" is defined as a cellular response to an antigen that occurs when lymphocytes recognize the antigenic molecule as foreign and induce antibody formation and / or activate lymphocytes to remove the antigen.
[0145] As used herein, the term "immunostimulation" refers to increasing the overall immune response.
[0146] As used herein, the term "immunosuppression" refers to a decrease in the overall immune response.
[0147] As used herein, "instructional materials" include publications, recordings, diagrams, or any other medium of expression that can be used to convey the usefulness of the compositions and methods of the present invention. The instructional materials of the kits of the present invention can, for example, be affixed to a container containing the nucleic acids, peptides, and / or compositions of the present invention, or can be shipped with the container containing the nucleic acids, peptides, and / or compositions. Alternatively, the instructional materials can be shipped separately from the container so that the instructional materials and the compound can be used together by the recipient.
[0148] The term "isolated" means altered or removed from its native state. For example, a nucleic acid or peptide naturally present in a living animal is not "isolated," but the same nucleic acid or peptide partially or completely separated from the coexisting materials of its native state is "isolated." An isolated nucleic acid or protein can exist in a substantially purified form or can exist in a non-native environment (such as, for example, a host cell).
[0149] As used herein, the term "knockdown" refers to a decrease in gene expression of one or more genes.
[0150] As used herein, the term "knockout" refers to the elimination of gene expression of one or more genes.
[0151] As used herein, "lentivirus" refers to a genus of the Retroviridae family. Lentiviruses are unique among retroviruses in their ability to infect non-dividing cells; they can deliver significant amounts of genetic information into the host cell's DNA, making them one of the most effective gene delivery vectors. HIV, SIV, and FIV are all examples of lentiviruses. Lentivirus-derived vectors provide tools for achieving significant levels of gene transfer in vivo.
[0152] As used herein, the term "limited toxicity" refers to the fact that the peptides, polynucleotides, cells and / or antibodies of the present invention exhibit substantially no negative biological effects, anti-tumor effects or substantially no negative physiological symptoms on healthy cells, non-tumor cells, non-diseased cells, non-target cells or populations of such cells in vitro or in vivo.
[0153] As used herein, the term "modified" refers to an alteration in the state or structure of a molecule or cell of the invention. Molecules can be modified in a variety of ways, including chemically, structurally, and functionally. Cells can be modified by the introduction of nucleic acids.
[0154] As used herein, the term "modulate" refers to mediating a detectable increase or decrease in the level of a response in a subject compared to the level of the response in the subject in the absence of the treatment or compound, and / or compared to the level of the response in an otherwise identical but untreated subject. The term includes perturbing and / or influencing a natural signal or response, thereby mediating a beneficial therapeutic response in a subject (e.g., a human).
[0155] In the context of the present invention, the following abbreviations are used for commonly occurring nucleic acid bases: "A" refers to adenosine, "C" refers to cytosine, "G" refers to guanosine, "T" refers to thymidine, and "U" refers to uridine.
[0156] Unless otherwise specified, a "nucleotide sequence encoding an amino acid sequence" includes all nucleotide sequences that are degenerate versions of each other and that encode the same amino acid sequence. The phrase "nucleotide sequence encoding a protein or RNA" may also include introns, to the extent that a nucleotide sequence encoding the protein may include intron(s) in certain versions.
[0157] "Parenteral" administration of the immunogenic composition includes, for example, subcutaneous (sc), intravenous (iv), intramuscular (im) or intrasternal injection, or infusion techniques.
[0158] As used herein, the term "polynucleotide" is defined as a chain of nucleotides. In addition, nucleic acid is a polymer of nucleotides. Therefore, nucleic acid and polynucleotide as used herein are interchangeable. It is generally known to those skilled in the art that nucleic acids are polynucleotides, which can be hydrolyzed into monomeric "nucleotides." Monomeric nucleotides can be hydrolyzed into nucleosides. As used herein, polynucleotides include, but are not limited to, all nucleic acid sequences obtained by any means available in the art and by synthetic means, any means including, but not limited to, recombinant means, i.e., cloning from a recombinant library or a cell genome nucleic acid sequence using conventional cloning techniques and PCR™.
[0159] As used herein, the terms "peptide," "polypeptide," and "protein" are used interchangeably and refer to compounds composed of amino acid residues covalently linked by peptide bonds. A protein or peptide must contain at least two amino acids, and there is no limit to the maximum number of amino acids that can constitute a protein or peptide sequence. A polypeptide includes any peptide or protein comprising two or more amino acids linked to each other by peptide bonds. As used herein, the term refers to short chains, such as those commonly referred to in the art as peptides, oligopeptides, and oligomers, and also to longer chains, which are commonly referred to in the art as proteins, of which there are many types. "Polypeptide" includes, for example, biologically active fragments, substantially homologous polypeptides, oligopeptides, homodimers, heterodimers, variants of polypeptides, modified polypeptides, derivatives, analogs, fusion proteins, and the like. Polypeptides include natural peptides, recombinant peptides, synthetic peptides, or combinations thereof.
[0160] As used herein, the term "autoantigen" is defined as an antigen expressed by a host cell or tissue. An autoantigen may be a tumor antigen, but in certain embodiments, it is expressed in both normal cells and tumor cells. A skilled artisan will readily appreciate that an autoantigen may be overexpressed in a cell.
[0161] As used herein, the term "specific binding" with respect to an antibody refers to an antibody that recognizes a specific antigen but does not substantially recognize or bind to other molecules in the sample. For example, an antibody that specifically binds to an antigen from one species may also bind to antigens from one or more species. However, this cross-species reactivity itself does not change the specificity of the antibody. In another example, an antibody that specifically binds to an antigen may also bind to different allelic forms of the antigen. However, this cross-reactivity itself does not change the specificity of the antibody. In some examples, the term "specific binding" or "specifically binds" can be used with reference to the interaction between an antibody, protein, or peptide and a second chemical species to refer to the presence of a specific structure (e.g., an antigenic determinant or epitope) on the chemical species; for example, an antibody recognizes and binds to a specific protein structure rather than generally recognizing and binding proteins. If the antibody is specific for epitope "A," the presence of molecules comprising epitope A (or free, unlabeled A) in a reaction comprising labeled "A" and the antibody will reduce the amount of labeled A bound to the antibody.
[0162] The term "stimulation" refers to a primary response induced by binding of a stimulatory molecule (e.g., a TCR / CD3 complex) to its cognate ligand, thereby mediating a signal transduction event (such as, but not limited to, signal transduction via the TCR / CD3 complex). Stimulation can mediate altered expression of certain molecules, such as downregulation of TGF-β and / or reorganization of cytoskeletal structure.
[0163] "Stimulatory molecule," as the term is used herein, refers to a molecule on a T cell that specifically binds to a cognate stimulatory ligand present on an antigen presenting cell.
[0164] As used herein, "stimulatory ligand" refers to a ligand that, when present on an antigen presenting cell (e.g., aAPC, dendritic cell, B-cell, etc.), can specifically bind to a cognate binding partner (referred to herein as a "stimulatory molecule") on a T cell, thereby mediating a primary response of the T cell, including, but not limited to, activation, initiation of an immune response, proliferation, etc. Stimulatory ligands are well known in the art and include, inter alia, MHC class I molecules loaded with peptides, anti-CD3 antibodies, superagonist anti-CD28 antibodies, and superagonist anti-CD2 antibodies.
[0165] The term "subject" is intended to include living organisms (e.g., mammals) in which an immune response can be elicited. As used herein, a "subject" or "patient" can be a human or a non-human mammal. Non-human mammals include, for example, livestock and pets such as sheep, cattle, pigs, canines, felines, and murine mammals. In an exemplary embodiment, the subject is a human.
[0166] As used herein, "substantially purified" cells are cells that are substantially free of other cell types. Substantially purified cells also refer to cells that have been separated from other cell types with which they are naturally associated in their naturally occurring state. In some cases, a substantially purified cell population refers to a homogenous group of cells. In other cases, the term refers only to cells that have been separated from cells with which they are naturally associated in their naturally occurring state. In some embodiments, the cells are cultured in vitro. In other embodiments, the cells are not cultured in vitro.
[0167] "Target site" or "target sequence" refers to a genomic nucleic acid sequence that defines a portion of the nucleic acid to which a binding molecule will specifically bind under conditions sufficient for binding to occur.
[0168] As used herein, the term "T cell receptor" or "TCR" refers to a membrane protein complex involved in activating T cells in response to antigen presentation. The TCR is responsible for recognizing antigens bound to major histocompatibility complex molecules. The TCR consists of a heterodimer of α (alpha) and β (beta) chains, although in some cells the TCR consists of γ and δ (γ / δ) chains. TCRs may exist in α / β and γ / δ forms, which are structurally similar but have different anatomical locations and functions. Each chain consists of two extracellular domains: a variable domain and a constant domain. In some embodiments, the TCR can be modified on any cell that contains a TCR, including, for example, helper T cells, cytotoxic T cells, memory T cells, regulatory T cells, natural killer T cells, and γδ T cells.
[0169] As used herein, the term "therapeutic" means treatment and / or prevention. A therapeutic effect is achieved by the inhibition, alleviation or eradication of the disease state.
[0170] As used herein, the term "transfected" or "transformed" or "transduced" refers to the process of transferring or introducing exogenous nucleic acid into a host cell. A "transfected" or "transformed" or "transduced" cell is a cell that has been transfected, transformed, or transduced with exogenous nucleic acid. Cells include primary subject cells and their progeny.
[0171] As used herein, the term "treat," "treat," or "treating" refers to reducing the frequency or severity of at least one sign or symptom of a disease or disorder experienced by a subject.
[0172] A "vector" is a composition of matter that includes an isolated nucleic acid and can be used to deliver the isolated nucleic acid to the interior of a cell. Many vectors are known in the art, including but not limited to linear polynucleotides, polynucleotides associated with ions or amphiphilic compounds, plasmids, and viruses. Therefore, the term "vector" includes autonomously replicating plasmids or viruses. The term should also be interpreted to include non-plasmids and non-viral compounds that facilitate the transfer of nucleic acids into cells, such as polylysine compounds, liposomes, etc. Examples of viral vectors include but are not limited to Sendai virus vectors, adenovirus vectors, adeno-associated virus vectors, retroviral vectors, lentiviral vectors, etc.
[0173] "Xenogeneic" refers to any substance that originates from an animal of a different species.
[0174] Range: Throughout this disclosure, various aspects of the invention may be presented in the form of ranges. It should be understood that descriptions in range format are merely for convenience and brevity and should not be construed as inflexible limitations on the scope of the invention. Thus, descriptions of ranges should be considered to specifically disclose all possible subranges as well as single numbers within the range. For example, description of a range from 1 to 6 should be considered to have specifically disclosed subranges such as 1 to 3, 1 to 4, 1 to 5, 2 to 4, 2 to 6, 3 to 6, etc., as well as single numbers within the range, such as 1, 2, 2.7, 3, 4, 5, 5.3, and 6. This applies regardless of the size of the range.
[0175] illustrate
[0176] The present invention provides a MUC1-specific chimeric antigen receptor (CAR; e.g., Tn-MUC1 CAR) and modified cells comprising the receptor. Compositions and methods for treating cancer using MUC1-specific CAR are also provided. Specifically, the Tn-MUC1 CAR of the present invention can be used to treat both liquid tumors (e.g., multiple myeloma, etc.) and solid tumors (e.g., breast cancer, non-small cell lung cancer, ovarian cancer and fallopian tube cancer, pancreatic cancer, etc.).
[0177] Here, we demonstrate that Tn-MUC1 is a compelling tumor-specific antigen for antibody-directed adoptive immunotherapy in multiple cancers. CAR T cells directed against Tn-MUC1 exhibit potent cytolytic activity against cancer cell lines in vitro and significant tumor eradication in vivo. Strategies targeting MUC1 outside the context of tumor-specific glycosylation may exhibit off-target toxicity, but CAR T cells targeting Tn-MUC1 overcome potential toxicities and extend the therapeutic window for solid tumors such as breast cancer.
[0178] Chimeric Antigen Receptor (CAR)
[0179] The present invention provides compositions and methods for modified immune cells or their precursor cells (e.g., modified T cells) comprising a chimeric antigen receptor (CAR) with affinity for a glycosylated form of MUC1 or MUC1 (e.g., Tn-MUC1). The subject CAR of the present invention includes an antigen binding domain (e.g., a Tn-MUC1 binding domain), a transmembrane domain, a costimulatory signaling domain, and an intracellular signaling domain. The subject CAR of the present invention may optionally include a hinge domain. Therefore, the subject CAR of the present invention includes an antigen binding domain (e.g., a Tn-MUC1 binding domain), a hinge domain, a transmembrane domain, a costimulatory signaling domain, and an intracellular signaling domain. In some embodiments, each domain of the subject CAR is separated by a linker.
[0180] The antigen binding domain can be operably connected to another domain of CAR, such as a transmembrane domain, a costimulatory signaling domain, or an intracellular signaling domain (each described elsewhere herein) for expression in a cell. In one embodiment, the first nucleic acid sequence encoding the antigen binding domain is operably connected to the second nucleic acid encoding the transmembrane domain, and is further operably connected to the third nucleic acid sequence encoding the costimulatory signaling domain structure.
[0181] The antigen binding domains described herein can be combined with any transmembrane domain, any costimulatory signaling domain, any intracellular signaling domain, or any other domain described herein that can be included in a CAR of the invention.
[0182] In one aspect, the present invention includes a chimeric antigen receptor (CAR) that specifically binds to MUCl, comprising: a MUCl-specific antigen binding domain, an optional hinge domain, a transmembrane domain, a co-stimulatory signaling domain, and an intracellular signaling domain.
[0183] In one aspect, the present invention includes a chimeric antigen receptor (CAR) that specifically binds to MUCl, comprising: a TnMUCl-specific antigen binding domain, an optional hinge domain, a transmembrane domain, a co-stimulatory signaling domain, and an intracellular signaling domain.
[0184] In an exemplary embodiment, the present invention comprises a chimeric antigen receptor (CAR) that specifically binds to MUC1, comprising: a MUC1-specific antigen binding domain comprising a heavy chain variable (VH) domain and a light chain variable (VL) domain, wherein the VH domain comprises the heavy chain complementary determining region (CDR) sequences recited in SEQ ID NOs: 22, 23, and 24, and wherein the VL domain comprises the light chain complementary determining region (CDR) sequences recited in SEQ ID NOs: 19, 20, and 21; a CD8 hinge domain; a CD8 transmembrane domain; a CD2 costimulatory signaling domain; and a CD3 zeta intracellular signaling domain.
[0185] In an exemplary embodiment, the present invention comprises a chimeric antigen receptor (CAR) that specifically binds to MUC1, comprising: a MUC1-specific antigen binding domain comprising a heavy chain variable (VH) domain and a light chain variable (VL) domain, wherein the VH domain comprises the heavy chain complementary determining region (CDR) sequences recited in SEQ ID NOs: 22, 23, and 24, and wherein the VL domain comprises the light chain complementary determining region (CDR) sequences recited in SEQ ID NOs: 19, 20, and 21; a CD8 hinge domain; a CD8 transmembrane domain; a 4-1BB costimulatory signaling domain; and a CD3 zeta intracellular signaling domain.
[0186] In an exemplary embodiment, the invention comprises a chimeric antigen receptor (CAR) that specifically binds to MUC1, comprising: a MUC1-specific antigen binding domain comprising a heavy chain variable (VH) domain and a light chain variable (VL) domain, wherein the VH domain comprises the heavy chain complementarity determining region (CDR) sequences recited in SEQ ID NOs: 22, 23, and 24, and wherein the VL domain comprises the light chain complementarity determining region (CDR) sequences recited in SEQ ID NOs: 19, 20, and 21; a CD8 hinge domain; a CD8 transmembrane domain; an ICOS costimulatory signaling domain; and a CD3 zeta intracellular signaling domain.
[0187] In some embodiments, the genetically modified immune cells (e.g., T cells) or their precursor cells of the present invention comprise a chimeric antigen receptor (CAR) with affinity for MUC1. In some embodiments, the genetically modified immune cells (e.g., T cells) or their precursor cells of the present invention comprise a chimeric antigen receptor (CAR) with affinity for Tn-MUC1.
[0188] In certain embodiments, the genetically modified cells are T cells. In certain embodiments, the genetically modified cells are natural killer (NK) cells. In certain embodiments, the genetically modified cells are NKT cells.
[0189] Thus, in one exemplary embodiment, provided herein are genetically modified T cells comprising a chimeric antigen receptor (CAR) that specifically binds to MUCl, the chimeric antigen receptor (CAR) comprising: a MUCl-specific antigen binding domain, an optional hinge domain, a transmembrane domain, a co-stimulatory signaling domain, and an intracellular signaling domain.
[0190] Thus, in one exemplary embodiment, provided herein are genetically modified T cells comprising a chimeric antigen receptor (CAR) that specifically binds to MUC1, the chimeric antigen receptor (CAR) comprising: a TnMUC1-specific antigen binding domain, an optional hinge domain, a transmembrane domain, a co-stimulatory signaling domain, and an intracellular signaling domain.
[0191] Thus, in one exemplary embodiment, the present invention provides a chimeric antigen receptor (CAR) that specifically binds to MUC1, the chimeric antigen receptor (CAR) comprising: a MUC1-specific antigen binding domain comprising a heavy chain variable (VH) domain and a light chain variable (VL) domain, wherein the VH domain comprises the heavy chain complementary determining region (CDR) sequence recited in SEQ ID NOs: 22, 23, and 24, and wherein the VL domain comprises the light chain complementary determining region (CDR) sequence recited in SEQ ID NOs: 19, 20, and 21; a CD8 hinge domain; a CD8 transmembrane domain; a CD2 costimulatory signaling domain; and a CD3 zeta intracellular signaling domain.
[0192] Thus, in one exemplary embodiment, the present invention provides a chimeric antigen receptor (CAR) that specifically binds to MUC1, the chimeric antigen receptor (CAR) comprising: a MUC1-specific antigen binding domain comprising a heavy chain variable (VH) domain and a light chain variable (VL) domain, wherein the VH domain comprises the heavy chain complementary determining region (CDR) sequence recited in SEQ ID NOs: 22, 23, and 24, and wherein the VL domain comprises the light chain complementary determining region (CDR) sequence recited in SEQ ID NOs: 19, 20, and 21; a CD8 hinge domain; a CD8 transmembrane domain; a 4-1BB costimulatory signaling domain; and a CD3 zeta intracellular signaling domain.
[0193] Thus, in one exemplary embodiment, the present invention provides a chimeric antigen receptor (CAR) that specifically binds to MUC1, the chimeric antigen receptor (CAR) comprising: a MUC1-specific antigen binding domain comprising a heavy chain variable (VH) domain and a light chain variable (VL) domain, wherein the VH domain comprises the heavy chain complementary determining region (CDR) sequence recited in SEQ ID NOs: 22, 23, and 24, and wherein the VL domain comprises the light chain complementary determining region (CDR) sequence recited in SEQ ID NOs: 19, 20, and 21; a CD8 hinge domain; a CD8 transmembrane domain; an ICOS costimulatory signaling domain; and a CD3 zeta intracellular signaling domain.
[0194] In certain embodiments of the invention, the CAR is encoded by a nucleic acid sequence comprising the nucleotide sequence of SEQ ID NO: 1, 38, 40, 42, 44, or 46. In certain embodiments of the invention, the CAR comprises the amino acid sequence of SEQ ID NO: 2, 39, 41, 43, 45, or 47.
[0195] The sequences of the individual domains and CAR are shown in Table 1.
[0196] Table 1
[0197]
[0198]
[0199]
[0200]
[0201]
[0202]
[0203]
[0204]
[0205]
[0206]
[0207]
[0208]
[0209]
[0210]
[0211]
[0212]
[0213]
[0214]
[0215] Thus, the subject CAR can be a CAR having affinity for Tn-MUC1, comprising a Tn-MUC1 binding domain comprising the amino acid sequence recited in SEQ ID NOs: 4, 5, 6, and / or 19-24. The subject Tn-MUC1 CAR can further comprise a leader sequence comprising the amino acid sequence recited in SEQ ID NO: 48. The subject Tn-MUC1 CAR can further comprise a hinge domain comprising the amino acid sequence recited in SEQ ID NO: 13. The subject Tn-MUC1 CAR can further comprise a transmembrane domain comprising the amino acid sequence recited in SEQ ID NOs: 7 and / or 15. The subject Tn-MUC1 CAR can further comprise a costimulatory signaling domain comprising the amino acid sequence recited in SEQ ID NOs: 9, 17, 25, 28, 32, 34, and / or 36. The subject Tn-MUC1 CAR may further comprise an intracellular signaling domain comprising the amino acid sequence recited in SEQ ID NO: 11 and / or 30. The subject Tn-MUC1 CAR may comprise the amino acid sequence recited in SEQ ID NO: 2, 39, 41, 43, 45 and / or 47.
[0216] Thus, the subject CAR can be a CAR having affinity for Tn-MUC1, comprising a Tn-MUC1 binding domain comprising the amino acid sequence recited in SEQ ID NOs: 4, 5, 6, and / or 19-24. The subject Tn-MUC1 CAR can further comprise a leader sequence comprising the amino acid sequence recited in SEQ ID NO: 48. The subject Tn-MUC1 CAR can further comprise a hinge domain comprising the amino acid sequence recited in SEQ ID NO: 13. The subject Tn-MUC1 CAR can further comprise a transmembrane domain comprising the amino acid sequence recited in SEQ ID NO: 7 or 15. The subject Tn-MUC1 CAR can further comprise a costimulatory signaling domain comprising the amino acid sequence recited in SEQ ID NOs: 9, 17, 25, 28, 32, 34, or 36. The subject Tn-MUC1 CAR may further comprise an intracellular signaling domain comprising the amino acid sequence set forth in SEQ ID NO: 11 or 30. The subject Tn-MUC1 CAR may comprise the amino acid sequence set forth in SEQ ID NO: 2, 39, 41, 43, 45, or 47.
[0217] Antigen binding domain
[0218] The antigen binding domain of CAR is the extracellular region of CAR, for binding specific target antigens, which include proteins, carbohydrates and glycolipids. In some embodiments, CAR includes affinity for target antigens (e.g., tumor-associated antigens) on target cells (e.g., cancer cells). The target antigen may include any type of protein or its epitope associated with the target cell. For example, CAR may include affinity for the target antigen on the target cell, which indicates the specific state of the target cell.
[0219] In certain embodiments, the CAR of the present invention includes an antigen binding domain that binds to MUC1. In certain embodiments, the antigen binding domain binds to a glycosylated form or sugar epitope of MUC1. In certain embodiments, the antigen binding domain is specific to the truncated sugar epitope of MUC1. In certain embodiments, the antigen binding domain is specific to Tn-MUC1. In certain embodiments, the antigen binding domain of the present invention includes an antibody or fragment thereof that binds to a sugar epitope of a MUC1 molecule or MUC1 (Tn-MUC1). In certain exemplary embodiments, the antigen binding domain is a scFv antibody that binds to Tn-MUC1. The selection of the antigen binding domain depends on the type and quantity of the antigen present on the surface of the target cell. For example, the antigen binding domain can be selected to recognize an antigen that acts as a cell surface marker on a target cell associated with a specific state of the target cell.
[0220] As described herein, the CAR of the present disclosure that has affinity for a specific target antigen on a target cell may include a target-specific binding domain. In some embodiments, the target-specific binding domain is a murine target-specific binding domain, e.g., the target-specific binding domain is of murine origin. In some embodiments, the target-specific binding domain is a human target-specific binding domain, e.g., the target-specific binding domain is of human origin. In exemplary embodiments, the CAR of the present disclosure that has affinity for Tn-MUC1 on a target cell may include a Tn-MUC1 binding domain. In some embodiments, the Tn-MUC1 binding domain is a murine Tn-MUC1 binding domain, e.g., the Tn-MUC1 binding domain is of murine origin. In some embodiments, the Tn-MUC1 binding domain is humanized. In some embodiments, the Tn-MUC1 binding domain is a human Tn-MUC1 binding domain, e.g., the Tn-MUC1 binding domain is of human origin.
[0221] In some embodiments, the Tn-MUC1 binding domain is derived from the 5E5 antibody disclosed in PCT Publication No. WO2008 / 040362, the disclosure of which is incorporated herein by reference in its entirety. Thus, the CAR of the present disclosure comprises a Tn-MUC1 binding domain derived from the 5E5 antibody disclosed in PCT Publication No. WO2008 / 040362. In some embodiments, the Tn-MUC1 binding domain is a humanized Tn-MUC1 binding domain. In some embodiments, the humanized Tn-MUC1 binding domain is derived from any one of the humanized 5E5 heavy and light chain sequences disclosed in PCT Publication No. WO2015 / 159076, the disclosure of which is incorporated herein by reference in its entirety. Thus, the CAR of the present disclosure comprises a humanized Tn-MUC1 binding domain derived from any one of the humanized 5E5 heavy and light chain sequences disclosed in PCT Publication No. WO2015 / 159076. A CAR of the present disclosure may include a humanized Tn-MUC binding domain, any transdomain membrane domain, optionally any hinge domain, any costimulatory domain, and any intracellular signaling domain as disclosed herein.
[0222] In some embodiments, the CAR of the present disclosure may have affinity for one or more target antigens on one or more target cells. In some embodiments, CAR may have affinity for one or more target antigens on a single target cell. In such embodiments, CAR is a bispecific CAR, or a multispecific CAR. In some embodiments, CAR includes one or more target-specific binding domains that confer affinity for one or more target antigens. In some embodiments, CAR includes one or more target-specific binding domains that confer affinity for the same target antigen. For example, a CAR comprising one or more target-specific binding domains with affinity for the same target antigen can bind to different epitopes of the target antigen. When multiple target-specific binding domains are present in a CAR, the binding domains can be arranged in series and can be separated by a linker peptide. For example, in a CAR comprising two target-specific binding domains, the binding domains are covalently linked to each other on a single polypeptide chain through a polypeptide linker, an Fc hinge region, or a membrane hinge region.
[0223] The antigen binding domain may include any domain that binds to the antigen and may include but is not limited to monoclonal antibodies, polyclonal antibodies, synthetic antibodies, human antibodies, humanized antibodies, non-human antibodies, and any fragment thereof. Therefore, in one embodiment, the antigen binding domain portion includes a mammalian antibody or a fragment thereof. In another embodiment, the antigen binding domain of CAR is selected from an anti-Tn-MUC1 antibody or a fragment thereof. In some embodiments, the antigen binding domain is selected from an antibody, an antigen binding domain (Fab), and a single-chain variable fragment (scFv). In some embodiments, the Tn-MUC1 binding domain of the present invention is selected from a Tn-MUC1-specific antibody, a Tn-MUC1-specific Fab, and a Tn-MUC1-specific scFv. In one embodiment, the Tn-MUC1 binding domain is a Tn-MUC1-specific antibody. In one embodiment, the Tn-MUC1 binding domain is a Tn-MUC1-specific Fab. In one embodiment, the Tn-MUC1 binding domain is a Tn-MUC1-specific scFv.
[0224] As used herein, the term "single-chain variable fragment" or "scFv" refers to a fusion protein of the variable regions of the heavy (VH) and light (VL) chains of an immunoglobulin (e.g., mouse or human) covalently linked to form a VH::VL heterodimer. The heavy (VH) and light (VL) chains are either directly joined or joined by an encoded peptide linker or spacer that connects the N-terminus of the VH to the C-terminus of the VL, or vice versa. The terms "linker" and "spacer" are used interchangeably herein. In some embodiments, the antigen-binding domain (e.g., a Tn-MUC1 binding domain) comprises an scFv with a VH-linker-VL configuration from the N-terminus to the C-terminus. In some embodiments, the antigen-binding domain (e.g., a Tn-MUC1 binding domain) comprises an scFv with a VL-linker-VH configuration from the N-terminus to the C-terminus. One skilled in the art will be able to select an appropriate configuration for use in the present invention.
[0225] The linker is typically rich in glycine for flexibility and rich in serine or threonine for solubility. The linker can connect the heavy chain variable region and the light chain variable region of the extracellular antigen binding domain. Non-limiting examples of linkers are disclosed in Shen et al., Anal. Chem. 80 (6): 1910-1917 (2008) and WO 2014 / 087010, the contents of which are incorporated herein by reference in their entirety. Various linker sequences are known in the art, including but not limited to glycine serine (GS) linkers, such as (GS) n 、(GSGGS) n (SEQ ID NO:52), (GGGS) n(SEQ ID NO:53) and (GGGGS) n (SEQ ID NO: 54), wherein n represents an integer of at least 1. Exemplary linker sequences may include amino acid sequences including, but not limited to, GGSG (SEQ ID NO: 55), GGSGG (SEQ ID NO: 56), GSGSG (SEQ ID NO: 57), GSGGG (SEQ ID NO: 58), GGGSG (SEQ ID NO: 59), GSSSG (SEQ ID NO: 60), GGGGS (SEQ ID NO: 61), GGGGSGGGGSGGGGS (SEQ ID NO: 62), etc. Those skilled in the art will be able to select suitable linker sequences for use in the present invention. In one embodiment, an antigen binding domain of the invention (e.g., a Tn-MUC1 binding domain) comprises a heavy chain variable region (VH) and a light chain variable region (VL), wherein VH and VL are separated by a linker sequence having the amino acid sequence GGGGSGGGGSGGGGS (SEQ ID NO: 62), which can be encoded by a nucleic acid sequence comprising the nucleotide sequence GGTGGCGGTGGCTCGGGCGGTGGTGGGTCGGGTGGCGGCGGATCT (SEQ ID NO: 63).
[0226] Despite the removal of the constant region and the introduction of a linker, the scFv protein retains the specificity of the original immunoglobulin. Single-chain Fv polypeptide antibodies can be expressed from nucleic acids comprising VH- and VL-encoding sequences, as described by Huston et al. (Proc. Nat. Acad. Sci. USA, 85: 5879-5883, 1988). See also U.S. Patent Nos. 5,091,513, 5,132,405, and 4,956,778; and U.S. Patent Publication Nos. 20050196754 and 20050196754. Antagonistic scFvs with inhibitory activity have been described (see, e.g., Zhao et al., Hyrbidoma (Larchmt) 2008 27(6):455-51; Peter et al., J Cachexia Sarcopenia Muscle 2012 August 12; Shieh et al., J Imunol 2009 183(4):2277-85; Giomarelli et al., Thromb Haemost 2007 97(6):955-63; Fifeeta., J Clin Invst 2006 116(8):2252-61; Brocks et al., Immunotechnology 1997 3(3):173-84; Moosmayer et al., Ther Immunol 1995 2(10:31-40)). Competitive (Agonistic) scFvs with stimulatory activity have been described (see, e.g., Peter et al., J Bioi Chem 2003 25278(38):36740-7; Xie et al., Nat Biotech 1997 15(8):768-71; Ledbetter et al., Crit Rev Immunol 1997 17(5-6):427-55; Ho et al., BioChim Biophys Acta 2003 1638(3):257-66).
[0227] As used herein, "Fab" refers to a fragment of an antibody structure that binds antigen but is monovalent and does not have an Fc portion, e.g., papain digestion of an antibody produces two Fab fragments and an Fc fragment (e.g., a heavy (H) chain constant region; the Fc region that does not bind antigen).
[0228] As used herein, "F(ab')2" refers to an antibody fragment produced by pepsin digestion of an intact IgG antibody, wherein the fragment has two antigen-binding (ab') (divalent) regions, wherein each (ab') region comprises two independent amino acid chains, a portion of the H chain and the light (L) chain linked by an SS bond for antigen binding, and wherein the remaining H chains are linked together. The "F(ab')2" fragment can be divided into two independent Fab' fragments.
[0229] In some cases, the antigen binding domain can be derived from the same species in which the CAR will ultimately be used. For example, for use in humans, the antigen binding domain of the CAR can include a human antibody described elsewhere herein, or a fragment thereof.
[0230] In an exemplary embodiment, the Tn-MUC1 CAR of the present invention includes a Tn-MUC1 binding domain, such as a Tn-MUC1-specific scFv. In one embodiment, the Tn-MUC1 binding domain includes the amino acid sequence recited in SEQ ID NO: 4. In one embodiment, the Tn-MUC1 binding domain is encoded by a nucleic acid sequence including the nucleotide sequence recited in SEQ ID NO: 3.
[0231] In one embodiment, the Tn-MUC1 binding domain comprises a light chain variable region comprising the amino acid sequence recited in SEQ ID NO:6. The light chain variable region of the Tn-MUC1 binding domain comprises three light chain complementarity determining regions (CDRs). As used herein, "complementarity determining region" or "CDR" refers to the variable chain region of an antigen binding molecule that binds to a specific antigen. Thus, the Tn-MUC1 binding domain may comprise a light chain variable region comprising: CDR1 comprising the amino acid sequence recited in SEQ ID NO:19; CDR2 comprising the amino acid sequence recited in SEQ ID NO:20; and CDR3 comprising the amino acid sequence recited in SEQ ID NO:21.
[0232] In one embodiment, the Tn-MUCl binding domain comprises a heavy chain variable region comprising the amino acid sequence set forth in SEQ ID NO: 5. The Tn-MUCl binding domain may comprise a heavy chain variable region comprising: a CDR1 comprising the amino acid sequence set forth in SEQ ID NO: 22; a CDR2 comprising the amino acid sequence set forth in SEQ ID NO: 23; and a CDR3 comprising the amino acid sequence set forth in SEQ ID NO: 24.
[0233] Those skilled in the art will appreciate the permissible variations in Tn-MUCl binding domains while maintaining specific binding to Tn-MUCl. For example, in some embodiments, the Tn-MUCl binding domain comprises an amino acid sequence having at least 60%, at least 65%, at least 70%, at least 75%, at least 80%, at least 81%, at least 82%, at least 83%, at least 84%, at least 85%, at least 86%, at least 87%, at least 88%, at least 89%, at least 90%, at least 91%, at least 92%, at least 93%, at least 94%, at least 95%, at least 96%, at least 97%, at least 98%, or at least 99% sequence identity to any of the amino acid sequences recited in SEQ ID NOs:4-6 and 19-24.
[0234] In some embodiments, the Tn-MUCl binding domain is encoded by a nucleic acid sequence comprising a nucleotide sequence having at least 60%, at least 65%, at least 70%, at least 75%, at least 80%, at least 81%, at least 82%, at least 83%, at least 84%, at least 85%, at least 86%, at least 87%, at least 88%, at least 89%, at least 90%, at least 91%, at least 92%, at least 93%, at least 94%, at least 95%, at least 96%, at least 97%, at least 98%, or at least 99% sequence identity to the nucleotide sequence recited in SEQ ID NO:3.
[0235] The antigen binding domain can be operably linked to another domain of the CAR, such as a transmembrane domain or a costimulatory signaling domain, both of which are described elsewhere herein. In one embodiment, the nucleic acid encoding the antigen binding domain is operably linked to the nucleic acid encoding the transmembrane domain and the nucleic acid encoding the costimulatory signaling domain.
[0236] The antigen binding domains described herein, e.g., antibodies or fragments thereof that bind to Tn-MUCl, can be combined with any transmembrane domain described herein, any intracellular or cytoplasmic domain described herein, or any other domain described herein that can be included in a CAR.
[0237] transmembrane domain
[0238] About transmembrane domain, CAR of the present invention (such as, Tn-MUC1 CAR) can be designed to include transmembrane domain, which connects the antigen binding domain of CAR to the intracellular domain. The transmembrane domain of theme CAR is a region that can span the plasma membrane of a cell (such as, an immune cell or its precursor). Transmembrane domain is used to insert into a cell membrane, such as, a eukaryotic cell membrane. In some embodiments, the transmembrane domain is between the antigen binding domain and the intracellular domain of CAR.
[0239] In one embodiment, the transmembrane domain is naturally associated with one or more domains in the CAR. In some cases, the transmembrane domain can be selected or modified by amino acid substitution to avoid binding of such domains to the transmembrane domains of the same or different surface membrane proteins, thereby minimizing interactions with other members of the receptor complex.
[0240] The transmembrane domain can be derived from a natural source or from a synthetic source. When the source is natural, the domain can be derived from any membrane-bound protein or transmembrane protein, such as a type I transmembrane protein. When the source is synthetic, the transmembrane domain can be any artificial sequence that facilitates CAR insertion into the cell membrane, such as an artificial hydrophobic sequence. Examples of transmembrane regions of particular use in the present invention include, but are not limited to, those derived from the following transmembrane domains (i.e., comprising at least the following transmembrane domain(s)): α, β or ζ chains of T cell receptors, CD28, CD2, CD3ε, CD45, CD4, CD5, CD7, CD8, CD9, CD16, CD22, CD33, CD37, CD64, CD80, CD86, CD134 (OX-40), CD137 (4-1BB), CD154 (CD40L), CD278 (ICOS), CD357 (GITR), Toll-like receptor 1 (TLR1), TLR2, TLR3, TLR4, TLR5, TLR6, TLR7, TLR8 and TLR9. In some embodiments, the transmembrane domain can be synthetic, in which case it will primarily include hydrophobic residues, such as leucine and valine. In certain exemplary embodiments, a triplet of phenylalanine, tryptophan, and valine is found at each end of the synthetic transmembrane domain.
[0241] The transmembrane domains described herein can be combined with any antigen binding domain described herein, any costimulatory signaling domain described herein, any intracellular signaling domain described herein, or any other domain described herein that can be included in a subject CAR.
[0242] In some embodiments, the transmembrane domain further includes a hinge region. The subject CAR of the present invention may also include a hinge region. The hinge region of CAR is a hydrophilic region located between the antigen binding domain and the transmembrane domain. In some embodiments, the domain promotes the suitable protein folding of CAR. The hinge region is an optional component for CAR. The hinge region may include a domain selected from the Fc fragment of an antibody, the hinge region of an antibody, the CH2 region of an antibody, the CH3 region of an antibody, an artificial hinge sequence, or a combination thereof. Examples of hinge regions include, but are not limited to, CD8a hinges, artificial hinges prepared from polypeptides that can be as small as three glycine (Gly), and CH1 and CH3 domains of IgG (such as human IgG4).
[0243] In some embodiments, the subject CAR of the present disclosure includes a hinge region, which connects the antigen binding domain to the transmembrane domain, and then connects to the intracellular domain. The hinge region is preferably capable of supporting the antigen binding domain to identify and bind to the antigen on the target cell (see, e.g., Hudecek et al., Cancer Immunol. Res. (2015) 3 (2): 125-135). In some embodiments, the hinge region is a flexible domain, so that the antigen binding domain is allowed to have the specific structure and density of the target antigen on the optimal recognition cell (such as a tumor cell). The flexibility of the hinge region allows the hinge region to adopt many different conformations.
[0244] In some embodiments, the hinge region is an immunoglobulin heavy chain hinge region. In some embodiments, the hinge region is a hinge region polypeptide derived from a receptor (eg, a hinge region derived from CD8).
[0245] The hinge region can have a length of about 4 amino acids to about 50 amino acids, e.g., about 4 amino acids to about 10 amino acids, about 10 amino acids to about 15 amino acids, about 15 amino acids to about 20 amino acids, about 20 amino acids to about 25 amino acids, about 25 amino acids to about 30 amino acids, about 30 amino acids to about 40 amino acids, or about 40 amino acids to about 50 amino acids.
[0246] Suitable hinge regions can be readily selected and can have any number of suitable lengths, such as 1 amino acid (e.g., Gly) to 20 amino acids, 2 amino acids to 15 amino acids, 3 amino acids to 12 amino acids, including 4 amino acids to 10 amino acids, 5 amino acids to 9 amino acids, 6 amino acids to 8 amino acids, or 7 amino acids to 8 amino acids, and can be 1, 2, 3, 4, 5, 6, or 7 amino acids.
[0247] For example, the hinge region includes glycine polymers (G)n, glycine-serine polymers (including, for example, (GS)n, (GSGGS)n (SEQ ID NO: 52), and (GGGS)n (SEQ ID NO: 53), where n is an integer of at least 1, glycine-alanine polymers, alanine-serine polymers, and other flexible linkers known in the art. Glycine and glycine-serine polymers can be used; both Gly and Ser are relatively unstructured and can therefore serve as neutral tethers between components. Glycine polymers can be used; glycine even enters significantly more than alanine. The hinge region can be spaced apart and less constrained than residues with longer side chains (see, e.g., Scheraga, Rev. Computational. Chem. (1992) 2: 73-142). Exemplary hinge regions may include amino acid sequences including, but not limited to, GGSG (SEQ ID NO: 55), GGSGG (SEQ ID NO: 56), GSGSG (SEQ ID NO: 57), GSGGG (SEQ ID NO: 58), GGGSG (SEQ ID NO: 59), GSSSG (SEQ ID NO: 60), etc.
[0248] In some embodiments, the hinge region is an immunoglobulin heavy chain hinge region. Immunoglobulin hinge region amino acid sequences are known in the art; see, e.g., Tan et al., Proc. Natl. Acad. Sci. USA (1990) 87(1):162-166; and Huck et al., Nucleic Acids Res. (1986) 14(4):1779-1789. As non-limiting examples, the immunoglobulin hinge region can include one of the following amino acid sequences: DKTHT (SEQ ID NO: 64); CPPC (SEQ ID NO: 65); CPEPKSCDTPPPCPR (SEQ ID NO: 66) (see, e.g., Glaser et al., J. Biol. Chem. (2005) 280: 41494-41503); ELKTPLGDTTHT (SEQ ID NO: 67); KSCDKTHTCP (SEQ ID NO: 68); KCCVDCP (SEQ ID NO: 69); KYGPPCP (SEQ ID NO: 70); EPKSCDKTHTCPPCP (SEQ ID NO: 71) (human IgG1 hinge); ERKCCVECPPCP (SEQ ID NO: 72) (human IgG2 hinge); ELKTPLGDTTHTCPRCP (SEQ ID NO: 73) (human IgG3 hinge); SPNMVPHAHHAQ (SEQ ID NO: 74). NO:74) (human IgG4 hinge); etc.
[0249] The hinge region may comprise the amino acid sequence of a human IgG1, IgG2, IgG3, or IgG4 hinge region. In one embodiment, the hinge region may comprise one or more amino acid substitutions and / or insertions and / or deletions compared to a wild-type (naturally occurring) hinge region. For example, His229 of the human IgG1 hinge may be substituted with Tyr so that the hinge region comprises the sequence EPKSCDKTYTCPPCP (SEQ ID NO: 75); see, e.g., Yan et al., J. Biol. Chem. (2012) 287: 5891-5897. In one embodiment, the hinge region may comprise an amino acid sequence derived from human CD8 or a variant thereof.
[0250] In one embodiment, the transmembrane domain comprises a CD8α transmembrane domain. In some embodiments, the subject CAR comprises a CD8α transmembrane domain comprising an amino acid sequence recited in SEQ ID NO: 7, which can be encoded by a nucleic acid sequence comprising a nucleotide sequence recited in SEQ ID NO: 8.
[0251] In another embodiment, the subject CAR includes a CD8α hinge domain and a CD8α transmembrane domain. In one embodiment, the CD8α hinge domain includes an amino acid sequence recited in SEQ ID NO: 13, which can be encoded by a nucleic acid sequence including a nucleotide sequence recited in SEQ ID NO: 14.
[0252] In one embodiment, the transmembrane domain comprises a CD28 transmembrane domain. In some embodiments, the subject CAR comprises a CD28 transmembrane domain comprising an amino acid sequence recited in SEQ ID NO: 15, which may be encoded by a nucleic acid sequence comprising a nucleotide sequence recited in SEQ ID NO: 16.
[0253] Those skilled in the art will appreciate the permissible variations in the transmembrane and / or hinge domains while maintaining their intended function. For example, in some embodiments, the transmembrane or hinge domain comprises an amino acid sequence having at least 60%, at least 65%, at least 70%, at least 75%, at least 80%, at least 81%, at least 82%, at least 83%, at least 84%, at least 85%, at least 86%, at least 87%, at least 88%, at least 89%, at least 90%, at least 91%, at least 92%, at least 93%, at least 94%, at least 95%, at least 96%, at least 97%, at least 98%, at least 99% sequence identity to any of the amino acid sequences recited in SEQ ID NOs: 7, 13, and 15. For example, in some embodiments, the span or hinge domain is encoded by a nucleic acid sequence comprising a nucleotide sequence having at least 60%, at least 65%, at least 70%, at least 75%, at least 80%, at least 81%, at least 82%, at least 83%, at least 84%, at least 85%, at least 86%, at least 87%, at least 88%, at least 89%, at least 90%, at least 91%, at least 92%, at least 93%, at least 94%, at least 95%, at least 96%, at least 97%, at least 98%, or at least 99% sequence identity to any of the nucleotide sequences recited in SEQ ID NOs: 8, 14, and 16.
[0254] The transmembrane domain may be combined with any hinge domain and / or may include one or more transmembrane domains described herein.
[0255] The transmembrane domains described herein, such as the α, β or ζ chain of the T cell receptor, CD28, CD2, CD3ε, CD45, CD4, CD5, CD7, CD8, CD9, CD16, CD22, CD33, CD37, CD64, CD80, CD86, CD134 (OX-40), CD137 (4-1BB), CD154 (CD40L), CD278 (ICOS), CD357 (GITR), Toll-like receptor 1 (TLR1), TLR2, TLR3, TLR4, TLR5, TLR6, TLR7, TLR8 and TLR9, can be combined with any antigen binding domain described herein, any costimulatory signaling domain or intracellular domain or cytoplasmic domain described herein, or any other domain described herein that can be included in a CAR.
[0256] In one embodiment, the transmembrane domain may be synthetic, in which case it will comprise primarily hydrophobic residues such as leucine and valine. In an exemplary embodiment, a triplet of phenylalanine, tryptophan, and valine will be found at each end of the synthetic transmembrane domain.
[0257] In some embodiments, between the extracellular domain and the transmembrane domain of CAR or between the intracellular domain and the transmembrane domain of CAR, the subject CAR may further include a spacer domain. As used herein, the term "spacer domain" generally means any oligopeptide or polypeptide that links the transmembrane domain to the extracellular domain or intracellular domain function in a polypeptide chain. The spacer domain may include up to 300 amino acids, such as 10 to 100 amino acids, or 25 to 50 amino acids. In some embodiments, the spacer domain may be a short oligopeptide or polypeptide linker, such as, between 2 and 10 amino acids in length. For example, a glycine-serine doublet provides a special suitable linker between the transmembrane domain and the intracellular signaling domain of the subject CAR.
[0258] Thus, the subject CARs of the present disclosure may include any transmembrane domain, hinge domain, or spacer domain described herein.
[0259] Intracellular domain
[0260] The subject CAR of the present invention also includes an intracellular domain. The intracellular domain of CAR is responsible for activating at least one of the effector functions of cells (eg, immune cells) expressing CAR. The intracellular domain transduces effector function signals and guides cells (eg, immune cells) to perform their specialized functions, such as damaging and / or destroying target cells.
[0261] The intracellular domain of CAR or additionally the cytoplasmic domain is responsible for the activation of cells expressing CAR. Examples of the intracellular domain used in the present invention include but are not limited to the cytoplasmic portion of surface receptors, costimulatory molecules and any molecules that work together to start signal transduction in T cells, as well as any derivatives or variants of these elements and any synthetic sequences with the same functional capabilities.
[0262] In certain embodiments, the intracellular domain comprises a costimulatory signaling domain. In certain embodiments, the intracellular domain comprises an intracellular signaling domain. In certain embodiments, the intracellular domain comprises a costimulatory signaling domain and an intracellular signaling domain. In certain embodiments, the intracellular domain comprises 4-1BB and CD3ζ. In certain embodiments, the costimulatory signaling domain comprises 4-1BB. In certain embodiments, the intracellular signaling domain comprises CD3ζ.
[0263] In one embodiment, the intracellular domain of the CAR includes a costimulatory signaling domain that includes any portion of one or more costimulatory molecules, such as at least one signaling domain from CD2, CD3, CD8, CD27, CD28, OX40, ICOS, 4-1BB, PD-1, any derivative or variant thereof, any synthetic sequence thereof with the same functional capability, and any combination thereof.
[0264] Examples of intracellular signaling domains include, but are not limited to, the zeta chain of the T cell receptor complex or any homolog thereof, such as the eta chain, FcsRIγ and β chains, MB 1 (Ig) chain, B29 (Ig) chain, etc., human CD3 zeta chain, CD3 polypeptides (Δ, δ, and ε), syk family tyrosine kinases (Syk, ZAP 70, etc.), src family tyrosine kinases (Lck, Fyn, Lyn, etc.), and other molecules involved in T cell transduction, such as CD2, CD5, and CD28. In one embodiment, the intracellular signaling domain can be human CD3 zeta chain, FcγRIII, FcsRI, the cytoplasmic tail of an Fc receptor, a cytoplasmic receptor with an immunoreceptor tyrosine-based activation motif (ITAM), and combinations thereof.
[0265] Other examples of intracellular domains include fragments or domains from one or more molecules or receptors including, but not limited to, TCR, CD3ζ, CD3γ, CD3δ, CD3ε, CD86, common FcRγ, FcRβ (FcεRib), CD79a, CD79b, FcγRlla, DAP10, DAP12, T cell receptor (TCR), CD8, CD27, CD28, 4-1BB (CD137), OX9, OX40, CD30, CD40, PD-1, ICOS, KIR family proteins, lymphocyte function-associated antigen-1 (LFA-1), CD2, CD7, LIGHT, NKG2C, B7-H3, ligands specifically binding to CD83, CD5, ICAM-1, GITR, BAFFR, HVEM (LIGHTR), SLAMF7, NKp80 (KLRF1), CD127, CD160, CD19, CD4, CD8α, CD8β, IL2Rβ, IL2Rγ, IL7Rα, ITGA4, VLA1, CD49a, ITGA4, IA4, CD49D, ITGA6, VLA-6, CD49f, ITGAD, CD1Id, ITGAE, CD103, ITGAL, CD11a, LFA-1, ITGAM, CD lib, ITGAX, CD11c, ITGB1, CD29, ITGB2, CD18, LFA-1, ITGB7, TNFR2, TRANCE / RANKL, DNAM1(CD226), SLAMF4(CD244, 2B4), CD84, CD96(Tactile), CEACA M1, CRTAM, Ly9 (CD229), CD160 (BY55), PSGL1, CD100 (SEMA4D), CD69, SLAMF6 (NTB-A, Ly108), SLAM (SLAMF1, CD150, IPO-3), BLAME (SLAMF8), SELPLG (CD 162), LTBR, LAT, GADS, SLP-76, PAG / Cbp, NKp44, NKp30, NKp46, NKG2D, Toll-like receptor 1 (TLR1), TLR2, TLR3, TLR4, TLR5, TLR6, TLR7, TLR8, TLR9, other costimulatory molecules described herein, any derivative, variant or fragment thereof, any synthetic sequence of a costimulatory molecule with the same functional capability, and combinations thereof.
[0266] Additional examples of intracellular domains include, but are not limited to, intracellular signaling domains of several types of various other immune signaling receptors, including, but not limited to, first, second, and third generation T cell signaling proteins, including CD3, B7 family co-stimulatory, and tumor necrosis factor receptor (TNFR) superfamily receptors (see, e.g., Park and Brentjens, J. Clin. Oncol. (2015) 33(6):651-653). Additionally, the intracellular signaling domain can include signaling domains used by NK and NKT cells (see, e.g., Hermanson and Kaufman, Front. Immunol. (2015) 6: 195), such as the signaling domain (B7-H6) of NKp30 (see, e.g., Zhang et al., J. Immunol. (2012) 189(5): 2290-2299), and DAP 12 (see, e.g., Topfer et al., J. Immunol. (2015) 194(7): 3201-3212), NKG2D, NKp44, NKp46, DAP10, and CD3z.
[0267] The intracellular signaling domain suitable for use in the subject CAR of the present invention includes any desired signaling domain that provides different and detectable signals (e.g., by increasing the production of one or more cytokines by cells; changes in target gene transcription; changes in protein activity; changes in cell behavior (e.g., cell death); cell proliferation; cell differentiation; cell survival; modulation of cell signaling responses; etc.) in response to the activation of CAR (i.e., activated by antigens and dimerizers). In some embodiments, the intracellular signaling domain includes at least one (e.g., one, two, three, four, five, six, etc.) ITAM motif described below. In some embodiments, the intracellular signaling domain includes a DAP10 / CD28 type signaling chain. In some embodiments, the intracellular signaling domain is not covalently attached to a membrane-bound CAR, but diffuses in the cytoplasm.
[0268] The intracellular signaling domain suitable for use in the subject CAR of the present invention includes an intracellular signaling polypeptide containing an immunoreceptor tyrosine-based activation motif (ITAM). In some embodiments, the ITAM motif is repeated twice in the intracellular signaling domain, wherein the first and second instances of the ITAM motif are separated from each other by 6 to 8 amino acids. In one embodiment, the intracellular signaling domain of the subject CAR includes 3 ITAM motifs. In some embodiments, the intracellular signaling domain includes a signaling domain of a human immunoglobulin receptor containing an immunoreceptor tyrosine-based activation motif (ITAM), such as, but not limited to, FcγRI, FcγRIIA, FcγRIIC, FcγRIIIA, FcRL5 (see, e.g., Gillis et al., Front. (2014) Immunol. 5: 254).
[0269] Suitable intracellular signaling domains can be portions containing ITAM motifs derived from polypeptides containing ITAM motifs. For example, suitable intracellular signaling domains can be domains containing ITAM motifs from any protein containing ITAM motifs. Thus, suitable intracellular signaling domains do not need to contain the entire sequence of the entire protein from which they are derived. Examples of suitable ITAM motif-containing polypeptides include, but are not limited to, DAP12, FCER1G (Fcε receptor Iγ chain), CD3D (CD3δ), CD3E (CD3ε), CD3G (CD3γ), CD3Z (CD3ζ), and CD79A (antigen receptor complex-associated protein α chain).
[0270] In one embodiment, the intracellular signaling domain is derived from DAP12 (also known as TYROBP; TYRO protein tyrosine kinase binding protein; KARAP; PLOSL; DNAX-activated protein 12; KAR-related protein; TYRO protein tyrosine kinase binding protein; killer-activated receptor-associated protein; killer-activated receptor-associated protein; etc.). In one embodiment, the intracellular signaling domain is derived from FCER1G (also known as FCRG; Fcε receptor I gamma chain; Fc receptor gamma-chain; fc-εRI-γ; fcRγ; fceR1γ; high affinity immunoglobulin epsilon receptor subunit gamma; immunoglobulin E receptor, high affinity, gamma chain; etc.). In one embodiment, the intracellular signaling domain is derived from the T-cell surface glycoprotein CD3 delta chain (also known as CD3D; CD3-Δ; T3D; CD3 antigen, delta subunit; CD3δ; CD3d antigen, delta polypeptide (TiT3 complex); OKT3, delta chain; T-cell receptor T3 delta chain; T-cell surface glycoprotein CD3 delta chain; etc.). In one embodiment, the intracellular signaling domain is derived from the T-cell surface glycoprotein CD3 epsilon chain (also known as CD3e, T-cell surface antigen T3 / Leu-4 epsilon chain, T-cell surface glycoprotein CD3 epsilon chain, AI504783, CD3, CD3 epsilon, T3e, etc.). In one embodiment, the intracellular signaling domain is derived from the T-cell surface glycoprotein CD3 gamma chain (also known as CD3G, T-cell receptor T3 gamma chain, CD3-Γ, T3G, gamma polypeptide (TiT3 complex), etc.). In one embodiment, the intracellular signaling domain is derived from the T-cell surface glycoprotein CD3ζ chain (also known as CD3Z, T-cell receptor T3ζ chain, CD247, CD3-Z, CD3H, CD3Q, T3Z, TCRZ, etc.). In one embodiment, the intracellular signaling domain is derived from CD79A (also known as B-cell antigen receptor complex-associated protein α chain; CD79a antigen (immunoglobulin-associated α); MB-1 membrane glycoprotein; Ig-α; membrane-bound immunoglobulin-associated protein; surface IgM-associated protein; etc.). In one embodiment, the intracellular signaling domain suitable for use in the subject CAR of the present disclosure includes a DAP10 / CD28 type signaling chain. In one embodiment, the intracellular signaling domain suitable for use in the subject CAR of the present disclosure includes a ZAP70 polypeptide. In some embodiments, the intracellular signaling domain comprises a cytoplasmic signaling domain of TCR ζ, FcR γ, FcR β, CD3 γ, CD3 δ, CD3 ε, CD5, CD22, CD79a, CD79b or CD66d. In one embodiment, the intracellular signaling domain in the CAR comprises a cytoplasmic signaling domain of human CD3 ζ.
[0271] While the entire intracellular signaling domain can generally be employed, in many cases it is not necessary to use the entire chain. With respect to the use of truncated portions of the intracellular signaling domain, such truncated portions can be used in place of the entire chain, as long as they transduce the effector function signal. The intracellular signaling domain includes any truncated portion of the intracellular signaling domain that is sufficient to transduce the effector function signal.
[0272] The intracellular signaling domains described herein can be combined with any co-stimulatory signaling domains described herein, any antigen binding domains described herein, any transmembrane structures described herein, or any other domain described herein that can be included in a CAR.
[0273] Further, variant intracellular signaling domains suitable for subject CARs are known in the art. The YMFM motif is found in ICOS and is an SH2 binding motif that simultaneously recruits the p85 and p50α subunits of PI3K, thereby leading to enhanced AKT signaling. See, for example, Simpson et al. (2010) Curr.Opin.Immunol., 22: 326-332. In one embodiment, a CD28 intracellular domain variant can be generated to include a YMFM motif.
[0274] In one embodiment, the intracellular domain of the subject CAR comprises a 4-1BB costimulatory domain comprising the amino acid sequence set forth in SEQ ID NO: 9, which is encoded by a nucleic acid sequence comprising the nucleotide sequence set forth in SEQ ID NO: 10. In one embodiment, the intracellular domain of the subject CAR comprises a CD28 costimulatory domain comprising the amino acid sequence set forth in SEQ ID NO: 17, which is encoded by a nucleic acid sequence comprising the nucleotide sequence set forth in SEQ ID NO: 18. In one embodiment, the intracellular domain of the subject CAR comprises an ICOS costimulatory domain comprising the amino acid sequence set forth in SEQ ID NO: 25, which is encoded by a nucleic acid sequence comprising the nucleotide sequence set forth in SEQ ID NO: 26 or 27. In one embodiment, the intracellular domain of the subject CAR comprises a CD2 costimulatory domain comprising the amino acid sequence set forth in SEQ ID NO: 28, which is encoded by a nucleic acid sequence comprising the nucleotide sequence set forth in SEQ ID NO: 29. In one embodiment, the intracellular domain of the subject CAR comprises a CD28 YMFM variant costimulatory domain comprising the amino acid sequence set forth in SEQ ID NO: 32, which is encoded by a nucleic acid sequence comprising the nucleotide sequence set forth in SEQ ID NO: 33. In one embodiment, the intracellular domain of the subject CAR comprises a CD27 costimulatory domain comprising the amino acid sequence set forth in SEQ ID NO: 34, which is encoded by a nucleic acid sequence comprising the nucleotide sequence set forth in SEQ ID NO: 35. In one embodiment, the intracellular domain of the subject CAR comprises an OX40 costimulatory domain comprising the amino acid sequence set forth in SEQ ID NO: 36, which is encoded by a nucleic acid sequence comprising the nucleotide sequence set forth in SEQ ID NO: 37.
[0275] In one embodiment, the intracellular domain of the subject CAR comprises a CD3 zeta intracellular signaling domain comprising the amino acid sequence recited in SEQ ID NO: 11 or 30, which is encoded by a nucleic acid sequence comprising the nucleotide sequence recited in SEQ ID NO: 12 or 31.
[0276] Those skilled in the art will appreciate the permissible variations in the intracellular domain while maintaining its specific activity. For example, in some embodiments, the intracellular domain comprises an amino acid sequence having at least 60%, at least 65%, at least 70%, at least 75%, at least 80%, at least 81%, at least 82%, at least 83%, at least 84%, at least 85%, at least 86%, at least 87%, at least 88%, at least 89%, at least 90%, at least 91%, at least 92%, at least 93%, at least 94%, at least 95%, at least 96%, at least 97%, at least 98%, at least 99% sequence identity to any of the amino acid sequences recited in SEQ ID NO:9, 11, 17, 25, 28, 32, 34, or 36. For example, in some embodiments, the intracellular domain is encoded by a nucleic acid sequence comprising a nucleotide sequence having at least 60%, at least 65%, at least 70%, at least 75%, at least 80%, at least 81%, at least 82%, at least 83%, at least 84%, at least 85%, at least 86%, at least 87%, at least 88%, at least 89%, at least 90%, at least 91%, at least 92%, at least 93%, at least 94%, at least 95%, at least 96%, at least 97%, at least 98%, at least 99% sequence identity to any of the nucleotide sequences recited in SEQ ID NO:10, 12, 18, 26, 27, 29, 31, 33, 35, or 37.
[0277] In one embodiment, the intracellular domain of the subject CAR includes an ICOS costimulatory domain and a CD3 ζ intracellular signaling domain. In one embodiment, the intracellular domain of the subject CAR includes a CD28 costimulatory domain and a CD3 ζ intracellular signaling domain. In one embodiment, the intracellular domain of the subject CAR includes a CD28 YMFM variant costimulatory domain and a CD3 ζ intracellular signaling domain. In one embodiment, the intracellular domain of the subject CAR includes a CD27 costimulatory domain and a CD3 ζ intracellular signaling domain. In one embodiment, the intracellular domain of the subject CAR includes an OX40 costimulatory domain and a CD3 ζ intracellular signaling domain. In an exemplary embodiment, the intracellular domain of the subject CAR includes a 4-1BB costimulatory domain and a CD3 ζ intracellular signaling domain. In an exemplary embodiment, the intracellular domain of the subject CAR includes a CD2 costimulatory domain and a CD3 ζ intracellular signaling domain.
[0278] CAR sequence
[0279] The subject CAR of the present invention can be a CAR having affinity for MUC1 (e.g., MUC1). In one embodiment, the Tn-MUC1 CAR of the present invention comprises a 4-1BB costimulatory domain and a CD3ζ intracellular signaling domain structure comprising the amino acid sequence recited in SEQ ID NO: 2, which can be encoded by a nucleic acid sequence comprising the nucleotide sequence recited in SEQ ID NO: 1. In one embodiment, the Tn-MUC1 CAR of the present invention comprises a CD28 costimulatory domain and a CD3ζ intracellular signaling domain structure comprising the amino acid sequence recited in SEQ ID NO: 39, which can be encoded by a nucleic acid sequence comprising the nucleotide sequence recited in SEQ ID NO: 38. In one embodiment, the Tn-MUC1 CAR of the present invention comprises a CD28 YMFM variant costimulatory domain and a CD3ζ intracellular signaling domain structure comprising the amino acid sequence recited in SEQ ID NO: 41, which can be encoded by a nucleic acid sequence comprising the nucleotide sequence recited in SEQ ID NO: 40. In one embodiment, the Tn-MUC1 CAR of the present invention comprises a CD27 costimulatory domain and a CD3ζ intracellular signaling domain structure comprising the amino acid sequence recited in SEQ ID NO: 43, which can be encoded by a nucleic acid sequence comprising the nucleotide sequence recited in SEQ ID NO: 42. In one embodiment, the Tn-MUC1 CAR of the present invention comprises an OX40 costimulatory domain and a CD3ζ intracellular signaling domain structure comprising the amino acid sequence recited in SEQ ID NO: 45, which can be encoded by a nucleic acid sequence comprising the nucleotide sequence recited in SEQ ID NO: 44. In one embodiment, the Tn-MUC1 CAR of the present invention comprises a CD2 costimulatory domain and a CD3ζ intracellular signaling domain structure comprising the amino acid sequence recited in SEQ ID NO: 47, which can be encoded by a nucleic acid sequence comprising the nucleotide sequence recited in SEQ ID NO: 46.
[0280] Those skilled in the art will appreciate the permissible variations of CARs while maintaining their specific activity. For example, in some embodiments, the CAR comprises an amino acid sequence having at least 60%, at least 65%, at least 70%, at least 75%, at least 80%, at least 81%, at least 82%, at least 83%, at least 84%, at least 85%, at least 86%, at least 87%, at least 88%, at least 89%, at least 90%, at least 91%, at least 92%, at least 93%, at least 94%, at least 95%, at least 96%, at least 97%, at least 98%, at least 99% sequence identity to the amino acid sequence recited in SEQ ID NO: 2, 39, 41, 43, 45, or 47. For example, in some embodiments, the CAR is encoded by a nucleic acid sequence comprising a nucleotide sequence having at least 60%, at least 65%, at least 70%, at least 75%, at least 80%, at least 81%, at least 82%, at least 83%, at least 84%, at least 85%, at least 86%, at least 87%, at least 88%, at least 89%, at least 90%, at least 91%, at least 92%, at least 93%, at least 94%, at least 95%, at least 96%, at least 97%, at least 98%, or at least 99% sequence identity to the nucleotide sequence recited in SEQ ID NO: 1, 38, 40, 42, 44, or 46.
[0281] In some embodiments, the subject CAR of the present invention includes a MUC1 binding domain and a transmembrane domain. In one embodiment, the CAR includes a MUC1 binding domain and a transmembrane domain, wherein the transmembrane domain includes a CD8 hinge region. In one embodiment, the CAR includes a MUC1 binding domain and a transmembrane domain, wherein the transmembrane domain includes a CD8 α transmembrane domain. In one embodiment, the CAR includes a MUC1 binding domain and a transmembrane domain, wherein the transmembrane domain includes a CD8 hinge region and a CD8 α transmembrane domain.
[0282] In some embodiments, the subject CAR of the present invention includes a MUC1 binding domain, a transmembrane domain and an intracellular domain. In one embodiment, CAR includes a Tn-MUC1 binding domain, a transmembrane domain and an intracellular domain. In one embodiment, CAR includes a Tn-MUC1 binding domain, a transmembrane domain, and an intracellular domain including a 4-1BB costimulatory domain and a CD3 ζ domain. In one embodiment, CAR includes a Tn-MUC1 binding domain, a transmembrane domain, and an intracellular domain including a CD28 costimulatory domain and a CD3 ζ domain. In one embodiment, CAR includes a Tn-MUC1 binding domain, a transmembrane domain, and an intracellular domain including a CD28 YMFM variant costimulatory domain and a CD3 ζ domain. In one embodiment, CAR includes a Tn-MUC1 binding domain, a transmembrane domain, and an intracellular domain including a CD27 domain and a CD3 ζ domain. In one embodiment, the CAR comprises a Tn-MUC1 binding domain, a transmembrane domain, and an intracellular domain comprising an OX40 domain and a CD3 ζ domain. In one embodiment, the CAR comprises a Tn-MUC1 binding domain, a transmembrane domain, and an intracellular domain comprising a CD2 domain and a CD3 ζ domain.
[0283] Thus, the present invention provides modified immune cells or precursor cells thereof, such as modified T cells, modified NK cells, modified NKT cells, comprising a chimeric antigen receptor (CAR) having affinity for MUCl as described herein.
[0284] Human antibodies
[0285] It may be preferred that the antigen binding domain of CAR includes a human antibody or a fragment thereof. Fully human antibodies are particularly ideal for therapeutic treatment of human subjects. Human antibodies can be prepared by a variety of methods known in the art, including phage display methods using antibody libraries derived from human immunoglobulin sequences, including improvements to these technologies. See also U.S. Patent Nos. 4,444,887 and 4,716,111; and PCT Publications WO 98 / 46645, WO 98 / 50433, WO 98 / 24893, WO98 / 16654, WO 96 / 34096, WO 96 / 33735, and WO 91 / 10741; each of which is incorporated herein by reference in its entirety.
[0286] Human antibodies can also be produced using transgenic mice that cannot express functional endogenous immunoglobulins but can express human immunoglobulin genes. For example, human heavy and light chain immunoglobulin gene complexes can be introduced into mouse embryonic stem cells randomly or by homologous recombination. Alternatively, in addition to human heavy and light chain genes, human variable regions, constant regions, and diversity regions can also be introduced into mouse embryonic stem cells. By introducing human immunoglobulin loci through homologous recombination, mouse heavy and light chain immunoglobulin genes may be rendered non-functional separately or simultaneously. For example, homozygous deletion of the antibody heavy chain joining region (JH) gene in chimeric and germline mutant mice has been described, resulting in complete inhibition of endogenous antibody production. Modified embryonic stem cells are amplified and microinjected into blastocysts to produce chimeric mice. Chimeric mice are then cultivated to produce homozygous offspring expressing human antibodies. Transgenic mice are immunized in the normal manner with selected antigens, such as all or part of the polypeptides of the present invention. Conventional hybridoma technology can be used to obtain antibodies against the selected target from immunized, transgenic mice. The human immunoglobulin transgene carried by transgenic mice rearranges during B cell differentiation, followed by class switching and somatic mutation. Thus, using such technology, therapeutically useful IgG, IgA, IgM, and IgE antibodies can be produced, including but not limited to IgG1 (γ1) and IgG3. For an overview of this technology for producing human antibodies, see Lonberg and Huszar (Int. Rev. Immunol., 13: 65-93 (1995)). For a detailed discussion of such techniques for producing human antibodies and human monoclonal antibodies and protocols for producing such antibodies, see, e.g., PCT Publication Nos. WO 98 / 24893, WO 96 / 34096, and WO 96 / 33735; and U.S. Patent Nos. 5,413,923; 5,625,126; 5,633,425; 5,569,825; 5,661,016; 5,545,806; 5,814,318; and 5,939,598, each of which is incorporated herein by reference in its entirety. In addition, companies such as Abgenix, Inc. (Freemont, California) and Genpharm (San Jose, California) are engaged in providing human antibodies to selected antigens using techniques similar to those described above.For a detailed discussion of how transfer of the human germline immunoglobulin gene array into germline mutant mice results in the production of human antibodies upon antigen challenge, see, e.g., Jakobovits et al., Proc. Natl. Acad. Sci. USA, 90:2551 (1993); Jakobovits et al., Nature, 362:255-258 (1993); Bruggermann et al., Year in Immunol., 7:33 (1993); and Duchosal et al., Nature, 355:258 (1992).
[0287] Human antibodies can also be derived from phage display libraries (Hoogenboom et al., J. Mol. Biol., 227: 381 (1991); Marks et al., J. Mol. Biol., 222: 581-597 (1991); Vaughan et al., Nature Biotech., 14: 309 (1996)). Phage display technology (McCafferty et al., Nature, 348: 552-553 (1990)) can be used to produce human antibodies and antibody fragments in vitro from immunoglobulin variable (V) domain gene libraries from unimmunized donors. According to this technology, antibody V domain genes are cloned in frame into major or minor coat protein genes of filamentous phage (such as M13 or fd) and displayed as functional antibody fragments on the surface of phage particles. Because filamentous particles contain a single-stranded DNA copy of the phage genome, selection based on the functional properties of the antibody will also result in selection of genes encoding antibodies that exhibit those properties. Thus, phages mimic some of the properties of B cells. Phage display can be performed in a variety of formats; for their review, see, for example, Johnson, Kevin S and Chiswell, David J., Current Opinion in Structural Biology 3:564-571 (1993). V gene segments from several sources can be used for phage display. Clackson et al., Nature, 352:624-628 (1991) isolated a variety of antibodies from a small random combinatorial library of V genes derived from the spleen of unimmunized mice. Antibodies to oxazolidinones. V gene libraries from unimmunized human donors can be constructed, and antibodies to a variety of antigens (including self-antigens) can be isolated essentially according to the techniques described in Marks et al., J. Mol. Biol., 222: 581-597 (1991), or Griffith et al., EMBO J., 12: 725-734 (1993). See also U.S. Patent Nos. 5,565,332 and 5,573,905, each of which is incorporated herein by reference in its entirety.
[0288] Human antibodies can also be generated by in vitro activated B cells (see U.S. Patent Nos. 5,567,610 and 5,229,275, each of which is incorporated herein by reference in its entirety). Human antibodies can also be generated in vitro using hybridoma technology, such as, but not limited to, the technology described by Roder et al. (Methods Enzymol., 121: 140-167 (1986)).
[0289] Dominant negative receptors and switch receptors
[0290] The present invention provides compositions and methods of modified immune cells or their precursors, such as modified T cells, comprising dominant negative receptors and / or conversion receptors. Therefore, in some embodiments, the immune cells have been genetically modified to express dominant negative receptors and / or conversion receptors. The sequences of dominant negative receptors and conversion receptors are shown in Table 1. As used herein, the term "dominant negative receptor" refers to a molecule designed to reduce the effect of negative signal transduction molecules (e.g., the effect of negative signal transduction molecules on the modified immune cells of the present invention). The dominant negative receptors of the present invention can utilize the extracellular domain associated with the negative signal to bind to negative signal transduction molecules, such as TGF-β or PD-1, and reduce the effect of negative signal transduction molecules. Such dominant negative receptors are described herein. For example, a modified immune cell comprising a dominant negative receptor can bind to a negative signal transduction molecule in the microenvironment of the modified immune cell and reduce the effect that the negative signal transduction molecule may have on the modified immune cell.
[0291] In addition to reducing the effects of negative signal transduction molecules, the switch receptors of the present invention can also be designed to convert negative signals into positive signals by including an intracellular domain associated with a positive signal. Described herein are switch receptors designed to convert negative signals into positive signals. Thus, the switch receptors include an extracellular domain associated with a negative signal and / or an intracellular domain associated with a positive signal.
[0292] Tumor cells produce an immunosuppressive microenvironment, which is used to protect tumor cells from being recognized and eliminated by the immune system. This immunosuppressive microenvironment may limit the effect of immunosuppressive therapies, such as CAR-T cell therapy. The secreted cytokine transforming growth factor β (TGFβ) directly inhibits the function of cytotoxic T cells and additionally induces the formation of regulatory T cells to further suppress the immune response. In the context of prostate cancer, T cell immunosuppression due to TGFβ has been previously described (Donkor et al., 2011; Shalapour et al., 2015). In order to reduce the immunosuppressive effect of TGFβ, immune cells can be modified to express dominant negative receptors that are dominant negative receptors for TGF-β.
[0293] In some embodiments, the dominant negative receptor is a truncated variant of a wild-type protein associated with a negative signal. In some embodiments, the dominant negative receptor is a dominant negative receptor for TGF-β. Thus, in some embodiments, the dominant negative receptor for TGF-β is a truncated variant of a wild-type TGF-β receptor. In some embodiments, the dominant negative receptor is a truncated dominant negative variant of a TGF-β type II receptor (TGFβRII-DN). In one embodiment, TGFβRII-DN comprises an amino acid sequence of SEQ ID NO: 76 that can be encoded by a nucleic acid sequence of SEQ ID NO: 77.
[0294] Those skilled in the art will appreciate the permissible variations in the sequence of TGFβRII-DN while maintaining its intended function. For example, in some embodiments, the dominant negative receptor of the present invention is a TGFβRII-DN comprising an amino acid sequence having at least 60%, at least 65%, at least 70%, at least 75%, at least 80%, at least 81%, at least 82%, at least 83%, at least 84%, at least 85%, at least 86%, at least 87%, at least 88%, at least 89%, at least 90%, at least 91%, at least 92%, at least 93%, at least 94%, at least 95%, at least 96%, at least 97%, at least 98%, at least 99% sequence identity to the amino acid sequence set forth in SEQ ID NO: 76. In one embodiment, the dominant negative receptor is a TGFβRII-DN comprising the amino acid sequence set forth in SEQ ID NO: 76.
[0295] In some embodiments, the dominant negative receptor of the present invention is TGFβRII-DN encoded by a nucleic acid sequence having at least 60%, at least 65%, at least 70%, at least 75%, at least 80%, at least 81%, at least 82%, at least 83%, at least 84%, at least 85%, at least 86%, at least 87%, at least 88%, at least 89%, at least 90%, at least 91%, at least 92%, at least 93%, at least 94%, at least 95%, at least 96%, at least 97%, at least 98%, at least 99% sequence identity to the nucleic acid sequence set forth in SEQ ID NO: 77. In one embodiment, the dominant negative receptor is TGFβRII-DN encoded by the nucleic acid sequence set forth in SEQ ID NO: 77.
[0296] In one embodiment, a conversion receptor suitable for use in the present invention is the PD1-CTM-CD28 receptor. When expressed in a cell, the PD1-CTM-CD28 receptor converts a negative PD1 signal into a positive CD28 signal. The PD1-CTM-CD28 receptor comprises a variant of the PD1 extracellular domain, the CD28 transmembrane domain, and the CD28 cytoplasmic domain. In one embodiment, the PD1-CTM-CD28 receptor comprises the amino acid sequence of SEQ ID NO: 78, which can be encoded by the nucleic acid sequence of SEQ ID NO: 79.
[0297] Those skilled in the art will appreciate the permissible variations of the PD1-CTM-CD28 receptor while maintaining its intended biological activity (e.g., converting a negative PD1 signal into a positive CD28 signal when expressed in a cell). Thus, the PD1-CTM-CD28 receptor of the present invention may comprise an amino acid sequence having at least 60%, at least 65%, at least 70%, at least 75%, at least 80%, at least 81%, at least 82%, at least 83%, at least 84%, at least 85%, at least 86%, at least 87%, at least 88%, at least 89%, at least 90%, at least 91%, at least 92%, at least 93%, at least 94%, at least 95%, at least 96%, at least 97%, at least 98%, at least 99% sequence identity to the PD1-CTM-CD28 receptor amino acid sequence recited in SEQ ID NO: 78. Thus, the PD1-CTM-CD28 receptor of the present invention can be encoded by a nucleic acid comprising a nucleic acid sequence having at least 60%, at least 65%, at least 70%, at least 75%, at least 80%, at least 81%, at least 82%, at least 83%, at least 84%, at least 85%, at least 86%, at least 87%, at least 88%, at least 89%, at least 90%, at least 91%, at least 92%, at least 93%, at least 94%, at least 95%, at least 96%, at least 97%, at least 98%, or at least 99% sequence identity to the PD1-CTM-CD28 receptor nucleic acid sequence recited in SEQ ID NO:79.
[0298] In one embodiment, a switch receptor suitable for use in the present invention is a PD1-PTM-CD28 receptor. When expressed in a cell, the PD1-PTM-CD28 receptor converts a negative PD1 signal into a positive CD28 signal. The PD1-PTM-CD28 receptor comprises a variant of the PD1 extracellular domain, the PD1 transmembrane domain, and the CD28 cytoplasmic domain. In one embodiment, the PD1-PTM-CD28 receptor comprises the amino acid sequence of SEQ ID NO: 80, which can be encoded by the nucleic acid sequence of SEQ ID NO: 81.
[0299] Those skilled in the art will appreciate the permissible variations of the PD1-PTM-CD28 receptor while maintaining its intended biological activity (e.g., converting a negative PD1 signal into a positive CD28 signal when expressed in a cell). Thus, the PD1-PTM-CD28 receptor of the present invention may comprise an amino acid sequence having at least 60%, at least 65%, at least 70%, at least 75%, at least 80%, at least 81%, at least 82%, at least 83%, at least 84%, at least 85%, at least 86%, at least 87%, at least 88%, at least 89%, at least 90%, at least 91%, at least 92%, at least 93%, at least 94%, at least 95%, at least 96%, at least 97%, at least 98%, or at least 99% sequence identity to the PD1-PTM-CD28 receptor amino acid sequence recited in SEQ ID NO: 80. Thus, the PD1-PTM-CD28 receptor of the present invention can be encoded by a nucleic acid comprising a nucleic acid sequence having at least 60%, at least 65%, at least 70%, at least 75%, at least 80%, at least 81%, at least 82%, at least 83%, at least 84%, at least 85%, at least 86%, at least 87%, at least 88%, at least 89%, at least 90%, at least 91%, at least 92%, at least 93%, at least 94%, at least 95%, at least 96%, at least 97%, at least 98%, or at least 99% sequence identity to the PD1-PTM-CD28 receptor nucleic acid sequence recited in SEQ ID NO:81.
[0300] In one embodiment, a switch receptor suitable for use in the present invention is PD1 A132L -PTM-CD28 receptor. When expressed in cells, PD1 A132L -PTM-CD28 receptor converts negative PD1 signal into positive CD28 signal. It was found that a point mutation at amino acid position 132 of PD1 (alanine replaced by leucine) (A132L) increased its affinity for PD-L1 by two-fold (see, e.g., Zhang et al., Immunity (2004) 20(3), 337-347). A132L -PTM-CD28 receptors include variants of the PD1 extracellular domain, the PD1 transmembrane domain, and the CD28 cytoplasmic domain with an amino acid substitution at position 132 (A132L). In one embodiment, the PD1 A132L The -PTM-CD28 receptor comprises the amino acid sequence of SEQ ID NO: 82 which may be encoded by the nucleic acid sequence of SEQ ID NO: 83.
[0301] Those skilled in the art know that PD1 A132L-PTM-CD28 receptors while maintaining their intended biological activity (e.g., converting a negative PD1 signal into a positive CD28 signal when expressed in a cell). A132L -PTM-CD28 receptor may include an amino acid sequence that is identical to the PD1 sequence described in SEQ ID NO: 82. A132L -PTM-CD28 receptor amino acid sequence having at least 60%, at least 65%, at least 70%, at least 75%, at least 80%, at least 81%, at least 82%, at least 83%, at least 84%, at least 85%, at least 86%, at least 87%, at least 88%, at least 89%, at least 90%, at least 91%, at least 92%, at least 93%, at least 94%, at least 95%, at least 96%, at least 97%, at least 98%, at least 99% sequence identity. Therefore, the PD1 of the present invention has a sequence identity of at least 60%, at least 65%, at least 70%, at least 75%, at least 80%, at least 81%, at least 82%, at least 83%, at least 84%, at least 85%, at least 86%, at least 87%, at least 88%, at least 89%, at least 90%, at least 91%, at least 92%, at least 93%, at least 94%, at least 95%, at least 96%, at least 97%, at least 98%, at least 99%. A132L The -PTM-CD28 receptor may be encoded by a nucleic acid comprising a nucleic acid sequence that is identical to the PD1 sequence set forth in SEQ ID NO: 83. A132L -PTM-CD28 receptor nucleic acid sequence having at least 60%, at least 65%, at least 70%, at least 75%, at least 80%, at least 81%, at least 82%, at least 83%, at least 84%, at least 85%, at least 86%, at least 87%, at least 88%, at least 89%, at least 90%, at least 91%, at least 92%, at least 93%, at least 94%, at least 95%, at least 96%, at least 97%, at least 98%, at least 99% sequence identity.
[0302] In one embodiment, the conversion receptor suitable for use in the present invention is PD1-4-1BB receptor.When expressed in cells, PD1-4-1BB receptors (also referred to herein as PD1-BB) convert negative PD1 signals into positive 4-1BB signals.In one embodiment, PD1-4-1BB receptors include SEQ ID NO:84 amino acids encoded by SEQ ID NO:85 nucleic acid.
[0303] Those skilled in the art will appreciate that variations in the PD1-4-1BB receptor are tolerated while maintaining its intended biological activity (e.g., converting a negative PD1 signal into a positive 4-1BB signal when expressed in a cell). Thus, the receptor of the present invention may comprise an amino acid sequence having at least 60%, at least 65%, at least 70%, at least 75%, at least 80%, at least 81%, at least 82%, at least 83%, at least 84%, at least 85%, at least 86%, at least 87%, at least 88%, at least 89%, at least 90%, at least 91%, at least 92%, at least 93%, at least 94%, at least 95%, at least 96%, at least 97%, at least 98%, or at least 99% sequence identity to the PD1-4-1BB receptor amino acid sequence recited in SEQ ID NO: 84. Therefore, the PD1-4-1BB receptor of the present invention can be encoded by a nucleic acid comprising a nucleic acid sequence having at least 60%, at least 65%, at least 70%, at least 75%, at least 80%, at least 81%, at least 82%, at least 83%, at least 84%, at least 85%, at least 86%, at least 87%, at least 88%, at least 89%, at least 90%, at least 91%, at least 92%, at least 93%, at least 94%, at least 95%, at least 96%, at least 97%, at least 98%, or at least 99% sequence identity to the PD1-4-1BB receptor nucleic acid sequence recited in SEQ ID NO: 85.
[0304] In one embodiment, a switch receptor suitable for use in the present invention is PD1 A132L -4-1BB receptor. When expressed in cells, PD1 A132L -4-1BB receptor (also referred to herein as PD1*BB) converts the negative PD1 signal into a positive 4-1BB signal. A132L The -4-1BB receptor includes the amino acid sequence of SEQ ID NO: 86 which can be encoded by the nucleic acid sequence of SEQ ID NO: 87.
[0305] Those skilled in the art know that PD1 A132L -4-1BB receptors while maintaining their intended biological activity (e.g., converting negative PD1 signals into positive 4-1BB signals when expressed in cells). A132L -4-1BB receptor may include such an amino acid sequence, which has the same amino acid sequence as the PD1 described in SEQ ID NO:86. A132L-4-1BB receptor amino acid sequence has at least 60%, at least 65%, at least 70%, at least 75%, at least 80%, at least 81%, at least 82%, at least 83%, at least 84%, at least 85%, at least 86%, at least 87%, at least 88%, at least 89%, at least 90%, at least 91%, at least 92%, at least 93%, at least 94%, at least 95%, at least 96%, at least 97%, at least 98%, at least 99% sequence identity. Therefore, the PD1 of the present invention has a sequence identity of at least 60%, at least 65%, at least 70%, at least 75%, at least 80%, at least 81%, at least 82%, at least 83%, at least 84%, at least 85%, at least 86%, at least 87%, at least 88%, at least 89%, at least 90%, at least 91%, at least 92%, at least 93%, at least 94%, at least 95%, at least 96%, at least 97%, at least 98%, at least 99%. A132L The 4-1BB receptor may be encoded by a nucleic acid comprising a nucleic acid sequence that is identical to the PD1 sequence described in SEQ ID NO: 87. A132L -4-1BB receptor nucleic acid sequence having at least 60%, at least 65%, at least 70%, at least 75%, at least 80%, at least 81%, at least 82%, at least 83%, at least 84%, at least 85%, at least 86%, at least 87%, at least 88%, at least 89%, at least 90%, at least 91%, at least 92%, at least 93%, at least 94%, at least 95%, at least 96%, at least 97%, at least 98%, at least 99% sequence identity.
[0306] In one embodiment, a switch receptor suitable for use in the present invention is a TGFβR-IL12Rβ1 receptor. When expressed in a cell, the TGFβR-IL12Rβ1 receptor converts a negative TGF-β signal into a positive IL-12 signal. In one embodiment, the TGFβR-IL12Rβ1 receptor comprises the amino acid sequence of SEQ ID NO: 88, which can be encoded by the nucleic acid sequence of SEQ ID NO: 89.
[0307] Those skilled in the art will appreciate that variations in the TGFβR-IL12Rβ1 receptor are tolerated while maintaining its intended biological activity (e.g., converting a negative TGF-β signal into a positive IL-12 signal when expressed in a cell). Thus, the TGFβR-IL12Rβ1 receptor of the present invention may comprise an amino acid sequence having at least 60%, at least 65%, at least 70%, at least 75%, at least 80%, at least 81%, at least 82%, at least 83%, at least 84%, at least 85%, at least 86%, at least 87%, at least 88%, at least 89%, at least 90%, at least 91%, at least 92%, at least 93%, at least 94%, at least 95%, at least 96%, at least 97%, at least 98%, or at least 99% sequence identity to the TGFβR-IL12Rβ1 receptor amino acid sequence set forth in SEQ ID NO:88. Thus, the TGFβR-IL12Rβ1 receptor of the present invention can be encoded by a nucleic acid comprising a nucleic acid sequence having at least 60%, at least 65%, at least 70%, at least 75%, at least 80%, at least 81%, at least 82%, at least 83%, at least 84%, at least 85%, at least 86%, at least 87%, at least 88%, at least 89%, at least 90%, at least 91%, at least 92%, at least 93%, at least 94%, at least 95%, at least 96%, at least 97%, at least 98%, or at least 99% sequence identity to the TGFβR-IL12Rβ1 receptor nucleic acid sequence recited in SEQ ID NO:89.
[0308] In one embodiment, a switch receptor suitable for use in the present invention is a TGFβR-IL12Rβ2 receptor. When expressed in a cell, the TGFβR-IL12Rβ2 receptor converts a negative TGF-β signal into a positive IL-12 signal. In one embodiment, the TGFβR-IL12Rβ2 receptor comprises the amino acid sequence of SEQ ID NO: 90, which can be encoded by the nucleic acid sequence of SEQ ID NO: 91.
[0309] Those skilled in the art will appreciate that variations in the TGFβR-IL12Rβ2 receptor are permissible while maintaining its intended biological activity (e.g., converting a negative TGF-β signal into a positive IL-12 signal when expressed in a cell). Thus, the TGFβR-IL12Rβ2 receptor of the present invention may comprise an amino acid sequence having at least 60%, at least 65%, at least 70%, at least 75%, at least 80%, at least 81%, at least 82%, at least 83%, at least 84%, at least 85%, at least 86%, at least 87%, at least 88%, at least 89%, at least 90%, at least 91%, at least 92%, at least 93%, at least 94%, at least 95%, at least 96%, at least 97%, at least 98%, or at least 99% sequence identity to the TGFβR-IL12Rβ2 receptor amino acid sequence set forth in SEQ ID NO:90. Thus, the TGFβR-IL12Rβ2 receptor of the present invention can be encoded by a nucleic acid comprising a nucleic acid sequence having at least 60%, at least 65%, at least 70%, at least 75%, at least 80%, at least 81%, at least 82%, at least 83%, at least 84%, at least 85%, at least 86%, at least 87%, at least 88%, at least 89%, at least 90%, at least 91%, at least 92%, at least 93%, at least 94%, at least 95%, at least 96%, at least 97%, at least 98%, or at least 99% sequence identity to the TGFβR-IL12Rβ2 receptor nucleic acid sequence recited in SEQ ID NO:91.
[0310] In one embodiment, a switch receptor suitable for use in the present invention is a TIM3-CD28 receptor. When expressed in a cell, the TIM3-CD28 receptor converts a negative TIM-3 signal into a positive CD28 signal. In one embodiment, the TIM3-CD28 receptor comprises the amino acid sequence of SEQ ID NO: 92, which can be encoded by the nucleic acid sequence of SEQ ID NO: 93.
[0311] Those skilled in the art will appreciate the permissible variations of the TIM3-CD28 receptor while maintaining its intended biological activity (e.g., converting a negative TIM-3 signal into a positive CD28 signal when expressed in a cell). Thus, the TIM3-CD28 receptor of the present invention may comprise an amino acid sequence having at least 60%, at least 65%, at least 70%, at least 75%, at least 80%, at least 81%, at least 82%, at least 83%, at least 84%, at least 85%, at least 86%, at least 87%, at least 88%, at least 89%, at least 90%, at least 91%, at least 92%, at least 93%, at least 94%, at least 95%, at least 96%, at least 97%, at least 98%, or at least 99% sequence identity to the TIM3-CD28 receptor amino acid sequence recited in SEQ ID NO: 92. Thus, the TIM3-CD28 receptor of the present invention can be encoded by a nucleic acid comprising a nucleic acid sequence having at least 60%, at least 65%, at least 70%, at least 75%, at least 80%, at least 81%, at least 82%, at least 83%, at least 84%, at least 85%, at least 86%, at least 87%, at least 88%, at least 89%, at least 90%, at least 91%, at least 92%, at least 93%, at least 94%, at least 95%, at least 96%, at least 97%, at least 98%, or at least 99% sequence identity to the TIM3-CD28 receptor nucleic acid sequence recited in SEQ ID NO:93.
[0312] Other suitable dominant negative receptors and switch receptors for use in the present invention are described in PCT Publication No. WO2013019615A2, the disclosure of which is incorporated herein by reference.
[0313] Modified immune cells
[0314] The present invention provides modified immune cells or their precursor cells (e.g., modified T cells, modified NK cells, modified NKT cells) comprising a subject CAR. Thus, such modified cells have specificity directed by the CAR expressed therein. For example, the modified cells of the present invention comprising a TnMUC1 CAR are specific for MUC1 on target cells.
[0315] Any modified cell comprising any antigen binding domain, any hinge, any transmembrane domain, any intracellular membrane co-stimulatory domain, and any intracellular signaling domain described herein is envisioned and can be readily understood and made by those skilled in the art based on this disclosure.
[0316] In some embodiments, the modified cell is an immune cell or a precursor thereof. In an exemplary embodiment, the modified cell is a T cell. In an exemplary embodiment, the modified cell is an autologous cell. In an exemplary embodiment, the modified cell is an autologous immune cell or a precursor thereof. In an exemplary embodiment, the modified cell is an autologous T cell.
[0317] The present invention provides modified immune cells or their precursor cells (e.g., T cells) comprising CAR and / or dominant negative receptors and / or switch receptors. Thus, such modified cells have specificity directed by the CAR expressed therein. For example, the modified cells of the present invention including TnMUC1-CAR are specific for TnMUC1 on target cells.
[0318] In some embodiments, the modified cells of the present invention include CAR. In one embodiment, the modified cells of the present invention include CAR with affinity for TnMUC1 on target cells. In some embodiments, the modified cells of the present invention include dominant negative receptors and / or conversion receptors. In one embodiment, the modified cells of the present invention include dominant negative receptors that can reduce the effect of negative signal transduction molecules in the microenvironment. In one embodiment, the modified cells of the present invention include conversion receptors that can reduce the effect of negative signal transduction molecules in the microenvironment and convert negative signals into positive signals in the modified cells. In some embodiments, the modified cells of the present invention include CAR and dominant negative receptors and / or conversion receptors. In one embodiment, the modified cells of the present invention include CAR with affinity for TnMUC1 on target cells, and dominant negative receptors and / or conversion receptors. The modified cells of the present invention including dominant negative receptors and / or conversion receptors can engage negative signal transduction molecules (e.g., inhibitory ligands) in the microenvironment through their respective extracellular domains. In some embodiments, the modified cells of the present invention comprising a dominant negative receptor are capable of reducing the effects of negative signaling molecules in the microenvironment, wherein the dominant negative receptor comprises an extracellular domain associated with a negative signal. In some embodiments, the modified cells of the present invention comprising a switch receptor are capable of converting the effects of negative signaling molecules in the microenvironment into a positive signal, wherein the switch receptor comprises an extracellular domain associated with a negative signal and an intracellular domain associated with a positive signal.
[0319] In an exemplary embodiment, the modified cell of the invention comprises a dominant negative receptor capable of reducing the effects of a negative signaling molecule. In one embodiment, the modified cell of the invention comprises TGFβRII-DN.
[0320] In an exemplary embodiment, the modified cells of the present invention include a transducer receptor capable of converting the effect of a negative signal transduction molecule into a positive (e.g., activation) signal within the modified cell. In one embodiment, the modified cells of the present invention include PD1-CTM-CD28. In one embodiment, the modified cells of the present invention include PD1 A132L -PTM-CD28. In one embodiment, the modified cells of the present invention comprise TIM3-CD28.
[0321] In an exemplary embodiment, the modified cells of the present invention include TnMUC1-CAR and a dominant negative receptor capable of reducing the effect of a negative signal transduction molecule. In one embodiment, the modified cells of the present invention include TnMUC1-CAR and TGFβRII-DN. In addition to having affinity for TnMUC1 on target cells, such modified cells (e.g., modified T cells) can also reduce inhibitory TGF-β signals from the microenvironment in which they exist.
[0322] In an exemplary embodiment, the modified cells of the present invention include MUC1-CAR and a conversion receptor capable of converting the inhibitory effect of a negative signal transduction molecule into a positive signal within the modified cells. In one embodiment, the modified cells of the present invention include MUC1-CAR and PD1-CTM-CD28. In one embodiment, the modified cells of the present invention include MUC1-CAR and PD1 A132L -PTM-CD28. In one embodiment, the modified cells of the present invention include MUC1-CAR and TIM3-CD28. In one embodiment, the modified cells of the present invention include MUC1 CAR and PD1-4-1BB. In one embodiment, the modified cells of the present invention include MUC1-CAR and PD1 A132L -4-1BB. In one embodiment, the modified cells of the present invention include MUC1-CAR and TGFβR-IL12Rβ1. In addition to having affinity for MUC1 on target cells, such modified cells (e.g., modified T cells) are capable of converting inhibitory PD-1, TIMI1, or TGFβ signals from the microenvironment into positive (e.g., activation) signals within the modified cells. In addition to having affinity for MUC1 on target cells, such modified cells (e.g., modified T cells) are capable of converting inhibitory PD-1 or TIM-3 signals from the microenvironment into positive (e.g., activation) CD28 signals within the modified cells.
[0323] In an exemplary embodiment, the modified cells of the invention include MUC1-CAR, TGFβRII-DN, and PD1-CTM-CD28.
[0324] Nucleic acids and expression vectors
[0325] The present invention provides nucleic acids encoding CARs with affinity for MUC1 (e.g., Tn-MUC1). As described herein, the subject CAR includes an antigen binding domain (e.g., a MUC1 binding domain), a transmembrane domain, and an intracellular domain. Therefore, the present invention provides nucleic acids encoding the antigen binding domain (e.g., a MUC1 binding domain), a transmembrane domain, and an intracellular domain of the subject CAR.
[0326] In an exemplary embodiment, the nucleic acid encoding the MUC1 CAR of the present invention is encoded by a nucleic acid sequence comprising the nucleotide sequence set forth in SEQ ID NOs: 1, 38, 40, 42, 44, or 46.
[0327] In certain embodiments, the present invention provides nucleic acids encoding CAR and / or dominant negative receptors and / or conversion receptors. In one embodiment, the nucleic acid of the present disclosure includes a nucleic acid sequence encoding a theme CAR of the present invention (e.g., TnMUC1-CAR). In one embodiment, the nucleic acid of the present disclosure includes a nucleic acid sequence encoding a dominant negative receptor and / or conversion receptor (e.g., PD1-PTM-CD28 receptor).
[0328] In some embodiments, the nucleic acids of the present disclosure provide for the production of CARs and / or dominant negative receptors and / or switch receptors as described herein in mammalian cells. In some embodiments, the nucleic acids of the present disclosure provide for the amplification of nucleic acids encoding CARs and / or dominant negative receptors and / or switch receptors.
[0329] As described herein, the subject CAR includes an antigen binding domain, a transmembrane domain, and an intracellular domain. Therefore, the present disclosure provides nucleic acids encoding the antigen binding domain, transmembrane domain, and intracellular domain of the subject CAR. As described herein, various dominant negative receptors and conversion receptors are provided. Therefore, the present invention provides nucleic acids encoding dominant negative receptors and / or conversion receptors.
[0330] In some embodiments, the nucleic acid encoding the CAR is separated from the nucleic acid encoding the dominant negative receptor and / or the switch receptor. In an exemplary embodiment, the nucleic acid encoding the CAR and the nucleic acid encoding the dominant negative receptor and / or the switch receptor are present in the same nucleic acid.
[0331] In some embodiments, the nucleic acid of the present invention includes a nucleic acid containing a CAR coding sequence and a dominant negative receptor and / or a conversion receptor coding sequence. In some embodiments, the nucleic acid of the present invention includes a nucleic acid containing a CAR coding sequence and a dominant negative receptor and / or a conversion receptor coding sequence separated by a joint. The joint used in the present invention (e.g., in the context of connecting a CAR coding sequence and a dominant negative receptor and / or a conversion receptor coding sequence) allows multiple proteins (e.g., polycistronic or bicistronic sequences) to be encoded by the same nucleic acid sequence, which is translated into a polyprotein that is dissociated into separate protein components. For example, the joint used in the nucleic acid of the present invention containing a CAR coding sequence and a dominant negative receptor and / or a conversion receptor coding sequence allows CAR and a dominant negative receptor and / or a conversion receptor to be translated into a polyprotein that is dissociated into separate CAR and dominant negative receptor and / or conversion receptor components.
[0332] In some embodiments, the linker includes a nucleic acid sequence encoding an internal ribosome entry site (IRES). As used herein, an "internal ribosome entry site" or "IRES" refers to an element that facilitates direct entry of internal ribosomes into the start codon (such as ATG) of a protein coding region, thereby allowing the gene to undergo cap-independent translation. Various internal ribosome entry sites are known to those skilled in the art, including, but not limited to, IRES that can be obtained from viral or cellular mRNA sources, such as immunoglobulin heavy chain binding protein (BiP); vascular endothelial growth factor (VEGF); fibroblast growth factor 2; insulin-like growth factor; translation initiation factor eIF4G; yeast transcription factors TFIID and HAP4; and IRES that can be obtained from, for example, cardiovirus, rhinovirus, foot-and-mouth disease virus, HCV, Friedreich's murine leukemia virus (FrMLV) and Moloney's murine leukemia virus (MoMLV). Those skilled in the art will be able to select an IRES suitable for use in the present invention.
[0333] In some embodiments, the linker includes a nucleic acid sequence encoding a self-cleaving peptide. As used herein, "self-cleaving peptide" or "2A peptide" refers to an oligopeptide that allows multiple proteins to be encoded as a polyprotein, which dissociates into component proteins after translation. The use of the term "self-cleavage" does not mean a hydrolytic cleavage reaction. Various self-cleaving peptides or 2A peptides are known to those skilled in the art, including but not limited to those found in members of the Picornaviridae family, such as foot-and-mouth disease virus (FMDV), equine rhinitis virus A (ERAV0), scutellaria virus (TaV) and porcine tetanus virus-1 (PTV-1), and cardioviruses such as Theilovirus and encephalomyocarditis virus. The 2A peptides derived from FMDV, ERAV, PTV-1, and TaV are referred to herein as "F2A," "E2A," "P2A," and "T2A," respectively. Those skilled in the art will be able to select a self-cleaving peptide suitable for use in the present invention.
[0334] In some embodiments, the nucleic acid of the present disclosure includes a nucleic acid sequence comprising a CAR coding sequence and a dominant negative receptor and / or a switch receptor coding sequence separated by a joint, and the joint includes a T2A peptide sequence. In some embodiments, the T2A peptide sequence includes the amino acid sequence EGRGSLLTCGDVEENPGP (SEQ ID NO: 94), which can be encoded by the nucleic acid sequence GAGGGCAGAGGAAGTCTTCTAACATGCGGTGACGTGGAGGAGAATCCCGGCCCT (SEQ ID NO: 95). In some embodiments, the joint including the T2A peptide sequence can further include a spacer sequence described herein. For example, the joint including the T2A peptide sequence can further include a spacer containing the amino acid sequence SGRSGGG (SEQ ID NO: 96), which can be encoded by the nucleic acid sequence TCCGGAAGATCTGGCGGCGGA (SEQ ID NO: 97).
[0335] In some embodiments, the nucleic acids of the present disclosure include a nucleic acid sequence comprising a CAR coding sequence and a dominant negative receptor and / or switch receptor coding sequence separated by a linker, the linker comprising a F2A peptide sequence. In some embodiments, the F2A peptide sequence comprises the amino acid sequence VKQTLNFDLLKLAGDVESNPGP (SEQ ID NO: 98), which can be encoded by the nucleic acid sequence GTGAAACAGACTTTGAATTTTGACCTTCTCAAGTTGGCGGGAGACGTGGAGTCCAACCCAGGGCCG (SEQ ID NO: 99).
[0336] In some embodiments, the joint further comprises a nucleic acid sequence encoding a furin cleavage site. Furin is a ubiquitous protease that is present in trans-Hokkigenia and processes its precursor before protein secretion. Furin cuts at the COOH-terminal end of its consensus recognition sequence. The consensus recognition sequence (or " furin cleavage site ") of various furins known to those skilled in the art includes but is not limited to Arg-X-Lys-Arg (SEQ ID NO:100) or Arg-X-Arg-Arg (SEQ ID NO:101), and Arg-XX-Arg (SEQ ID NO:102), such as Arg-Gln-Lys-Arg (SEQ ID NO:103), wherein X is any naturally occurring amino acid. Another example of a furin cleavage site is X1-Arg-X2-X3-Arg (SEQ ID NO:104), wherein X1 is Lys or Arg, X2 is any naturally occurring amino acid, and X3 is Lys or Arg. One skilled in the art will be able to select an appropriate furin cleavage site for use in the present invention.
[0337] In some embodiments, the linker comprises a nucleic acid sequence encoding a combination of a furin cleavage site and a 2A peptide. Examples include, but are not limited to, a linker comprising a nucleic acid sequence encoding furin and F2A, a linker comprising a nucleic acid sequence encoding furin and E2A, a linker comprising a nucleic acid sequence encoding furin and P2A, and a linker comprising a nucleic acid sequence encoding furin and T2A. One skilled in the art will be able to select a suitable combination for use in the present invention. In such embodiments, the linker may further comprise a spacer sequence between the furin and 2A peptide. Various spacer sequences are known in the art, including but not limited to glycine-serine (GS) spacers, such as (GS)n, (GSGGS)n (SEQ ID NO: 52), and (GGGS)n (SEQ ID NO: 53), where n represents an integer of at least 1. Exemplary spacer sequences can include, but are not limited to, amino acid sequences including but not limited to: GGSG (SEQ ID NO: 55), GGSGG (SEQ ID NO: 56), GSGSG (SEQ ID NO: 57), GSGGG (SEQ ID NO: 58), GGGSG (SEQ ID NO: 59), GSSSG (SEQ ID NO: 60), etc. One skilled in the art will be able to select suitable spacer sequences for use in the present invention.
[0338] In some embodiments, nucleic acid of the present disclosure includes a nucleic acid sequence containing a CAR coding sequence and a dominant negative receptor and / or a switch receptor coding sequence separated by a furin-(G4S)2-T2A (F-GS2-T2A) joint. The F-GS2-T2A joint can be encoded by the nucleic acid sequence CGTGCGAAGAGGGGCGGCGGGGGCTCCGGCGGGGGAGGCAGTGAGGGCCGCGGCTCCCTGCTGACCTGCGGAGATGTAGAAGAGAACCCAGGCCCC (SEQ ID NO: 105) and can include the amino acid sequence RAKRGGGGSGGGGSEGRGSLLTCGDVEENPGP (SEQ ID NO: 106). Those skilled in the art will recognize that the joint of the present invention can include permissible sequence changes.
[0339] In some embodiments, the present invention provides nucleic acids comprising nucleic acid sequences encoding dominant negative receptors and / or conversion receptors as described herein. In some embodiments, nucleic acid includes nucleic acid sequences encoding dominant negative receptors and / or conversion receptors and nucleic acid sequences encoding CAR as described herein (e.g., TnMUC1-CAR). In one embodiment, the nucleic acid sequences encoding dominant negative receptors and / or conversion receptors and nucleic acid sequences encoding CAR are present on separate nucleic acids. In one embodiment, the nucleic acid sequences encoding dominant negative receptors and / or conversion receptors and nucleic acid sequences encoding CAR are present in the same nucleic acid. In such embodiments, the nucleic acid sequences encoding dominant negative receptors and / or conversion receptors and nucleic acid sequences encoding CAR are separated by joints as described herein.
[0340] For example, the nucleic acid of the present disclosure may include a nucleic acid sequence encoding a dominant receptor, a joint, and a nucleic acid sequence encoding CAR. In one embodiment, the joint includes a nucleic acid sequence encoding a 2A peptide (e.g., T2A). In an exemplary embodiment, the nucleic acid of the present disclosure may include a nucleic acid sequence encoding a dominant negative receptor and / or a conversion receptor separated by a joint sequence including a nucleic acid sequence encoding T2A and a nucleic acid sequence encoding CAR.
[0341] Therefore, in one embodiment, the nucleic acid of the present disclosure includes from 5' to 3': a nucleic acid sequence encoding a dominant negative receptor and / or a switch receptor, a nucleic acid sequence encoding a linker, and a nucleic acid sequence encoding a CAR. In one embodiment, the nucleic acid of the present disclosure includes from 5' to 3' a nucleic acid sequence encoding a CAR, a CAR encoding a linker, and a nucleic acid sequence encoding a dominant negative receptor and / or a switch receptor.
[0342] Therefore, in an exemplary embodiment, the nucleic acid of the present invention includes from 5' to 3': a nucleic acid sequence encoding TGFβRII-DN, a nucleic acid sequence encoding a linker comprising a 2A peptide (e.g., T2A), and a nucleic acid sequence encoding MUC1-CAR (e.g., SEQ ID NO: 1, 38, 40, 42, 44, or 46). In one embodiment, the nucleic acid of the present disclosure includes from 5' to 3': a nucleic acid encoding MUC1-CAR, a nucleic acid encoding a linker comprising a 2A peptide (e.g., T2A), and a nucleic acid encoding a dominant negative receptor and / or a switch receptor.
[0343] In some embodiments, the nucleic acids of the present disclosure can be operably linked to transcriptional control elements, such as promoters and enhancers, etc. Suitable promoter and enhancer elements are known to those skilled in the art.
[0344] For expression in bacterial cells, suitable promoters include, but are not limited to, lacI, lacZ, T3, T7, gpt, λP, and trc. For expression in eukaryotic cells, suitable promoters include, but are not limited to, light chain and / or heavy chain immunoglobulin gene promoters and enhancer elements; cytomegalovirus immediate early promoter; herpes simplex virus thymidine kinase promoter; early and late SV40 promoters; promoters in the long terminal repeats of retroviruses; mouse metallothionein-I promoter; and various tissue-specific promoters known in the art. Suitable reversible promoters (including reversible inducible promoters) are known in the art. Such reversible promoters can be isolated and derived from many organisms, such as eukaryotes and prokaryotes. Modification of a reversible promoter derived from a first organism for use in a second organism (e.g., a first prokaryote and a second eukaryote, or a first eukaryote and a second prokaryote, etc.) is known in the art. Such reversible promoters, and systems based on such reversible promoters but also comprising additional control proteins, include, but are not limited to, alcohol-regulated promoters (e.g., alcohol dehydrogenase I (alcA) gene promoter, promoters responsive to ethanol transactivator protein (A1cR), etc.), tetracycline-regulated promoters (e.g., promoter systems including TetActivators, TetON, TetOFF, etc.), steroid-regulated promoters (e.g., rat glucocorticoid receptor promoter system, human estrogen receptor promoter system, retinoid promoter system, thyroid promoter system, ecdysone promoter system, mifepristone promoter system, etc.), metal-regulated promoters (such as metallothionein promoter system, etc.), promoters regulated by related pathogens (such as salicylic acid-regulated promoters, ethylene-regulated promoters, benzothiadiazole-regulated promoters, etc.), temperature-regulated promoters (such as heat shock-inducible promoters (such as HSP-70, HSP-90, soybean heat shock promoter, etc.), light-regulated promoters, synthetic inducible promoters, etc.
[0345] In some embodiments, the promoter is a CD8 cell-specific promoter, a CD4 cell-specific promoter, a neutrophil-specific promoter, or a NK-specific promoter. For example, the CD4 gene promoter can be used; see, e.g., Salmon et al. Proc. Natl. Acad. Sci. USA (1993) 90: 7739; and Marodon et al. (2003) Blood 101: 3416. As another example, the CD8 gene promoter can be used. NK cell-specific expression can be achieved by using the NcrI (p46) promoter; see, e.g., Eckelhart et al. Blood (2011) 117: 1565.
[0346] For expression in yeast cells, suitable promoters are constitutive promoters, such as ADH1 promoter, PGK1 promoter, ENO promoter, PYK1 promoter, etc.; or regulatable promoters, such as GAL1 promoter, GAL10 promoter, ADH2 promoter, PHOS promoter, CUP1 promoter, GALT promoter, MET25 promoter, MET3 promoter, CYC1 promoter, HIS3 promoter, ADH1 promoter, PGK promoter, GAPDH promoter, ADC1 promoter, TRP1 promoter, URA3 promoter, LEU2 promoter, ENO promoter, TP1 promoter, and AOX1 (e.g., for Pichia). Selecting appropriate vectors and promoters is well within the level of one of ordinary skill in the art.Suitable promoters for prokaryotic host cells include, but are not limited to, the bacteriophage T7 RNA polymerase promoter; the trp promoter; the lac operon promoter; hybrid promoters, such as the lac / tac hybrid promoter, the tac / trc hybrid promoter, the trp / lac promoter, the T7 / lac promoter; the trc promoter; the tac promoter; the araBAD promoter; in vivo regulated promoters, such as the ssaG promoter or related promoters (see, e.g., U.S. Patent Publication No. 20040131637), the pagC promoter (Pulkkinen and Miller, J. Bacter iol. (1991) 173(1):86-93; Alpuche-Aranda et al., Proc. Natl. Acad. Sci. USA (1992) 89(21):10079-83), nirB promoter (Harborne et al. Mol. Micro. (1992) 6:2805-2813), etc. (see, e.g., Dunstan et al., Infect. Immun. (1999) 67:5133-5141; McKelvie et al., Proc. Natl. Acad. Sci. USA (1992) 89(21):10079-83), nirB promoter (Harborne et al. Mol. Micro. (1992) 6:2805-2813), etc. , Vaccine (2004) 22: 3243-3255; and Chatfield et al., Biotechnol. (1992) 10: 888-892); Σ70 promoter, such as the common σ70 promoter (see, e.g., GenBank accession numbers AX79898, AX798961, and AX798183); stationary phase promoters, such as the dps promoter, the spv promoter, etc.; promoters derived from the pathogenicity island SPI-2 (see, e.g., WO96 / 17951); actA promoter (see, e.g., Shetron-Rama et al., Infect. Immun. (2002) 70: 1087-1096); rpsM promoter (see, e.g., Valdivia and Falkow Mol. Microbiol. (1996). 22: 367); tet promoter (see, e.g., Hillen, W. and Wissmann, A. (1989) In Saenger, W. and Heinemann, U. (eds), Topics in Molecular and Structural Biology, protein--Nucleic Acid Interaction. Macmillan, London, UK, Vol. 10, pp. 143-162); SP6 promoter (see, e.g., Melton et al., Nucl. Acids Res. (1984) 12: 7035); etc. Suitable strong promoters for use in prokaryotes, such as E. coli, include, but are not limited to, Trc, Tac, T5, T7, and P Lambda.Non-limiting examples of operators for bacterial host cells include the lactose promoter operator (when exposed to lactose, the Lad repressor protein changes conformation, thereby preventing the Lad repressor protein from binding to the operator), the tryptophan promoter operator (when complexed with tryptophan, the TrpR repressor protein adopts a conformation that binds the operator; in the absence of tryptophan, the TrpR repressor protein adopts a conformation that does not bind the operator), and the tac promoter operator (see, e.g., deBoer et al., Proc. Natl. Acad. Sci. USA (1983) 80:21-25).
[0347] Other examples of suitable promoters include the immediate early cytomegalovirus (CMV) promoter sequence. This promoter sequence is a strong constitutive promoter capable of driving high-level expression of any polynucleotide sequence operably linked thereto. However, other constitutive promoter sequences may also be used, including but not limited to the simian virus 40 (SV40) early promoter, mouse mammary tumor virus (MMTV), human immunodeficiency virus (HIV) long terminal repeat (LTR) promoter, MoMuLV promoter, avian leukosis virus promoter, Epstein-Barr virus immediate early promoter, Rous sarcoma virus promoter, EF-1α promoter, and human gene promoters, such as but not limited to the actin promoter, myosin promoter, hemoglobin promoter, and creatine kinase promoter. In addition, the present invention should not be limited to the use of constitutive promoters. Inducible promoters are also considered as part of the present invention. Using an inducible promoter provides a molecular switch that can turn on the expression of the polynucleotide sequence operably linked thereto when expression is desired, or turn off the expression when expression is not desired. Examples of inducible promoters include, but are not limited to, the metallothionein promoter, the glucocorticoid promoter, the progesterone promoter, and the tetracycline promoter.
[0348] In some embodiments, a locus or construct or transgene containing a suitable promoter is irreversibly converted by induction of an induction system. Suitable systems for inducing irreversible conversion are well known in the art, such as Cre-lox-mediated recombination (see, e.g., Fuhrmann-Benzakein, et al., Proc. Natl. Acad. Sci. USA (2000) 28: e99, the disclosure of which is incorporated herein by reference). Any suitable combination of recombinases, endonucleases, ligases, recombination sites, etc. known in the art can be used to generate irreversibly converted promoters. The methods, mechanisms, and requirements for performing site-specific recombination described elsewhere herein can be used to generate irreversibly converted promoters and are well known in the art, see, e.g., Grindley et al. Annual Review of Biochemistry (2006) 567-605; and Tropp, Molecular Biology (2012) (Jones & Bartlett Publishers, Sudbury, MA), the disclosure of which is incorporated herein by reference.
[0349] In some embodiments, the nucleic acid of the present disclosure further comprises a nucleic acid sequence encoding a CAR inducible expression cassette. In one embodiment, the CAR inducible expression cassette is used to produce a transgenic polypeptide product released based on CAR signal transduction. See, e.g., Chmielewski and Abken, Expert Opin. Biol. Ther. (2015) 15 (8): 1145-1154; and Abken, Immunotherapy (2015) 7 (5): 535-544.
[0350] The nucleic acids disclosed herein may be present in expression vectors and / or cloning vectors. The expression vectors may include selectable markers, origins of replication, and other features that provide for vector replication and / or maintenance. Suitable expression vectors include, for example, plasmids, viral vectors, and the like. A large number of suitable vectors and promoters are known to those skilled in the art; many are commercially available for use in generating the subject recombinant constructs. The following vectors are provided by way of example, but should in no way be construed as limiting: Bacterial: pBs, phage, PsiX174, pBluescript SK, pBs KS, pNH8a, pNH16a, pNH18a, pNH46a (Stratagene, La Jolla, Calif., USA); pTrc99A, pKK223-3, pKK233-3, pDR540, and pRIT5 (Pharmacia, Uppsala, Sweden). Eukaryotes: pWLneo, pSV2cat, pOG44, PXR1, pSG (Stratagene) pSVK3, pBPV, pMSG, and pSVL (Pharmacia).
[0351] Expression vectors generally have convenient restriction sites located near the promoter sequence to provide for the insertion of nucleic acid sequences encoding heterologous proteins.Selectable markers that operate in the expression host may be present. Suitable expression vectors include, but are not limited to, viral vectors (e.g., poxvirus-based viral vectors; poliovirus; adenovirus (see, e.g., Li et al., Invest. Opthalmol. Vis. Sci. (1994) 35:2543-2549; Borras et al., Gene Ther. (1999) 6:515-524; Li and Davidson, Proc. Natl. Acad. Sci. USA (1995) 92:7700-7704; Sakamoto et al., H. Gene Ther. (1999) 5:1088-1097; WO 94 / 12649, WO 93 / 03769; WO 93 / 19191; WO 94 / 28938; WO 95 / 11984 and WO 95 / 00655); adeno-associated virus (see, e.g., Ali et al., Hum. Gene Ther. (1998) 9:81-86, Flannery et al., Proc. Natl. Acad. Sci. USA (1997) 94:6916-6921; Bennett et al., Invest. Opthalmol. Vis. Sci. (1997) 38:2857-2863; Jomary et al., Gene Ther. (1997) 4:683-690, Rolling et al., Hum. Gene Ther. (1999) 10:641-648; Ali et al., Hum. Mol. Genet. (1996) 5:591-594; Srivastava in WO 93 / 09239, Samulski et al., J. Vir. (1989) 63:3822-3828; Mendelson et al., Virol. (1988) 166:154-165; and Flotte et al., Proc. Natl. Acad. Sci. USA (1993) 90:10613-10617); SV40; herpes simplex virus; human immunodeficiency virus (see, e.g., Miyoshi et al., P Roc. Natl. Acad. Sci. USA (1997) 94: 10319-23; Takahashi et al., J. Virol. (1999) 73: 7812-7816); retroviral vectors (e.g., murine leukemia virus, spleen necrosis virus, and vectors derived from retroviruses, such as Rous sarcoma virus, Harvey sarcoma virus, family leukemia virus, human immunodeficiency virus, myeloproliferative sarcoma virus, and mammary tumor virus); etc.
[0352] Suitable additional expression vectors include, but are not limited to, lentiviral vectors, gamma retroviral vectors, foamy virus vectors, adeno-associated virus vectors, adenoviral vectors, poxvirus vectors, herpes virus vectors, engineered hybrid virus vectors, transposon-mediated vectors, and the like. Viral vector technology is well known in the art and is described in, for example, Sambrook et al., 2012, Molecular Cloning: A Laboratory Manual, volumes 1-4, Cold Spring Harbor Press, NY), and other virology and molecular biology manuals. Viruses that can be used as vectors include, but are not limited to, retroviruses, adenoviruses, adeno-associated viruses, herpes viruses, and lentiviruses.
[0353] Typically, suitable vectors contain an origin of replication functional in at least one organism, a promoter sequence, convenient restriction endonuclease sites, and one or more selectable markers (eg, WO 01 / 96584, WO 01 / 29058, and US Pat. No. 6,326,193).
[0354] In some embodiments, an expression vector (such as a lentiviral vector) can be used to introduce CAR into immune cells or their precursors (such as T cells). Therefore, the expression vector of the present invention (such as a lentiviral vector) may include nucleic acids encoding CAR. In some embodiments, an expression vector (such as a lentiviral vector) will include additional elements for assisting the functional expression of the CAR encoded therein. In some embodiments, the expression vector comprising the nucleic acid encoding CAR further includes a mammalian promoter. In one embodiment, the vector further includes an elongation factor-1-α promoter (EF-1α promoter). Using the EF-1α promoter can increase the efficiency of expression of downstream transgenics (such as, nucleic acid sequences encoding CAR). Physiological promoters (such as EF-1α promoters) may be less likely to induce integration-mediated genetic toxicity and can abolish the ability of retroviral vectors to transform stem cells. Other physiological promoters suitable for vectors (such as lentiviral vectors) are known to those skilled in the art and can be incorporated into the vector of the present invention. In some embodiments, the vector (such as a lentiviral vector) further includes a non-essential cis-acting sequence that can increase titer and gene expression. A non-limiting example of a non-essential cis-acting sequence is a central polypurine tract and a central termination sequence (cPPT / CTS), which are important for efficient reverse transcription and nuclear import. Other non-essential cis-acting sequences are known to those skilled in the art and can be incorporated into the vector of the present invention (e.g., lentiviral vectors). In some embodiments, the vector further includes a post-transcriptional regulatory element. The post-transcriptional regulatory element can improve RNA translation, increase transgene expression, and stabilize RNA transcripts. An example of a post-transcriptional regulatory element is the woodchuck hepatitis virus post-transcriptional regulatory element (WPRE). Therefore, in some embodiments, the vector of the present invention further includes a WPRE sequence. Various post-transcriptional regulatory elements are known to those skilled in the art and can be incorporated into the vector of the present invention (e.g., lentiviral vectors). The vector of the present invention can further include other elements, such as the rev response element (RRE) for RNA transport, a packaging sequence, and 5' and 3' long terminal repeats (LTR). The term "long terminal repeat" or "LTR" refers to the domain of the base pairs at the end of the retroviral DNA, which includes U3, R, and U5 regions. LTRs typically provide functions required for retroviral gene expression (e.g., promotion, initiation, and polyadenylation of gene transcripts) and for viral replication. In one embodiment, the vectors of the present invention (e.g., lentiviral vectors) include LTRs with 3' U3 deletions. Thus, the vectors of the present invention (e.g., lentiviral vectors) can include any combination of elements described herein that enhance the efficiency of transgenic functional expression.For example, in addition to the nucleic acid encoding CAR, the vector of the present invention (eg, lentiviral vector) may further include a WPRE sequence, a cPPT sequence, an RRE sequence, a 5'LTR, and a 3'U3-deleted LTR'.
[0355] The vector of the present invention can be a self-inactivating vector. As used herein, the term "self-inactivating vector" refers to a vector in which the 3'LTR enhancer promoter region (U3 region) has been modified (e.g., by deletion or substitution). Self-inactivating vectors can prevent viral transcription from exceeding the first round of viral replication. Therefore, self-inactivating vectors can infect and then integrate into the host genome (e.g., mammalian genome) only once, and cannot be further transmitted. Therefore, self-inactivating vectors can greatly reduce the risk of producing replication-competent viruses.
[0356] In some embodiments, the nucleic acid of the present invention may be RNA, such as, in vitro synthesized RNA. Methods for synthesizing RNA in vitro are known to those skilled in the art; RNA comprising a sequence encoding the CAR of the present disclosure can be synthesized using any known method. Methods for introducing RNA into host cells are known in the art. See, e.g., Zhao et al. Cancer Res. (2010) 15: 9053. Methods for introducing RNA comprising a nucleotide sequence encoding the CAR of the present disclosure into host cells can be performed in vitro, ex vivo, or in vivo. For example, host cells (e.g., NK cells, cytotoxic T lymphocytes, etc.) can be electroporated in vitro or ex vivo using RNA comprising a nucleotide sequence encoding the CAR of the present disclosure.
[0357] In order to evaluate the expression of a polypeptide or portion thereof, the expression vector to be introduced into the cell may also contain a selectable marker gene or a reporter gene, or both, to facilitate identification and selection of expressing cells from a cell population transfected or infected by a viral vector. In some embodiments, the selectable marker can be carried on a separate DNA sheet and used in a co-transfection procedure. The selectable marker and reporter gene may be flanked by appropriate regulatory sequences to enable expression in the host cell. Useful selectable markers include, but are not limited to, antibiotic resistance genes.
[0358] Reporter genes are used to identify potential transfected cells and to assess the function of regulatory sequences. In general, reporter genes do not exist or are not expressed in recipient organisms or tissues, and encode polypeptides whose expression can be manifested by some easily detectable properties (e.g., enzymatic activity). After DNA is introduced into recipient cells, the expression of reporter genes is assessed at the appropriate time. Suitable reporter genes may include, but are not limited to, genes encoding luciferase, beta-galactosidase, chloramphenicol acetyltransferase, secreted alkaline phosphatase, or green fluorescent protein genes (e.g., Ui-Tei et al., 2000 FEBS Letters 479:79-82).
[0359] Methods for generating modified immune cells
[0360] The present invention provides methods for producing / generating modified immune cells or their precursor cells (e.g., T cells / NK cells / NKT cells). Cells are typically transformed by introducing nucleic acids encoding a subject CAR (e.g., MUC1 CAR).
[0361] Methods for introducing nucleic acids into cells include physical, biological, and chemical methods. Physical methods for introducing polynucleotides such as RNA into host cells include calcium phosphate precipitation, lipofection, particle bombardment, microinjection, electroporation, and the like. Commercially available methods including electroporation (Amaxa Nucleofector-II (Amaxa Biosystems, Cologne, Germany)), (ECM 830 (BTX) (Harvard Instruments, Boston, Massachusetts)) or Gene Pulser II (BioRad, Denver, Colorado), Multiporator (Eppendorf, Hamburg Germany) can be used to introduce RNA into target cells. Cationic liposome-mediated transfection can also be used—using lipofection, using polymer encapsulation, using peptide-mediated transfection, or using biolistic particle delivery systems (e.g., "gene guns") (see, e.g., Nishikawa et al., Hum Gene Ther., 12(8):861-70 (2001) to introduce RNA into cells.
[0362] Biological methods for introducing polynucleotides of interest into host cells include the use of DNA and RNA vectors. Viral vectors, particularly retroviral vectors, have become the most widely used method for inserting genes into mammalian, e.g., human, cells. Other viral vectors can be derived from lentiviruses, poxviruses, herpes simplex virus I, adenoviruses, and adeno-associated viruses, among others. See, e.g., U.S. Patent Nos. 5,350,674 and 5,585,362.
[0363] In some embodiments, the nucleic acid encoding the subject CAR of the present invention is introduced into cells by an expression vector. Provided herein are expression vectors comprising nucleic acids encoding subject CAR (e.g., MUC1 CAR). Suitable expression vectors include lentiviral vectors, gamma retroviral vectors, foamy virus vectors, adeno-associated virus (AAV) vectors, adenoviral vectors, engineered hybrid viruses, naked DNA, including but not limited to transposon-mediated vectors, such as Sleeping Beauty, Piggybak, and Integrases (such as Phi31). Some other suitable expression vectors include herpes simplex virus (HSV) and retroviral expression vectors.
[0364] Adenovirus expression vector is based on adenovirus, and it has low ability to be integrated into genomic DNA but has high efficiency to transfecting host cells.Adenovirus expression vector contains enough to support the packaging of expression vector (a) and (b) finally express theme CAR in host cell.In some embodiments, adenovirus genome is 36kb, linear, double-stranded DNA, wherein foreign DNA sequence (such as, encoding theme CAR nucleic acid) can be inserted to replace large adenovirus DNA, so as to prepare the expression vector of the present invention (see, e.g., Danthinne and Imperiale, Gene Therapy (2000) 7 (20): 1707-1714).
[0365] Another expression vector is based on adeno-associated virus, which utilizes an adenovirus coupling system. The AAV expression vector has a high frequency of integration into the host genome. It can infect non-dividing cells, thereby making it useful for gene delivery into mammalian cells, for example, in tissue culture or in vivo. AAV vectors have a wide host range for infectivity. Details related to the production and use of AAV vectors are described in U.S. Patent Nos. 5,139,941 and 4,797,368.
[0366] Retroviral expression vector can be integrated into the host genome, delivers a large amount of foreign genetic material, infects a wide spectrum of species and cell types, and is packaged in a specialized cell line. By inserting nucleic acid (such as, encoding theme CAR nucleic acid) into viral genome at certain positions, to produce replication-defective viruses, construct retroviral vectors. Although retroviral vectors can infect a variety of cell types, the integration and stable expression of theme CAR require the division of host cells.
[0367] Lentiviral vector is derived from lentivirus, which is a complex retrovirus, in addition to common retroviral genes gag, pol and env, it also contains other genes with regulatory or structural functions (see, e.g., U.S. Patents 6,013,516 and 5,994,136). Some examples of lentivirus include human immunodeficiency virus (HIV-1, HIV-2) and simian immunodeficiency virus (SIV). Lentiviral vectors have been produced by repeatedly attenuating HIV virulence genes, for example, deletion genes env, vif, vpr, vpu and nef, making the vector biologically safe. Lentiviral vectors can infect non-dividing cells and can be used for in vivo and ex vivo gene transfer and expression, such as in vivo and ex vivo gene transfer and expression of nucleic acids encoding theme CAR (see, e.g., U.S. Patents 5,994,136).
[0368] The expression vector comprising nucleic acid of the present disclosure can be introduced into host cells by any method known to those skilled in the art. If necessary, the expression vector can include a viral sequence for transfection. Alternatively, the expression vector can be introduced by fusion, electroporation, biolistics, transfection, lipofection, etc. The host cell can be grown and amplified in culture before introducing the expression vector, and then appropriately treated to introduce and integrate the vector. The host cell can then be amplified, and the marker present in the vector can be used for screening. Various markers known in the art can be used, and can include hprt, neomycin resistance, thymidine kinase, hygromycin resistance, etc. As used herein, the terms "cell", "cell line", and "cell culture" can be used interchangeably. In some embodiments, the host cell is an immune cell or a precursor thereof, such as a T cell, NK cell, or NKT cell.
[0369] The present invention also provides genetically engineered cells, which include and stably express the subject CAR of the present disclosure. In some embodiments, genetically engineered cells are genetically engineered T lymphocytes (T cells), regulatory T cells (Tregs), naive T cells (TN), memory T cells (e.g., central memory T cells (TCM), effector memory cells (TEM)), natural killer cells (NK cells), natural killer T cells (NKT cells) and macrophages capable of producing treatment-related offspring. In one embodiment, genetically engineered cells are autologous cells.
[0370] Modified cells (such as, including theme CAR) can be produced by stably transfecting host cells using an expression vector including nucleic acid disclosed herein.Another method for producing modified cells disclosed herein includes but is not limited to chemical conversion methods (such as, using calcium phosphate, dendrimers, liposomes and / or cationic polymers), non-chemical conversion methods (such as, electroporation, photoconversion, gene electrotransfer and / or fluid dynamic delivery) and / or particle-based methods (such as, impalefection, using gene guns and / or magnetic transfection (magnetofection)).Expressing the transfected cells of the theme CAR of the present disclosure can be amplified in vitro.
[0371] Physical methods for introducing expression vectors into host cells include calcium phosphate precipitation, lipofection, particle bombardment, microinjection, electroporation, and the like. Methods for generating cells containing vectors and / or exogenous nucleic acids are known in the art. See, e.g., Sambrook et al. (2001), Molecular Cloning: A Laboratory Manual, Cold Spring Harbor Laboratory, New York.
[0372] Chemical means for introducing polynucleotides into host cells include colloidal dispersion systems (e.g., macromolecular complexes, nanocapsules, microspheres, beads) and lipid-based systems (including oil-in-water emulsions, micelles, mixed micelles, and liposomes). An exemplary colloidal system for use as a delivery vehicle in vitro and in vivo is a liposome (e.g., an artificial membrane vesicle).
[0373] Suitable lipids for use can be obtained from commercial sources. For example, dimyristylphosphatidylcholine ("DMPC") is available from Sigma, St. Louis, MO; dicetyl phosphate ("DCP") is available from K&K Laboratories (Plainview, NY); cholesterol ("Choi") is available from Calbiochem-Behring; dimyristylphosphatidylglyceride ("DMPG") and other lipids are available from Avanti Polar Lipids, Inc. (Birmingham, AL). Stock solutions of lipids in chloroform or chloroform / methanol can be stored at approximately -20°C. Chloroform is used as the sole solvent because it evaporates more easily than methanol. "Liposome" is a general term that encompasses various monolayer and multilayer lipid carriers formed by creating closed lipid bilayers or aggregates. Liposomes can be characterized as having a vesicle structure having a phospholipid bilayer membrane and an aqueous medium inside. Multilayer liposomes have multiple lipid layers separated by an aqueous medium. When phospholipids are suspended in an excess of aqueous solution, they form spontaneously. Before forming a closed structure, the lipid components undergo self-rearrangement and entrap water and dissolved solutes between the lipid bilayers (Ghosh et al., 1991 Glycobiology 5:505-10). However, compositions that have structures that differ from normal vesicle structures in solution are also included. For example, lipids may exhibit micellar structures or exist only as heterogeneous aggregates of lipid molecules. Lipofectamine-nucleic acid complexes are also contemplated.
[0374] Regardless of the method used to introduce exogenous nucleic acid into the host cell or otherwise expose the cell to the inhibitor of the present invention, a variety of assays can be performed to confirm the presence of the nucleic acid in the host cell. Such assays include, for example, "molecular biology" assays known to those skilled in the art (e.g., Southern and Northern blotting, RT-PCR and PCR); "biochemical" assays, such as detecting the presence or absence of a specific peptide, such as by immunological methods (ELISA and Western blotting), or by the assays described herein, to identify agents that fall within the scope of the present invention.
[0375] Furthermore, nucleic acids can be introduced by any means, such as transduction of expanded T cells, transfection of expanded T cells, and electroporation of expanded T cells. One nucleic acid can be introduced by one method, and another nucleic acid can be introduced into T cells by a different method.
[0376] RNA
[0377] In one embodiment, the nucleic acid introduced into the host cell is RNA. In another embodiment, the RNA is mRNA, which comprises in vitro transcribed RNA or synthetic RNA. RNA is produced by in vitro transcription using the template produced by polymerase chain reaction (PCR). The target DNA from any source can be directly converted into a template by PCR to synthesize in vitro mRNA using suitable primers and RNA polymerase. The source of the DNA can be, for example, genomic DNA, plasmid DNA, phage DNA, cDNA, synthetic DNA sequence or any other suitable DNA source.
[0378] PCR can be used to generate templates for in vitro transcription of mRNA, which are then introduced into cells. Methods for performing PCR are known in the art. Primers used for PCR are designed to have regions that are substantially complementary to regions of DNA that can serve as PCR templates. As used herein, "substantially complementary" refers to nucleotide sequences in which most or all of the bases in the primer sequence are complementary, or one or more bases are non-complementary or mismatched. Substantially complementary sequences are capable of annealing or hybridizing with the intended DNA target under annealing conditions for PCR. Primers can be designed to be substantially complementary to any portion of the DNA template. For example, primers can be designed to amplify the portion of a gene that is typically transcribed in a cell (open reading frame), including 5' and 3' UTRs. Primers can also be designed to amplify a portion of a gene that encodes a specific target domain. In one embodiment, primers are designed to amplify the coding region of a human cDNA, including all or part of the 5' and 3' UTRs. Primers that can be used for PCR can be produced by synthetic methods known in the art. A "forward primer" refers to a primer containing a nucleotide region that is substantially complementary to the nucleotides on the DNA template upstream of the DNA sequence to be amplified. "Upstream" is used herein to refer to the 5' position relative to the DNA sequence to be amplified in the coding strand. "Reverse primer" refers to a primer containing a nucleotide region that is substantially complementary to the double-stranded DNA template downstream of the DNA sequence to be amplified. "Downstream" is used herein to refer to the 3' position relative to the DNA sequence to be amplified in the coding strand.
[0379] Chemical structures with the ability to promote RNA stability and / or translation efficiency can also be used. RNA preferably has 5' and 3' UTRs. In one embodiment, the length of the 5' UTR is 0 to 3000 nucleotides. The length of the 5' and 3' UTR sequences to be added to the coding region can be changed by different methods, including but not limited to designing PCR primers that anneal to different regions of the UTR. Using this method, those skilled in the art can modify the length of the 5' and 3' UTRs required for the best translation efficiency after transfection of the RNA to be transcribed.
[0380] The 5' and 3' UTRs can be naturally occurring endogenous 5' and 3' UTRs of the target gene. Alternatively, a UTR sequence that is not endogenous to the target gene can be added by incorporating the UTR sequence into the forward and reverse primers, or by any other modification of the template. The use of a UTR sequence that is not endogenous to the target gene can be used to modify the stability and / or translation efficiency of the RNA. For example, it is known that AU-rich elements in the 3' UTR sequence can reduce the stability of the mRNA. Therefore, 3' UTRs can be selected or designed based on UTR properties well known in the art to increase the stability of the transcribed RNA.
[0381] In one embodiment, the 5'UTR may contain a Kozak sequence of an endogenous gene. Alternatively, when a 5'UTR that is not endogenous to the target gene is added by PCR as described above, a consensus Kozak sequence can be redesigned by adding a 5'UTR sequence. The Kozak sequence can improve the translation efficiency of certain RNA transcripts, but it does not appear that all RNAs require such a sequence for efficient translation. It is known in the art that many mRNAs require a Kozak sequence. In other embodiments, the 5'UTR may be derived from an RNA virus whose RNA genome is stable in cells. In other embodiments, various nucleotide analogs can be used in the 3' or 5'UTR to prevent exonuclease degradation of the mRNA.
[0382] In order to be able to synthesize RNA from DNA templates without the need for gene cloning, a transcription promoter should be connected to the DNA template upstream of the sequence to be transcribed. When the sequence of the promoter serving as RNA polymerase was added to the 5 ' end of the forward primer, the RNA polymerase promoter was incorporated into the PCR product upstream of the open reading frame to be transcribed. In one embodiment, the promoter is a T7 polymerase promoter, as described in other parts of this paper. Other useful promoters include but are not limited to T3 and SP6 RNA polymerase promoters. The consensus nucleotide sequence of T7, T3 and SP6 promoters is known in the art.
[0383] In one embodiment, the mRNA has a cap on the 5' end and a 3' poly (A) tail, which determines ribosome binding, translation initiation, and mRNA stability in the cell. On circular DNA templates, such as plasmid DNA, RNA polymerase produces long, multimeric products that are not suitable for expression in eukaryotic cells. Linearization of plasmid DNA transcripts at the 3' UTR end results in normal-sized mRNA, which, even after polyadenylation, is ineffective in eukaryotic cell transfection.
[0384] On a linear DNA template, bacteriophage T7 RNA polymerase can extend the 3' end of the transcript beyond the last base of the template (Schenborn and Mierendorf, Nuc Acids Res., 13:6223-36 (1985); Nacheva and Berzal-Herranz, Eur. J. Biochem., 270:1485-65 (2003)).
[0385] The conventional method for integrating polyA / T stretches into DNA templates is molecular cloning. However, polyA / T sequences integrated into plasmid DNA can lead to plasmid instability, which is why plasmid DNA templates obtained from bacterial cells are often highly contaminated with deletions and other aberrations. This makes cloning procedures not only laborious and time-consuming, but also often unreliable. Therefore, methods that allow the use of polyA / T 3' stretches to construct DNA templates without cloning are highly desirable.
[0386] The polyA / T segment of the transcribed DNA template can be generated during PCR using a reverse primer containing a polyT tail (e.g., a 100T tail (which can range in size from 50 to 5000 T), or after PCR by any other method (including but not limited to DNA ligation or in vitro recombination). The poly(A) tail also provides stability to the RNA and reduces its degradation. In general, the length of the poly(A) tail is positively correlated with the stability of the transcribed RNA. In one embodiment, the poly(A) tail is 100 to 5000 adenosines.
[0387] After in vitro transcription using poly (A) polymerase (e.g., E. coli poly A polymerase (E-PAP)), the poly (A) tail of the RNA can be further extended. In one embodiment, increasing the length of the poly (A) tail from 100 nucleotides to 300 to 400 nucleotides results in an approximately 2-fold increase in the translation efficiency of the RNA. In addition, different chemical groups are attached to the 3' end to increase mRNA stability. This attachment may contain modified / artificial nucleotides, aptamers, and other compounds. For example, poly (A) polymerase may be used to incorporate ATP analogs into the poly (A) tail. ATP analogs can further increase the stability of the RNA.
[0388] The 5' cap also provides stability to the RNA molecule. In certain exemplary embodiments, the RNA produced by the methods disclosed herein includes a 5' cap. The 5' cap is provided using techniques known in the art and described herein (Cougot, et al., Trends in Biochem. Sci., 29:436-444 (2001); Stepinski, et al., RNA, 7:1468-95 (2001); Elango, et al., Biochim. Biophys. Res. Commun., 330:958-966 (2005)).
[0389] The RNA produced by the methods disclosed herein can also contain an internal ribosome entry site (IRES) sequence. The IRES sequence can be any viral, chromosomal or artificially designed sequence that initiates the binding of cap-independent ribosomes to mRNA and promotes the initiation of translation. Any solute suitable for cell electroporation can be included, and these solutes can contain factors that promote cell permeability and viability, such as sugars, peptides, lipids, proteins, antioxidants and surfactants.
[0390] In some embodiments, RNA is electroporated into cells, such as in vitro transcribed RNA.
[0391] The methods disclosed herein can be applied to basic research and therapy in the fields of cancer, stem cells, acute and chronic infections, and autoimmune diseases to modulate host cell activity, including evaluating the ability of genetically modified host cells to kill target cancer cells.
[0392] The method also provides the ability to control expression levels over a wide range by changing, for example, the promoter or the amount of input RNA, making it possible to independently regulate expression levels. In addition, PCR-based mRNA production technology has greatly facilitated the design of mRNAs with different structures and their domain combinations.
[0393] An advantage of the RNA transfection method of the present invention is that RNA transfection is essentially transient and does not require a vector. RNA transgenes can be delivered to lymphocytes and expressed therein after brief in vitro cell activation, as a minimal expression cassette without the need for any additional viral sequences. Under these conditions, integration of the transgene into the host cell genome is not possible. Due to the transfection efficiency of RNA and its ability to uniformly modify an entire lymphocyte population, there is no need for cell cloning.
[0394] Genetic modification of host cells with in vitro transcribed RNA (IVT-RNA) utilizes two different strategies, both of which have been successfully tested in various animal models. Cells are transfected with in vitro transcribed RNA by lipofection or electroporation. It is desirable to stabilize the IVT-RNA using various modifications to achieve prolonged expression of the transferred IVT-RNA.
[0395] Certain IVT vectors are known in the literature that are used as templates for in vitro transcription in a standardized manner and are genetically modified in such a way that stable RNA transcripts are produced. Currently, the protocols used in the art are based on plasmid vectors with the following structure: a 5' RNA polymerase promoter that enables RNA transcription, followed by the gene of interest flanked by untranslated regions (UTRs) at the 3' and / or 5' sides, and a 3' polyadenylated cassette containing 50 to 70 A nucleotides. Prior to in vitro transcription, the circular plasmid is linearized downstream of the polyadenylated cassette by a type II restriction enzyme (the recognition sequence corresponds to the cleavage site). The polyadenylated cassette thus corresponds to the subsequent poly(A) sequence in the transcript. Due to this procedure, some nucleotides remain after linearization as part of the restriction site and extend or mask the poly(A) sequence at the 3' end. It is not known whether this non-physiological overhang affects the amount of protein produced intracellularly from such a construct.
[0396] RNA offers several advantages over more traditional plasmid or viral approaches. Gene expression from RNA sources does not require transcription and results in rapid production of protein products following transfection. Furthermore, because RNA can only enter the cytoplasm, not the nucleus, typical transfection methods result in extremely high transfection rates. Furthermore, plasmid-based approaches require that the promoter driving expression of the gene of interest be active in the cells being studied.
[0397] On the other hand, RNA constructs are delivered into cells by electroporation. See, e.g., the preparations and methods for electroporating nucleic acid constructs into mammalian cells as taught in US 2004 / 0014645, US 2005 / 0052630A1, US 2005 / 0070841A1, US 2004 / 0059285A1, and US 2004 / 0092907A1. Various parameters for the electric field strength required for electroporation of any known cell type are generally known in the relevant research literature in this area and in numerous patents and applications. See, e.g., U.S. Patent No. 6,678,556, U.S. Patent No. 7,171,264, and U.S. Patent No. 7,173,116. Commercially available devices for therapeutic applications of electroporation, e.g., the MedPulser TMDNA Electroporation Therapy System (Inovio / Genetronics, San Diego, CA), and they have been described in numerous patents, such as U.S. Patent No. 6,567,694; U.S. Patent No. 6,516,223, U.S. Patent No. 5,993,434, U.S. Patent No. 6,181,964, U.S. Patent No. 6,241,701 and U.S. Patent No. 6,233,482; Electroporation can also be used for in vitro transfection of cells, as described in US20070128708A1. Electroporation can also be used for in vitro delivery of nucleic acids into cells. Therefore, the use of any of the many available devices and electroporation systems known to those skilled in the art to electroporate-mediated administration of nucleic acids (including expression constructs) into cells provides an exciting new means of delivering target RNA to target cells.
[0398] Thus, the present invention provides a method for generating a modified immune cell or a precursor thereof, comprising introducing into a cell an isolated nucleic acid (e.g., an expression construct) encoding a subject CAR as described herein using any delivery method described herein or known to those of ordinary skill in the art.
[0399] Sources of immune cells
[0400] Before amplification, a source of immune cells is obtained from a subject for ex vivo operation. The source of target cells for ex vivo operation can also include, for example, autologous or allogeneic donor blood, umbilical cord blood or bone marrow. For example, the source of immune cells can be from a subject to be treated with the modified immune cells of the present invention, such as, subject's blood, subject's umbilical cord blood or subject's bone marrow. Non-limiting examples of subjects include humans, dogs, cats, mice, rats and transgenic species thereof. In some exemplary embodiments, the subject is a human.
[0401] Immune cells can be obtained from many sources, including blood, peripheral blood mononuclear cells, bone marrow, lymph node tissue, spleen tissue, umbilical cord, lymph or lymphoid organs.Immune cells are cells of the immune system, such as cells of innate or adaptive immunity, such as, myeloid (myeloid) cells or lymphoid (lymphoid) cells (including lymphocytes, generally T cells and / or NK cells and / or NKT cells). Other exemplary cells include stem cells, such as multipotent (multipotent) stem cells and multipotent (pluripotent) stem cells, which include inducible pluripotent stem cells (iPSC). In some aspects, cell is a human cell. About experimenter to be treated, cell can be allogeneic and / or autologous. Cell is typically primary cells, such as directly separating from experimenter and / or separating and freezing from experimenter.
[0402] In certain embodiments, the immune cell is a T cell, such as, CD8+ T cells (such as, CD8+ naive T cells, central memory T cells, or effector memory T cells), CD4+ T cells, natural killer T cells (NKT cells), regulatory T cells (Treg), stem cell memory T cells, lymphoid progenitor cells, hematopoietic stem cells, natural killer cells (NK cells), natural killer T cells (NK cells), or dendritic cells. In some embodiments, the cell is a monocyte or granulocyte, such as, myeloid cells, macrophages, neutrophils, dendritic cells, mast cells, eosinophils, and / or basophils. In embodiments, the target cell is an induced pluripotent stem (iPS) cell or a cell derived from an iPS cell, e.g., an iPS cell generated from a subject, manipulated to alter (e.g., induce mutations) or manipulate the expression of one or more target genes and differentiated into, e.g., a T cell (e.g., a CD8+ T cell (e.g., a CD8+ naive T cell, a central memory T cell, or an effector memory T cell), a CD4+ T cell, a stem cell memory T cell, a lymphoid progenitor cell, or a hematopoietic stem cell).
[0403] In some embodiments, the cells include one or more subsets of T cells or other cell types, such as the entire T cell population, CD4+ cells, CD8+ cells, and subpopulations thereof, such as those defined by function, activation state, maturity, differentiation capacity, expansion, circulation, localization, and / or persistence capacity, antigen specificity, antigen receptor type (present in a specific organ or compartment), marker or cytokine secretion profile, and / or degree of differentiation. In these subtypes and subpopulations of T cells and / or CD4+ and / or CD8+ T cells are naive T (TN) cells, effector T cells (TEFF), memory T cells and subtypes thereof, such as stem cell memory T (TSCM), central memory T (TCM), effector memory T (TEM) or terminally differentiated effector memory T cells, tumor infiltrating lymphocytes (TIL), immature T cells, mature T cells, helper T cells, cytotoxic T cells, mucosal-associated invariant T (MAIT) cells, naturally occurring and adaptive regulatory T (Treg) cells, helper T cells (such as TH1 cells, TH2 cells, TH3 cells, TH17 cells, TH9 cells, TH22 cells, follicular helper T cells, α / β T cells and δ / γ T cells). In certain embodiments, any number of T cell lines available in this area can be used.
[0404] In some embodiments, the method includes separating immune cells from a subject, preparing, processing, culturing, and / or engineering them. In some embodiments, the preparation of engineered cells includes one or more cultivation and / or preparation steps. The cells for the described engineering can be separated from a sample, such as a biological sample, such as obtained from a subject or derived from a sample of a subject. In some embodiments, the subject from which the cells are separated is a subject suffering from a disease or illness, or needs a cell therapy, or will be administered a cell therapy. In some embodiments, the subject is a person who needs a specific treatment intervention, such as adoptive cell therapy, in which the cells are separated, processed, and / or engineered. Therefore, in some embodiments, the cell is a primary cell, such as a primary human cell. The sample includes tissues, fluids, and other samples taken directly from the subject, and samples from one or more processing steps, such as separation, centrifugation, genetic engineering (e.g., transduction with a viral vector), washing, and / or incubation. The biological sample can be a sample obtained directly from a biological source or a processed sample. Biological samples include, but are not limited to, body fluids, such as blood, plasma, serum, cerebrospinal fluid, synovial fluid, urine, and sweat, tissue and organ samples, including processed samples derived therefrom.
[0405] In certain aspects, the sample derived from or separated from cell is blood or blood-derived sample, or or derive from the product of single blood component technique or single leukocyte component technique (leukapheresis).Exemplary samples include whole blood, peripheral blood mononuclear cells (PBMC), leukocytes, bone marrow, thymus, tissue biopsy, tumor, leukemia, lymphoma, lymph node, intestinal associated lymphoid tissue, mucosa associated lymphoid tissue, spleen, other lymphoid tissues, liver, lung, stomach, small intestine, large intestine, kidney, pancreas, breast, bone, prostate, cervix uteri, testis, ovary, tonsil or other organs and / or cells derived therefrom.In the case of cell therapy (such as adoptive cell therapy), sample includes the sample from autologous and allogeneic sources.
[0406] In some embodiments, the cell is derived from a cell line, such as a T cell line. In some embodiments, the cell is obtained from a xenogeneic source, for example, from a mouse, rat, non-human primate, and pig. In some embodiments, the separation of the cell includes one or more preparations and / or non-affinity separation steps based on the cell. In some instances, for example, the cells are washed, centrifuged, and / or cultured in the presence of one or more reagents to remove unwanted components, enrich for desired components, crack, or remove cells sensitive to specific reagents. In some instances, cells are separated based on one or more properties, such as density, adhesion properties, size, sensitivity, and / or resistance to specific components.
[0407] In some instances, cells from the circulating blood of the experimenter are obtained, such as by apheresis or leukocyte apheresis. In some aspects, the sample contains lymphocytes, including T cells, monocytes, granulocytes, B cells, other nucleated leukocytes, red blood cells and / or platelets, and in some aspects, the sample contains other cells except red blood cells and platelets. In some embodiments, the hemocytes collected by the experimenter are washed to remove the plasma portion and the cells are placed in a suitable buffer or culture medium for subsequent processing steps. In some embodiments, cells are washed with phosphate buffered saline (PBS). In some embodiments, according to the manufacturer's instructions, washing steps are completed by tangential flow filtration (TFF). In some embodiments, after washing, cells are resuspended in a variety of biocompatible buffers. In some embodiments, the components of the blood cell sample are removed and directly resuspended in culture medium. In some embodiments, method includes a cell separation method based on density, such as preparing white blood cells from peripheral blood by lysis of red blood cells and by Percoll or Ficoll gradient centrifugation.
[0408] In one embodiment, immune cells obtained from the circulating blood of an individual are obtained by apheresis or leukocyte apheresis. Apheresis products typically contain lymphocytes, including T cells, monocytes, granulocytes, B cells, other nucleated leukocytes, red blood cells, and platelets. The cells collected by apheresis can be washed to remove the plasma portion and the cells are placed in an appropriate buffer or culture medium, such as phosphate buffered saline (PBS) or a washing solution lacking calcium and possibly magnesium, or possibly lacking many (if not all) divalent cations for subsequent processing steps. It will be readily understood by those skilled in the art that the washing steps can be accomplished by methods known to those skilled in the art, such as by using a semi-automatic "flow-through" centrifuge (e.g., Cobe 2991 cell processor, Baxter CytoMate, or Haemonetics Cell Saver 5) according to the manufacturer's instructions. After washing, the cells can be resuspended in a variety of biocompatible buffers, such as Ca-free PBS or a washing solution. 2+ , Mg-free 2+ PBS, PlasmaLyte A, or another saline solution with or without a buffer. In some embodiments, the apheresis sample can be stripped of unwanted components and the cells resuspended directly in culture medium.
[0409] In some embodiments, separation method includes separating different cell types, and this is based on the presence of one or more specific molecules in expression or cell, such as surface markers, as, surface proteins, intracellular markers or nucleic acids. In some embodiments, any known separation method based on this type of mark can be used. In some embodiments, separation is based on the separation of affinity or immunoaffinity. For example, in some aspects, separation includes the separation of cells and cell colonies based on the expression level of cell expression or one or more marks (normally cell surface markers), for example, by incubation with antibodies or binding partners that specifically bind to this type of mark, then generally washing steps are carried out and the cells bound to antibodies or binding partners are separated from those cells that are not bound to antibodies or binding partners. This type of separation step can be based on positive selection and / or negative selection, and the cells bound to reagents are retained in the positive selection for further use, and the cells not bound to antibodies or binding partners are retained in the negative selection. In some instances, both parts are retained for further use. In some aspects, when the antibody that specifically recognizes cell types in heterologous colonies cannot be obtained, negative selection is particularly useful so that the labels based on the cell expression except the desired colony are best separated. Separation need not result in 100% enrichment or removal of a particular cell population or cells expressing a particular marker. For example, positive selection or enrichment of cells of a particular type (such as those expressing a marker) refers to increasing the number or percentage of such cells, but need not result in the complete absence of cells that do not express the marker. Similarly, negative selection, removal or elimination of cells of a particular type (such as those expressing a marker) refers to reducing the number or percentage of such cells, but need not result in the complete removal of all such cells.
[0410] In certain exemplary embodiments, multiple rounds of separation steps are performed, wherein the fraction positively or negatively selected in one step is subjected to another separation step, such as a subsequent positive or negative selection. In certain exemplary embodiments, a single separation step can simultaneously eliminate cells expressing multiple markers, such as by incubating the cells with multiple antibodies or binding partners, each antibody or binding partner being specific for the marker targeted for negative selection. Similarly, multiple cell types can be simultaneously positively selected by incubating the cells with antibodies or binding partners expressed on the various cell types.
[0411] In some embodiments, one or more of the enrichment or removal of T cell populations are positive (marker+) or express its high level (marker high) for one or more specific markers (e.g., surface markers), or negative (marker-) or express its relatively low level (marker low) for one or more specific markers. For example, in some aspects, a specific subpopulation of T cells (such as positive or express its high level for one or more surface markers (e.g., CD28+, CD62L+, CCR7+, CD27+, CD127+, CD4+, CD8+, CD45RA+, and / or CD45RO+T cells) is separated by positive selection or negative selection techniques. In some cases, such markers are absent or expressed at relatively low levels on some T cell (e.g., non-memory cells) populations but present or expressed at relatively high levels on some other T cell populations (e.g., memory cells). In one embodiment, cells (such as, CD8+ cells, or T cells, such as, CD3+ cells) are enriched (i.e., positively selected) for cells that are positive for or express high surface levels of CD45RO, CCR7, CD28, CD27, CD44, CD127, and / or CD62L, and / or cells that are positive for or express high surface levels of CD45RA are eliminated (i.e., negatively selected). In some embodiments, cells are enriched or eliminated for or express high surface levels of CD122, CD95, CD25, CD27, and / or IL7-Ra (CD127). In certain exemplary embodiments, cells are enriched for CD8+ T cells that are positive for CD45RO (or negative for CD45RA) and positive for CD62L. For example, CD3+, CD28+ T cells can be positively selected using CD3 / CD28 conjugated magnetic beads (e.g., M-450 CD3 / CD28 T Cell Expander).
[0412] In some embodiments, T cell is separated from PBMC sample by the mark expressed on negative selection non-T cell (such as B cell, monocyte or other leukocyte (such as CD14)).In some aspects, CD4+ or CD8+ selection step is used to separate CD4+ helper T cell and CD8+ cytotoxic T cell.Such CD4+ and CD8+ colony can further express or express relatively high degree of mark sorting as subgroup on one or more immature memory and / or effector T cell colony by positive selection or negative selection.In some embodiments, further enrichment or removal CD8+ cell immature, central memory, effector memory and / or central memory stem cell, such as by positive selection or negative selection based on the surface antigen relevant to each subgroup.In some embodiments, carry out the enrichment of central memory T (TCM) cell to increase effect, such as providing long-term survival, amplification and / or transplantation after administration, in some aspects, in such subgroup, it is particularly strong.In some embodiments, the CD8+T cell and CD4+T cell of combination TCM-enrichment further enhance effect.
[0413] In some embodiments, memory T cells are present in both CD62L+ and CD62L- subsets of CD8+ peripheral blood lymphocytes. The CD62L-CD8+ and / or CD62L+CD8+ portions in PBMCs can be enriched or removed, such as using anti-CD8 and anti-CD62L antibodies. In some embodiments, the central memory (TCM) cells of CD4+ T cell colonies and / or CD8+ T cell colonies are enriched. In some embodiments, the positive or high surface expression of central memory T (TCM) cells based on CD45RO, CD62L, CCR7, CD28, CD3, and / or CD 127 is enriched; in some aspects, it is based on the negative selection of cells expressing or highly expressing CD45RA and / or granzyme B. In some aspects, the CD8+ populations of isolated enriched TCM cells are carried out by removing cells expressing CD4, CD14, CD45RA and positively selecting or enriching cells expressing CD62L. In one aspect, the enrichment of central memory T (TCM) cells is started with the negative portion of cells selected based on CD4 expression, which undergoes negative selection based on the expression of CD14 and CD45RA, and positive selection based on CD62L. In some aspects, such selections are performed simultaneously, and in other aspects are performed sequentially in any order. In some aspects, the same selection steps based on CD4 expression used in preparing CD8+ cell colonies or subpopulations can also be used to produce CD4+ cell colonies or subpopulations, so that both the positive and negative portions from the separation based on CD4 are retained and used in subsequent steps in the method, optionally performed after one or more positive or negative selection steps.
[0414] CD4+T helper cells are sorted into naive, central memory and effector cells by identifying cell populations with cell surface antigens. CD4+ lymphocytes can be obtained by standard methods. In some embodiments, naive CD4+T lymphocytes are CD45RO-, CD45RA+, CD62L+, CD4+T cells. In some embodiments, central memory CD4+ cells are CD62L+ and CD45RO+. In some embodiments, effector CD4+ cells are CD62L- and CD45RO. In one example, in order to enrich CD4+ cells by negative selection, a monoclonal antibody mixture generally includes antibodies to CD14, CD20, CD11b, CD16, HLA-DR and CD8. In some embodiments, the antibody or binding partner is bound to a solid support or matrix, such as magnetic beads or paramagnetic beads, thereby allowing cells to be separated by positive selection and / or negative selection.
[0415] In some embodiments, before genetic engineering or in combination with genetic engineering, cells are incubated and / or cultured. The incubation step includes cultivating, nurturing, stimulating, activating and / or breeding. In some embodiments, the composition or cells are incubated in the presence of stimulating conditions or stimulating agents. Such conditions include those conditions designed to induce cell proliferation, amplification, activation and / or survival in the induction colony, simulated antigen exposure, and / or primary immune cells are genetically engineered, such as to introduce recombinant antigen receptors. Conditions can include one or more of specific culture media, temperature, oxygen content, carbon dioxide content, time, reagents (such as nutrients, amino acids, antibiotics, ions and / or stimulating factors, such as cytokines, chemokines, antigens, binding partners, fusion proteins, recombinant soluble receptors and any other reagents designed to activate cells). In some embodiments, stimulating conditions or reagents include one or more reagents, such as ligands capable of activating the intracellular signaling domain of the TCR complex. In some aspects, the reagent opens or starts the TCR / CD3 intracellular signaling cascade in the T cell. Such reagents can include antibodies, such as those specific for TCR components and / or co-stimulatory receptors (e.g., anti-CD3, anti-CD28), for example, bound to a solid support (such as beads), and / or one or more cytokines. Optionally, the amplification method can further include the step of adding anti-CD3 and / or anti-CD28 antibodies to the culture medium (e.g., at a concentration of at least about 0.5 ng / ml). In some embodiments, the stimulating reagent includes IL-2 and / or IL-15, for example, at a concentration of at least about 10 units / mL of IL-2.
[0416] In another embodiment, T cells are isolated from peripheral blood by lysing red blood cells and depleting monocytes, e.g., by PERCOLL TMAlternatively, T cells can be isolated from the umbilical cord. In any case, specific subpopulations of T cells can be further isolated by positive selection or negative selection techniques.
[0417] The cord blood mononuclear cells thus isolated can be cleared of cells expressing certain antigens, including but not limited to CD34, CD8, CD14, CD19, and CD56. The clearance of these cells can be accomplished using isolated antibodies, biological samples (such as ascites) containing antibodies, antibodies bound to a physical support, and cells that bind the antibodies.
[0418] Enrichment of T cell populations by negative selection can be accomplished using a combination of antibodies directed to surface markers unique to the negatively selected cells. Exemplary methods are cell sorting and / or cell selection via negative magnetic immunoadhesion or flow cytometry using a cocktail of monoclonal antibodies directed to cell surface markers presented on the negatively selected cells. For example, to enrich for CD4 T cells by negative selection, + For cells, the monoclonal antibody cocktail typically includes antibodies to CD14, CD20, CD11b, CD16, HLA-DR, and CD8.
[0419] For the separation of desired cell colony by positive selection or negative selection, the concentration and surface (e.g., particles such as beads) of cells can vary. In some embodiments, the volume (i.e., increasing the concentration of cells) by which beads and cells are mixed together is significantly reduced to ensure that the maximum contact of cells and beads is desirable. For example, in one embodiment, the concentration used is 2 billion cells / ml. In one embodiment, the concentration used is 1 billion cells / ml. In a further embodiment, greater than 100 million cells / ml is used. In a further embodiment, the concentration of the cell used is 10 million, 15 million, 20 million, 25 million, 30 million, 35 million, 40 million, 45 million or 50 million cells / ml. In still another embodiment, the cell concentration used is 75 million, 80 million, 85 million, 90 million, 95 million or 100 million cells / ml. In a further embodiment, the concentration of 125 million or 150 million cells / ml can be used. Using high concentration can obtain increased cell yield, cell activation and cell expansion.
[0420] After the washing step, T cells can also be frozen, which does not require a monocyte removal step. Although not wishing to be bound by theory, the freezing and subsequent thawing steps provide a more uniform product by removing a certain degree of monocytes in the granulocyte and cell populations. After the washing steps to remove plasma and platelets, the cells can be suspended in a freezing solution. Although many freezing solutions and parameters are known in the art and can be useful in this context, in a non-limiting example, one method involves using PBS containing 20% DMSO and 8% human serum albumin, or other suitable cell freezing media. The cells are then frozen to -80°C at a rate of 1°C per minute and stored in the vapor phase of a liquid nitrogen storage tank. Other methods of controlled freezing can be used, as well as uncontrolled freezing immediately at -20°C or in liquid nitrogen.
[0421] In one embodiment, the T cell colony is contained in a cell such as a peripheral blood mononuclear cell, an umbilical cord blood cell, a purified T cell colony and a T cell line. In another embodiment, the peripheral blood mononuclear cell comprises a T cell colony. In still another embodiment, the purified T cell comprises a T cell colony.
[0422] Expansion of immune cells
[0423] Whether before or after the cells are modified to express the subject CAR, the cells can be activated and expanded in number using the methods described in, for example, U.S. Patent Nos. 6,352,694; 6,534,055; 6,905,680; 6,692,964; 5,858,358; 6,887,466; 6,905,681; 7,144,575; 7,067,318; 7,172,869; 7,232,566; 7,175,843; 5,883,223; 6,905,874; 6,797,514; 6,867,041; and U.S. Patent Application No. 20060121005. For example, the immune cell of the present invention can be amplified by contacting with a surface, and the surface has been attached with a reagent stimulating CD3 / TCR complex related signals and a part stimulating the co-stimulatory molecules on the immune cell surface. Specifically, immune cell colonies can be contacted with anti-CD3 antibodies or their antigen-binding fragments, or anti-CD2 antibodies fixed on the surface, or contacted with a protein kinase C activator (such as bryostatin) bound to a calcium ion carrier. In order to costimulate the auxiliary molecules on the immune cell surface, a part in conjunction with an auxiliary molecule is used. For example, immune cells can be contacted with anti-CD3 antibodies and anti-CD28 antibodies under conditions suitable for stimulating immune cell proliferation. Examples of anti-CD28 antibodies include 9.3, B-T3, XR-CD28 (Diaclone, Besancon, France), and these can be used in the present invention, as can other methods and reagents known in the art (see, e.g., ten Berge et al., Transplant Proc. (1998) 30(8):3975-3977; Haanen et al., J. Exp. Med. (1999) 190(9):1319-1328; and Garland et al., J. Immunol. Methods (1999) 227(1-2):53-63).
[0424] Immune cells expanded by the methods disclosed herein can be doubled by about 10 times, 20 times, 30 times, 40 times, 50 times, 60 times, 70 times, 80 times, 90 times, 100 times, 200 times, 300 times, 400 times, 500 times, 600 times, 700 times, 800 times, 900 times, 1000 times, 2000 times, 3000 times, 4000 times, 5000 times, 6000 times, 7000 times, 8000 times, 9000 times, 10,000 times, 100,000 times, 1,000,000 times, 10,000,000 times or more, and any and all whole or partial integers therebetween. In one embodiment, the immune cell expansion range is from about 20 times to about 50 times.
[0425] After culturing, the immune cells can be incubated in the cell culture medium in the culture device for a period of time or until the cells reach confluence or a high cell concentration for optimal passage, and then the cells are transferred to another culture device. The culture device can be any culture device commonly used for culturing cells in vitro. In certain exemplary embodiments, the confluence level is 70% or greater before the cells are transferred to another culture device. In a specific exemplary embodiment, the confluence level is 90% or greater. A period of time can be any time suitable for culturing cells in vitro. The immune cell culture medium can be replaced at any time for culturing immune cells. In certain exemplary embodiments, the immune cell culture medium is replaced approximately every 2 to 3 days. The immune cells are then harvested from the culture device and can be used immediately or refrigerated for use at a later time. In one embodiment, the present invention includes cryopreserved amplified immune cells. Before nucleic acid is introduced into the immune cells, the refrigerated immune cells are thawed.
[0426] In another embodiment, the method comprises isolating immune cells and expanding the immune cells. In another embodiment, the invention further comprises refrigerating the immune cells prior to expansion. In yet another embodiment, the refrigerated immune cells are thawed and used for electroporation with RNA encoding the chimeric membrane protein.
[0427] Another process for ex vivo expansion of cells is described in U.S. Patent No. 5,199,942 (incorporated herein by reference). Amplification such as that described in U.S. Patent No. 5,199,942 can be an alternative or additional method to other amplification methods described herein. In brief, the ex vivo culture and expansion of immune cells include adding to cell growth factors, such as those described in U.S. Patent No. 5,199,942, or other factors, such as flt3-L, IL-1, IL-3, and c-kit ligand. In one embodiment, expanding immune cells includes culturing immune cells with a factor selected from flt3-L, IL-1, IL-3, and c-kit ligand.
[0428] The culture steps described herein (contacting with the reagents described herein or after electroporation) can be very short, for example, less than 24 hours, such as 1, 2, 3, 4, 5, 6, 7, 8, 9, 10, 11, 12, 13, 14, 15, 16, 17, 18, 19, 20, 21, 22 or 23 hours. The culture steps further described herein (contacting with the reagents described herein) can be longer, for example, 1, 2, 3, 4, 5, 6, 7, 8, 9, 10, 11, 12, 13, 14 or more days.
[0429] Various terms are used to describe cells in culture. Cell culture generally refers to cells taken from a living organism and grown under controlled conditions. Primary cell culture is a culture of cells, tissues, or organs taken directly from an organism and prior to the first subculture. When cells are placed in a growth medium under conditions that promote cell growth and / or division, the cells in the culture are amplified, resulting in a larger cell population. When cells are amplified in culture, the cell proliferation rate is typically measured by the amount of time required for the cell number to double, also known as the doubling time.
[0430] Each round of subculture is called going down to posterity. When cells are subcultured, they are referred to as having gone down to posterity. A specific cell colony or cell line is sometimes referred to as or is characterized by the number of times it has been gone down to posterity. For example, the cell colony of a culture that has been gone down to posterity ten times can be referred to as a P10 culture. Primary culture, i.e., the first culture after tissue separation cells, is designated as P0. After the first subculture, cells are described as secondary cultures (P1 or going down to posterity 1). After the second culture, cells become tertiary cultures (P2 or going down to posterity 2), and so on. It will be understood by those skilled in the art that there are many population doublings in the subculture cycle. Therefore, the number of culture population doublings is greater than the number of going down to posterity. The amplification of cells in the cycle between going down to posterity (i.e., the number of population doublings) depends on many factors, including but not limited to inoculation density, substrate, culture medium and the time between going down to posterity.
[0431] In one embodiment, cells can be cultured for several hours (about 3 hours) to about 14 days or any integer in hours. Suitable conditions for immunocyte culture include suitable culture medium (such as, Minimal Essential Media or RPMI Media1640 or, X-vivo 15, (Lonza)), which can contain the necessary factors for proliferation and survival, including serum (such as, fetal bovine serum or human serum), interleukin-2 (IL-2), insulin, IFN-γ, IL-4, IL-7, GM-CSF, IL-10, IL-12, IL-15, TGF-β and TNF-α, or any other additive for cell growth well known to persons skilled in the art. Other additives for cell growth include but are not limited to surfactant, plasma products (plasmanate) and reducing agents such as N-acetyl-cysteine and 2-mercaptoethanol. Culture medium may include RPMI 1640, AIM-V, DMEM, MEM, α-MEM, F-12, X-Vivo 15, and X-Vivo 20, Optimizer, as well as added amino acids, sodium pyruvate, and vitamins, serum-free or supplemented with an appropriate amount of serum (or plasma) or a defined group of hormones, and / or cytokines (one or more) sufficient for the growth and expansion of immune cells. Antibiotics, such as penicillin and streptomycin, are included only in experimental cultures and not in cell cultures to be injected into a subject. Target cells are maintained under conditions required to support growth, such as an appropriate temperature (e.g., 37° C.) and atmosphere (e.g., air plus 5% CO 2 ).
[0432] The culture medium for culturing immune cells may include reagents that can costimulate immune cells. For example, the reagent that can stimulate CD3 is an antibody to CD3, and the reagent that can stimulate CD28 is an antibody to CD28. This is because, as demonstrated by the data disclosed herein, the cells separated by the method disclosed herein can be expanded by about 10 times, 20 times, 30 times, 40 times, 50 times, 60 times, 70 times, 80 times, 90 times, 100 times, 200 times, 300 times, 400 times, 500 times, 600 times, 700 times, 800 times, 900 times, 1000 times, 2000 times, 3000 times, 4000 times, 5000 times, 6000 times, 7000 times, 8000 times, 9000 times, 10,000 times, 100,000 times, 1,000,000 times, 10,000,000 times or more. In one embodiment, the range of amplification of the immune cells by culturing electroporation populations is about 2-fold to about 50-fold or more. In one embodiment, human T regulatory cells are amplified via anti-CD3 antibody-coated KT64.86 artificial antigen presenting cells (aAPCs). Methods for amplifying and activating immune cells can be found in U.S. Patent Nos. 7,754,482, 8,722,400, and 9,555,105, the contents of which are incorporated herein in their entirety.
[0433] In one embodiment, the method for amplifying immune cells may further include the immune cells of separation and amplification for further application. In another embodiment, the method for amplification may further include the immune cells amplified by electroporation subsequently, and then cultured. Subsequent electroporation may include introducing the nucleic acid encoding reagent (such as the immune cells amplified by nucleic acid transduction, the immune cells amplified by transfection or the immune cells amplified by electroporation) into the immune cell colony of amplification, wherein the reagent further stimulates the immune cell. Reagent can stimulate immune cells, such as by stimulating further amplification, effector function or another immune cell function.
[0434] Treatment
[0435] Mucins are high molecular weight glycosylated proteins that function in normal, healthy cells by providing physicochemical protection against toxins and mutagens when overexpressed in epithelial cells. Expression has been noted in other healthy cell types, where mucins may function as adhesion regulators or play a role in signal transduction and cell growth regulation (Winterford et al. (1999) J Histochem Cytochem, 47(8): 1063-1074). Tumorigenesis and metastasis have been shown to increase with changes in cell surface glycosylation (protein modification after the addition of sugar moieties to specific amino acids) of mucins of various proteins (Ren et al. (2014) Tumour Biol, 35(10): 9603-9612; Tarp et al. (2008) Glycobiology, 17(2): 197-209; Taylor-Papadimitriou et al. (1999) 1455(2-3): 301-313). At least 9 of the 20 amino acids can be modified by various carbohydrates (Stowell et al. (2015) Annu Rev Pathol, 10:473-510). Tn (GalNAca1-O-Ser / Thr) and sialyl-Tn (STn) (NeuAca2-6-GalNAca1-O-Ser / Thr) are the most common abnormal glycoforms found in cancer (Springer (1984) Science, 224(4654):1198-1206). This abnormal glycosylation also leads to a tumor-specific form of the full-length Mucin1 glycoprotein, called TnMUC1, which is thought to play a key role in carcinogenesis (Ju et al. (2005) Nature, 437(7063):1252; Ju et al. (2008) Cancer Res, 68(6):1636-1646; Ju et al. (2014) Cancer Biomark, 14(1):63-81; Varki et al. (2017) Essentials of Glycobiology [Internet]. 3rd edition. Cold Spring Harbor (NY): Cold Spring Harbor Laboratory Press; 2015-2017). Specifically, aberrant expression of Tn / sTn glycoforms was found on the cell membrane-bound mucin (MUC1), a large protein with tandem repeat sequences carrying O-glycans that are overexpressed in most adenocarcinomas (Cascio et al. (2017) Oncotarget, 8(62):105284-98; Finn et al. (2011) Immunol Research, 50(2-3):261-268).Some healthy tissues of epithelial origin express MUC1 on the cell surface (Winterford et al. (1999) J Histochem Cytochem, 47(8):1063-1074); an abnormally glycosylated version (TnMUC1) is expressed in the Golgi apparatus and is a precursor to the full-length MUC1 observed on the cell surface (Posey et al. (2016) Immunity, 44(6):1444-1454). Tumor-associated TnMUC1 is overexpressed in a proportion of multiple myeloma cases (Andrulis et al. (2014) Histopathology, 64:799-806; Cloosen et al. (2006) British Journal of Haematology, 135:513-516) and in a variety of solid tumors, including breast, colon, lung, stomach, ovary and pancreas, where loss of membrane polarity and aberrant O-glycosylation lead to the expression of Tn and STn glycoforms on the tumor cell surface (Lavrsen et al. (2013) Glycoconjugates, 30(3):227-236; Pinto et al. (2012) J Cellular Mol Medicine, 16:1474-1484;). et al. (2006) Glycobiology, 16:96-107).
[0436] In one aspect, the present invention includes a method for treating a MUC1-associated cancer in a subject in need thereof. In another aspect, the present invention includes a method for treating a MUC1-associated cancer in a subject, the method comprising administering to a subject in need thereof a therapeutically effective population of modified immune cells of the present invention. In some embodiments, the MUC1-associated cancer is selected from multiple myeloma, breast cancer, colon cancer, lung cancer, gastric cancer, ovarian cancer, and pancreatic cancer. In some embodiments, the MUC1-associated cancer is selected from MUC1-associated breast cancer, MUC1-associated multiple myeloma, MUC1-associated non-small cell lung cancer, MUC1-associated pancreatic cancer, MUC1-associated ovarian cancer, and fallopian tube cancer.
[0437] The method comprises administering to a subject a modified immune cell of the invention (eg, a MUC1 CAR T cell).
[0438] As used herein, the terms "subject" and "patient" refer to an organism to be treated by the methods of the present invention. The terms "subject" and "patient" are used interchangeably herein. Such organisms include, but are not limited to, mammals (e.g., murines, monkeys, equines, bovines, porcines, canines, felines, etc.), and in exemplary embodiments, include humans. As used herein, the terms "treat," "therapeutic," and "treating" include any effect that results in an improvement in a condition, disease, disorder, or the like, such as mitigation, reduction, regulation, improvement, or elimination, or improvement of a symptom thereof, such as a decrease in the number of cancer cells, a decrease in tumor size, a decrease in tumor burden, a decrease in the rate at which cancer cells infiltrate peripheral organs, or a decrease in the rate of tumor metastasis or tumor growth.
[0439] Positive therapeutic effects in cancer can be measured in a variety of ways (see .WA Weber, J. Null. Med. 50: 1S-10S (2009); Eisenhauer et al., Eur. J. Cancer 45: 228-247 (2009)). In some embodiments, the response to the subject CAR T cell therapy (e.g., TN-MUC1 CAR T cell therapy) is assessed using the RECIST 1.1 criteria (see, Eisenhauer et al., supra). In some embodiments, the treatment achieved by a therapeutically effective amount (e.g., a therapeutically effective amount of TN-MUC1 CAR T cell therapy) is any one of partial response (PR), complete response (CR), progression-free survival (PFS), disease-free survival (DFS), objective response (OR), a change in duration of response (e.g., an increase in duration of response), a change in time to response (e.g., a shortened time to response), or overall survival (OS). A therapeutically effective amount of the agents described herein effective to treat breast cancer in a patient may vary according to factors such as the patient's disease state, age, and weight, and the ability of the therapy to elicit an anti-cancer response in the subject.
[0440] As used herein, "RECIST 1.1 response criteria" refers to the definitions described in Eisenhauer et al. Eur J Cancer, 45(2):228-247, applied to target lesions or non-target lesions, as appropriate, based on the context in which the response is being measured.
[0441] "Tumor" when applied to a subject diagnosed with or suspected of having cancer (e.g., MUCl-related breast cancer, MUCl-related multiple myeloma, MUCl-related non-small cell lung cancer, MUCl-related pancreatic cancer, MUCl-related ovarian cancer, and fallopian tube cancer) refers to a malignant or potentially malignant tumor or tissue mass of any size.
[0442] "Tumor burden," also known as "tumor load," refers to the total amount of tumor material distributed throughout the body. Tumor burden refers to the total number of cancer cells or the total size of the tumor(s) throughout the body, including lymph nodes and bone marrow. Tumor burden can be determined by various methods known in the art, such as, for example, by measuring the size of the tumor(s) after removal from a subject, for example, using calipers, or in vivo using imaging techniques, such as, for example, a bone scan, computed tomography (CT), or magnetic resonance imaging (MRI) scan.
[0443] The term "tumor size" refers to the overall size of a tumor, which can be measured as the length and width of the tumor. Tumor size can be determined by a variety of methods known in the art, for example, by measuring the size of the tumor(s) after removal from a subject, for example, using calipers, or in vivo using imaging techniques, such as bone scans, ultrasound, CT, or MRI scans.
[0444] In one aspect, the present invention includes a method for treating MUC1-associated breast cancer in a subject in need thereof, comprising administering to the subject a therapeutically effective population of modified immune cells, wherein the modified immune cells comprise a chimeric antigen receptor (CAR). In certain embodiments, the CAR comprises a MUC1-specific antigen binding domain, a transmembrane domain, a costimulatory signaling domain, and an intracellular signaling domain.
[0445] In one aspect, the present invention includes a method for treating MUC1-related multiple myeloma in a subject in need thereof, comprising administering to the subject a modified immune cell population that is therapeutically effective, wherein the modified immune cell comprises a chimeric antigen receptor (CAR). In certain embodiments, CAR includes a MUC1-specific antigen binding domain, a transmembrane domain, a costimulatory signaling domain, and an intracellular signaling domain. In other embodiments, the modified cells further include a dominant negative receptor and / or a conversion receptor.
[0446] In one aspect, the present invention includes a method for treating MUC1-associated non-small cell lung cancer in a subject in need thereof, comprising administering to the subject a modified immune cell population that is therapeutically effective, wherein the modified immune cell comprises a chimeric antigen receptor (CAR). In certain embodiments, CAR comprises a MUC1-specific antigen binding domain, a transmembrane domain, a costimulatory signaling domain, and an intracellular signaling domain. In other embodiments, the modified cells further comprise a dominant negative receptor and / or a switch receptor.
[0447] In one aspect, the present invention includes a method for treating MUC1-associated pancreatic cancer in a subject in need thereof, comprising administering to the subject a population of therapeutically effective modified immune cells, wherein the modified immune cells include a chimeric antigen receptor (CAR). In certain embodiments, CAR includes a MUC1-specific antigen binding domain, a transmembrane domain, a costimulatory signaling domain, and an intracellular signaling domain. In other embodiments, the modified cells further include a dominant negative receptor and / or a switch receptor.
[0448] In one aspect, the present invention includes a method for treating MUC1-associated ovarian cancer and / or fallopian tube cancer in a subject in need thereof, comprising administering to the subject a population of therapeutically effective modified immune cells, wherein the modified immune cells include a chimeric antigen receptor (CAR). In certain embodiments, CAR includes a MUC1-specific antigen binding domain, a transmembrane domain, a costimulatory signaling domain, and an intracellular signaling domain. In other embodiments, the modified cells further include a dominant negative receptor and / or a switch receptor.
[0449] In certain embodiments, the MUC1-specific antigen binding domain binds to a glycosylated form of MUC1, i.e., is specific for a carbohydrate epitope of MUC1. In certain embodiments, the MUC1-specific antigen binding domain is specific for a truncated carbohydrate epitope of MUC1. In certain embodiments, the MUC1-specific antigen binding domain is specific for TnMUC1. In certain embodiments, the MUC1-specific antigen binding domain may include the heavy chain complementary determining region (CDR) sequences of SEQ ID NOs: 22, 23, and 24 and / or the light chain complementary determining region (CDR) sequences of SEQ ID NOs: 19, 20, and 21. In certain embodiments, the MUC1-specific antigen binding domain may include all six complementary determining region (CDR) sequences of SEQ ID NOs: 19-24. In certain embodiments, the MUC1-specific antigen binding domain may include the heavy chain variable domain (VH) sequence of SEQ ID NO: 5 and / or the light chain variable domain (VL) sequence of SEQ ID NO: 6. In certain embodiments, the MUCl-specific antigen binding domain comprises the amino acid sequence of SEQ ID NO:2.
[0450] The CAR used in the method of the present invention may include an α, β or ζ chain, CD28, CD3ε, CD45, CD4, CD5, CD8, CD9, CD16, CD22, CD33, CD37, CD64, CD80, CD86, OX40 (CD134), 4-1BB (CD137) and CD154 transmembrane domain selected from artificial hydrophobic sequence, type I transmembrane protein. In some exemplary embodiments, transmembrane domain includes CD8a transmembrane domain.
[0451] CAR may include a costimulatory signaling domain, the costimulatory signaling domain includes a costimulatory domain of a protein selected from the group consisting of TNFR superfamily members, CD27, CD28, 4-1BB (CD137), OX40 (CD134), CD30, CD40, PD-1, ICOS, lymphocyte function-associated antigen-1 (LFA-1), CD2, CD5, CD7, LIGHT, NKG2C, B7-H3, a ligand specifically binding to CD83, DAP10, DAP12, Lck, Fas, and any combination thereof. In certain exemplary embodiments, the costimulatory signaling domain includes a 41BB costimulatory domain.
[0452] The intracellular signaling domain may comprise a signaling domain of a protein selected from the group consisting of CD3ζ, FcγRIII, FcsRI, the cytoplasmic tail of an Fc receptor, a cytoplasmic receptor with an immunoreceptor tyrosine-based activation motif (ITAM), TCRζ, FcRγ, FcRβ, CD3γ, CD3δ, CD3ε, CD5, CD22, CD79a, CD79b, and CD66d. In certain exemplary embodiments, the intracellular signaling domain comprises a CD3ζ signaling domain.
[0453] CAR may further include a CD8a leader sequence and / or an extracellular hinge domain selected from the group consisting of an Fc fragment of an antibody, a hinge region of an antibody, a CH2 region of an antibody, a CH3 region of an antibody, an artificial spacer sequence, a hinge comprising an amino acid sequence of CD8, and any combination thereof. In certain exemplary embodiments, the extracellular hinge domain comprises a CD8a extracellular hinge domain.
[0454] In certain embodiments, the CAR is encoded by a nucleic acid sequence comprising the nucleotide sequence of SEQ ID NO: 1, 38, 40, 42, 44, or 46. In certain embodiments, the CAR comprises the amino acid sequence of SEQ ID NO: 2, 39, 41, 43, 45, or 47.
[0455] In certain exemplary embodiments, the CAR is encoded by a nucleic acid sequence comprising the nucleotide sequence of SEQ ID NO: 46. In certain exemplary embodiments, the CAR comprises the amino acid sequence of SEQ ID NO: 47.
[0456] The CAR of the present disclosure, when present in T lymphocytes or NK cells, can mediate cytotoxicity to target cells. The CAR of the present disclosure binds to the antigen present on the target cell, thereby mediating the killing of the target cell by T lymphocytes or NK cells modified by genes to produce CAR. The antigen binding domain of CAR (e.g., anti-TN-MUC1 scFv) binds to the antigen (e.g., TN-MUC1 antigen) present on the surface of the target cell. Target cells include but are not limited to cancer cells, such as breast cancer cells. Therefore, the present disclosure provides a method for killing target cancer cells or inhibiting their growth, the method comprising contacting cytotoxic immune effector cells (e.g., cytotoxic T cells or NK cells)-which are genetically modified to produce subject CARs so that T lymphocytes or NK cells recognize antigens present on the surface of target cancer cells and mediate the killing of target cells.
[0457] The present disclosure provides a method for treating cancer in a subject suffering from cancer, the method comprising: i) introducing a chimeric antigen receptor of the present disclosure or an expression vector of the present disclosure into a cell to produce a modified cell; and ii) administering the modified cell to the subject. In some embodiments, the cell is obtained from the subject (i.e., the cell is autologous), engineered ex vivo, and administered to the same subject. In some embodiments, the cell is obtained from one subject, engineered ex vivo, and administered to a second suitable subject (i.e., the cell is allogeneic).
[0458] In some embodiments, a method is provided, which includes recovering cytotoxic cells from a subject, genetically modifying the cytotoxic cells by introducing the CAR gene of the present invention into cytotoxic cells, and administering the modified cytotoxic cells to the subject. In some embodiments, the cytotoxic cells are selected from T cells, naive T cells, memory T cells, effector T cells, natural killer cells and macrophages. In one embodiment, the cytotoxic cells are T cells.
[0459] In one embodiment, T cells are obtained from a subject. T cells can be obtained from a variety of sources, including peripheral blood mononuclear cells, bone marrow, lymph node tissue, umbilical cord blood, thymus tissue, tissue from an infected site, ascites, pleural effusion, spleen tissue, and tumors. In some embodiments of the invention, any number of T cell lines available in the art can be used. In some embodiments of the invention, T cells can be isolated using any number of techniques known to those skilled in the art, such as Ficoll. TMIsolated and obtained from blood collected from subjects.
[0460] For example, in one embodiment, T cells are isolated by beads conjugated to anti-CD3 / anti-CD28 (i.e., 3x28), e.g. CD3 / CD28T is incubated together for a sufficient time for positive selection of desired T cells. In one embodiment, the time period is about 30 minutes. In one embodiment, the range of the time period is 30 minutes to 36 hours or longer, and all integer values therebetween. In one embodiment, the time period is at least 1, 2, 3, 4, 5 or 6 hours. In one embodiment, the time period is 10 to 24 hours. In one embodiment, the incubation period is 24 hours. In order to separate T cells from leukemia patients, using a longer incubation time, such as 24 hours, can increase cell yield. In any case where T cells are rare compared to other cell types, such as separating tumor infiltrating lymphocytes (TIL) from tumor tissue or individuals without immune response, a longer incubation time can be used to separate T cells. Further, using a longer incubation time can improve the efficiency of capturing CD8+T cells. Therefore, by simply shortening or extending the time allowing T cells to bind to CD3 / CD28 beads and / or by increasing or decreasing the ratio of beads to T cells (as further described herein), it is possible to support or oppose preferential selection of T cell subsets at other time points during the start of culture or method. In addition, by increasing or decreasing the ratio of anti-CD3 and / or anti-CD28 antibodies on beads or other surfaces, it is possible to favor or oppose preferential selection of T cell subsets at the beginning of the culture or at other desired time points. The skilled person will recognize that multiple rounds of selection may also be used in the context of the present invention. In some embodiments, it may be desirable to perform a selection procedure and use "unselected" cells in activation and amplification methods. "Unselected" cells may also be subjected to further rounds of selection.
[0461] The cells obtained are then modified as described herein. The polynucleotides encoding the subject CAR (eg, TN-MUC1 CAR) typically located in an expression vector are introduced into cytotoxic cells so that the cytotoxic cells will express, preferably stably express, CAR. In some embodiments, the polynucleotides encoding CAR also encode CAR-inducible expression cassettes for producing and releasing transgenic polypeptide products after CAR signal transduction. In some embodiments, the polynucleotides encoding CAR also encode cytokines (eg, IL-12) operably connected to a T cell activation response promoter. In some embodiments, the expression vector includes polynucleotides encoding CAR and polynucleotides encoding cytokines operably connected to a T cell activation response promoter. See, for example, Chmielewski and Abken, Expert Opin.Biol.Ther.(2015)15(8):1145-1154; and Abken, Immunotherapy(2015)7(5):535-544. In some embodiments, cells are genetically engineered using an expression vector including a polynucleotide encoding CAR and an expression vector including a polynucleotide encoding a cytokine (such as IL-12) operably connected to a T cell activation response promoter. In some embodiments, the introduction of polynucleotides does not need to result in integration, but it may be sufficient to simply maintain the short-term presence of the polynucleotides introduced. In this way, short-term effects can be achieved, in which cytotoxic cells can be introduced into the host and then opened after a predetermined time, for example, after cells are able to migrate to a specific site for treatment.
[0462] Depending on the nature of the cytotoxic cells and the disease to be treated, modified cytotoxic cells (e.g., modified T cells) can be introduced into a subject, such as a mammal, in a variety of ways. Genetically engineered cytotoxic cells can be introduced into the tumor site. In one embodiment, the genetically engineered cytotoxic cells navigate to the cancer or are modified to navigate to the cancer. The quantity of the modified cytotoxic cells adopted depends on many factors, such as the environment, the purpose of introduction, the life span of the cell, the protocol to be used. For example, the quantity of the modified cytotoxic cells adopted may depend on the ability of administration number, cell proliferation and the stability of the recombinant construct. Modified cytotoxic cells can be used as a dispersion injected at or near the site of interest. In one embodiment, the cell can be in a physiologically acceptable culture medium.
[0463] It will be understood that treatment methods are affected by many variables, such as the cellular response to the CAR (e.g., TN-MUC1 CAR), the efficiency of expression of the CAR by the cytotoxic cells and, if appropriate, the level of secretion, the activity of the expressed CAR, the specific needs of the subject (which may vary over time and circumstances), the rate of loss of cellular activity due to loss of expression activity by the modified cytotoxic cells or individual cells, etc. Therefore, it is expected that for each individual patient, even if there are universal cells that can be administered to the entire population, the individual appropriate dose will be monitored for each patient, and such practice of monitoring patients is routine in the art.
[0464] Thus, in an exemplary embodiment, a method of treating a MUC1-associated cancer in a subject in need thereof is provided, comprising administering to the subject a therapeutically effective composition comprising a modified T cell comprising: a MUC1-specific antigen binding domain comprising a heavy chain variable (VH) domain and a light chain variable (VL) domain, wherein the VH domain comprises the heavy chain complementarity determining region (CDR) sequences recited in SEQ ID NOs: 22, 23, and 24, and wherein the VL domain comprises the light chain complementarity determining region (CDR) sequences recited in SEQ ID NOs: 19, 20, and 21; an optional hinge domain; a transmembrane domain; a costimulatory signaling domain; and an intracellular signaling domain.
[0465] In an exemplary embodiment, a method of treating a MUC1-associated cancer in a subject in need thereof is provided, comprising administering to the subject a therapeutically effective composition comprising a modified T cell comprising: a MUC1-specific antigen binding domain comprising a heavy chain variable (VH) domain and a light chain variable (VL) domain, wherein the VH domain comprises the heavy chain complementarity determining region (CDR) sequences recited in SEQ ID NOs: 22, 23, and 24, and wherein the VL domain comprises the light chain complementarity determining region (CDR) sequences recited in SEQ ID NOs: 19, 20, and 21; optionally, a CD8α hinge domain; a CD8α transmembrane domain; a CD2 costimulatory signaling domain; and a CD3ζ intracellular signaling domain.
[0466] Exemplary cancer types to be treated with the modified cytotoxic cells (e.g., modified T cells comprising a TN-MUC1 CAR) or pharmaceutical compositions of the invention include breast cancer. In certain embodiments, the breast cancer treated by any of the methods of the invention is characterized by abnormal glycosylation of MUC1.
[0467] Breast cancer that is histologically negative for hormone receptors (HR, estrogen receptor (ER), or progesterone receptor (PR)) and human epidermal growth factor receptor 2 (HER2) is called triple-negative breast cancer (TNBC) and accounts for approximately 15% of all breast cancers. Due to the aggressive nature of the disease associated with a high proliferation index, TNBC generally has a poor outcome; the standard of care for this subset of breast cancers is generally different from that for other subsets (Gradishar et al. (2018) NCCN Guidelines v. 2018 Breast Cancer. Website: www.nccn.org / professionals / physician_gls / pdf / breast.pdf (accessed February 2019)). As with all breast cancers, local therapy utilizes both surgery and radiation therapy, but despite adequate local treatment, many patients with TNBC go on to develop distant metastatic disease. Most of these patients respond poorly to conventional chemotherapy, and to date, few clear drug targets have been identified as effective treatments for TNBC (Gerratana et al. (2018) Cancer Treat Rev, 68:102-110).
[0468] Metastatic TNBC represents a high unmet need, with a median OS of 6 months from the time of initial diagnosis of metastatic disease, while the median OS of patients with hormone receptor-positive and / or Her2-positive metastatic breast cancer is 20 months. As biology and targets differ, the results of metastatic HER2-positive and hormone receptor-positive breast cancer continue to improve, but TNBC remains an unmet need (Ganesan et al. (2014) Mol Cancer Ther, 12: 3175-3184). In clinical studies, immunotherapy using PD-1 / PD-L1 inhibition has shown promising results in late TNBC. In late TNBC, the combination of atezolizumab and standard chemotherapy agents (nab-paclitaxel) showed significant improvements in PFS (all patients) and OS (PD-L1 positive, Schmid et al. (2018) New England J Med, 379 (22): 2108-2121).
[0469] In some embodiments, the breast cancer is hormone receptor positive (HR-positive). In some embodiments, the breast cancer is hormone receptor negative. In some embodiments, the breast cancer is estrogen receptor negative. In some embodiments, the breast cancer is progesterone receptor negative. In some embodiments, the breast cancer is Her2 receptor negative. In some embodiments, the breast cancer is metastatic breast cancer. In some embodiments, the breast cancer is triple-negative breast cancer (ER negative, PR negative, and HER2 negative). In some embodiments, the breast cancer is triple-positive breast cancer (ER positive, PR positive, and HER2 positive). In some embodiments, the breast cancer is triple-negative, metastatic breast cancer. In some embodiments, the breast cancer is incurable, unresectable locally advanced or metastatic breast cancer (LA / MBC). In some embodiments, the breast cancer is ER negative and / or PR positive and HER2 negative breast cancer. In some embodiments, the breast cancer is HER2 positive and LA / MBC. In some embodiments, the breast cancer is triple-negative breast cancer and LA / MBC.
[0470] Exemplary breast cancers are those that express aberrantly glycosylated MUC1 (e.g., TnMUC1) in cells expressing the cancer (i.e., a cancer expressing TnMUC1). In certain exemplary embodiments, the breast cancer is selected from carcinoma, sarcoma, phyllodes, Paget's disease, and angiosarcoma. In certain exemplary embodiments, the breast cancer is selected from ductal carcinoma in situ, invasive ductal carcinoma, or a subtype thereof (e.g., tubular carcinoma of the breast, medullary carcinoma of the breast, mucinous carcinoma of the breast, papillary carcinoma of the breast, cribriform carcinoma of the breast, etc.), invasive lobular carcinoma, inflammatory breast cancer, lobular carcinoma in situ, male breast cancer, Paget's disease of the nipple, phyllodes tumor of the breast, metastatic breast cancer, and certain molecular subtypes (e.g., luminal A breast cancer, luminal B breast cancer, triple negative / basal-like breast cancer, HER2-enriched breast cancer, normal-like breast cancer).
[0471] Breast cancer is characterized by the expression of several markers.For example, breast cancer can be estrogen receptor positive (ER+) breast cancer, progesterone receptor positive (PR+) breast cancer, hormone receptor negative (HR-) breast cancer, HER2 gene overexpression (HER2+) breast cancer, HER2 gene wild type or low expression (HER2-) breast cancer.Breast cancer can be group 1 (lumen A) breast cancer (i.e. ER+ / PR+ / HER2-), group 2 (lumen B) breast cancer (i.e. ER+ / PR- / HER2+), group 3 (HER2+) breast cancer (i.e. ER- / PR- / HER2+) or group 4 (basal sample or triple negative (TN)) breast cancer (i.e. ER- / PR- / HER2-).
[0472] Breast cancer can be classified as grade 1, 2, or 3. Grade 1 or well-differentiated (scores 3, 4, or 5) breast cancers include cells that grow slower and look more like normal breast tissue than higher-grade breast cancers. Grade 2 or moderately differentiated (scores 6, 7) breast cancers include cells that grow between the speed of grade 1 and grade 3 and look somewhere like cells. Grade 3 or poorly differentiated (scores 8, 9) breast cancers include cells that look very different from normal cells and typically grow and spread faster than grade 1 or 2 cells.
[0473] Thus, in an exemplary embodiment, the present invention provides a method of treating MUC1-associated triple-negative breast cancer in a subject in need thereof, comprising administering to the subject a therapeutically effective composition comprising a modified T cell comprising: a MUC1-specific antigen binding domain comprising a heavy chain variable (VH) domain and a light chain variable (VL) domain, wherein the VH domain comprises the heavy chain complementarity determining region (CDR) sequences recited in SEQ ID NOs: 22, 23, and 24, and wherein the VL domain comprises the light chain complementarity determining region (CDR) sequences recited in SEQ ID NOs: 19, 20, and 21; an optional hinge domain; a transmembrane domain; a costimulatory signaling domain; and an intracellular signaling domain.
[0474] In an exemplary embodiment, the present invention provides a method of treating MUC1-associated triple-negative breast cancer in a subject in need thereof, comprising administering to the subject a therapeutically effective composition comprising a modified T cell comprising: a MUC1-specific antigen binding domain comprising a heavy chain variable (VH) domain and a light chain variable (VL) domain, wherein the VH domain comprises the heavy chain complementarity determining region (CDR) sequences recited in SEQ ID NOs: 22, 23, and 24, and wherein the VL domain comprises the light chain complementarity determining region (CDR) sequences recited in SEQ ID NOs: 19, 20, and 21; optionally, a CD8α hinge domain; a CD8α transmembrane domain; a 4-1BB costimulatory signaling domain; and a CD3ζ intracellular signaling domain.
[0475] In an exemplary embodiment, the present invention provides a method of treating MUC1-associated triple-negative breast cancer in a subject in need thereof, comprising administering to the subject a therapeutically effective composition comprising a modified T cell comprising: a MUC1-specific antigen binding domain comprising a heavy chain variable (VH) domain and a light chain variable (VL) domain, wherein the VH domain comprises the heavy chain complementarity determining region (CDR) sequences recited in SEQ ID NOs: 22, 23, and 24, and wherein the VL domain comprises the light chain complementarity determining region (CDR) sequences recited in SEQ ID NOs: 19, 20, and 21; optionally, a CD8α hinge domain; a CD8α transmembrane domain; a CD2 costimulatory signaling domain; and a CD3ζ intracellular signaling domain.
[0476] Exemplary cancer types to be treated with the modified cytotoxic cells of the present invention (e.g., including modified T cells of TN-MUC1 CAR) or pharmaceutical compositions include multiple myeloma. Multiple myeloma (MM) is a disease defined by the accumulation of clonal bone marrow plasma cells and the development of clinical complications, including hypercalcemia, renal insufficiency, symptomatic anemia, destructive osteolytic lesions, and susceptibility to infection. According to the National Cancer Institute Surveillance, Epidemiology, and End Results (NCI SEER) database, in the United States (US), it is estimated that more than 30,000 patients have been diagnosed with multiple myeloma, with a death toll exceeding 12,000 (Siegel (2016) CA Cancer J Clin, 66:7-30). Over the past decade, significant progress has been made in the treatment of multiple myeloma, with a growing number of drugs targeting multiple myeloma plasma cells, including proteasome inhibitors, immunomodulatory drugs (IMiDs), steroids, and alkylating agents, now available clinically, enabling the vast majority of newly diagnosed patients to respond to initial therapy. When high-dose chemotherapy and autologous stem cell transplantation (ASCT) are performed after induction therapy, approximately one-third of patients achieve complete remission, and even more patients experience clinically meaningful responses (SanMiguel et al. (2013) Lancet Oncol, 14: 1055-1066). Despite these advances, even in patients who achieve deep remission through sensitive molecular or flow cytometric detection methods, almost all patients relapse, and the disease becomes increasingly refractory to continuous lines of treatment (Martinez-Sanchez et al. (2008) Br J Haematology, 142: 766-774; Paiva et al. (2012) Blood, 119: 687-691).
[0477] In patients with both bortezomib and IMiD-resistant disease, median progression-free survival and overall survival (OS) are typically reported to be 6 to 9 months (Kumar et al. Leukemia, 26: 149-157). Second-generation proteasome inhibitors (such as carfilzomib), IMiDs (e.g., pomalidomide), and monoclonal antibodies (such as daratumumab) are useful additions but have only incrementally improved outcomes (median progression-free survival [PFS] of 3 to 4 months) (Siegel (2016) CA Cancer J Clin, 66: 7-30; SanMiguel et al. (2013) Lancet Oncol, 14: 1055-1066; Lonial et al. (2016) Lancet, 387(10027): 1551-1560). Immunotherapy using PD-1 / PD-L1 checkpoint inhibition has been evaluated in many myeloma trials. Combining PD-1-targeting agents with IMiDs has shown promising clinical activity, and ongoing studies are evaluating possible safety signals with IMiD-PD-1 combinations (Costa et al. (2018) Frontiers Immunol, 9:2204). Trials of CAR-T therapies are ongoing, and initial activity is promising. The primary antigen targeted in ongoing studies is B-cell maturation antigen, or BCMA (Costa et al. (2018) Frontiers Immunol, 9:2204). Despite recent progress, relapsed / refractory multiple myeloma remains a disease setting with high unmet need.
[0478] Multiple myeloma (MM) can be characterized by a variety of methods, including laboratory tests, imaging, and biopsy. Laboratory tests include: a complete blood count to measure the levels of red blood cells, white blood cells, and platelets in the blood; blood chemistry tests to measure the levels of blood creatinine, albumin, calcium, lactate dehydrogenase, and other electrolytes; urine tests to measure the presence of myeloma proteins, such as Bence Jones proteins (e.g., urine protein electrophoresis, urine immunofixation); quantitative immunoglobulin tests to measure the blood levels of different antibodies, where certain types of antibodies may be higher than others in subjects with MM; blood tests to assess the presence and levels of abnormal proteins produced by bone marrow cells, such as monoclonal immunoglobulins, monoclonal proteins (M proteins), M spikes, and paraproteins; blood tests to measure the levels of light chains in the blood; and blood tests to assess the presence and levels of beta-2 microglobulin.
[0479] A diagnosis of multiple myeloma generally requires: (1) a plasma cell tumor in the bone marrow (confirmed by biopsy) or at least 10% plasma cells; and (2) at least one of a high blood calcium level, poor kidney function, a low red blood cell count (anemia), holes in the bone from the tumor found on imaging studies (CT, MRI, PET scan), an increase in one type of light chain in the blood such that one type is 100 times more common than another, and 60% or more plasma cells in the bone marrow.
[0480] Multiple myeloma can be staged according to the Revised International Staging System (RISS) based on four factors: the amount of albumin in the blood, the amount of beta-2-microglobulin in the blood, the amount of lactate dehydrogenase (LDH) in the blood, and the specific genetic abnormalities of the cancer (cytogenetics). RISS stage group I is characterized by serum beta-2-microglobulin less than 3.5 mg / L, an albumin level of 3.5 g / dL or higher, cytogenetics that are not considered high risk, and a normal LDH level. RISS stage group II is characterized by not belonging to stage group I or stage group III. RISS stage group III is characterized by serum beta-2-microglobulin of 5.5 mg / L or higher, cytogenetics that are considered high risk, and / or a high LDH level.
[0481] Thus, in an exemplary embodiment, a method of treating MUC1-associated multiple myeloma in a subject in need thereof is provided, comprising administering to the subject a therapeutically effective composition comprising a modified T cell comprising: a MUC1-specific antigen binding domain comprising a heavy chain variable (VH) domain and a light chain variable (VL) domain, wherein the VH domain comprises the heavy chain complementarity determining region (CDR) sequences recited in SEQ ID NOs: 22, 23, and 24, and wherein the VL domain comprises the light chain complementarity determining region (CDR) sequences recited in SEQ ID NOs: 19, 20, and 21; an optional hinge domain; a transmembrane domain; a costimulatory signaling domain; and an intracellular signaling domain.
[0482] In an exemplary embodiment, a method of treating MUC1-associated multiple myeloma in a subject in need thereof is provided, comprising administering to the subject a therapeutically effective composition comprising a modified T cell comprising: a MUC1-specific antigen binding domain comprising a heavy chain variable (VH) domain and a light chain variable (VL) domain, wherein the VH domain comprises the heavy chain complementarity determining region (CDR) sequences recited in SEQ ID NOs: 22, 23, and 24, and wherein the VL domain comprises the light chain complementarity determining region (CDR) sequences recited in SEQ ID NOs: 19, 20, and 21; optionally, a CD8α hinge domain; a CD8α transmembrane domain; a CD2 costimulatory signaling domain; and a CD3ζ intracellular signaling domain.
[0483] Exemplary cancer types to be treated with the modified cytotoxic cells (e.g., modified T cells comprising TN-MUC1 CAR) or pharmaceutical compositions of the present invention include non-small cell lung cancer. Lung cancer is the leading cause of cancer-related deaths worldwide and remains a significant unmet need despite advances in therapy. Non-small cell lung cancer (NSCLC) accounts for 85% of all lung cancer cases in the United States, with a large portion of the remaining 15% being small cell lung cancer (SCLC) (Zappa et al. (2016) Transl Lung Cancer Res, 5(3):288-300; Alvarado-Luna et al. (2016) Transl Lung Cancer Res, 5(1):26-38). Surgical resection remains the single most consistent and successful option for localized NSCLC; however, nearly 70% of lung cancer patients have locally advanced or metastatic disease at the time of diagnosis (Molina et al. (2008) Mayo Clin Proc, 83(5):584-594). Overall, the prognosis for lung cancer patients is poor, with a 5-year relative survival rate of less than 18%. The median OS time for stage IV NSCLC patients is 4 months, while the 1-year and 5-year survival rates are less than 16% and 2%, respectively (Cetin et al. (2011) Clin Epidemiol, 3:139-148).
[0484] In addition to radiotherapy for stage III or IV lung cancer, platinum-based regimens (doublet chemotherapy; for example, cisplatin plus gemcitabine or carboplatin plus paclitaxel / gemcitabine) remain one of the main treatments for unresectable NSCLC (Ettinger et al. (2019) website: nccn.org / professionals / physician_gls / pdf / nscl.pdf (accessed February 2019)). For patients with anaplastic lymphoma kinase (ALK) or sensitizing epidermal growth factor receptor (EGFR) mutations or other driver mutations / alterations, single-agent targeted therapy is added to the doublet (Ettinger et al., supra; Yoon et al. (2017) World J Clin Oncol, 8(1): 1-20). These targeted therapies have had a significant impact on the treatment of NSCLC in patients with genetic alterations and have led to greatly improved outcomes (Ettinger et al., supra). However, resistance to TKIs has become a significant unmet medical need, and recent evidence has postulated a unique mechanism of TKI resistance (Lin et al. (2014) J Cancer Res, 4(5):411-435). Inhibition of the immune checkpoint PD-1 / PD-L1 is used in the first-line and second-line settings for patients with locally advanced or metastatic NSCLC. PD-1 / PD-L1 pathway inhibition has demonstrated improved overall survival, longer duration of response, and fewer adverse events compared to chemotherapy alone. Currently, the NCCN guidelines recommend PD-1 inhibition in the first-line setting (associated with strong expression of PD-L1 in the tumor) and the second-line setting (regardless of PD-L1 expression; Ettinger et al., supra). Despite recent advances in targeted agents and checkpoint inhibition, NSCLC remains an area of significant unmet need.
[0485] NSCLC includes adenocarcinoma, squamous cell carcinoma and large cell carcinoma. NSCLC can be characterized by a variety of methods, including laboratory tests, imaging and biopsy. For example, the diagnosis of NSCLC may require tests including bone scans, imaging tests (MRI, CT scans, PET scans), microscopic examination of sputum to check for cancer cells and lung biopsy.
[0486] NSCLC can be staged according to the American Joint Committee on Cancer (AJCC) Tumor, Node, Metastasis (TNM) system, which is based on three main factors: (1) the size and extent of the main tumor; (2) spread to nearby lymph nodes; and (3) spread to distant sites. The earliest stage of NSCLC is stage 0 (also called carcinoma in situ). Other stages range from stage I to stage IV, with higher-numbered stages meaning the cancer has spread further.
[0487] Thus, in an exemplary embodiment, a method of treating MUC1-associated non-small cell lung cancer in a subject in need thereof is provided, comprising administering to the subject a therapeutically effective composition comprising a modified T cell comprising: a MUC1-specific antigen binding domain comprising a heavy chain variable (VH) domain and a light chain variable (VL) domain, wherein the VH domain comprises the heavy chain complementarity determining region (CDR) sequences recited in SEQ ID NOs: 22, 23, and 24, and wherein the VL domain comprises the light chain complementarity determining region (CDR) sequences recited in SEQ ID NOs: 19, 20, and 21; an optional hinge domain; a transmembrane domain; a costimulatory signaling domain; and an intracellular signaling domain.
[0488] In an exemplary embodiment, a method of treating MUC1-associated non-small cell lung cancer in a subject in need thereof is provided, comprising administering to the subject a therapeutically effective composition comprising a modified T cell comprising: a MUC1-specific antigen binding domain comprising a heavy chain variable (VH) domain and a light chain variable (VL) domain, wherein the VH domain comprises the heavy chain complementarity determining region (CDR) sequences recited in SEQ ID NOs: 22, 23, and 24, and wherein the VL domain comprises the light chain complementarity determining region (CDR) sequences recited in SEQ ID NOs: 19, 20, and 21; optionally, a CD8α hinge domain; a CD8α transmembrane domain; a CD2 costimulatory signaling domain; and a CD3ζ intracellular signaling domain.
[0489] Exemplary cancer types to be treated with the modified cytotoxic cells (e.g., modified T cells comprising a TN-MUC1 CAR) or pharmaceutical compositions of the present invention include pancreatic cancer. Pancreatic ductal adenocarcinoma is a highly lethal malignancy. It is the fourth leading cause of cancer-related deaths in the United States, with approximately 45,000 new cases each year. Surgical resection is the only potentially curative treatment, but for most patients with advanced disease, only 15-20% are candidates for surgical intervention (Fogel et al. (2017) Am J Gastroenterology, 112(4):537-555). Overall, even with surgical intervention, the prognosis is poor: the five-year survival rate for surgery is approximately 25% for node-negative disease and approximately 10% for node-positive disease. Because most patients present with unresectable disease, chemotherapy is the primary treatment. Prior to the recently developed combination chemotherapy, modest improvements in efficacy had been observed. FOLFIRINOX treatment showed an increase in median OS and PFS compared to gemcitabine alone, although increased toxicity was observed with the combination therapy. Combination therapy options include gemcitabine and nab-paclitaxel, which is more widely used than FOLFIRINOX due to its favorable toxicity profile, despite a poorer median OS.
[0490] Despite the success of targeted and immunotherapy approaches in other solid tumors, similar improvements in efficacy have not been evident in pancreatic cancer (Amanam et al. (2018) Cancers, 10(2). pii: E36). Interestingly, immune checkpoint inhibitors have had greater success in pancreatic cancer. Overall, pancreatic cancer remains an area of high unmet need, and clinical trials are considered part of the standard of care in this setting (Tempero et al. (2019) website: nccn.org / professionals / physician_gls / pdf / pancreatic.pdf. (accessed February 2019)).
[0491] Pancreatic cancer c...
Claims
1. A modified immune cell comprising a chimeric antigen receptor (CAR) that specifically binds to MUC1, wherein the CAR comprises: A MUCl-specific antigen-binding domain comprising a heavy chain variable (VH) domain and a light chain variable (VL) domain, wherein the VH domain consists of the amino acid sequence set forth in SEQ ID NO:5, and the VL domain consists of the amino acid sequence set forth in SEQ ID NO:6; transmembrane domain; CD2 or CD28YMFM costimulatory signaling domain; and The intracellular signaling domain of CD3ζ. 2 . The modified immune cell of claim 1 , wherein the MUC1-specific antigen binding domain is specific for a carbohydrate epitope of MUC1.
3. The modified immune cell of claim 2, wherein the MUCl-specific antigen binding domain is specific for a truncated carbohydrate epitope of MUCl. 4 . The modified immune cell of claim 1 , wherein the MUC1-specific antigen-binding domain comprises the amino acid sequence set forth in SEQ ID NO:
4.
5. The modified immune cell according to any one of claims 1 to 4, wherein: (a) the transmembrane domain comprises a transmembrane region of a protein selected from the group consisting of a type I transmembrane protein, an alpha chain of a T cell receptor, a beta chain of a T cell receptor, a zeta chain of a T cell receptor, CD28, CD2, CD3ε, CD45, CD4, CD5, CD7, CD8, CD9, CD16, CD22, CD33, CD37, CD64, CD80, CD86, CD134 (OX-40), CD137 (4-1BB), CD154 (CD40L), CD278 (ICOS), CD357 (GITR), Toll-like receptor 1 (TLR1), TLR2, TLR3, TLR4, TLR5, TLR6, TLR7, TLR8, and TLR9; or (b) the co-stimulatory signaling domain: (i) is a CD2 costimulatory signaling domain; or (ii) comprising the amino acid sequence set forth in SEQ ID NO:28; or (c) The intracellular signaling domain comprises the amino acid sequence set forth in SEQ ID NO:
30.
6. The modified immune cell of claim 5, wherein the transmembrane domain comprises a CD8 transmembrane region.
7. The modified immune cell according to claim 5, wherein the transmembrane domain comprises the amino acid sequence set forth in SEQ ID NO:
7.
8. The modified immune cell according to any one of claims 1-3, wherein the CAR further comprises: (a) leader sequence; or (b) Hinge domain.
9. The modified immune cell of claim 8, wherein the leader sequence is a CD8 leader sequence.
10. The modified immune cell according to claim 8, wherein the leader sequence comprises the amino acid sequence set forth in SEQ ID NO:
48.
11. The modified immune cell of claim 8, wherein the hinge domain: (a) from a protein selected from the group consisting of an antibody Fc fragment, an antibody hinge region, an antibody CH2 region, an antibody CH3 region, an artificial spacer sequence, and any combination thereof; or (b) is the CD8 hinge domain.
12. The modified immune cell of claim 8, wherein the hinge domain comprises the amino acid sequence set forth in SEQ ID NO:
13.
13. The modified immune cell of any one of claims 1-4, 6-7, 9-12, wherein the modified immune cell is a modified T cell.
14. The modified immune cell of any one of claims 1-4, 6-7, 9-12, wherein the modified immune cell is a modified natural killer (NK) cell.
15. The modified immune cell of any one of claims 1-4, 6-7, 9-12, wherein the modified immune cell is a modified natural killer T (NKT) cell.
16. The modified immune cell according to any one of claims 1-4, 6-7, 9-12, wherein the modified immune cell comprises the amino acid sequence recited in SEQ ID NO: 41 or 47.
17. The modified immune cell according to any one of claims 1-4, 6-7, 9-12, further comprising: (a) a switch receptor comprising an extracellular domain of a signaling protein associated with a negative signal, a transmembrane domain, and an intracellular domain of a signaling protein associated with a positive signal, wherein the signal transduction protein associated with negative signal is selected from CTLA4, PD-1, BTLA, TIM-3 and TGFβR, and wherein the signal transduction protein associated with positive signal is selected from CD28, ICOS, 4-1BB and IL-12R; or (b) a dominant negative receptor comprising an extracellular domain, a transmembrane domain, and lacking an intracellular signaling domain of a signaling protein associated with a negative signal, wherein the signaling protein associated with a negative signal is selected from CTLA4, PD-1, BTLA, TIM-3, and TGFβR.
18. The modified immune cell according to claim 17, wherein: (a) The extracellular domain and intracellular domain of the conversion receptor are selected from PD-1 and CD28, PD-1 A132L and CD28, PD-1 and 4-1BB, PD-1 A132L and 4-1BB, PD-1, IL12Rβ1, PD-1A A132L and IL12Rβ1, PD-1 and IL12Rβ2, PD-1 A132L and IL12Rβ2, TGFβRII and IL12Rβ1, TGFβRII and IL12Rβ2, TGFβRII and CD28, TGFβRII and IL12Rβ1; or TIM3 and CD28; or (b) the switch receptor comprises an amino acid sequence selected from the group consisting of SEQ ID NOs: 78, 80, 82, 84, 86, 88, 90, and 92; (c) the dominant negative receptor comprises the amino acid sequence set forth in SEQ ID NO: 76; or (d) The dominant negative receptor is a TGFβR1 or TGFβR2 dominant negative receptor.
19. An isolated nucleic acid sequence encoding a chimeric antigen receptor (CAR), the chimeric antigen receptor (CAR) comprising: A MUCl-specific antigen-binding domain comprising a heavy chain variable (VH) domain and a light chain variable (VL) domain, wherein the VH domain consists of the amino acid sequence set forth in SEQ ID NO:5, and the VL domain consists of the amino acid sequence set forth in SEQ ID NO:6; transmembrane domain; CD2 or CD28YMFM costimulatory signaling domain; and The intracellular signaling domain of CD3ζ.
20. The isolated nucleic acid sequence of claim 19, wherein: (a) the MUC1-specific antigen binding domain is specific for a carbohydrate epitope of MUC1; or (b) the transmembrane domain comprises a transmembrane region selected from the group consisting of a type I transmembrane protein, an alpha chain of a T cell receptor, a beta chain of a T cell receptor, a zeta chain of a T cell receptor, CD28, CD2, CD3ε, CD45, CD4, CD5, CD7, CD8, CD9, CD16, CD22, CD33, CD37, CD64, CD80, CD86, CD134 (OX-40), CD137 (4-1BB), CD154 (CD40L), CD278 (ICOS), CD357 (GITR), Toll-like receptor 1 (TLR1), TLR2, TLR3, TLR4, TLR5, TLR6, TLR7, TLR8, and TLR9; and / or (c) the co-stimulatory signaling domain: (i) encoded by the nucleic acid sequence of SEQ ID NO: 27; (ii) is a CD2 costimulatory signaling domain; or (iii) encoded by the nucleic acid sequence of SEQ ID NO: 29; or (d) The intracellular signaling domain is encoded by the nucleic acid sequence of SEQ ID NO:
31.
21. The isolated nucleic acid sequence of claim 19, wherein the MUCl-specific antigen binding domain is specific for a truncated carbohydrate epitope of MUCl.
22. The isolated nucleic acid sequence of claim 19, wherein the MUCl-specific antigen binding domain comprises the amino acid sequence set forth in SEQ ID NO:
4.
23. The isolated nucleic acid sequence of claim 19 or 20, wherein the CAR further comprises: (a) CD8 leader sequence; or (b) CD8 hinge domain.
24. The isolated nucleic acid sequence of claim 23, wherein the leader sequence is a CD8 leader sequence.
25. The isolated nucleic acid sequence of claim 23, wherein the leader sequence comprises the amino acid sequence of SEQ ID NO:
48.
26. The isolated nucleic acid sequence of claim 23, wherein the hinge domain: (a) from a protein selected from the group consisting of an antibody Fc fragment, an antibody hinge region, an antibody CH2 region, an antibody CH3 region, an artificial spacer sequence, and any combination thereof; or (b) is the CD8 hinge domain.
27. The isolated nucleic acid sequence of claim 23, wherein the hinge domain comprises the amino acid sequence set forth in SEQ ID NO:
13.
28. The isolated nucleic acid sequence of claim 19 or 20, wherein the nucleic acid sequence comprises the nucleotide sequence of SEQ ID NO: 40 or 46.
29. The isolated nucleic acid sequence of any one of claims 19-22 and 24-27, further comprising a second nucleic acid sequence encoding: (a) a switch receptor comprising an extracellular domain of a signaling protein associated with a negative signal, a transmembrane domain, and an intracellular domain of a signaling protein associated with a positive signal, wherein the signal transduction protein associated with negative signal is selected from CTLA4, PD-1, BTLA, TIM-3 and TGFβR, and wherein the signal transduction protein associated with positive signal is selected from CD28, ICOS, 4-1BB and IL-12R; or (b) a dominant negative receptor comprising an extracellular domain of a signaling protein associated with a negative signal, a transmembrane domain, and lacking an intracellular signaling domain, wherein the signaling protein associated with a negative signal is selected from the group consisting of CTLA4, PD-1, BTLA, TIM-3, and TGFβR; The nucleic acid encoding the CAR and the second nucleic acid sequence are separated by a nucleic acid sequence encoding a self-cleaving peptide.
30. The isolated nucleic acid sequence of claim 29, wherein: (a) The extracellular domain and intracellular domain of the conversion receptor are selected from PD-1 and CD28, PD-1 A132L and CD28, PD-1 and 4-1BB, PD-1 A132L and 4-1BB, PD-1, IL12Rβ1, PD-1A A132L and IL12Rβ1, PD-1 and IL12Rβ2, PD-1 A132L and IL12Rβ2, TGFβRII and IL12Rβ1, TGFβRII and IL12Rβ2, TGFβRII and CD28, TGFβRII and IL12Rβ1; or TIM3 and CD28; and / or (b) the second nucleic acid sequence comprises a nucleic acid sequence selected from the group consisting of SEQ ID NO: 79, 81, 83, 85, 87, 89, 91 and 93; and / or (c) the second nucleic acid sequence encodes a protein selected from TGFβR1, TGFβR2, TIM-3, and PD-1; and / or (d) The second nucleic acid sequence comprises the nucleic acid sequence described in SEQ ID NO:
77.
31. A chimeric antigen receptor (CAR) that specifically binds to MUCl, wherein the CAR is encoded by the nucleic acid of any one of claims 19-28.
32. A chimeric antigen receptor (CAR) that specifically binds to MUC1, wherein the CAR comprises: a MUCl-specific antigen-binding domain comprising a heavy chain variable (VH) domain and a light chain variable (VL) domain, wherein the VH domain consists of the amino acid sequence set forth in SEQ ID NO:5, and wherein the VL domain consists of the amino acid sequence set forth in SEQ ID NO:6; Hinge domain; transmembrane domain; A CD2 costimulatory signaling domain comprising the amino acid sequence set forth in SEQ ID NO: 28; and The intracellular signaling domain of CD3ζ.
33. A chimeric antigen receptor (CAR) that specifically binds to MUC1, wherein the CAR comprises: A MUCl-specific antigen-binding domain comprising a heavy chain variable (VH) domain and a light chain variable (VL) domain, wherein the VH domain consists of the amino acid sequence set forth in SEQ ID NO:5, and the VL domain consists of the amino acid sequence set forth in SEQ ID NO:6; CD8 hinge domain; CD8 transmembrane domain; A CD2 costimulatory signaling domain comprising the amino acid sequence set forth in SEQ ID NO: 28; and CD3ζ intracellular signaling domain.
34. The CAR of claim 32 or 33, wherein the CAR comprises the amino acid sequence recited in SEQ ID NO: 41 or 47.
35. An expression construct comprising the isolated nucleic acid of any one of claims 19-28.
36. The expression construct of claim 35, further comprising: (a) EF-1α promoter; or (b) rev response element (RRE); (c) Woodchuck hepatitis virus posttranscriptional regulatory element (WPRE); (d) cPPT sequence; or (e) EF-1α promoter, rev response element (RRE), woodchuck hepatitis virus posttranscriptional regulatory element (WPRE) and cPPT sequence.
37. The expression construct of claim 35 or 36, wherein the expression construct is a viral vector selected from the group consisting of a retroviral vector, an adenoviral vector, and an adeno-associated viral vector.
38. The expression construct of claim 35 or 36, wherein the expression construct is a lentiviral vector.
39. The expression construct of claim 35 or 36, wherein the expression construct is a self-inactivating lentiviral vector.
40. A method for generating a modified immune cell comprising introducing into an immune cell the isolated nucleic acid of any one of claims 19-22, 24-27, 30 or the expression construct of any one of claims 35-36.
41. Use of a composition in the preparation of a medicament for treating a MUCl-related cancer in a subject in need thereof, the treatment comprising administering to the subject a therapeutically effective amount of a composition comprising the modified immune cell of any one of claims 1-18, wherein the MUCl-related cancer is selected from multiple myeloma, breast cancer, and pancreatic cancer.
42. The use of claim 41, wherein the MUCl -associated cancer is breast cancer.
43. The use of claim 41, wherein the breast cancer is characterized by aberrant glycosylation of MUCl.
44. The use according to claim 41, wherein the breast cancer is hormone receptor positive breast cancer.
45. The use according to claim 41, wherein the breast cancer is metastatic breast cancer.
46. The use of any one of claims 41-45, wherein the treatment further comprises administering to the subject: (a) lymphodepleting chemotherapy; or (b) a therapeutically effective amount of cyclophosphamide; or (c) a therapeutically effective amount of fludarabine; or (d) a therapeutically effective amount of cyclophosphamide and a therapeutically effective amount of fludarabine; or (e) Cytokine Release Syndrome (CRS) management plan; or (f) a therapeutically effective amount of tocilizumab and / or a corticosteroid.
47. The use of any one of claims 41-45, wherein the treatment further comprises administering to the subject a therapeutically effective amount of tocilizumab.
48. The use according to any one of claims 41-45, wherein the modified immune cells are autologous.
49. The use according to any one of claims 41-45, wherein administration of the modified immune cells is carried out via intratumoral delivery, via intravenous delivery, or via intraperitoneal delivery.
Citation Information
Patent Citations
Check-controlled postage-stamp-vending machine.
US1007983A
Protecting hole in component during coating process using plug with water soluble layer
US10888892B2
Increased delivery of a nucleic acid construct in vivo by the poly-L-glutamate ("PLG") system
US20040014645A1
Electroporation device and injection apparatus
US20040059285A1
Method for muscle delivery of drugs, nucleic acids and other compounds
US20040092907A1