Microorganisms and methods for the production of glycolic acid and glycine by reverse glyoxylate shunt

Abstract

The present invention provides a recombinant microorganism for producing glyoxylic acid through a biochemical pathway of the reverse glyoxylate shunt, and a method for improving the production and yield of glycolic acid and / or glycine. The reverse glyoxylate shunt comprises: an enzyme that catalyzes the carboxylation of phosphoenolpyruvate (PEP) to oxaloacetate (OAA), or an enzyme that catalyzes the carboxylation of pyruvate to oxaloacetate (OAA), or an enzyme that catalyzes the carboxylation of pyruvate to malic acid, or a combination of any of the foregoing reactions; an enzyme that catalyzes the conversion of malic acid to malyl coenzyme A; an enzyme that catalyzes the conversion of malyl coenzyme A to glyoxylic acid and acetyl coenzyme A; and optionally, an enzyme that catalyzes the conversion of oxaloacetate (OAA) to malic acid. Glyoxylic acid is reduced to produce glycolic acid. Alternatively, glyoxylic acid is converted to glycine. The reverse glyoxylate shunt pathway of the present invention can be used synergistically with other glycolic acid and / or glycine production pathways to increase the production yield.

Description

[0001] CROSS-REFERENCE TO RELATED APPLICATIONS

[0002] This application claims priority to U.S. Provisional Application No. 62 / 806,195, filed on February 15, 2019, entitled “Microorganisms and methods for producing glycolic acid and glycine by reversing the glyoxylate bypass,” the disclosure of which is incorporated herein by reference. Technical Field

[0003] The application relates to a method for using a recombinant microorganism and producing the recombinant microorganism, wherein the recombinant microorganism uses a reverse glyoxylate bypass to carry out biosynthesis of glycolic acid and / or glycine from glyoxylic acid and improve its productivity. The application also relates to a method for using a recombinant microorganism to produce glycolic acid and / or glycine from a carbon source (e.g., hexose or pentose raw materials) by a reverse glyoxylate bypass. The application also relates to a composition comprising one or more of these compounds and / or the recombinant microorganism.

[0004] Statement regarding sequence listing

[0005] The sequence listing associated with this application is provided in text format in lieu of a paper copy and is hereby incorporated by reference into the specification. The name of the text file containing the sequence listing is BRSK-010_02WO_ST25.txt. The text file is approximately 45.5KB, created on February 12, 2020, and submitted electronically via EFS-Web. Background Art

[0006] Glycolic acid and glycine are valuable raw materials for the production of a variety of compounds. For example, glycolic acid is an important raw material for the production of products such as polyglycolic acid and other biocompatible copolymers. Similarly, glycine has a variety of uses in the pharmaceutical and cosmetic industries, in the production of insecticides (pyrethroid insecticides), and as a food and feed additive.

[0007] To develop environmentally friendly processes for producing glycolic acid (GA) and glycine, researchers have engineered microorganisms with biosynthetic pathways to produce GA and / or glycine. For example, U.S. Patent No. 9,034,615 and U.S. Patent No. 8,945,888 disclose the production of glycolic acid via the glyoxylate shunt (GS) pathway. U.S. Pre-Grant Publication No. 2014 / 0295510 discloses a GS pathway for producing glycolic acid in eukaryotic organisms, while patent documents such as WO2017 / 059236, WO2016 / 079440, US2016 / 0076061, and US2015 / 0147794 disclose the production of glycolic acid using pentose-based sugars. Although the purpose of developing the biochemical pathways described in these and other patent documents is to provide high GA and glycine yields, because these pathways produce excess NADH and excess CO 2, resulting in a loss of product yield, so the GA and glycine yields provided by these pathways are still not optimal.

[0008] The biosynthetic pathways for producing glycolic acid and glycine provided by the present invention have higher theoretical yield potentials compared to existing metabolic pathways, which solve or partially reduce the problem of lost product yield potentials. The present invention provides biosynthetic pathways in which carbon fixing enzymes and reverse glyoxylate shunt enzymes are coupled to produce glycolic acid and glycine and increase their yields. The present invention also provides further improvements to prevent carbon loss from previously described pathways and facilitate carbon fixation coupled to the reverse glyoxylate shunt.

[0009] The present invention is also intended to further increase the theoretical yields of glycolate and glycine from the previously described pathways, in part by utilizing the CO released by these pathways. 2 and / or NAD(P)H, or by capturing exogenously supplied carbon sources (CO 2 , HCO 3 - The present invention further provides biosynthetic pathways for producing and improving the GA and glycine yield potential of previously described pathways by rerouting carbon flow through carbon fixation in the pyruvate and / or phosphoenolpyruvate nodes to oxaloacetate, partially reducing or even eliminating carbon losses in microbial intrinsic metabolism and enzymatic reactions.

[0010] Thus, the present invention allows for higher production of GA and glycine using the same amount of starting carbon source (eg, sugar) and provides a method to improve the economic success of current processes. Summary of the invention

[0011] The present disclosure provides recombinant microorganisms and uses thereof. The present disclosure also provides methods for preparing recombinant microorganisms. In various embodiments, the recombinant microorganisms of the present disclosure produce glycolic acid (GA) and / or glycine using glyoxylic acid as an intermediate.

[0012] In some embodiments, provided herein is a recombinant microorganism for producing glyoxylate for synthesizing glycolate (GA) and / or glycine, wherein the microorganism comprises: (a) a gene encoding a malate dehydrogenase that catalyzes the conversion of pyruvate into malate; (b) a gene encoding a malate thiokinase that catalyzes the conversion of malate into malyl-CoA; and (c) a gene encoding a malyl-CoA lyase that catalyzes the conversion of malyl-CoA into glyoxylate and acetyl-CoA.

[0013] In some embodiments, provided herein is a recombinant microorganism that produces glyoxylate for synthesizing glycolate (GA) and / or glycine, wherein the microorganism comprises: (a) a gene encoding a pyruvate carboxylase that catalyzes the conversion of pyruvate to oxaloacetate (OAA), and / or a gene encoding a phosphoenolpyruvate carboxylase that catalyzes the conversion of phosphoenolpyruvate to OAA, and / or a gene encoding a phosphoenolpyruvate carboxykinase that catalyzes the conversion of phosphoenolpyruvate to OAA; (b) a gene encoding a malate thiokinase that catalyzes the conversion of malate to malyl-CoA; and (c) a gene encoding a malyl-CoA lyase that catalyzes the conversion of malyl-CoA to glyoxylate and acetyl-CoA, wherein the acetyl-CoA produced by the malyl-CoA lyase combines with OAA to increase the biosynthesis of GA and / or glycine.

[0014] In some embodiments, provided herein is a recombinant microorganism for producing glyoxylate for synthesizing glycolate (GA) and / or glycine, wherein the microorganism comprises: (a) a gene encoding a pyruvate carboxylase that catalyzes the conversion of pyruvate into oxaloacetate (OAA), and / or a gene encoding a phosphoenolpyruvate carboxylase that catalyzes the conversion of phosphoenolpyruvate into OAA, and / or a gene encoding a phosphoenolpyruvate carboxykinase that catalyzes the conversion of phosphoenolpyruvate into OAA; (b) a gene encoding a malate dehydrogenase that catalyzes the conversion of OAA into malate; (c) a gene encoding a malate thiokinase that catalyzes the conversion of malate into malyl-CoA; and (d) a gene encoding a malyl-CoA lyase that catalyzes the conversion of malyl-CoA into glyoxylate and acetyl-CoA, wherein the acetyl-CoA produced by the malyl-CoA lyase is combined with OAA to increase the biosynthesis of GA and / or glycine. In some of these embodiments, the recombinant microorganism may comprise a gene encoding a malate dehydrogenase that catalyzes the conversion of pyruvate into malate.

[0015] In some embodiments, provided herein is a recombinant microorganism that produces glyoxylate for synthesizing glycolate (GA) and / or glycine, wherein the microorganism comprises: (a) a gene encoding a pyruvate carboxylase that catalyzes the conversion of pyruvate to oxaloacetate (OAA), and / or a gene encoding a phosphoenolpyruvate carboxylase that catalyzes the conversion of phosphoenolpyruvate to OAA, and / or a gene encoding a phosphoenolpyruvate carboxykinase that catalyzes the conversion of phosphoenolpyruvate to OAA; (b) a gene encoding a malate thiokinase that catalyzes the conversion of malate to malyl-CoA; and (c) a gene encoding a malyl-CoA lyase that catalyzes the conversion of malyl-CoA to glyoxylate and acetyl-CoA, wherein the recombinant microorganism does not catalyze the conversion of oxaloacetate to malate.

[0016] In some embodiments, provided herein is a recombinant microorganism for producing glyoxylate for synthesizing glycolate (GA) and / or glycine, wherein the microorganism comprises: (a) a gene encoding a pyruvate carboxylase that catalyzes the conversion of pyruvate into oxaloacetate (OAA), and / or a gene encoding a phosphoenolpyruvate carboxylase that catalyzes the conversion of phosphoenolpyruvate into OAA, and / or a gene encoding a phosphoenolpyruvate carboxykinase that catalyzes the conversion of phosphoenolpyruvate into OAA; (b) a gene encoding a malate thiokinase that catalyzes the conversion of malate into malyl-CoA; (c) a gene encoding a malyl-CoA lyase that catalyzes the conversion of malyl-CoA into glyoxylate and acetyl-CoA, wherein the acetyl-CoA produced by the malyl-CoA lyase is combined with OAA to increase the biosynthesis of GA and / or glycine. In these embodiments, the recombinant microorganism has a reduced phosphoglucose isomerase activity, or more preferably does not catalyze the conversion of glucose-6-phosphate to fructose-6-phosphate by the enzyme phosphoglucose isomerase. In addition, the recombinant microorganism may or may not contain overexpressed endogenous or exogenous enzymes: citrate synthase, isocitrate lyase and / or glyoxylate reductase. By reducing the activity of phosphoglucose isomerase, or more preferably by deleting the gene encoding phosphoglucose isomerase that catalyzes the conversion of glucose-6-phosphate to fructose-6-phosphate (e.g., gene pgi in E. coli), the carbon source can be at least partially diverted to the pentose-phosphate pathway (PPP) to provide additional NADPH that may be required for optimal conversion of glyoxylate to glycolate. In some embodiments, CO generated by the PPP route 2 It is possible to reincorporate carboxykinase by using the carboxylase and carboxykinase proposed herein.

[0017] The recombinant microorganism in any of the embodiments described herein can produce isopropanol, ethanol, acetone, citric acid, itaconic acid, acetic acid, butyric acid, (poly)3-hydroxybutyric acid, 3-hydroxyisobutyric acid, 3-aminoisobutyric acid, 2-hydroxyisobutyric acid, methacrylic acid, (poly)glutamic acid, glutamic acid, arginine, ornithine, citrulline, leucine, isoleucine, or proline without acetyl-CoA produced by malyl-CoA lyase.

[0018] In the recombinant microorganisms of the present disclosure, acetyl-CoA produced by malyl-CoA lyase is expected to combine with OAA to increase the biosynthesis of GA and / or glycine.

[0019] In some embodiments, any of the recombinant microorganisms described herein can comprise a deletion or loss-of-function mutation in a gene encoding a malate dehydrogenase, wherein the mutation results in partial or complete inhibition of malate dehydrogenase activity that catalyzes the conversion of oxaloacetate to malate, malate to pyruvate, and / or malate to oxaloacetate.

[0020] In embodiments where the recombinant microorganism produces glycolic acid, the recombinant microorganism comprises a gene encoding an NADH-dependent glyoxylate reductase that catalyzes the conversion of glyoxylate to glycolic acid, and / or a gene encoding an NADPH-dependent glyoxylate reductase that catalyzes the conversion of glyoxylate to glycolic acid.

[0021] In an embodiment in which a recombinant microorganism produces glycine, the recombinant microorganism comprises a gene encoding alanine-glyoxylate aminotransferase, a gene encoding glycine dehydrogenase, a gene encoding glycine transaminase, a gene encoding serine-glyoxylate transaminase, and / or a gene encoding glycine oxidase to catalyze the conversion of glyoxylate to glycine.

[0022] In some embodiments, the recombinant microorganisms of the present disclosure can produce glycolate and glycine and comprise one or more of the above genes for converting glyoxylate to GA and / or glycine.

[0023] In some embodiments, the gene encoding glyoxylate reductase activity is selected from: ycdW and / or yiaE from Escherichia coli, GOR1 from S. cerevisiae, gyaR from Thermococcus litoralis, and / or GLYR1 from Arabidopsis thaliana. The present disclosure also contemplates the use of homologs of these genes to catalyze the conversion of glyoxylate to glycolate.

[0024] In certain embodiments, the malate dehydrogenase that catalyzes the carboxylation of pyruvate to malate in the recombinant microorganisms of the present disclosure is from enzyme class (EC) 1.1.1.38, EC 1.1.1.39, or EC 1.1.1.40.

[0025] In some embodiments, the malate dehydrogenase that catalyzes the conversion of oxaloacetate to malate in the recombinant microorganisms of the present disclosure is from enzyme class (EC) 1.1.1.37.

[0026] In some embodiments, the gene encoding malate dehydrogenase that catalyzes the carboxylation of pyruvate to malate in the recombinant microorganism of the present disclosure is selected from: maeA, maeB, dme, mez, mae1, nad-me1, nad-me2 and homologs thereof. In these embodiments, the gene maeA can be from Escherichia coli, Pseudomonas, or Bacillus; the gene maeB can be from Escherichia coli or Salmonella; the gene dme can be from Rhizobium; the gene mez can be from Mycobacterium; the gene mae1 can be from Saccharomyces cerevisiae; and the gene nad-me1 or nad-me2 can be from Arabidopsis. For example, the maeA gene can be from Bacillus subtilis; the gene dme can be from R. melilote; or the gene mez can be from Mycobacterium tuberculosis. The present disclosure also contemplates the use of homologs of these genes to catalyze the carboxylation of pyruvate to malate.

[0027] In some embodiments, the gene encoding malate dehydrogenase that catalyzes the conversion of oxaloacetate into malic acid in the recombinant microorganism of the present disclosure is selected from: the gene mdh from Escherichia coli, Corynebacterium, Streptomyces, yeast and Arabidopsis. For example, the gene mdh can be from Streptomyces coelicolor (S.coelicolor) or the gene mdh1 / 2 / 3 is from Saccharomyces cerevisiae (S.cerevisiae). The present disclosure also contemplates the use of homologs of these genes to catalyze the conversion of oxaloacetate into malic acid.

[0028] In some embodiments, the malate thiokinase that converts malate to malyl-CoA can be from Enzyme Classification System Number EC 6.2.1.4, EC 6.2.1.5, EC 6.2.1.9, or EC 6.2.1.-.

[0029] In one embodiment, the gene encoding malate thiokinase in the recombinant microorganism of the present disclosure can be sucCD and / or SucCD-2 and / or mtkAB from Methylobacterium sp., Methylobacterium extorquens, Escherichia coli, Thermus thermophiles, Hyphomicrobium sp., Methanocaldococcus jannaschii, Methanothermobacter thermautotrophicus, Rhizobium, Methylococcus capsulatus or Pseudomonas, or a homolog thereof.

[0030] In some embodiments, the malyl-CoA lyase that converts malyl-CoA to glyoxylate and acetyl-CoA is from EC 4.3.1.24 or EC 4.3.1.25.

[0031] In some embodiments, the gene encoding malyl-CoA lyase in the recombinant microorganism of the present disclosure can be mcl and / or Mcl1 and / or mclA or a homolog thereof from Methylobacterium extorquens, Rhodobacter sphaeroides, Streptomyces, Chloroflexus aurantiacus, Nitrosomonas europaea, Methylococcus capsulatus, Nereida ignava, Hyphomicrobium methylovorum, Thalassobius activus, Roseobacter litoralis, Hyphomicrobium denitrificans, R. sphaeroides, Mycobacterium smegmatis, or Rhodococcus fascians.

[0032] In some embodiments, the pyruvate carboxylase that converts pyruvate to OAA can be from the enzyme classification system number EC6.4.1.1; the phosphoenolpyruvate carboxylase that converts phosphoenolpyruvate to OAA can be from EC4.1.1.31; the phosphoenolpyruvate carboxykinase that converts phosphoenolpyruvate to OAA can be from EC4.1.1.32 and EC4.1.1.49.

[0033] In some embodiments, the gene encoding pyruvate carboxylase in the recombinant microorganism of the present disclosure may be pyc from Rhizobium etli, PYC1 or PYC2 from yeast, or pyc from Bacillus subtilis; or a homolog thereof.

[0034] In some embodiments, the gene encoding phosphoenolpyruvate carboxylase in the recombinant microorganism of the present disclosure can be ppc from Escherichia coli, ppc or pepC from R. Marinus, ppcA from M. thermoautotrophicus, pep1 from Z. mays, ppc1 / 2 / 3 from Arabidopsis, ppc from G. max, or ppc from Rhodothermus, Corynebacterium, Salmonella, Hyphomicrobium, Streptococcus and Streptomyces, Pantoea, Bacillus, Clostridium, Pseudomonas, Rhodopseudomonas, Nicotiana tabacum), Amaranthushy pochondriacus, Triticum aestivum, or Medicago sativa; or homologs thereof.

[0035] In some embodiments, the gene encoding phosphoenolpyruvate carboxykinase in the recombinant microorganism of the present disclosure can be pck or pckA from Escherichia coli, pckA from Selenomonas ruminantium, pckA from Salmonella typhimurium, pckA from Klebsiella sp., pckA from Thermus sp., pck or pckA from Ruminococcus albus or Ruminococcus flavefaciens, pck or pckA from Actinobacillus succinate-producing succinogenes), pck or pckA from Streptococcus bovis, or from Bacillus, Ruminiclostridium thermocellum, Klebsiella, Mycobacterium; or homologs thereof.

[0036] In some embodiments, the recombinant microorganism of the present disclosure includes: (a) a gene encoding a citrate synthase, which converts OAA and acetyl-CoA produced by malic acid acyl-CoA lyase into citric acid; (b) a gene encoding a citrate hydrolase that converts citric acid into aconitic acid; (c) a gene encoding a D-threoisocitrate hydrolase or aconitase that converts aconitic acid into isocitrate; (d) a gene encoding an isocitrate lyase that converts isocitrate into succinic acid and glyoxylic acid; (e) a gene encoding a succinate dehydrogenase that converts succinic acid into fumaric acid; and (f) a gene encoding a fumarase that converts fumaric acid into malic acid. In the same embodiment, the recombinant microorganism may have a malate dehydrogenase that catalyzes the conversion of malic acid into oxaloacetic acid, which is at least partially retained. Alternatively, the malate dehydrogenase that catalyzes the conversion of malic acid into oxaloacetic acid may be downregulated or even inactivated to favor the activity of malate thiokinase.

[0037] In some embodiments, a loss-of-function mutation of a gene encoding malate synthase may be included in the recombinant microorganism of the present disclosure, or the gene may be deleted. Exemplary genes encoding malate synthase include aceB and / or glcB from Escherichia coli, or DAL7 and / or MLS1 from yeast (e.g., Saccharomyces cerevisiae).

[0038] The recombinant microorganism of any of the embodiments disclosed herein may include deletions or modifications that reduce the activity of one or more endogenous genes selected from the following: (a) a gene encoding isocitrate dehydrogenase; (b) a gene encoding pyruvate dehydrogenase, pyruvate oxidase, and / or pyruvate formate lyase; (c) a gene encoding pyruvate kinase; and (d) a gene encoding glycolate oxidase. Exemplary genes encoding isocitrate dehydrogenase include icd from Escherichia coli, or IDP2 and / or IDH1 / 2 from yeast. Exemplary genes encoding pyruvate dehydrogenase include aceE and / or aceF from Escherichia coli. Exemplary genes encoding pyruvate kinase include pykA and / or pykF from Escherichia coli. Exemplary genes encoding glycolate oxidase include glcD, glcE, glcF, and / or glcG from Escherichia coli. Exemplary genes.

[0039] The recombinant microorganism of any of the embodiments disclosed herein may include deletions or modifications that reduce the activity of pyruvate dehydrogenase, prevent or at least attenuate the major carbon loss in the conversion of pyruvate to acetyl-CoA, and favor carbon rerouting from pyruvate or phosphoenolpyruvate to oxaloacetate through the carboxylation activity of the enzyme candidates presented herein.

[0040] The recombinant microorganism of any of the embodiments disclosed herein may include deletions or modifications that reduce the activity of pyruvate kinase and favor carbon fixation from phosphoenolpyruvate to oxaloacetate via the carboxylation activity of the enzyme candidates presented herein.

[0041] The recombinant microorganism of any of the embodiments disclosed herein may include a deletion or modification that reduces the activity of one or more endogenous genes selected from the following: (a) a gene encoding a glyoxylate aldehyde ligase; (b) a gene encoding a 2-oxo-4-hydroxyglutarate aldolase; (c) a gene encoding a glycolaldehyde reductase; and (d) a gene encoding a repressor of isocitrate lyase. An exemplary gene encoding a glyoxylate aldehyde ligase is gcl. An exemplary gene encoding a 2-oxo-4-hydroxyglutarate aldolase is edA. Exemplary genes encoding glycolaldehyde reductase include fucO and gldA. An exemplary gene encoding a repressor of isocitrate lyase is iclR.

[0042] In some embodiments, in the recombinant microorganisms of the present disclosure, the expression level of a gene encoding alanine-glyoxylate aminotransferase, a gene encoding glycine dehydrogenase, a gene encoding glycine transaminase, a gene encoding serine-glyoxylate transaminase, and / or a gene encoding glycine oxidase is increased.

[0043] In some embodiments, in the recombinant microorganisms of the present disclosure, the expression level of a gene encoding alanine aminotransferase and / or a gene encoding NADPH-dependent glutamate synthase is increased.

[0044] In some embodiments, in the recombinant microorganisms of the present disclosure, the synthesis of glycolate and / or glycine is increased by increasing the expression level, activity, or specificity of at least one enzyme selected from the group consisting of pyruvate carboxylase, phosphoenolpyruvate carboxylase, phosphoenolpyruvate carboxykinase, malate dehydrogenase, malate thiokinase, malyl-CoA lyase, alanine-glyoxylate aminotransferase, glycine dehydrogenase, glycine transaminase, serine-glyoxylate transaminase, glycine oxidase, NADH-dependent glyoxylate reductase, and NADPH-dependent glyoxylate reductase.

[0045] In some embodiments, in the recombinant microorganisms of the present disclosure, the synthesis of glycolate and / or glycine is increased by reducing the expression level, activity, or specificity of at least one enzyme selected from the group consisting of malate synthase, isocitrate dehydrogenase, pyruvate dehydrogenase, pyruvate oxidase and / or pyruvate formate lyase, pyruvate kinase, glyoxylate-aldehyde ligase, 2-oxo-4-hydroxyglutarate aldolase, glucose-6-phosphate isomerase, glycolaldehyde reductase, and glycolate oxidase.

[0046] In some embodiments, in the recombinant microorganisms of the present disclosure, the synthesis of glycolate and / or glycine is increased by reducing the expression level of a gene encoding a repressor of isocitrate lyase.

[0047] In some embodiments, the recombinant microorganisms of the present disclosure can utilize NADH and CO produced by other glycolate and / or glycine production pathways in reactions catalyzed by malate dehydrogenase, pyruvate carboxylase, phosphoenolpyruvate carboxylase, phosphoenolpyruvate carboxykinase, malate thiokinase, and malyl-CoA lyase. 2 For example, in some embodiments, the recombinant microorganisms of the present disclosure can utilize NADH and / or CO produced by the serine / hydroxypyruvate pathway in reactions catalyzed by malate dehydrogenase, pyruvate carboxylase, phosphoenolpyruvate carboxylase, phosphoenolpyruvate carboxylkinase, malate thiokinase, and malyl-CoA lyase. 2 In some embodiments, the recombinant microorganisms of the present disclosure can utilize NADH and / or CO produced by the glyoxylate shunt pathway in reactions catalyzed by malate dehydrogenase, pyruvate carboxylase, phosphoenolpyruvate carboxylase, phosphoenolpyruvate carboxykinase, malate thiokinase, and malyl-CoA lyase. 2In some embodiments, the recombinant microorganisms of the present disclosure can utilize NADH and / or CO produced by the D-erythrose to glycolaldehyde pathway in reactions catalyzed by malate dehydrogenase, pyruvate carboxylase, phosphoenolpyruvate carboxylase, phosphoenolpyruvate carboxykinase, malate thiokinase, and malyl-CoA lyase. 2 In some embodiments, the recombinant microorganisms of the present disclosure can utilize NADH and / or CO produced by the pentose derivative-to-glycolaldehyde pathway in reactions catalyzed by malate dehydrogenase, pyruvate carboxylase, phosphoenolpyruvate carboxylase, phosphoenolpyruvate carboxykinase, malate thiokinase, and malyl-CoA lyase. 2 .

[0048] In some embodiments, the recombinant microorganisms of the present disclosure can utilize exogenously added CO in reactions catalyzed by malate dehydrogenase, pyruvate carboxylase, phosphoenolpyruvate carboxylase, phosphoenolpyruvate carboxylkinase, malate thiokinase, and malyl-CoA lyase. 2 , carbonic acid, and / or a reducing agent. The reducing agent may be hydrogen, electrons, and / or NAD(P)H.

[0049] The recombinant microorganism provided by the present disclosure includes bacterium, yeast and fungi. In some embodiments, the recombinant microorganism of the present disclosure can be a bacterium selected from Enterobacteriaceae, Clostridium family, Bacillaceae, Streptomycetaceae and Corynebacterium family. In an exemplary embodiment, the recombinant microorganism of the present disclosure can be a species of Escherichia coli, Clostridium, Bacillus, Klebsiella, Pantoea, Salmonella, Lactobacillus or Corynebacterium. For example, the recombinant microorganism of the present disclosure can be Escherichia coli, Corynebacterium glutamicum, Clostridium acetobutylicum or Bacillus subtilis.

[0050] In some embodiments, the recombinant microorganism of the present disclosure can be a yeast selected from the family Saccharomyces. In an exemplary embodiment, the recombinant microorganism of the present disclosure can be a yeast species. For example, the recombinant microorganism of the present disclosure can be Saccharomyces cerevisiae.

[0051] In the recombinant microorganisms of the present disclosure, any of the genes described herein are heterologously expressed.

[0052] The present disclosure also provides methods for producing GA and / or glycine using the recombinant microorganisms described herein. In some embodiments, the methods for producing glycolic acid and / or glycine using the recombinant microorganisms described herein include culturing the recombinant microorganism in a culture medium until glycolic acid and / or glycine is produced, wherein the culture medium contains a raw material that provides a carbon source.

[0053] In some embodiments, the carbon source used in the method for producing GA and / or glycine can be selected from: sugars, glycerol, alcohols, organic acids, alkanes, fatty acids, hemicellulose, lignocellulose, proteins, carbon dioxide and carbon monoxide. In an exemplary embodiment, the carbon source is hexose and / or pentose. In an exemplary embodiment, the carbon source is glucose. In another exemplary embodiment, the carbon source is sucrose. In another exemplary embodiment, the carbon source comprises a biomass hydrolyzate containing hemicellulose. In another exemplary embodiment, the carbon source is CO 2 or carbonic acid, such as HCO 3 - .

[0054] Also provided herein are methods of producing a recombinant microorganism that produces glycolate and / or glycine from glyoxylate.

[0055] In some embodiments, a method for producing a recombinant microorganism that produces glycolate and / or glycine comprises introducing into the microorganism: (a) a gene encoding a malate dehydrogenase that catalyzes the conversion of pyruvate to malate; (b) a gene encoding a malate thiokinase that catalyzes the conversion of malate to malyl-CoA; and (c) a gene encoding a malyl-CoA lyase that catalyzes the conversion of malyl-CoA to glyoxylate and acetyl-CoA.

[0056] In some embodiments, a method of producing a recombinant microorganism that produces glycolate and / or glycine comprises introducing into the microorganism: (a) a gene encoding a pyruvate carboxylase that catalyzes the conversion of pyruvate to OAA, and / or a gene encoding a phosphoenolpyruvate carboxylase that catalyzes the conversion of phosphoenolpyruvate to OAA, and / or a gene encoding a phosphoenolpyruvate carboxykinase that catalyzes the conversion of phosphoenolpyruvate to OAA; (b) a gene encoding a malate dehydrogenase that catalyzes the conversion of OAA to malate; (c) a gene encoding a malate thiokinase that catalyzes the conversion of malate to malyl-CoA; and (d) a gene encoding a malyl-CoA lyase that catalyzes the conversion of malyl-CoA to glyoxylate and acetyl-CoA, wherein the acetyl-CoA produced by the malyl-CoA lyase is combined with OAA to increase the biosynthesis of GA and / or glycine. In some of these embodiments, the method may comprise introducing a gene into the microorganism that encodes a malate dehydrogenase that catalyzes the conversion of pyruvate to malate.

[0057] In some embodiments, a method for producing a recombinant microorganism that produces glycolate and / or glycine comprises introducing into the microorganism: (a) a gene encoding a pyruvate carboxylase that catalyzes the conversion of pyruvate to oxaloacetate (OAA), and / or a gene encoding a phosphoenolpyruvate carboxylase that catalyzes the conversion of phosphoenolpyruvate to OAA, and / or a gene encoding a phosphoenolpyruvate carboxykinase that catalyzes the conversion of phosphoenolpyruvate to OAA; (b) a gene encoding a malate thiokinase that catalyzes the conversion of malate to malyl-CoA; and (c) a gene encoding a malyl-CoA lyase that catalyzes the conversion of malyl-CoA to glyoxylate and acetyl-CoA, wherein the recombinant microorganism does not catalyze the conversion of oxaloacetate to malate.

[0058] In one exemplary embodiment, a gene encoding a malate dehydrogenase heterologously introduced into a microorganism comprises a mutation that results in partial or complete inhibition of malate dehydrogenase activity, wherein the malate dehydrogenase activity catalyzes the conversion of oxaloacetate to malate, or the conversion of malate to pyruvate, or the conversion of malate to oxaloacetate. In another exemplary embodiment, if a gene encoding a malate dehydrogenase is endogenously present in the recombinant microorganism, wherein the malate dehydrogenase catalyzes the conversion of pyruvate to malate and / or catalyzes the conversion of oxaloacetate to malate, then the method for producing a recombinant microorganism that produces glycolic acid and / or glycine comprises introducing a mutation into an endogenous gene encoding a malate dehydrogenase, wherein the mutation results in partial or complete inhibition of malate dehydrogenase activity, wherein the malate dehydrogenase activity catalyzes the conversion of oxaloacetate to malate, or the conversion of malate to pyruvate, or the conversion of malate to oxaloacetate.

[0059] In some embodiments, the method for producing a recombinant microorganism that produces glycolate and / or glycine may further include introducing into the microorganism: (a) a gene encoding an NADH-dependent glyoxylate reductase that catalyzes the conversion of glyoxylate to glycolate; (b) a gene encoding an NADPH-dependent glyoxylate reductase that catalyzes the conversion of glyoxylate to glycolate; and / or c) a gene encoding an alanine-glyoxylate aminotransferase, a gene encoding a glycine dehydrogenase, a gene encoding a glycine transaminase, a gene encoding a serine-glyoxylate transaminase, and / or a gene encoding a glycine oxidase that catalyzes the conversion of glyoxylate to glycine.

[0060] In some embodiments, the method of producing a recombinant microorganism that produces glycolate and / or glycine may further include introducing a loss-of-function mutation or deleting a gene encoding malate synthase into the microorganism.

[0061] In some embodiments, the method of producing a recombinant microorganism that produces glycolate and / or glycine can also include introducing into the microorganism a deletion or modification that reduces the activity of one or more enzymes encoded by genes selected from the group consisting of: (a) a gene encoding isocitrate dehydrogenase; (b) a gene encoding pyruvate dehydrogenase, pyruvate oxidase, and / or pyruvate formate lyase; (c) a gene encoding pyruvate kinase; and (d) a gene encoding glycolate oxidase.

[0062] In some embodiments, the method of producing a recombinant microorganism that produces glycolate and / or glycine can also include introducing into the microorganism a deletion or modification that reduces the activity of one or more enzymes encoded by genes selected from the group consisting of: (a) a gene encoding glyoxylate aldehyde ligase (carboligase); (b) a gene encoding 2-oxo-4-hydroxyglutarate aldolase; (c) a gene encoding glycolaldehyde reductase; and (d) a gene encoding a repressor of isocitrate lyase.

[0063] In some embodiments, the method of producing a recombinant microorganism that produces glycolate and / or glycine may further include introducing a gain-of-function mutation into a gene encoding an alanine-glyoxylate aminotransferase, a gene encoding an alanine-glyoxylate aminotransferase that converts glyoxylate into glycine, a gene encoding a glycine dehydrogenase, a gene encoding a glycine transaminase, a gene encoding a serine-glyoxylate transaminase, and / or a gene encoding a glycine oxidase that catalyzes the conversion of glyoxylate into glycine.

[0064] In some embodiments, the method of producing a recombinant microorganism that produces glycolate and / or glycine may further include introducing a gain-of-function mutation into a gene encoding alanine aminotransferase and / or a gene encoding NADPH-dependent glutamate synthase.

[0065] In embodiments where a gain-of-function mutation is introduced into a gene, the gain-of-function mutation may be introduced into an endogenous gene of the microorganism, or the gain-of-function mutation may be introduced into a heterologous gene and the heterologous gene containing the gain-of-function mutation may be introduced into the microorganism.

[0066] The microorganism that can be used for producing the recombinant microorganism of the present disclosure includes bacterium, yeast and fungi.Exemplary bacteria that can be used for the present disclosure include selected from the following bacterium: Enterobacteriaceae, Clostridium family, Bacillaceae, Streptomycetaceae and Corynebacterium family.For example, the recombinant microorganism can be following kind: Escherichia (for example Escherichia coli), Clostridium (for example Clostridium acetobutylicum), Bacillus (for example Bacillus subtilis), Klebsiella, Pantoea, Salmonella, Lactobacillus or Corynebacterium (for example Corynebacterium glutamicum).

[0067] Exemplary yeasts that can be used to produce the recombinant microorganisms of the present disclosure can be from the family Saccharomyces. For example, the recombinant microorganism can be a yeast species, such as Saccharomyces cerevisiae. BRIEF DESCRIPTION OF THE DRAWINGS

[0068] Figure 1 Schematic diagram showing the production of glycolate (GA) and glycine (Gly) via the reverse glyoxylate shunt. Symbols It means that the enzyme will likely be downregulated or inactivated / eliminated, i.e. the corresponding gene may be weakened or deleted.

[0069] Figure 2 Schematic diagram showing the co-utilization of known glycolate (GA) and glycine (Gly) production pathways and the reverse glyoxylate bypass pathway of the present disclosure. The dashed line shows the reaction outline. Symbols It indicates that the enzyme may be downregulated or inactivated / eliminated, that is, the corresponding gene may be weakened or deleted.

[0070] Figure 3 It is a schematic diagram describing the flux diagram of the maximum theoretical production yield from glucose to GA, which uses the hexokinase transport system, via the carboxylation of phosphoenolpyruvate carboxykinase (PEPCK), phosphoenolpyruvate carboxylase (PPC) or pyruvate carboxylase (PYC), and combines glyoxylate branch (GS) and reverse glyoxylate branch (rGS). The enzyme candidate based on the glyoxylate reductase of the NADPH dependency used is subjected to flux analysis. The flux value is normalized for glucose input.

[0071] Figure 4 Schematic diagram depicting the maximum theoretical production yield of GA from glucose using a transport system of phosphotransferase (PTS), carboxylation by PEPCK, PPC or PYC, and combining GS and rGS. Flux analysis was performed based on enzyme candidates using NADPH-dependent glyoxylate reductase. Flux values ​​were normalized for glucose input. DETAILED DESCRIPTION

[0072] definition

[0073] The following definitions and abbreviations will be used to explain this disclosure.

[0074] As used herein and in the appended claims, the singular forms "a," "an," and "the" include plural referents unless the context clearly dictates otherwise. Thus, for example, reference to "an enzyme" includes a plurality of such enzymes and reference to "the microorganism" includes reference to one or more microorganisms, etc.

[0075] As used herein, the terms "comprises," "comprising," "include," "including," "has," "having," "contain," "containing," or any other variation thereof, are intended to cover a non-exclusive inclusion. A composition, mixture, process, method, article, or apparatus that comprises a list of elements is not necessarily limited to only those elements but may include other elements not expressly listed or inherent to such composition, mixture, process, method, article, or apparatus. In addition, unless expressly stated otherwise, "or" refers to an inclusive "or" and not an exclusive "or."

[0076] The terms "about" and "around" used herein to modify numerical values ​​represent a close range around the explicit value. If "X" is this value, "about X" and "approximately X" will refer to values ​​from 0.9X to 1.1X, or in some embodiments, values ​​from 0.95X to 1.05X. Any reference to "about X" or "approximately X" at least explicitly represents the values ​​X, 0.95X, 0.96X, 0.97X, 0.98X, 0.99X, 1.01X, 1.02X, 1.03X, 1.04X, and 1.05X. Therefore, "about X" and "approximately X" are intended to teach and provide written description support for claim limitations such as "0.98X".

[0077] As used herein, the terms "microbial," "microbial organism," and "microorganism" include any organism that exists as a microscopic cell, which is included within the scope of archaea, bacteria, or eukaryotic organisms, including yeast and filamentous fungi, protozoa, algae, or higher protists. Thus, the term is intended to encompass prokaryotic cells, or eukaryotic cells, or organisms of microscopic size, as well as bacteria, archaea, and eubacteria, including all species, and eukaryotic microorganisms, such as yeast and fungi. Also included are cell cultures of any species that can be cultured for the production of chemicals.

[0078] As described herein, in some embodiments, the recombinant microorganism is a prokaryotic microorganism. In some embodiments, the prokaryotic microorganism is a bacterium. "Bacteria" or "eubacteria" refers to the range of prokaryotes. Bacteria include at least the following eleven different groups: (1) Gram-positive (gram+) bacteria, of which there are two major subdivisions: (1) high G+C group (actinomycetes, mycobacteria, micrococci, etc.), (2) low G+C group (Bacillus, Clostridium, Lactobacillus, Staphylococcus, Streptococcus, Mycoplasma); (2) Proteobacteria, such as purple photosynthetic + non-photosynthetic Gram-negative bacteria (including most "common" Gram-negative bacteria); (3) Cyanobacteria, such as oxygenic phototrophs; (4) Spirochetes and related species; (5) Planctomyces; (6) Bacteroidetes, Flavobacterium; (7) Chlamydia; (8) Green sulfur bacteria; (9) Green non-sulfur bacteria (also anaerobic phototrophs); (10) Radioresistant Micrococcus and its relatives; (11) Thermotoga and Thermosipho thermophiles).

[0079] "Gram-negative bacteria" include cocci, non-enterobacteria and enterobacteria. The genus of gram-negative bacteria includes, for example, Neisseria, Spirillus, Pasteurella, Brucella, Yersinia, Francisella, Haemophilus, Bordetella, Escherichia, Salmonella, Shigella, Klebsiella, Proteus, Vibrio, Pseudomonas, Bacteroides, Acetobacter, Aerobacter, Agrobacterium, Azotobacter, Spirillus, Serratia, Vibrio, Rhizobium, Chlamydia, Rickettsia, Treponema and Fusobacterium.

[0080] "Gram-positive bacteria" include cocci, non-sporing bacilli and sporing bacilli. The genus of Gram-positive bacteria includes, for example, Actinomycetes, Bacillus, Clostridium, Corynebacterium, Erysipelothrix, Lactobacillus, Listeria, Mycobacterium, Myxococcus, Nocardia, Staphylococcus, Streptococcus and Streptomyces.

[0081] The terms "recombinant microorganism" and "recombinant host cell" are used interchangeably herein and refer to a microorganism that has been genetically modified to express or overexpress an endogenous enzyme, to express a heterologous enzyme, such as those contained in a vector, in an integration construct, or those enzymes in which the expression of an endogenous gene is altered. "Altered" refers to the expression of a gene, or the level of an RNA molecule or equivalent RNA molecule encoding one or more polypeptides or polypeptide subunits, or the activity of one or more polypeptides or polypeptide subunits being upregulated or downregulated so that the expression, level, or activity is greater or less than that observed in the absence of the alteration. It should be understood that the terms "recombinant microorganism" and "recombinant host cell" refer not only to a particular recombinant microorganism, but also to the progeny or potential progeny of such a microorganism.

[0082] The term "expression" associated with a gene sequence refers to the transcription of a gene, and where appropriate, the resulting mRNA transcript is translated into a protein. Therefore, it is clear from the context that the expression of a protein is obtained by the transcription and translation of an open reading frame sequence. The expression level of a desired product in a host cell can be determined based on the amount of the corresponding mRNA present in the cell, or the amount of the desired product encoded by the selected sequence. For example, the mRNA transcribed from the selected sequence can be quantified by qRT-PCR or Northern hybridization (see Sambrook et al., Molecular Cloning: A Laboratory Manual, Cold Spring Harbor Laboratory Press (1989)). The protein encoded by the selected sequence can be quantified by various methods, such as by ELISA, by determining the biological activity of the protein, or by using an assay that is not dependent on this activity, such as, Western blot or radioimmunoassay, using antibodies that recognize and bind to the protein. See Sambrook et al., 1989, supra.

[0083] The expression level or enzymatic activity of the term "reducing" or "reducing" gene refers to the expression or enzymatic activity of a gene that is partially or completely inhibited. This expression or active inhibition can be to inhibit gene expression, delete all or part of the promoter region required for gene expression, delete the gene coding region, or replace a wild promoter with a weaker natural or synthetic promoter. For example, the gene can be deleted completely and can be replaced by a selective marker gene to promote identification, separation and purification according to the bacterial strain of the present invention. Alternatively, an endogenous gene can be knocked out or deleted to facilitate new metabolic pathways. In another embodiment, the expression of a gene can be reduced or reduced by using a weak promoter or by introducing some mutations.

[0084] As used herein, the term "non-naturally occurring" when used to refer to a microorganism or enzyme activity of the present disclosure is intended to mean that the microorganism or enzyme has at least one genetic alteration that is not commonly found in strains naturally occurring in a reference species (including wild-type strains of the reference species). Genetic alterations include, for example, modifications that introduce expressible nucleic acids encoding metabolic polypeptides, other nucleic acid additions, nucleic acid deletions, and / or other functional disruptions of microbial genetic material. Such modifications include, for example, coding regions for heterologous, homologous, or heterologous and homologous polypeptides of the reference species and functional fragments thereof. Other modifications include, for example, non-coding regulatory regions, wherein the modification alters the expression of a gene or operon. Exemplary non-naturally occurring microorganisms or enzyme activities include the above-mentioned hydroxylation activities.

[0085] The term "exogenous" as used herein with respect to various molecules (e.g., polynucleotides, polypeptides, enzymes, etc.) refers to molecules that are not normally or naturally found in and / or produced by a given yeast, bacteria, organism, microorganism or cell in nature.

[0086] On the other hand, the terms "endogenous" or "native" as used herein with respect to various molecules, such as polynucleotides, polypeptides, enzymes, etc., refer to molecules that are normally or naturally present in and / or produced by a given yeast, bacteria, organism, microorganism or cell in nature.

[0087] The term "heterologous" as used herein in the context of modifying a host cell refers to various molecules, such as polynucleotides, polypeptides, enzymes, etc., wherein at least one of the following is true: (a) the molecule is foreign ("exogenous") to the host cell (i.e., not naturally present in the host cell); (b) the molecule is naturally present (e.g., "endogenous") in a given host microorganism or host cell, but is produced at a non-natural location in the cell or in a non-natural amount in the cell; and / or (c) the molecule differs from the endogenous nucleotide or amino acid sequence in nucleotide or amino acid sequence, such that the molecule that differs from the endogenous nucleotide or amino acid in nucleotide or amino acid sequence is produced in a non-natural amount (e.g., greater than naturally occurring) in the cell. Heterologous expression of a polynucleotide can be achieved by introducing one or more vectors (e.g., plasmids, cosmids, viral vectors, etc.) comprising a target gene into a host microorganism, or by integrating a construct comprising a target gene into the genome of the host microorganism.

[0088] As used herein, "homologue" of an original enzyme or gene of a first section or species refers to a different enzyme or gene of a second section or species, which is determined to be an enzyme or gene of a second section or species corresponding to the original enzyme or gene of the first section or species by function, structure or genome analysis. Homologues usually have function, structure or genome similarity. The technology of easily cloning homologues of enzymes or genes using gene probes and PCR is known. Functional assays and / or genome mapping of genes can be used to confirm the identity of cloned sequences and homologues.

[0089] If a gene encodes an amino acid sequence that has a similar amino acid sequence to the amino acid sequence encoded by a second gene, then the protein has "homology" with the second protein or is "homologous" to the second protein. Alternatively, if two proteins have "similar" amino acid sequences, then the protein has homology with the second protein. Therefore, the term "homologous proteins" is intended to mean that two proteins have similar amino acid sequences. In some cases, the homology between two proteins indicates that they have a common ancestor that is related in evolution. The term "homologous sequences" or "homologs" are considered, believed or known to be functionally related. Functional relationships can be expressed in any of a variety of ways, including but not limited to: (a) the degree of sequence identity and / or (b) the same or similar biological function. Preferably, both (a) and (b) are referred to. The degree of sequence identity can vary, but in one embodiment, (when using standard sequence alignment programs known in the art) the sequence identity is at least 50%, at least 60%, at least 65%, at least 70%, at least 75%, at least 80%, at least 85%, at least 90%, at least about 91%, at least about 92%, at least about 93%, at least about 94%, at least about 95%, at least about 96%, at least about 97%, at least about 98%, or at least 98.5%, or at least about 99%, or at least 99.5%, or at least 99.8%, or at least 99.9%. Homology can be determined using software programs readily available in the art, such as those discussed in Current Protocols in Molecular Biology (FM Ausubel et al., eds., 1987) Supplement 30, Section 7.718, Table 7.71. Some alignment programs are MacVector (Oxford Molecular Ltd, Oxford, UK) and ALIGN Plus (Scientific and Educational Software, Pennsylvania). Other non-limiting alignment programs include Sequencher (Gene Codes, Ann Arbor, Michigan), AlignX, and Vector NTI (Invitrogen, Carlsbad, California). Similar biological functions may include, but are not limited to: catalyzing the same or similar enzymatic reactions; having the same or similar selectivity for substrates or cofactors; having the same or similar stability; having the same or similar tolerance to various fermentation conditions (temperature, pH, etc.); and / or having the same or similar tolerance to various metabolic substrates, products, by-products, intermediates, etc.The degree of similarity of biological function can vary, but in one embodiment, the degree of similarity of biological function is at least 1%, at least 2%, at least 3%, at least 4%, at least 5%, at least 6%, at least 7%, at least 8%, at least 9%, at least 10%, at least 20%, at least 30%, at least 40%, at least 50%, at least 60%, at least 65%, at least 70%, at least 75%, at least 80%, at least 85%, at least 90%, at least about 91%, at least about 92%, at least about 93%, at least about 94%, at least about 95%, at least about 96%, at least about 97%, at least about 98%, or at least 98.5%, at least about 99%, or at least 99.5%, or at least 99.8%, or at least 99.9% according to one or more assays known to those of skill in the art for determining a given biological function.

[0090] The term "variant" refers to any polypeptide or enzyme as described herein. Variants also include one or more components of a polymer, a polymer comprising a single component, a polymer comprising a plurality of single components (e.g., a polymer of a reference molecule), chemical decomposition products, and biological decomposition products. In a specific non-limiting embodiment, an enzyme may be a "variant" relative to a reference enzyme due to changes in any portion of the polypeptide sequence encoding the reference enzyme. In a standard assay for measuring the enzymatic activity of a reference enzyme preparation, a variant of the reference enzyme may have at least 10%, at least 30%, at least 50%, at least 80%, at least 90%, at least 100%, at least 105%, at least 110%, at least 120%, at least 130% or more enzymatic activity. In some embodiments, variants may also refer to full-length or unprocessed enzymes of the present disclosure having at least 50%, at least 60%, at least 70%, at least 80%, at least 90%, at least 91%, at least 92%, at least 93%, at least 94%, at least 95%, at least 96%, at least 97%, at least 98%, or at least 99% sequence identity. In some embodiments, variants may also refer to mature or processed enzymes of the present disclosure having at least 50%, at least 60%, at least 70%, at least 80%, at least 90%, at least 91%, at least 92%, at least 93%, at least 94%, at least 95%, at least 96%, at least 97%, at least 98%, or at least 99% sequence identity.

[0091] As used herein, the term "yield potential" refers to the yield of a product from a biosynthetic pathway. In one embodiment, the yield potential can be expressed as a percentage of the weight of the final product per weight of the starting compound.

[0092] As used herein, the term "thermodynamic maximum yield" refers to the maximum yield of a product obtained from a given raw material (such as glucose) fermented based on the energy value of the product compared to the raw material. For example, in normal fermentation, if no additional energy source (such as light, hydrogen, or methane, or electricity) is used, the energy contained in the product will not exceed the raw material. Thermodynamic maximum yield represents the product yield of the product in which all energy and mass from the raw material are converted into the product. The yield can be calculated and the yield is independent of the specific pathway. If the yield of the specific pathway of the product is lower than the thermodynamic maximum yield, the specific pathway will lose quality, and it is likely that the specific pathway is improved or replaced by a more efficient product pathway.

[0093] The term "redox balance" refers to the total amount of redox cofactors in a given set of reactions. When redox cofactors are in short supply, the redox balance is negative because raw materials need to be burned to meet the cofactor requirements, and the yield of this pathway will be unrealistic. When redox cofactors are in excess, the redox balance is considered to be positive, and the yield of this pathway is lower than the maximum yield (Dugar et al., "Relative potential of biosynthetic pathways forbiofuels and bio-based products" Nature biotechnology 29.12 (2011): 1074). In addition, when the pathway produces the same amount of redox cofactors as it consumes, the redox balance is zero, and the pathway can be referred to as "redox balance". Compared with unbalanced pathways, designed metabolic pathways and engineered organisms make redox cofactors balanced or close to balance, which usually leads to more efficient and higher yield production of desired compounds. Because two half reactions (one is an oxidation reaction and the other is a reduction reaction) occur simultaneously, redox reactions always occur simultaneously. In the redox process, the reductant transfers electrons to the oxidant. In one embodiment, redox reaction occurs in biological system. The term redox state is generally used to describe the balance of NAD+ / NADH and NADP+ / NADPH of natural or non-natural metabolic pathways in biological system (e.g., microbial cells). Redox state is reflected in the balance of several groups of metabolites (e.g., lactic acid and pyruvic acid, beta-hydroxybutyric acid and acetoacetic acid), and its mutual conversion depends on these ratios. In one embodiment, external hydrogen or electron source is used in combination with or not in combination with hydrogenase that can convert hydrogen into NAD (P) H, it may be beneficial to increase the product yield in metabolic pathways with negative redox balance (i.e., when redox cofactor (e.g., NAD (P) H) is in short supply).

[0094] Background

[0095] The glyoxylate shunt (GS) (also referred to as the glyoxylate cycle) is a variation of the tricarboxylic acid cycle (TCA cycle), an anabolic pathway that occurs in plants, bacteria, protists, and fungi. The TCA cycle differs from the glyoxylate shunt in that, in the glyoxylate shunt, isocitrate is cleaved by isocitrate lyase to glyoxylate and succinate, rather than decarboxylated and dehydrogenated to alpha-ketoglutarate. This bypasses the two decarboxylation steps that occur in the TCA cycle, allowing acetyl-CoA to be converted into TCA cycle intermediates without carbon loss. Glyoxylate is converted into malic acid by incorporating an acetyl-CoA molecule.

[0096] The production of glycolic acid using the glyoxylate shunt (GS) pathway is described in U.S. Patent No. 9,034,615, which is incorporated herein by reference in its entirety. The patent discloses the production of GA by weakening the glyoxylate consumption pathway and increasing the activity of NAD (P) H-dependent glyoxylate reductase. U.S. Patent No. 8,945,888; U.S. Pre-Grant Publication No. 2014 / 0295510; and PCT Publication No. WO 2016 / 193540 also disclose the use of the glyoxylate shunt pathway for the production of glycolic acid, all of which are incorporated herein by reference. However, the glyoxylate shunt pathway has a reduced total yield potential of 0.84 g_GA / g_glucose, while the thermodynamic maximum yield of glucose→GA conversion is 1.70 g / g. This pathway is also not redox balanced, and has a highly excessive 4 mol NADH and 2 mol quinone alcohol for each mole of glucose consumed, all of which require reoxidation to enable cell survival. The overall stoichiometry and yield potential of the pathway can be summarized as follows: Glucose -> 2GA + 2CO 2 +4NADH+2quinols+2ATP; y=0.84g / g, Y(max)=1.70g / g, y is 49% of Y(max).

[0097] The description of producing GA by the approach based on pentose derivatives to glycolaldehyde is found in PCT Publication Nos. WO 2017 / 059236 and WO 2016 / 79440, and U.S. Pre-grant Publication Nos. US2016 / 0076061 and US 2015 / 0147794, the entire contents of which are incorporated herein by reference. However, these approaches also have a reduced overall yield potential. For example, the GA production using xylose as a source has a reduced yield potential of 1.01g_GA / g_xylose, while the thermodynamic maximum yield of xylose→GA conversion is 1.71g / g. The overall stoichiometry and yield potential based on the xylose approach can be summarized as follows: xylose->2GA+1CO 2+3NADH+1quinol+0ATP; y=1.01g / g, Y(max)=1.71g / g, y is 59% of Y(max). As can be seen from this equation, the xylose-based pathway also produces excess NADH and CO 2 .

[0098] PCT Publication No. WO 2015 / 181074 (incorporated herein by reference in its entirety) discloses a method for producing D-erythrose and subsequently converting D-erythrose into glycolaldehyde. Glycolic acid and / or glycine can be further converted into glycolic acid and / or glycine. This pathway has a reduced yield potential of 1.27 g_GA / g_glucose, while the thermodynamic maximum yield is 1.70 g / g. The overall stoichiometry and yield potential based on the erythrose pathway can be summarized as follows: glucose->3GA+2NADH+1quinol-1ATP, y=1.27 g / g, Y(max)=1.70 g / g, y is 75% of Y(max). This pathway is also not redox balanced, and has a highly excessive 2 mol NADH and 1 mol quinol for each mole of glucose consumed, all of which require reoxidation to keep the cells alive.

[0099] The serine / hydroxypyruvate pathway for GA production is described in US Pat. No. 8,911,978, which is incorporated herein by reference in its entirety.

[0100] All of these pathways produce excess NADH and release excess CO 2 , that is, these pathways do not achieve the maximum thermodynamically possible yields. They typically oxidize more sugar carbon to CO than is required. 2 , thereby reducing product yield.

[0101] The application relates to a recombinant microorganism producing glyoxylic acid, which has one or more biosynthetic pathways for the production of glycolic acid (GA) and / or glycine. In one embodiment, the recombinant microorganism producing glyoxylic acid of the present invention comprises a route based on the reverse glyoxylic acid bypass, which increases the productivity of GA and glycine. In another embodiment, the recombinant microorganism producing glyoxylic acid of the present invention comprises a route based on the reverse glyoxylic acid bypass described previously for the production of GA and / or glycine and modifications and further increases the productivity of GA and glycine. The terms "glycolic acid" and "glycolate" are used interchangeably throughout the disclosure.

[0102] Some patent documents disclose reverse glyoxylate shunt pathways. For example, U.S. Patent No. 9,410,131 discloses a reverse glyoxylate shunt pathway for producing oxaloacetic acid and malonyl-CoA. U.S. Pre-grant Publication No. 2016 / 369292 discloses the use of a reverse glyoxylate shunt for producing isocitrate and acetyl-CoA. EP Patent No. 2738247B1 discloses the use of a reverse glyoxylate shunt for producing acetyl-CoA. However, none of these patent documents discloses a reverse glyoxylate shunt for increasing the production of glyoxylate and subsequently increasing the production of glycolic acid and / or glycine. In addition, none of these patent documents discloses a reverse glyoxylate shunt, in which the acetyl-CoA generated by the activity of malyl-CoA lyase is reincorporated into a metabolic pathway (e.g., by producing citric acid in combination with oxaloacetic acid in the glyoxylate shunt), for increasing the production of glycolic acid and / or glycine.

[0103] The present disclosure provides for the first time a carbon fixation route for GA or glycine production, making it applicable to most current CO 2 By providing a suitable common pathway, the present disclosure solves the problem of excess NADH in all glycolate (GA) and glycine pathways described to date, and is able to achieve higher GA and glycine yields than previously described individual pathways (including the recently published high-yield pathway using xylose).

[0104] The present disclosure provides for the first time a reverse glyoxylate shunt pathway utilizing carboxylation reactions for the production of GA and glycine. None of the GA or glycine production pathways described to date utilize carboxylation reactions to synthesize GA or glycine.

[0105] In certain embodiments, the carboxylation-based reverse glyoxylate shunt pathways of the present disclosure can be used in conjunction with known GA or glycine production pathways.

[0106] The present disclosure includes the use of homologs of the genes described herein, and / or enzymes encoded by these genes, as well as natural variants, or engineered variants.

[0107] Microorganisms, approaches and methods of the invention

[0108] In one embodiment, the present invention provides a recombinant microorganism for producing glyoxylic acid, which uses a reverse glyoxylic acid bypass pathway to produce glycolic acid and / or glycine from glyoxylic acid. The expression of the reverse glyoxylic acid bypass pathway increases the production of glyoxylic acid as an intermediate and increases the production of end products glycolic acid and glycine. In some embodiments, the recombinant microorganism for producing glyoxylic acid of the present invention co-produces glycolic acid and glycine. In another embodiment, the recombinant microorganism for producing glyoxylic acid of the present invention co-produces glycolic acid and another byproduct, such as, but not limited to succinic acid or lactic acid. In yet another embodiment, the recombinant microorganism for producing glyoxylic acid of the present invention co-produces glycine and another byproduct, such as, but not limited to succinic acid or lactic acid.

[0109] In some embodiments, the present disclosure provides a recombinant microorganism that produces glyoxylate for synthesizing glycolate and / or glycine, wherein the microorganism comprises: (a) a gene encoding a pyruvate carboxylase that catalyzes the conversion of pyruvate to oxaloacetate (OAA), and / or a gene encoding a phosphoenolpyruvate carboxylase that catalyzes the conversion of phosphoenolpyruvate to OAA, and / or a gene encoding a phosphoenolpyruvate carboxykinase that catalyzes the conversion of phosphoenolpyruvate to OAA; (b) a gene encoding a malate thiokinase that catalyzes the conversion of malate to malyl-CoA; and (c) a gene encoding a malyl-CoA lyase that catalyzes the conversion of malyl-CoA to glyoxylate and acetyl-CoA, wherein the acetyl-CoA produced by the malyl-CoA lyase is combined with OAA to increase the biosynthesis of GA and / or glycine.

[0110] In some embodiments, the present disclosure provides a recombinant microorganism for producing glyoxylate for synthesizing glycolate and / or glycine, wherein the microorganism comprises: (a) a gene encoding a pyruvate carboxylase that catalyzes the conversion of pyruvate to oxaloacetate (OAA), and / or a gene encoding a phosphoenolpyruvate carboxylase that catalyzes the conversion of phosphoenolpyruvate to OAA, and / or a gene encoding a phosphoenolpyruvate carboxykinase that catalyzes the conversion of phosphoenolpyruvate to OAA; (b) a gene encoding a malate thiokinase that catalyzes the conversion of malate to malyl-CoA; (c) a gene encoding a malyl-CoA lyase that catalyzes the conversion of malyl-CoA to glyoxylate and acetyl-CoA, wherein the acetyl-CoA produced by the malyl-CoA lyase is combined with OAA to increase the biosynthesis of GA and / or glycine. In these embodiments, the recombinant microorganism has reduced phosphoglucose isomerase activity, or more preferably does not catalyze the conversion of glucose-6-phosphate to fructose-6-phosphate by the enzyme phosphoglucose isomerase. In addition, the recombinant microorganism may or may not contain overexpressed endogenous or exogenous enzymes: citrate synthase, isocitrate lyase and / or glyoxylate reductase. By reducing the activity of phosphoglucose isomerase, or more preferably by deleting the gene encoding phosphoglucose isomerase (e.g., gene pgi in E. coli), the enzyme catalyzes the conversion of glucose-6-phosphate to fructose-6-phosphate, the carbon source can be at least partially diverted to the pentose-phosphate pathway (PPP) to provide additional NADPH that may be required for optimal conversion of glyoxylate to glycolate. In some embodiments, by using the carboxylase and carboxykinase suggested herein, it is possible to reincorporate CO generated by the PPP route. 2 .

[0111] In one embodiment, the disclosed reverse glyoxylate shunt-based pathway includes carboxylating pyruvate to malate; converting malate to malyl-CoA (CoA) and converting malyl-CoA to glyoxylate and acetyl-CoA. Therefore, in one embodiment, a recombinant microorganism is provided herein, comprising a gene encoding a malate dehydrogenase that converts pyruvate to malate, a gene encoding a malate thiokinase that converts malate to malyl-CoA, and a gene encoding a malyl-CoA lyase that converts malyl-CoA to glyoxylate and acetyl-CoA. In one embodiment, the gene encoding malate dehydrogenase encodes a modified malate dehydrogenase that catalyzes the conversion of pyruvate to malate, but does not catalyze the reverse reaction of malate to pyruvate or shows a reduced conversion of malate to pyruvate. In some embodiments, the gene encoding malate dehydrogenase may include a deletion or loss-of-function mutation. The modified malate dehydrogenase may be a naturally occurring variant or an engineered variant.

[0112] In another embodiment, the reverse glyoxylate shunt-based pathway of the present disclosure includes carboxylating phosphoenolpyruvate (PEP) and / or pyruvate to oxaloacetate (OAA); converting OAA to malate; converting malate to malyl-CoA (CoA), and converting malyl-CoA to glyoxylate and acetyl-CoA. Thus, in one embodiment, provided herein is a recombinant microorganism comprising the following genes: a gene encoding a pyruvate carboxylase that converts pyruvate to OAA, and / or a gene encoding a phosphoenolpyruvate carboxylase that converts phosphoenolpyruvate to OAA, and / or a gene encoding a phosphoenolpyruvate carboxykinase that converts phosphoenolpyruvate to OAA in combination with a gene encoding a malate dehydrogenase (which catalyzes the conversion of OAA to malate), a gene encoding a malate thiokinase that converts malate to malyl-CoA, and a gene encoding a malyl-CoA lyase that converts malyl-CoA to glyoxylate and acetyl-CoA.

[0113] In another embodiment, the reverse glyoxylate shunt-based pathway of the present disclosure comprises carboxylating phosphoenolpyruvate (PEP) or pyruvate to oxaloacetate (OAA), and / or carboxylating pyruvate to malate; converting OAA to malate; converting malate to malyl-CoA (CoA), and converting malyl-CoA to glyoxylate and acetyl-CoA. Thus, in one embodiment, provided herein is a recombinant microorganism comprising the following genes: a gene encoding a pyruvate carboxylase that converts pyruvate into OAA, and / or a gene encoding a phosphoenolpyruvate carboxylase that converts phosphoenolpyruvate into OAA, and / or a gene encoding a phosphoenolpyruvate carboxykinase that converts phosphoenolpyruvate into OAA; and / or a gene encoding a malate dehydrogenase that catalyzes the conversion of pyruvate into malate; and / or a gene encoding a malate dehydrogenase that catalyzes the conversion of OAA into malate; a gene encoding a malate thiokinase that converts malate into malyl-CoA; and a gene encoding a malyl-CoA lyase that converts malyl-CoA into glyoxylate and acetyl-CoA. In one embodiment, the gene encoding malate dehydrogenase encodes a modified malate dehydrogenase that catalyzes the conversion of pyruvate to malate, or OAA to malate, but does not catalyze the reverse reaction of malate to pyruvate, or malate to OAA, or shows reduced conversion of malate to pyruvate or malate to OAA. The modified malate dehydrogenase may be a naturally occurring variant, or an engineered variant.

[0114] In another embodiment, the reverse glyoxylate shunt based pathway of the present disclosure comprises carboxylating phosphoenolpyruvate (PEP) and / or pyruvate to oxaloacetate (OAA); converting malate to malyl-CoA (CoA) and converting malyl-CoA to glyoxylate and acetyl-CoA; wherein the reverse glyoxylate shunt pathway does not include converting OAA to malate. Thus, in one embodiment, provided herein is a recombinant microorganism comprising the following genes: a gene encoding a pyruvate carboxylase that converts pyruvate into OAA, and / or a gene encoding a phosphoenolpyruvate carboxylase that converts phosphoenolpyruvate into OAA, and / or a gene encoding a phosphoenolpyruvate carboxylase that converts phosphoenolpyruvate into OAA; a gene encoding a malate thiokinase that converts malate into malyl-CoA, and a gene encoding a malyl-CoA lyase that converts malyl-CoA into glyoxylate and acetyl-CoA, wherein the microorganism does not comprise a gene encoding a malate dehydrogenase that catalyzes the conversion of OAA into malate, or comprises a loss-of-function mutation in a gene encoding a malate dehydrogenase that catalyzes the conversion of OAA into malate.

[0115] In another embodiment, the reverse glyoxylate shunt based pathway of the present disclosure comprises carboxylating phosphoenolpyruvate (PEP) and / or pyruvate to oxaloacetate (OAA); carboxylating pyruvate to malate; converting malate to malyl-CoA (CoA) and converting malyl-CoA to glyoxylate and acetyl-CoA; wherein the reverse glyoxylate shunt pathway does not comprise converting OAA to malate. Thus, in one embodiment, provided herein is a recombinant microorganism comprising the following genes: a gene encoding a pyruvate carboxylase that converts pyruvate into OAA, and / or a gene encoding a phosphoenolpyruvate carboxylase that converts phosphoenolpyruvate into OAA, and / or a gene encoding a phosphoenolpyruvate carboxykinase that converts phosphoenolpyruvate into OAA; a gene encoding a malate dehydrogenase that catalyzes the conversion of pyruvate into malate; a gene encoding a malate thiokinase that converts malate into malyl-CoA, and a gene encoding a malyl-CoA lyase that converts malyl-CoA into glyoxylate and acetyl-CoA, wherein the microorganism does not comprise a gene encoding a malate dehydrogenase that catalyzes the conversion of OAA into malate, or comprises a loss-of-function mutation in a gene encoding a malate dehydrogenase that catalyzes the conversion of OAA into malate.

[0116] The glyoxylate produced by the reverse glyoxylate shunt and other pathways can be converted into glycolic acid and / or glycine. In order to increase the production of GA, the recombinant microorganism of any one of the embodiments disclosed herein may include a gene encoding a glyoxylate reductase that is NAD(P)H dependent, which catalyzes the conversion of glyoxylate into glycolic acid. In one embodiment, the recombinant microorganism may overexpress a glyoxylate reductase that is NAD(P)H dependent to increase the yield of GA. In another embodiment, the recombinant microorganism of any one of the embodiments disclosed herein may include a gain-of-function mutation in a gene encoding a glyoxylate reductase that is NAD(P)H dependent, so that the glyoxylate reductase activity of NAD(P)H dependent is increased compared to a microorganism lacking the mutation.

[0117] As used herein, the term "NAD(P)H-dependent" includes both NADH-dependent and NADPH-dependent enzyme activities.

[0118] In order to increase the production of glycine, any one of the recombinant microorganisms in the embodiments disclosed herein may include one or more genes encoding the enzyme that catalyzes glyoxylic acid to glycine conversion. For example, any one of the recombinant microorganisms in the embodiments disclosed herein may include the following genes: the gene encoding alanine-glyoxylate aminotransferase, the gene encoding glycine dehydrogenase, the gene encoding glycine aminotransferase, the gene encoding serine-glyoxylate aminotransferase, and / or the gene encoding glycine oxidase. In one embodiment, any one of the recombinant microorganisms in the embodiments disclosed herein may overexpress one or more of these genes to increase the productivity of glycine. In another embodiment, any one of the recombinant microorganisms in the embodiments disclosed herein may be included in the gene of one or more of the above-mentioned encodings producing the enzyme of glycine, so that the activity of these genes is increased compared to the microorganism lacking the mutation.

[0119] In one embodiment, the recombinant microorganism of the present disclosure does not produce malonyl-CoA via the rGS pathway.

[0120] The recombinant microorganism of the present invention comprises a gene encoding a malate dehydrogenase, which catalyzes the carboxylation of pyruvate to malate and / or catalyzes the reduction of OAA to malate. In one embodiment, the malate dehydrogenase that catalyzes the conversion of OAA to malate is from, but is not limited to, enzyme class (EC) 1.1.1.37. In another embodiment, the malate dehydrogenase that catalyzes the conversion of malate to OAA is from EC 1.1.5.4. The malate dehydrogenase that catalyzes the conversion of malate to OAA is also referred to as malate:quinol oxidoreductase. In certain embodiments, the malate dehydrogenase that catalyzes the carboxylation of pyruvate to malate is from, but is not limited to, enzyme class (EC) 1.1.1.38, EC 1.1.1.39, or EC 1.1.1.40.

[0121] In one embodiment, the recombinant microorganism of the present disclosure may include a gene encoding a malate dehydrogenase, wherein the malate dehydrogenase can catalyze the conversion of pyruvate to malate and / or catalyze the conversion of OAA to malate, but does not catalyze the reverse reaction of malate to pyruvate or malate to OAA, or catalyzes the reverse reaction but with reduced effect. In one embodiment, the recombinant microorganism of the present disclosure includes a gene encoding a malate dehydrogenase, wherein the malate dehydrogenase can catalyze the conversion of oxaloacetate to malate, but not the conversion of pyruvate to malate, or the conversion of malate to pyruvate. In one embodiment, the gene encoding a malate dehydrogenase may include a mutation that causes partial or complete inhibition of malate dehydrogenase activity, wherein the malate dehydrogenase activity catalyzes the conversion of oxaloacetate to malate, or the conversion of malate to oxaloacetate, or the conversion of pyruvate to malate, or the conversion of malate to pyruvate.

[0122] In an exemplary embodiment, the gene encoding malate dehydrogenase that catalyzes the carboxylation of pyruvate to malate is from, but is not limited to, bacteria such as Escherichia (e.g., gene maeA or maeB from Escherichia coli), Pseudomonas, Bacillus (e.g., gene maeA from Bacillus subtilis), Rhizobium (e.g., gene dme from R. melilote), Mycobacterium (e.g., gene mez from Mycobacterium tuberculosis), Salmonella (e.g., gene maeB from; or from yeast, for example (e.g., gene mae1 from Saccharomyces cerevisiae); or from plants (e.g., genes nad-me1, or nad-me2, or nad-me3, or nadp-me1, or nadp-me2 from Arabidopsis thaliana).

[0123] In an exemplary embodiment, the gene encoding the malate dehydrogenase that catalyzes the conversion of oxaloacetate to malate is from, but not limited to, bacteria such as Escherichia (e.g., gene mdh from Escherichia coli), Corynebacterium, Streptomyces (e.g., gene mdh from S. coelicolor); or from yeast, such as yeast (e.g., gene mdh1 / 2 / 3 from Saccharomyces cerevisiae); or from plants, such as Arabidopsis thaliana. In another embodiment, the gene encoding the malate dehydrogenase that catalyzes the conversion of malate to oxaloacetate (also known as malate:quinol oxidoreductase) is from, but not limited to, Escherichia (e.g., gene mqo from Escherichia coli), Pseudomonas (e.g., gene mqo from Pseudomonas putida) or Bacillus.

[0124] Malate is converted to malyl-CoA by malate thiokinase activity (also known as malate-CoA ligase or malyl-CoA synthetase), or by succinyl-CoA ligase activity (also known as succinyl-CoA synthetase). In one embodiment, the malate thiokinase is from, but not limited to, EC 6.2.1.4, EC 6.2.1.5, EC 6.2.1.9 or EC 6.2.1.-. In an exemplary embodiment, the gene encoding malate thiokinase or sucyl-CoA ligase is from a bacterium, such as Escherichia (e.g., gene sucCD-2 from E. coli), Thermus thermophiles, Clostridium kluyveri, Bacillus subtilis, Methanocaldococcus (e.g., gene mtkAB or sucCD from M. jannaschii), Staphylococcus aureus, Methanothermobacter thermautotrophicus, Pseudomonas, Methylococcus sp., Methylobacterium (e.g., gene mtkAB or sucCD from M. extorquens), Nitrosomonas europaea, Granulibacter besselsden (Gen. bethesdensis, Mesorhizobium japonicum, Hyphomicrobiummethylovorum, Hyphomicrobium denitrificans, Methylococcus capsulatus, Rhodobacteraceae bacterium or Rhizobium. In one embodiment, the malate thiokinase or succinyl-CoA ligase has high activity and / or high specificity for malate, and low activity and / or low specificity for other compounds such as succinate. This can be achieved by enzyme engineering.

[0125] Malyl-CoA is converted to glyoxylate and acetyl-CoA by malyl-CoA lyase. In one embodiment, the malyl-CoA lyase is from, but not limited to, EC 4.1.3.24 or EC 4.1.3.25. In an exemplary embodiment, the gene encoding the malyl-CoA lyase is from Methylobacterium (e.g., gene mclA from Methylobacter extorquens), Methylobacter extorquens, Thalassobius activus, Rhodobacter (e.g., gene mcl1 from R. sphaeroides), Roseobacter litoralis, Streptomyces, Streptococcus, Mycobacterium (e.g., gene mcl1 from M. smegmatis), Hyphomicrobium methylovorum, Roseobacter (e.g., gene mcl1 from R. litoralis), Nitrosomonas europaea, Cupriavidus necator), Chloroflexus (e.g., gene mcl from C. aurantiacus), Nereida (e.g., gene mcl1 from N. ignava), Hyphomicrobium denitrificans, Rhodococcus fascians.

[0126] PEP is carboxylated to oxaloacetate by phosphoenolpyruvate carboxylase or phosphoenolpyruvate carboxykinase. In one embodiment, the PEP carboxylase is from, but not limited to, EC 4.1.1.31. In an exemplary embodiment, the gene encoding PEP carboxylase is from, but is not limited to, bacteria, such as Escherichia (e.g., gene ppc from Escherichia coli), Rhodothermus (e.g., gene ppc or pepC from R. marinus), Corynebacterium, Salmonella, Hyphomicrobium, Streptococcus, Streptomyces, Pantoea, Bacillus, Clostridium, Pseudomonas, Rhodopseudomonas, Methanothermobacter (e.g., gene ppcA from Methanothermobacter thermoautotrophicum); plants, such as Saccharum hybrid, glycine (e.g., gene ppc from G. max), Nicotiana tabacum, Amaranthus hypochondriacus), Triticum aestivum, Medicago sativa, Zea mays (e.g., gene pep1), or Arabidopsis thaliana (e.g., gene ppc1, ppc2, or ppc3 from A. thaliana); Archaea or yeast. In one embodiment, the phosphoenolpyruvate carboxykinase is from, but is not limited to, EC 4.1.1.32 or EC 4.1.1.49.In an exemplary embodiment, the gene encoding the PEP carboxykinase is from, but is not limited to, bacteria, such as Escherichia (e.g., gene pck or pckA from Escherichia coli), Selenomonas (e.g., gene pckA from S. ruminantium), Salmonella (e.g., gene pckA from S. typhimurium), Mycobacterium, Pseudomonas, Rhodopseudomonas, Clostridium, Thermococcus, Streptococcus (e.g., gene pck or pckA from S. bovis), Ruminococcus (e.g., gene pck or pckA from R. albus and R. flavefaciens), Actinobacillus (e.g., gene pckA from A. succinogenes), Bacillus, Ruminiclostridium thermocellum, Klebsiella, Thermus; yeast, such as Saccharomyces (e.g., gene pck1 or pepc or ppc1 from Saccharomyces cerevisiae); or Trypanosoma (e.g., gene from T. brucei).

[0127] The carboxylation of pyruvate to oxaloacetate is catalyzed by pyruvate carboxylase. In one embodiment, the pyruvate carboxylase is from, but not limited to EC 6.4.1.1. In an exemplary embodiment, the gene encoding the pyruvate carboxylase is from bacteria, such as Bacillus (e.g., gene pyc from Bacillus subtilis (B.subtilis)), Candida (e.g., gene pyc1 from Candida glabrata (C.glabrata)), Cupriavidus (e.g., gene pyc1 from C.necator), Mycobacterium (e.g., gene pyc from Mycobacterium smegmatis (M.smegmatis)), Corynebacterium (e.g., gene pyc from Glycyrrhiza glabrata (Glycyrrhiza glabrata (Glycyrrhiza glabrata (Glycyrrhiza glabrata)), glyciniphilum), Nocardia (e.g., gene pyc1 from N.nova); or yeast, such as Saccharomyces (e.g., genes pyc1 and pyc2 from Saccharomyces cerevisiae), Pichia (e.g., pyc from P.pastoris); or Caenorhabditis (e.g., pyc from C.elegans); or from Homo sapiens.

[0128] NADH glyoxylate reductase or NADPH glyoxylate reductase can reduce glyoxylate to produce glycolic acid. In one embodiment, NADH glyoxylate reductase is from EC 1.1.1.26. In one embodiment, NADPH glyoxylate reductase is from EC 1.1.1.79. In an exemplary embodiment, the gene encoding the glyoxylate reductase activity of NADH or NADPH dependence is the gene "ycdW / ghrA" and / or "yiaE" in Escherichia coli, the gene "GLYR1" from Arabidopsis thaliana, the gene "GOR1" from Saccharomyces cerevisiae, and the "gyaR" from Thermococcus litoralis. In some embodiments, the cofactor preference (NADH or NADPH) of the enzyme can be changed by enzyme engineering. In some embodiments, the enzyme NADPH-dependent glyoxylate reductase encoded by the genes "ycdW / ghrA" or "yiaE" from Escherichia coli, or "GLYR1" from Arabidopsis thaliana, is engineered to become a NADH-dependent glyoxylate reductase, which accepts NADH as well as the cofactor NADPH accepted by the native enzyme, and which still exhibits the same glyoxylate to glycolate conversion performance (i.e., converts the cofactor without compromising its kinetic parameters in the desired reaction).

[0129] In one embodiment, the production of glyoxylate and ultimately glycolate and / or glycine can be increased by co-utilizing the rGS pathway with the glyoxylate shunt (GS) pathway. For example, acetyl-CoA produced in the rGS pathway (i.e., acetyl-CoA produced by the activity of malyl-CoA lyase on malyl-CoA) can be reincorporated into metabolic pathways to further increase the production of glyoxylate: i.e., by entering the GS pathway to produce citric acid in combination with OAA, which is converted to isocitrate, which is converted to succinate and glyoxylate. Succinate produced by the GS pathway can be converted to malate via fumarate, and malate produced by this pathway can enter the rGS pathway, where it is converted to malyl-CoA, which is further converted to glyoxylate and acetyl-CoA.

[0130] In the recombinant microorganism of the present invention, the rGS pathway may be run first and then the GS pathway, or the GS pathway may be run first and then the rGS pathway.

[0131] In one embodiment of the co-utilization of the rGS and GS pathways, PEP can be converted to OAA (PEP carboxylase or PEP carboxykinase) and / or pyruvate can be converted to OAA (pyruvate carboxylase) or to malate (malate dehydrogenase); OAA can be converted to malate (malate dehydrogenase); malate can be converted to malyl-CoA (malate thiokinase); malyl-CoA can be converted to glyoxylate and acetyl-CoA (malyl-CoA lyase); acetyl-CoA can combine with OAA to form citrate (citrate synthase); citrate can be converted to aconitic acid (citrate hydrolase); aconitic acid can be converted to isocitrate (D-threoisocitrate hydrolase or aconitase); isocitrate can be converted to succinate and glyoxylate (isocitrate lyase); succinate can be converted to fumarate (succinate dehydrogenase); and fumarate can be converted to malate (fumarase). Malate can re-enter the rGS pathway and can be converted to malyl-CoA.

[0132] In another embodiment of the co-utilization of the rGS and GS pathways, PEP can be converted to OAA (PEP carboxylase or PEP carboxykinase) and / or pyruvate can be converted to OAA (pyruvate carboxylase) or to malate (malate dehydrogenase); OAA can be converted to citrate by combination with acetyl-CoA (citrate synthase); citrate can be converted to aconitate (citrate hydrolase); aconitate can be converted to isocitrate (D-threoisocitrate hydrolase or aconitase); isocitrate can be converted to succinate and glyoxylate (isocitrate lyase); succinate can be converted to fumarate (succinate dehydrogenase); fumarate can be converted to malate (fumarase); and malate can be converted to malyl-CoA (malate thiokinase), and malyl-CoA can be converted to glyoxylate and acetyl-CoA. In this embodiment, OAA may be combined exclusively with acetyl-CoA to form citrate (ie, by blocking the conversion of OAA to malate, e.g., inactivating malate dehydrogenase that catalyzes the conversion of OAA to malate), or a portion of it may be converted to malate.

[0133] The recombinant microorganism in any of the embodiments disclosed herein may comprise genes encoding enzymes involved in the GS pathway. In one embodiment, the recombinant microorganism comprises (a) a gene encoding a citrate synthase that converts acetyl-CoA and OAA into citric acid; (b) a gene encoding a citrate hydrolase that converts citric acid into aconitic acid; (c) a gene encoding a D-threoisocitrate hydrolase or aconitase that converts aconitic acid into isocitrate; (d) a gene encoding an isocitrate lyase that converts isocitrate into succinate and glyoxylate; (e) a gene encoding a succinate dehydrogenase that converts succinate into fumarate; and (f) a gene encoding a fumarase that converts fumarate into malate.

[0134] Glyoxylate produced by the GS and rGS pathways can be converted to malate by malate synthase. However, this reaction reduces the yield of glyoxylate, thereby reducing the production of GA and glycine. Therefore, in one embodiment, the recombinant microorganism described herein may include a loss-of-function mutation in a gene encoding malate synthase. A loss-of-function mutation as referred to herein may result in a complete or partial loss of function. A loss-of-function mutation may also include a complete deletion of the target gene. In an exemplary embodiment, genes encoding malate synthase that may be inactivated according to the present disclosure include aceB and / or glcB in Escherichia coli or DAL7 and MLS1 in Saccharomyces cerevisiae.

[0135] In one embodiment, depending on the amount of excess NADH in a given pathway, the flux ratio of co-utilized rGS and GS is adjusted to obtain the lowest possible net NADH production corresponding to the optimal yield.

[0136] One or more genes encoding target enzymes disclosed herein can be endogenous, can be inserted into the genome of a microorganism and / or expressed by one or more vectors (e.g., plasmids, cosmids, viral vectors, etc.) introduced into a microorganism. A high level of enzymatic activity can be obtained by using or inserting a copy of one or more genes on the genome, and a copy of the one or more genes can be introduced into the genome by a recombination method known to those of ordinary skill in the art. In order to express by a vector, different types of vectors can be used, such as plasmids with different replication origins and therefore different copy numbers in cells. Exemplary plasmids for expressing target genes include, but are not limited to, pSK bluescript II, pSC101, RK2, pACYC, pRSF1010, etc.). Genes encoding enzymatic polypeptides can be expressed using promoters with different strengths, which may or may not be induced by inducing molecules. Examples of promoters include Ptrc, Ptac, Plac, lambda promoter cI or other promoters known to those of ordinary skill in the art. The expression of a gene can also be enhanced by elements which stabilize the corresponding messenger RNA (Carrier and Keasling (1998) Biotechnol. Prog. 15, 58-64) or proteins (eg, GST tag, Amersham Biosciences).

[0137] In one embodiment, the endogenous glyoxylate shunt (GS) pathway and / or other central metabolic pathways in a recombinant microorganism can be modified, for example, by avoiding competing routes or byproduct formation, and bypassing carbon loss reactions to maximize carbon influx to biosynthesis of glycolate and / or glycine via the reverse glyoxylate shunt. For example, in one embodiment, a recombinant microorganism comprising a rGS pathway can be modified to delete or attenuate the expression of at least one gene encoding an enzyme selected from:

[0138] (a) malate synthase (e.g., genes aceB and / or glcB in Escherichia coli or genes DAL7 and MLS1 in Saccharomyces cerevisiae);

[0139] (b) isocitrate dehydrogenase (e.g., gene icd in Escherichia coli or genes IDP2 and IDH1 / 2 in Saccharomyces cerevisiae);

[0140] (c) pyruvate dehydrogenase (e.g., gene pdhc and / or lpd in E. coli), pyruvate oxidase (e.g., gene poxB in E. coli) and / or pyruvate formate lyase (e.g., gene pfl in E. coli); and

[0141] (d) Pyruvate kinase (eg, genes pykA and / or pykF in E. coli).

[0142] In some embodiments, the endogenous glyoxylate consumption route in the recombinant microorganism comprising the rGS pathway can be deleted or attenuated to further increase the yield of glycolate and / or glycine. For example, in one embodiment, the recombinant microorganism comprising the rGS pathway is modified to delete or attenuate the expression of, or inhibit the activity of, at least one gene selected from:

[0143] (a) a gene encoding glyoxylate-aldehyde ligase (carboligase) (e.g., gene gcl in Escherichia coli);

[0144] (b) a gene encoding 2-oxo-4-hydroxyglutarate aldolase (e.g., edA in Escherichia coli);

[0145] (c) a gene encoding glycolaldehyde reductase (e.g., genes fucO and / or gldA in Escherichia coli);

[0146] (d) genes encoding glycolate oxidase (e.g., genes glcD, glcE, glcF, and glcG in Escherichia coli);

[0147] (e) a gene encoding an isocitrate lyase repressor (e.g., the gene iclR in E. coli); and

[0148] (f) A gene encoding glucose-6-phosphate isomerase (eg, gene pgi in Escherichia coli).

[0149] Gene expression can be weakened or the activity of the enzyme encoded by the gene can be inhibited by introducing a mutation that reduces the activity of the corresponding enzyme into the gene, or by replacing the natural promoter with a low-strength promoter, or by using an agent that makes the corresponding messenger RNA or protein unstable. Gene expression can be weakened or the activity of the enzyme encoded by the gene can be inhibited by deleting the corresponding gene from the microorganism using techniques known in the art.

[0150] In one embodiment, a recombinant microorganism of the present disclosure expresses a set of genes encoding:

[0151] (a) malate dehydrogenase catalyzes the conversion of pyruvate into malate;

[0152] (b) malate thiokinase which catalyzes the conversion of malate into malyl-CoA; and

[0153] (c) malyl-CoA lyase that catalyzes the conversion of malyl-CoA into glyoxylate and acetyl-CoA;

[0154] (d) optionally a phosphoenolpyruvate carboxylase that catalyzes the conversion of PEP into oxaloacetate, and / or a phosphoenolpyruvate carboxykinase that catalyzes the conversion of PEP into oxaloacetate, and / or a pyruvate carboxylase that catalyzes the conversion of pyruvate into oxaloacetate;

[0155] and comprising at least one modification selected from the group consisting of:

[0156] (a) deleting or weakening the gene encoding malate synthase;

[0157] (b) deleting or weakening the gene encoding isocitrate dehydrogenase;

[0158] (c) deleting or attenuating genes encoding pyruvate dehydrogenase, pyruvate oxidase and / or pyruvate formate lyase;

[0159] (d) deleting or attenuating a gene encoding malate dehydrogenase, which catalyzes the conversion of oxaloacetate to malate, or malate to oxaloacetate (malate:quinol oxidoreductase); and

[0160] (e) Deletion or attenuation of the gene encoding pyruvate kinase.

[0161] In another embodiment, the recombinant microorganism of the present disclosure expresses a set of genes encoding:

[0162] (a) a phosphoenolpyruvate carboxylase that catalyzes the conversion of PEP into oxaloacetate, and / or a phosphoenolpyruvate carboxykinase that catalyzes the conversion of PEP into oxaloacetate, and / or a pyruvate carboxylase that catalyzes the conversion of pyruvate into oxaloacetate, and / or a malate dehydrogenase that catalyzes the conversion of pyruvate into malate;

[0163] (b) malate thiokinase;

[0164] (c) malyl-CoA lyase; and

[0165] (d) optionally, a malate dehydrogenase that catalyzes the conversion of oxaloacetate into malate;

[0166] and comprising at least one modification selected from the group consisting of:

[0167] (a) deleting or weakening the gene encoding malate synthase;

[0168] (b) deleting or weakening the gene encoding isocitrate dehydrogenase;

[0169] (c) deleting or attenuating genes encoding pyruvate dehydrogenase, pyruvate oxidase, and / or pyruvate formate lyase;

[0170] (d) deleting or attenuating a gene encoding malate dehydrogenase that catalyzes the conversion of malate into pyruvate; and

[0171] (e) Deletion or attenuation of the gene encoding pyruvate kinase.

[0172] In one embodiment, a recombinant microorganism comprising an rGS pathway expresses a set of genes encoding:

[0173] (a) malate dehydrogenase catalyzes the conversion of pyruvate into malate;

[0174] (b) malate thiokinase which catalyzes the conversion of malate into malyl-CoA; and

[0175] (c) malyl-CoA lyase that catalyzes the conversion of malyl-CoA into glyoxylate and acetyl-CoA;

[0176] (d) optionally a phosphoenolpyruvate carboxylase that catalyzes the conversion of PEP into oxaloacetate, and / or a phosphoenolpyruvate carboxykinase that catalyzes the conversion of PEP into oxaloacetate, and / or a pyruvate carboxylase that catalyzes the conversion of pyruvate into oxaloacetate;

[0177] and comprising at least one modification selected from the group consisting of:

[0178] (a) deleting or weakening the gene encoding malate synthase;

[0179] (b) deleting or weakening the gene encoding isocitrate dehydrogenase;

[0180] (c) deleting or attenuating genes encoding pyruvate dehydrogenase, pyruvate oxidase and / or pyruvate formate lyase;

[0181] (d) deleting or attenuating a gene encoding malate dehydrogenase, which catalyzes the conversion of oxaloacetate into malate, or vice versa;

[0182] (e) deleting or attenuating the gene encoding pyruvate kinase;

[0183] (f) deleting or attenuating the gene encoding glyoxylate-aldehyde ligase;

[0184] (g) deleting or weakening the gene encoding 2-oxo-4-hydroxyglutarate aldolase;

[0185] (h) deleting or attenuating the gene encoding glycolaldehyde reductase;

[0186] (i) deleting or attenuating the gene encoding glycolate oxidase; and

[0187] (j) Deleting or attenuating the gene encoding the repressor of isocitrate lyase.

[0188] In one embodiment, the overall stoichiometry of glycolate produced using the rGS pathway and / or modifications in one or more of the genes described above is: glucose + 2CO 2 ->2GA+2 acetyl-CoA-2NAD(P)H-2ATP. In another embodiment, the total stoichiometry of glycolate produced using the rGS pathway and / or modifications in one or more of the above genes is: glucose + 2CO 2 +2NAD(P)H+2ATP->4GA+2quinol.

[0189] Redox balance is important for fine-tuning metabolic pathways to achieve maximum product yield potential. Imbalances in redox states (e.g., imbalances in NADPH and NADH cofactors pooled in the cell, imbalanced net ATP, and / or lack of reductants) can result in lower product yields and produce unwanted byproducts. The present disclosure includes recombinant microorganisms and methods of use thereof in which redox balance is fine-tuned. For example, the recombinant microorganism in any of the embodiments disclosed herein may include genes encoding transhydrogenases and / or NAD kinases to increase intracellular NADH and / or NADPH concentrations, thereby achieving increased product yields. In exemplary embodiments, the recombinant microorganism in any of the embodiments disclosed herein may include genes encoding transhydrogenases (e.g., "pntAB" and / or "udhA" from Escherichia coli), and / or genes encoding NAD kinases (e.g., "yfjB" from Escherichia coli). The expression of these genes can, for example, increase the concentration of intracellular NADPH to increase the activity of NADPH-dependent glyoxylate reductase to promote the conversion of glyoxylic acid into glycolic acid.

[0190] The use of transhydrogenases (e.g., genes pntAB and / or udhA in E. coli), and / or NAD kinases (e.g., gene yfjB in E. coli) to increase the concentration of intracellular NADH or NADPH has been described in US20140335578, Cui et al., Microbial Cell Factories 2014, 13:21, and Shi et al., Metabolic Engineering 16 (2013) 1-10; the entire contents of which are incorporated herein by reference.

[0191] In one embodiment, reductants such as sulfur compounds (e.g., sulfite, sulfur dioxide and cysteine) and / or hydrogen can be added to the culture medium as an additional source of reducing power to adjust the redox balance in the metabolic pathway to increase the yield of the product. In another embodiment, an exogenous hydrogen source or other additional electron / NAD(P)H source can be added to the culture medium for metabolic pathways with a negative balance of NADH or NADPH.

[0192] In certain embodiments, a gene encoding a malate:quinol oxidoreductase (also known as a malate dehydrogenase) is inactivated by deletion or attenuation in a recombinant microorganism comprising a reverse GS pathway.

[0193] The rGS pathway of the present disclosure can be combined with known GA and glycine production pathways. Currently known GA and / or glycine production pathways include serine / hydroxypyruvate pathways, described in U.S. Pat. No. 8,911,978; glyoxylate shunt (GS) pathways, described in U.S. Pat. Nos. 9,034,615 and 8,945,888, PCT Publication No. WO 2016 / 193540 and U.S. Pre-grant Publication No. 2014 / 0295510; D-erythrose-based pathways are described in PCT Publication No. WO 2015 / 181074; Pentose derivatives-based pathways to ethanolaldehyde are described in PCT Publication Nos. WO 2017 / 059236 and WO 2016 / 79440 and U.S. Pre-grant Publication Nos. US 2016 / 0076061 and US2015 / 0147794. All of these pathways generate excess NADH and release excess CO2, i.e., these pathways do not achieve the maximum yields thermodynamically possible. By combining these known pathways for producing GA and glycine with the rGS pathway of the present disclosure, the yield of GA and / or glycine can be significantly increased.

[0194] GA yields using some previously published pathways:

[0195] Serine / Hydroxypyruvate Pathway:

[0196] 1 glucose -> -> 2GA + 2CO 2 +6NADH+0ATP; y=0.84g / g, Y(max)=1.70g / g, y is 49% of Y(max)

[0197] GS pathway:

[0198] Glucose->2GA+2CO 2 +4NADH+2quinol+2ATP; y=0.84g / g, Y(max)=1.70g / g, y is 49% of Y(max)

[0199] Pentose derivative pathway using GS:

[0200] Xylose->2GA+1CO 2 +3NADH+1quinol+0ATP; y=1.01g / g, Y(max)=1.71g / g, y is 59% of Y(max)

[0201] Erythrose pathway:

[0202] Glucose->3GA+2NADH+1quinol-1ATP, y=1.27g / g, Y(max)=1.70g / g, y is 75% of Y(max).

[0203] By combining or co-utilizing the above-mentioned pathways with the rGS pathway of the present invention, the yield of GA can be significantly increased. For example, in certain embodiments, co-utilizing known GA production pathways with the rGS pathway of the present invention can provide increased GA yields as follows:

[0204] GS and rGS pathways:

[0205] Glucose + 2 / 3CO2 + 2 / 3ATP-> 10 / 3GA + 2quinol; y = 1.41 g / g, Y(max) = 1.69 g / g, y is 83% of Y(max)

[0206] GS and rGS pathways (no flux over malate dehydrogenase):

[0207] Glucose + 2CO2 + 2NAD(P)H-> 4GA + 2quinol; y = 1.69 g / g, Y(max) = 1.69 g / g, y is 100% of Y(max)

[0208] Pentose derivative pathway using GS and rGS:

[0209] Xylose + CO2 + 1ATP-> 3GA + 1quinol; y = 1.52 g / g, Y(max) = 1.69 g / g, y is 90% of Y(max)

[0210] Serine, GS and rGS pathways:

[0211] Glucose + CO2 + 1.5ATP->3.5GA + 1.5quinol; y = 1.48 g / g, Y(max) = 1.69 g / g, y is 88% of Y(max).

[0212] In one embodiment, the reverse glyoxylate shunt pathway of the invention utilizes NADH and CO produced by other glycolylglycine production pathways and / or glycolaldehyde production pathways. 2 , and / or externally supplied CO 2 and / or HCO3 - and / or other carbon sources, thereby increasing yield potential. For example, in one embodiment, the reverse glyoxylate bypass pathway of the present disclosure utilizes NADH and CO produced by the serine / hydroxypyruvate-based pathway described in U.S. Pat. No. 8,911,978. 2In another embodiment, the reverse glyoxylate shunt pathway utilizes NADH and CO produced by the glyoxylate shunt pathway. 2 The glyoxylate shunt pathway is described in U.S. Pat. Nos. 9,034,615 and 8,945,888, PCT Publication No. WO 2016 / 193540, and U.S. Pre-Grant Publication No. 2014 / 0295510. In yet another embodiment, the reverse glyoxylate shunt pathway utilizes NADH and CO produced by a pathway based on D-erythrose and pentose derivatives to glycolaldehyde. 2 , which are described in PCT Publication Nos. WO 2015 / 181074, WO 2017 / 059236, and WO 2016 / 79440 and US Pre-Grant Publication Nos. US 2016 / 0076061 and US 2015 / 0147794.

[0213] Recombinant microorganisms of the present disclosure include bacteria, yeast or fungi. In certain embodiments, microorganisms are selected from, but not limited to Enterobacteriaceae, Clostridium, Bacillaceae, Streptomyces, Corynebacteriaceae and Saccharomyces. In one embodiment, microorganisms are species of Escherichia, Clostridium, Bacillus, Klebsiella, Pantoea, Salmonella, Lactobacillus, Corynebacterium or yeast. In one embodiment, microorganisms are Escherichia coli or Corynebacterium glutamicum or Clostridium acetobutylicum or Bacillus subtilis or Saccharomyces cerevisiae.

[0214] Glycine production

[0215] Various enzymes can be used to convert glyoxylate produced using any of the above pathways into glycine. For example, glyoxylate can be produced from glyoxylate by transamination of alanine, such as by alanine-glyoxylate aminotransferase (EC 2.6.1.44). Typically, the natural pathway utilizes glutamate as an amino donor in another transamination reaction, catalyzed by alanine aminotransferase (EC 2.6.1.2) to supplement alanine with pyruvate. The common nitrogen source NH 3Fixation in the resulting 2-oxidoglutarate to replenish glutamate itself requires NAD(P)H glutamate synthase (EC 1.4.1.13, EC1.4.1.14). The overall stoichiometry is glyoxylate + NH3 + 1 NAD(P)H-> glycine. Other enzymes that can promote the conversion of glyoxylate to glycine include glycine dehydrogenase (EC1.4.1.10), glycine aminotransferase (EC2.6.1.4), serine-glyoxylate aminotransferase (EC2.6.1.45) and glycine oxidase (EC1.4.3.19). Thus, the recombinant microorganism in any of the embodiments disclosed herein may comprise one or more genes selected from the following: a gene encoding alanine-glyoxylate aminotransferase (EC2.6.1.44), a gene encoding glycine dehydrogenase (EC1.4.1.10), a gene encoding glycine transaminase (EC2.6.1.4), a gene encoding serine-glyoxylate transaminase (EC2.6.1.45) and / or a gene encoding glycine oxidase (EC1.4.3.19).

[0216] In an exemplary embodiment, the gene encoding glycine dehydrogenase (EC 1.4.1.10) can be from Mycobacterium (eg, Mycobacterium tuberculosis, Mycobacterium smegmatis), Pseudomonas, Xanthobacter sp., or Bacillus.

[0217] In an exemplary embodiment, the gene encoding glycine aminotransferase (EC 2.6.1.4) can be from Rhodopseudomonas palustris, Lactobacillus sp., Hydrogenobacter sp., Rattus sp., or Rhodopseudomonas sp.

[0218] Yields of glycine using previously published or natural pathways:

[0219] Glyoxylic acid using the glyoxylic acid shunt:

[0220] Glucose->2 glyoxylate+6 NADH+2 quinol+2 ATP; y=0.82 g / g, Y(max)=2.51 g / g, y is 33% of Y(max)

[0221] Glycine via transamination of glyoxylate:

[0222] Glucose + 2NH 3->2 glycine + 4 NADH + 2 quinol + 2 ATP; y = 0.701 g / g (glucose + 2 NH 3 ), Y(max) = 1.20 g / g, y is 58% of Y(max)

[0223] Glycine via decarboxylation of serine:

[0224] Glucose + 2THF + 2NH 3 ->2 glycine + 2M-THF + 2NADH + 0ATP; y = 0.701 g / g (glucose + 2NH 3 ).

[0225] Glycine yield by co-utilizing known pathways with the rGS pathway of the present invention:

[0226] Pentose derivative pathway, GS and rGS, using glyoxylate transamination:

[0227] Xylose + 3NH 3 +CO 2 +1ATP->3glycine+1quinol; y=1.12g / g(xylose+3NH 3 ), Y(max) = 1.25 g / g, y is 90% of Y(max)

[0228] GS and rGS, using glyoxylate transamination:

[0229] Glucose + 10 / 3NH 3 +2 / 3CO 2 +2 / 3ATP->10 / 3glycine+2quinol; y=1.06g / g(glucose+10 / 3NH 3 ), Y(max) = 1.24 g / g, y is 85% of Y(max)

[0230] GS and rGS pathways, using glyoxylate transamination (no flux over malate dehydrogenase):

[0231] Glucose + 4NH 3 +2CO2+2NAD(P)H->4glycine+2quinol; y=1.24g / g, Y(max)=1.24g / g, y is 100% of Y(max)

[0232] Serine, GS and rGS pathways:

[0233] Glucose + 3.5NH 3 +CO 2 +1.5ATP->3.5glycine+1.5quinol; y=1.10g / g(glucose+3.5NH 3), Y(max)=1.24g, y is 89% of Y(max).

[0234] In one embodiment, the expression level of at least one gene in a recombinant microorganism comprising an rGS pathway is increased to increase the production of glycine, the gene being selected from:

[0235] (a) a gene encoding alanine-glyoxylate aminotransferase;

[0236] (b) a gene encoding glycine dehydrogenase;

[0237] (c) a gene encoding glycine aminotransferase;

[0238] (d) a gene encoding serine-glyoxylate aminotransferase;

[0239] (e) a gene encoding glycine oxidase;

[0240] (f) a gene encoding alanine aminotransferase; and

[0241] (g) Genes encoding NAD(P)H-dependent glutamate synthase. In another embodiment, one or more of these genes may contain a gain-of-function mutation that increases the activity of the enzyme encoded by these genes.

[0242] The glyoxylic acid-producing recombinant microorganism of the present invention can also co-produce glycolic acid and glycine.

[0243] In some embodiments, microorganism of the present invention does not produce isopropanol.In one embodiment, microorganism of the present invention does not produce serine and / or glutamate by reverse glyoxylate bypass pathway.In some embodiments, microorganism of the present invention may not include one or more enzymes that glycine is converted into serine.For example, in one embodiment, microorganism of the present invention may be included in the loss of function mutation in the gene of encoding serine hydroxymethyltransferase.In another embodiment, the microorganism may not include glycine consumption pathway.

[0244] Microorganisms comprising a reverse glyoxylate pathway exhibit increased production of glycolate and glycine. In one embodiment, the microorganisms of the present disclosure lack pathways to convert glycolate and / or glycine to other products or intermediates.

[0245] Co-utilization of the rGS pathway and other glycolate production pathways

[0246] In certain embodiments, a recombinant microorganism comprising a reverse glyoxylate shunt pathway utilizes other carbon sources (CO) provided by other glycolate and / or glycine production pathways and / or exogenous sources. 2 and / or HCO 3 -and / or other carbonic acid) to generate NADH and CO 2 For example, in one embodiment, the rGS pathway of the present invention can be co-utilized with the pentose derivative-to-glycolaldehyde based pathways described in WO 2017 / 059236, US2016 / 0076061, US2015 / 0147794, and WO 2016 / 079440.

[0247] Thus, in one embodiment, a recombinant microorganism comprising the rGS pathway may also comprise the pathways and / or modifications described in these documents. For example, a recombinant microorganism comprising the rGS pathway may have reduced or eliminated xylulokinase activity, or reduced or eliminated expression of xylulokinase, may recombinantly express an enzyme that interconverts xylulose to ribulose, may recombinantly express a D-ribulose-phosphate aldolase (e.g., the fucA gene from E. coli), may recombinantly express a D-ribulose kinase (e.g., the gene fucK from E. coli), and / or may recombinantly express an alcoholaldehyde dehydrogenase, such as aldehyde dehydrogenase A (e.g., the gene aldA from E. coli).

[0248] A recombinant microorganism comprising an rGS pathway can have reduced or eliminated xylulokinase activity, or reduced or eliminated expression of a xylulokinase, recombinant expression of an enzyme that converts D-xylulose to D-xylulose-1P (e.g., kkh-C from Homo sapiens), recombinant expression of a D-xylulose-1-phosphate aldolase (e.g., gene aldoB from Homo sapiens), and recombinant expression of a glycolaldehyde dehydrogenase, such as aldehyde dehydrogenase A (e.g., gene aldA from Escherichia coli). A recombinant microorganism comprising an rGS pathway may have reduced or eliminated activity, or reduced or eliminated expression, of an enzyme that interconverts xylose to D-xylulose (e.g., gene xylA from E. coli), recombinantly expressed an enzyme that converts xylose to D-xylose, recombinantly expressed an enzyme that converts D-xylose to 2-dehydro-3-deoxy-D-pentonate (DPP) (e.g., gene yagF from E. coli), recombinantly expressed 2-keto-3-deoxy-D-pentonate aldolase (e.g., gene yagE from E. coli), and recombinantly expressed glycolaldehyde dehydrogenase, such as aldehyde dehydrogenase A (e.g., gene aldA from E. coli).

[0249] In some embodiments, a recombinant microorganism comprising an rGS pathway may include a deletion of a gene encoding a xylulokinase (e.g., gene xylB from E. coli). In some embodiments, the enzyme that interconverts xylulose and ribulose is a D-tagatose 3-epimerase (e.g., gene dte from Pseudomonas cichorii). In certain embodiments, the D-tagatose 3-epimerase is encoded by the dte gene from Pseudomonas cichorii, which is codon optimized for E. coli or S. cerevisiae. In some embodiments, a recombinant microorganism comprising an rGS pathway may have reduced or removed glycolaldehyde reductase activity, or reduced or removed expression of the enzyme. For example, a recombinant microorganism may include a deletion of a gene encoding glycolaldehyde reductase (e.g., gene fucO).

[0250] In another embodiment, the rGS pathway of the present invention can be used together with the serine / hydroxypyruvate pathway described in U.S. Patent No. 8,911,978. Thus, in one embodiment, a recombinant microorganism comprising the rGS pathway can exhibit increased expression levels of pyruvate decarboxylase (e.g., pyruvate decarboxylase encoded by genes Pdc1, Pdc5, Pdc6 from yeast), aldehyde dehydrogenase (e.g., aldehyde dehydrogenase encoded by genes aldA, aldB, aldH and gabD), serine aminotransferase and / or serine oxidase.

[0251] In another embodiment, a recombinant microorganism comprising an rGS pathway may further comprise a genetic modification described in: U.S. Patent Nos. 9,034,615, and 8,945,888; PCT Publication Nos. WO 2016 / 193540 and WO 2015 / 181074; and U.S. Pre-Grant Publication No. 2014 / 0295510.

[0252] method

[0253] The present invention provides methods for producing glycolic acid and glycine using any of the recombinant microorganisms described herein.

[0254] In one embodiment, the method comprises culturing in a suitable culture medium a recombinant microorganism that expresses a gene encoding a malate dehydrogenase that catalyzes the conversion of pyruvate to malate, a gene encoding a malate thiokinase that catalyzes the conversion of malate to malyl-CoA, and a gene encoding a malyl-CoA lyase that catalyzes the conversion of malyl-CoA to glyoxylate and acetyl-CoA. The gene encoding a malate dehydrogenase may encode a malate dehydrogenase that catalyzes the conversion of pyruvate to malate and / or catalyzes the conversion of OAA to malate, but preferably does not catalyze (or catalyzes less efficiently) the reverse reaction from malate to pyruvate or from malate to OAA.

[0255] In one embodiment, the method comprises culturing in a suitable culture medium a recombinant microorganism that expresses a gene encoding a pyruvate carboxylase that catalyzes the conversion of pyruvate to OAA, and / or a gene encoding a phosphoenolpyruvate carboxylase that catalyzes the conversion of phosphoenolpyruvate to OAA, and / or a gene encoding a phosphoenolpyruvate carboxykinase that catalyzes the conversion of phosphoenolpyruvate to OAA, in combination with a gene encoding a malate thiokinase that catalyzes the conversion of malate to malyl-CoA, and a gene encoding a malyl-CoA lyase that catalyzes the conversion of malyl-CoA to glyoxylate and acetyl-CoA.

[0256] In one embodiment, the method comprises culturing in a suitable culture medium a recombinant microorganism expressing a gene encoding a pyruvate carboxylase that catalyzes the conversion of pyruvate to OAA, and / or a gene encoding a phosphoenolpyruvate carboxylase that catalyzes the conversion of phosphoenolpyruvate to OAA, and / or a gene encoding a phosphoenolpyruvate carboxykinase that catalyzes the conversion of phosphoenolpyruvate to OAA, in combination with a gene encoding a malate thiokinase that catalyzes the conversion of malate to malyl-CoA, and a gene encoding a malyl-CoA lyase that catalyzes the conversion of malyl-CoA to glyoxylate and acetyl-CoA, wherein the acetyl-CoA produced by the malyl-CoA lyase is combined with OAA to increase the biosynthesis of GA and / or glycine. In the same embodiment, the recombinant microorganism may or may not have down-regulated or deleted glucose-6-phosphate isomerase, pyruvate kinase, pyruvate dehydrogenase, and / or malate dehydrogenase.

[0257] In one embodiment, the method comprises culturing in a suitable culture medium a recombinant microorganism expressing a gene encoding a pyruvate carboxylase that catalyzes the conversion of pyruvate to OAA, and / or a gene encoding a phosphoenolpyruvate carboxylase that catalyzes the conversion of phosphoenolpyruvate to OAA, and / or a gene encoding a phosphoenolpyruvate carboxykinase that catalyzes the conversion of phosphoenolpyruvate to OAA, in combination with a gene encoding a malate dehydrogenase that catalyzes the conversion of OAA to malate, a gene encoding a malate thiokinase that catalyzes the conversion of malate to malyl-CoA, and a gene encoding a malyl-CoA lyase that catalyzes the conversion of malyl-CoA to glyoxylate and acetyl-CoA. The gene encoding a malate dehydrogenase may encode a malate dehydrogenase that catalyzes the conversion of pyruvate to malate and / or catalyzes the conversion of OAA to malate, but preferably does not catalyze (or catalyzes less efficiently) the reverse reaction from malate to pyruvate or from malate to OAA.

[0258] In another embodiment, the method includes culturing in a suitable culture medium a recombinant microorganism that expresses a gene encoding a pyruvate carboxylase that catalyzes the conversion of pyruvate to OAA, and / or a gene encoding a phosphoenolpyruvate carboxylase that catalyzes the conversion of phosphoenolpyruvate to OAA, and / or a gene encoding a phosphoenolpyruvate carboxykinase that catalyzes the conversion of phosphoenolpyruvate to OAA; a gene encoding a malate dehydrogenase that catalyzes the conversion of pyruvate to malate; a gene encoding a malate dehydrogenase that catalyzes the conversion of OAA to malate; a gene encoding a malate thiokinase that catalyzes the conversion of malate to malyl-CoA; and a gene encoding a malyl-CoA lyase that catalyzes the conversion of malyl-CoA to glyoxylate and acetyl-CoA. In one embodiment, the gene encoding malate dehydrogenase encodes a modified malate dehydrogenase that catalyzes the conversion of pyruvate to malate or the conversion of OAA to malate, but does not catalyze the reverse reaction from malate to pyruvate, or from malate to OAA, or exhibits reduced conversion from malate to pyruvate, or from malate to OAA.

[0259] In another embodiment, the method comprises culturing in a suitable culture medium a recombinant microorganism expressing a gene encoding a pyruvate carboxylase that catalyzes the conversion of pyruvate to OAA, and / or a gene encoding a phosphoenolpyruvate carboxylase that catalyzes the conversion of phosphoenolpyruvate to OAA, and / or a gene encoding a phosphoenolpyruvate carboxykinase that catalyzes the conversion of phosphoenolpyruvate to OAA; a gene encoding a malate thiokinase that catalyzes the conversion of malate to malyl-CoA, and a gene encoding a malyl-CoA lyase that catalyzes the conversion of malyl-CoA to glyoxylate and acetyl-CoA, wherein the microorganism does not comprise a gene encoding a malate dehydrogenase that catalyzes the conversion of OAA to malate, or comprises a deletion or loss-of-function mutation in a gene encoding a malate dehydrogenase that catalyzes the conversion of OAA to malate.

[0260] In another embodiment, the method comprises culturing in a suitable culture medium a recombinant microorganism expressing a gene encoding a pyruvate carboxylase that catalyzes the conversion of pyruvate to OAA, and / or a gene encoding a phosphoenolpyruvate carboxylase that catalyzes the conversion of phosphoenolpyruvate to OAA, and / or a gene encoding a phosphoenolpyruvate carboxykinase that catalyzes the conversion of phosphoenolpyruvate to OAA; a gene encoding a malate dehydrogenase that catalyzes the conversion of pyruvate to malate; a gene encoding a malate thiokinase that catalyzes the conversion of malate to malyl-CoA, and a gene encoding a malyl-CoA lyase that catalyzes the conversion of malyl-CoA to glyoxylate and acetyl-CoA, wherein the microorganism does not comprise a gene encoding a malate dehydrogenase that catalyzes the conversion of OAA to malate, or comprises a loss-of-function mutation in a gene encoding a malate dehydrogenase that catalyzes the conversion of OAA to malate.

[0261] In one embodiment, glyoxylate is reduced to glycolate by an NAD(P)H-dependent glyoxylate reductase expressed by a recombinant microorganism.

[0262] In one embodiment, glyoxylate is converted to glycine using an alanine-glyoxylate aminotransferase, a glycine dehydrogenase, a glycine aminotransferase, a serine-glyoxylate aminotransferase, and / or a glycine oxidase expressed by a recombinant microorganism.

[0263] The suitable culture medium used in the method of the present disclosure comprises a fermentable carbon source. In one embodiment, the carbon source is selected from sugar, glycerol, alcohol, organic acid, alkane, fatty acid, lignocellulose, protein, carbon dioxide and carbon monoxide. In an exemplary embodiment, the carbon source is sugar. In another exemplary embodiment, the carbon source is hexose and / or pentose. In another embodiment, the carbon source is an oligomer of glucose or glucose, or the carbon source comprises a biomass hydrolyzate containing hemicellulose. In another embodiment, the carbon source is a monosaccharide (for example, glucose, xylose, arabinose, fructose and mannose), a disaccharide (for example, sucrose, lactose and maltose), an oligosaccharide (for example, galactose) or a polysaccharide (for example, cellulose).

[0264] In another embodiment, the method for producing GA and / or glycine comprises culturing in a suitable culture medium a recombinant microorganism expressing a set of genes encoding:

[0265] (a) malate dehydrogenase catalyzes the carboxylation of pyruvate to malate;

[0266] (b) malate thiokinase which catalyzes the conversion of malate into malyl-CoA; and

[0267] (c) Malyl-CoA lyase that catalyzes the decomposition of malyl-CoA into glyoxylate and acetyl-CoA;

[0268] (d) optionally phosphoenolpyruvate carboxylase, and / or phosphoenolpyruvate carboxykinase, and / or pyruvate carboxylase;

[0269] and comprising at least one modification selected from the group consisting of:

[0270] (a) deleting or weakening the gene encoding malate synthase;

[0271] (b) deleting or weakening the gene encoding isocitrate dehydrogenase;

[0272] (c) deleting or attenuating genes encoding pyruvate dehydrogenase, pyruvate oxidase and / or pyruvate formate lyase;

[0273] (d) deleting or attenuating a gene encoding malate dehydrogenase that catalyzes the conversion of oxaloacetate into malate, or vice versa; and

[0274] (e) Deletion or attenuation of the gene encoding pyruvate kinase.

[0275] In another embodiment, the method for producing GA and / or glycine comprises culturing in a suitable culture medium a recombinant microorganism expressing a set of genes encoding:

[0276] (a) malate dehydrogenase catalyzes the carboxylation of pyruvate to malate;

[0277] (b) malate thiokinase which catalyzes the conversion of malate into malyl-CoA; and

[0278] (c) Malyl-CoA lyase that catalyzes the decomposition of malyl-CoA into glyoxylate and acetyl-CoA;

[0279] And includes:

[0280] (a) attenuating a gene encoding malate dehydrogenase that catalyzes the conversion of oxaloacetate into malate, or a gene encoding malate dehydrogenase that catalyzes the conversion of malate into oxaloacetate, or attenuating / mutating a gene encoding malate dehydrogenase that catalyzes the carboxylation of pyruvate into malate, so that it shows reduced conversion of malate into pyruvate; and

[0281] (b) Deleting or attenuating a gene encoding malate synthase (eg, aceB and / or glcB genes in E. coli, or genes DAL7 and MLS1 in Saccharomyces cerevisiae).

[0282] In another embodiment, the method for producing GA and / or glycine comprises culturing in a suitable culture medium a recombinant microorganism expressing a set of genes encoding:

[0283] (a) a phosphoenolpyruvate carboxylase that catalyzes the carboxylation of PEP to oxaloacetate, and / or a phosphoenolpyruvate carboxykinase that catalyzes the carboxylation of PEP to oxaloacetate, and / or a pyruvate carboxylase that catalyzes the carboxylation of pyruvate to oxaloacetate, and / or a malate dehydrogenase that catalyzes the carboxylation of pyruvate to malate;

[0284] (b) malate thiokinase which catalyzes the conversion of malate into malyl-CoA; and

[0285] (c) malyl-CoA lyase that catalyzes the conversion of malyl-CoA into glyoxylate and acetyl-CoA;

[0286] (d) and optionally, malate dehydrogenase which catalyzes the conversion of oxaloacetate into malate,

[0287] as well as;

[0288] Wherein the microorganism comprises at least one modification selected from the group consisting of:

[0289] (a) deleting or weakening the gene encoding malate synthase;

[0290] (b) deleting or weakening the gene encoding isocitrate dehydrogenase;

[0291] (c) deleting or attenuating genes encoding pyruvate dehydrogenase, pyruvate oxidase, and / or pyruvate formate lyase;

[0292] (d) deleting or weakening a gene encoding malate dehydrogenase that catalyzes the conversion of malate into pyruvate, or deleting or weakening a gene encoding malate dehydrogenase that catalyzes the conversion of malate into oxaloacetate;

[0293] (e) deleting or attenuating the gene encoding pyruvate kinase;

[0294] (f) deleting or attenuating the gene encoding glyoxylate-aldehyde ligase;

[0295] (g) deleting or weakening the gene encoding 2-oxo-4-hydroxyglutarate aldolase;

[0296] (h) deleting or attenuating the gene encoding glycolaldehyde reductase;

[0297] (i) deleting or attenuating the gene encoding glycolate oxidase; and

[0298] (j) Deleting or attenuating the gene encoding the repressor of isocitrate lyase.

[0299] In yet another embodiment, the method for producing GA and / or glycine comprises culturing in a suitable culture medium a recombinant microorganism that exhibits increased expression levels, or increased activity (i.e., enhanced kinetic parameters for a desired reaction), or greater specificity (i.e., the engineered enzyme has a specificity for a target substrate >5x, >10x greater than that of a wild-type enzyme) of one or more enzymes. 1 x, >10 2 x, >10 3 x, 10 4 x, or preferably >10 5 or a novel homologous enzyme), wherein the enzyme is selected from the group consisting of: pyruvate carboxylase, phosphoenolpyruvate carboxylase, phosphoenolpyruvate carboxykinase, malate dehydrogenase, malate thiokinase, malyl-CoA lyase, NADH-dependent glyoxylate reductase, and NADPH-dependent glyoxylate reductase.

[0300] In other embodiments, the method for producing GA and / or glycine comprises culturing in a suitable culture medium a recombinant microorganism that exhibits reduced expression levels of at least one enzyme selected from the group consisting of malate synthase, isocitrate dehydrogenase, pyruvate dehydrogenase, pyruvate oxidase and / or pyruvate formate lyase, pyruvate kinase, glyoxylate-aldehyde ligase, 2-oxo-4-hydroxyglutarate aldolase, glucose-6-phosphate isomerase, glycolaldehyde reductase, and glycolate oxidase.

[0301] In another embodiment, the method for producing GA and / or glycine may include deletions or modifications that reduce the activity of pyruvate dehydrogenase, prevent or at least reduce the major carbon loss in the conversion of pyruvate to acetyl-CoA, and favor the rerouting of carbon from pyruvate or phosphoenolpyruvate to oxaloacetate via the carboxylation activity of the enzyme candidates presented herein.

[0302] In another embodiment, the method for producing GA and / or glycine may include deletions or modifications that reduce the activity of pyruvate kinase and favor carbon fixation from phosphoenolpyruvate to oxaloacetate via the carboxylation activity of the enzyme candidates presented herein.

[0303] The methods of the present disclosure can provide a yield of glycolic acid in the range of about 1.1 g glycolic acid to about 2.0 g / g per gram of carbon source, including values ​​and ranges therebetween. For example, the yield of glycolic acid can be about 1.1, 1.2, 1.3, 1.4, 1.5, 1.6, 1.7, 1.8, 1.9 or about 2.0 g / g. The yield of glycolic acid can be from about 1.1 to about 1.8 g / g, about 1.2 to about 1.8 g / g, about 1.3 to about 1.8 g / g, about 1.4 to 1.8 g / g, about 1.4 to 1.7 g / g, or about 1.4 to 1.6 g / g.

[0304] The method of the present disclosure can provide the productivity of glycine in the range of about 1.0g glycine to about 1.5g / g per gram of carbon source, including values ​​and ranges therebetween. For example, the productivity of glycine can be about 1.0, 1.1, 1.2, 1.3, 1.4 or 1.5g / g. The productivity range of glycine can be from about 1.0 to about 1.4g / g, about 1.0 to about 1.3g / g, about 1.0 to about 1.2g / g, about 1.1 to 1.5g / g, about 1.1 to 1.4g / g or about 1.1 to 1.3g / g or about 1.2 to 1.4g / g.

[0305] Production of Polyglycolic Acid (PGA)

[0306] The present disclosure also includes methods for producing polyglycolic acid (PGA). The glycolic acid produced by the recombinant microorganism of the present disclosure can be used to produce PGA. PGA can be produced from GA by in vivo polymerization or chemical polymerization.

[0307] In one embodiment, the production of PGA using an in vivo polymerization route is described in U.S. Pre-Grant Publication No. 2011 / 0118434A1, which is incorporated herein by reference in its entirety. In this route, once GA is produced, two types of enzymes - CoA transferase / synthase and PHA synthase can be used to produce PGA within the cell. Therefore, in one embodiment, the recombinant microorganism of any embodiment disclosed herein may include a gene encoding a polyhydroxyalkanoate (PHA) synthase.

[0308] Four major classes of PHA synthases are known (Rhem, B., 2003). Class I and Class II PHA synthases contain enzymes composed of only one type of subunit (PhaC). According to their in vivo and in vitro specificity, Class I PHA synthases (e.g., in Ralstonia eutropha) preferentially utilize CoA-thioesters of various hydroxy fatty acids containing 3 to 5 carbon atoms, while Class II PHA synthases (e.g., in Pseudomonas aeruginosa) preferentially utilize CoA-thioesters of various hydroxy fatty acids containing 6 to 14 carbon atoms. Class III synthases (e.g., in Allochromatium vinosum) contain enzymes composed of two different types of subunits: PhaC and PhaE subunits. These PHA synthases prefer CoA-thioesters of hydroxy fatty acids containing 3 to 5 carbon atoms. Class IV PHA synthases (eg, in Bacillus megaterium) are similar to class III PHA synthases, but PhaE is replaced by PhaR.

[0309] In one embodiment, the gene encoding a PHA synthase is phaC, phaEC and / or phaCR.

[0310] In one embodiment, glycolate is converted to glycolyl-CoA by one or more enzymes selected from the group consisting of acyl-CoA synthetase, acyl-CoA transferase, and phosphotransbutyrylase associated with butyrate kinase.

[0311] In an exemplary embodiment, the enzyme that converts glycolate to glycolyl-CoA is from an Enterobacteriaceae species. In an exemplary embodiment, the recombinant microorganism of any embodiment described herein may comprise a gene prpE encoding a propionyl-CoA synthetase from Escherichia coli or Salmonella Thyphimurium, a gene acs encoding an acetyl-CoA transferase from Escherichia coli, a gene ptb encoding a phosphotransbutyrylase, and / or a gene buk encoding a butyrate kinase.

[0312] If not through in vivo polymerization, chemical polymerization methods are known in the art: ring-opening polymerization from Kureha with high molecular weight PGA (see reference), and direct polycondensation to achieve low molecular weight PGA (Singh & Tiwari, 2010).

[0313] Alternatively, PGA can be prepared by a chemical polymerization route, such as the ring-opening polymerization of cyclic diesters or the polycondensation of 2-hydroxycarboxylic acids. In an exemplary embodiment, the ring-opening polymerization method described by Yamane et al. (Polymer Journal, August 2014, pp. 1-7) can be used to produce PGA to obtain high molecular weight PGA. In another exemplary embodiment, PGA can be produced by direct polycondensation to obtain low molecular weight PGA (Singh & Tiwari, International Journal of Polymer Science, 2010 volume, 652719, 23 pages, doi: 10.1155 / 2010 / 652719).

[0314] The present disclosure also provides methods for producing a recombinant microorganism capable of producing glycolic acid and / or glycine from glyoxylate using a reverse glyoxylate shunt. In one embodiment, the method for producing a recombinant microorganism comprises introducing one or more genes selected from the following into the microorganism, or introducing a gain-of-function mutation into one or more genes selected from the following:

[0315] (a) A gene encoding pyruvate carboxylase that converts pyruvate into OAA;

[0316] (b) a gene encoding phosphoenolpyruvate carboxylase that converts phosphoenolpyruvate into OAA;

[0317] (c) a gene encoding phosphoenolpyruvate carboxykinase that converts phosphoenolpyruvate into OAA;

[0318] (d) a gene encoding a malate dehydrogenase that converts OAA into malate and / or converts pyruvate into malate;

[0319] (e) a gene encoding malate thiokinase that converts malate into malyl-CoA;

[0320] (f) a gene encoding a malyl-CoA lyase that converts malyl-CoA into glyoxylate and acetyl-CoA;

[0321] (g) a gene encoding a NADH-dependent glyoxylate reductase that converts glyoxylate into glycolate; and

[0322] (h) A gene encoding an NADPH-dependent glyoxylate reductase that converts glyoxylate into glycolate.

[0323] The nucleotide sequences of the genes encoding the above-mentioned polypeptides are known in the art and are publicly available (www.ncbi.nlm.nih.gov / genbank / ). Methods for incorporating the desired nucleic acid sequence into a microbial genome or into an expression vector are also known. For example, U.S. Patent No. 9,034,615, incorporated herein by reference, discloses a method for incorporating the gene ycdW (encoding a NADPH-dependent glyoxylate reductase) into an expression vector.

[0324] In certain embodiments, recombinant microorganisms include deletions or modifications that reduce the expression of endogenous genes. Exemplary methods for producing these microorganisms include deleting genes, or replacing natural promoters with low-strength promoters, or reducing the expression of genes by introducing mutations that cause enzyme activity to decrease into genes.

[0325] In some embodiments, the method for producing a recombinant microorganism comprises introducing into the microorganism a deletion or modification that attenuates the expression of, or inhibits the activity of, an enzyme encoded by at least one endogenous gene selected from the group consisting of:

[0326] (a) a gene encoding malate synthase;

[0327] (b) a gene encoding isocitrate dehydrogenase;

[0328] (c) genes encoding pyruvate dehydrogenase, pyruvate oxidase, and / or pyruvate formate lyase;

[0329] (d) a gene encoding pyruvate kinase;

[0330] (e) a gene encoding malate dehydrogenase;

[0331] (f) a gene encoding glyoxylate-aldehyde ligase;

[0332] (g) a gene encoding 2-oxo-4-hydroxyglutarate aldolase;

[0333] (h) a gene encoding glycolaldehyde reductase;

[0334] (i) a gene encoding glycolate oxidase;

[0335] (j) a gene encoding a repressor of isocitrate lyase; and

[0336] (l) Gene encoding glucose-6-phosphate isomerase.

[0337] The method for producing a recombinant microorganism may also include (a) introducing a deletion or modification that attenuates the expression of a gene encoding malate:quinol oxidoreductase into the microorganism, and / or (b) introducing a gain-of-function mutation into a gene encoding malate dehydrogenase, a gene encoding pyruvate carboxylase, a gene encoding phosphoenolpyruvate carboxylase, a gene encoding phosphoenolpyruvate carboxykinase, a gene encoding malate thiokinase, a gene encoding malyl-CoA lyase, a gene encoding alanine-glyoxylate aminotransferase; a gene encoding glycine dehydrogenase; a gene encoding glycine transaminase; a gene encoding serine-glyoxylate transaminase; a gene encoding glycine oxidase; a gene encoding alanine transaminase and / or a gene encoding NADPH-dependent glutamate synthase.

[0338] Since modifications will be apparent to those skilled in the art, the foregoing detailed description has been given for clearness of understanding only, and no unnecessary limitations should be construed therefrom.

[0339] Although the disclosure has been described in conjunction with particular embodiments thereof, it will be understood that the disclosure is capable of further modifications and this application is intended to cover any variations, uses, or adaptations of the disclosure, generally following the principles of the disclosure and including such departures from the disclosure as come within the known or customary practice in the art to which the disclosure pertains, and which may be applied to the basic features described above as well as those described below within the scope of the appended claims.

[0340] Example

[0341] Embodiment 1:

[0342] Computer simulation analysis of biosynthesis and improved ethanol via reverse glyoxylate shunt activity in Escherichia coli Acid production

[0343] Flux balance analysis (FBA) was performed to simulate the effect of the genetic modifications described herein on the production yield of glycolic acid under various conditions ( Figure 3 and Figure 4). To this end, the genome-scale metabolic model iJO1366 (Orth JD. et al. (2011) A comprehensive genome-scale reconstruction of Escherichia coli metabolism—2011. Mol Syst Biol. 7:535) containing all known Escherichia coli metabolic reactions was modified to simulate glycolate (GA) production using a combination of glyoxylate (GS) and reverse glyoxylate (rGS) branches. The model was modified to include other reactions and corresponding metabolites, including malate thiokinase reaction (EC 6.2.1.9), malyl-CoA ligase reaction (EC 4.1.3.24) and pyruvate carboxylase reaction (EC 6.4.1.1).

[0344] OptFlux software (Rocha L. (2010) OptFlux:an ​​open-source software platform for in silico metabolic engineering. BMC Syst Biol. 4:45) is used to simulate. In an exemplary embodiment, a simplified flux balance analysis is performed to assess the maximum theoretical production yield of GA obtained by GS / rGS engineering. According to an exemplary embodiment, the transport system used is hexokinase HXK (EC2.7.1.1) or phosphotransferase system (PTS), and the carboxylase for entering the TCA cycle is phosphoenolpyruvate carboxykinase (PEPCK) (EC4.1.1.32), phosphoenolpyruvate carboxylase (PPC) (EC4.1.1.31) or pyruvate carboxylase PPC (EC6.4.1.1).

[0345] The simulations were performed by applying a set of constraints that are easily reproduced under in vivo culture conditions of E. coli strains, where glucose is the carbon substrate and under aerobic conditions. The glucose substrate flux was arbitrarily set to 10 μmole.gCDW-1.h-1. No constraints were set on minimum biomass yield or cell maintenance costs. The simulation results describing the maximum theoretical production of GA are shown in Table 1.

[0346] Table 1. Simulation results describing the maximum theoretical production of GA

[0347]

[0348] exist Figure 3 and Figure 4The simulation flux diagram is described in . The simulation shows that the theoretical production yield of GA from glucose by GS / rGS can reach 0.83 to 1.43 g depending on the glucose transport system and carboxylase used. GA / g 葡萄糖 Between. Strains that rely on PEPCK or PPC as carboxylases perform poorly in PTS+ strains. This is likely due to competition between the PTS system and PEPCK / PPC for their common substrate phosphoenolpyruvate. However, in PTS-deficient strains (where glucose is mostly transported via hexokinase HXK), the performance of the strains can be improved. As depicted in the flux diagram ( Figure 3 and Figure 4 ), maximum yield can only be achieved by diverting 86% to 100% of the carbon flux from glucose to the pentose phosphate pathway to provide redox cofactors for the final glyoxylate reductase reaction (EC 1.1.1.26). This carbon flow toward the pentose phosphate pathway is considered an alternative to provide the NADPH cofactor required by the NADPH-dependent glyoxylate reductase.

[0349] Embodiment 2:

[0350] By combining reverse glyoxylate shunt activity in Escherichia coli with carboxylation via pyruvate carboxylase activity Combination for in vivo biosynthesis and improvement of glycolic acid production

[0351] As previously described (Alkim C. (2016) the synthetic xylulose-1phosphate pathway increases production of glycolic acid from xylose-rich sugar mixtures. Biotechnol Biofuels, 9: 201), glycolic acid (GA) production in Escherichia coli can be enhanced by inactivating all annotated reactions that consume glyoxylate, namely, malate synthase encoded by aceB (GenBank Gene ID: 948512) and glcB (GenBank Gene ID: 948857), glyoxylate aldehyde ligase encoded by gcl (GenBank Gene ID: 945394), and 2-oxo-4-hydroxyglutarate aldolase encoded by eda (GenBank Gene ID: 946367). GA reoxidation can be further prevented by deleting the glcDEFG operon encoding glycolate oxidase (GenBank Gene IDs: 947353, 2847718, 2847717, 947473).

[0352] Therefore, the following experiments were performed in E. coli K12 strain MG1655 ΔaceB ΔglcDEFGB Δgcl Δedd-eda. This strain, called SGK_rGS_00, was a gift from Alkim et al. (Alkim C. (2016) The synthetic xylulose-1 phosphate pathway increases production of glycolic acid from xylose-rich sugar mixtures. Biotechnol Biofuels, 9: 201).

[0353] Deletion of the pgi locus encoding phosphoglucose isomerase

[0354] To construct strains with enhanced pentose phosphate activity and NADPH collection, pgi encoding glucose-6-phosphate isomerase (GenBank gene ID: 948535) was deleted by CRISPR-Cas9 (Jiang Y. et al. (2015) Multigene editing in the Escherichia coli genome via the CRISPR-Cas9 system. Appl Environ Microbiol, 81: 2506-2514) according to standard procedures. The plasmids pTargetF (pMB1 aadA sgRNA-cadA) containing the guide RNA and pCas (repA101-Ts kan Pcas-cas9 ParaB-Red lacIq Ptrc-sgRNA-pMB1) containing the cas9 gene and λ-Red recombinase were obtained from AddGene (Addgene plasmids #62226 and #62225, respectively; Addgene, Cambridge, USA).

[0355] pTargetFpMB1 aadA sgRNA-pgi, which expresses a guide RNA with the N20 sequence targeting the pgi locus, was obtained by overlapping PCR using primers Pgi_N20_FW and Pgi_N20_RV described in Table 2. 500 bp upstream and 500 bp downstream of the pgi locus were amplified by overlapping PCR using primers Pgi_H1_FW, Pgi_H1_RV, Pgi_H2_FW and Pgi_H2_RV (see Table 2), and combined to obtain PCR fragments to provide the donor DNA / disruption cassette.

[0356] Table 2. Oligonucleotides used for disruption of pGI by CRISPR-Cas9. Binding regions are underlined. N20 sequences specific for pGI are in italics.

[0357]

[0358] Genome editing was performed by adjusting the protocol from (Jiang Y. et al. (2015) Multigene editing in the Escherichia coli genome via the CRISPR-Cas9 system. Appl Environ Microbiol, 81: 2506-2514). The strain SGK_rGS_00 was first transformed with the pCAS plasmid by electroporation using a standard procedure (Woodall CA. (2003) Plasmid Vectors. Methods in Molecular Biology. 235). Competent cells of strain SGK_rGS_00 containing pCAS were prepared while inducing λ-Red recombinase with arabinose (10 mM final concentration) as previously described (Jiang Y. et al. (2015) Multigene editing in the Escherichia coli genome via the CRISPR-Cas9 system. Appl Environ Microbiol, 81: 2506-2514). Then, 50 μl competent cells were mixed with 100 ng of pTargetF plasmid and 400 ng of donor DNA. Electroporation was performed at 2.5 kV in a 2-mm electroporation cuvette (VWR), and the product was immediately suspended in 1 ml of LB medium (preheated at 30°C). The cells were recovered overnight at 30°C and then inoculated onto LB agar containing kanamycin (50 μg / ml) and spectinomycin (50 μg / ml) and incubated overnight at 30°C. Colony PCR and sequencing were used to identify transformants. The resulting strain was called SGK_rGS_01:MG1655ΔaceBΔglcDEFGBΔgclΔedd-edaΔpgi.

[0359] Deletion of the aceE locus encoding subunit E1 of pyruvate dehydrogenase

[0360] According to standard procedures (Thomasson LC. (2007) E. coli Genome Manipulation by P1 Transduction. Curr Protoc Mol Biol. 79: 1.17), using MG1655Δpgi::KanR strain JW0110 obtained from the Keio single gene deletion collection (Baba T. et al. (2006) Construction of Escherichia coli K-12 in-frame, single-gene knockout mutants: the Keio collection. Mol Syst Biol. 2: 2006.0008), pyruvate dehydrogenase subunit E1 aceE was deleted in strain SGK_rGS_01 to construct a strain that accumulates pyruvate to enhance the use of carboxylase (e.g., pyruvate carboxylase) to enter the Krebs cycle. Transformants were selected on LB agar supplemented with 100 μg / ml of kanamycin and identified by colony PCR and sequencing. The antibiotic marker was further removed by specific recombination of the FTR region using Flp recombination, as previously described in the literature (Datsenko KA. et al. (2000) One-step inactivation of chromosomal genes in Escherichia coli K-12 using PCR products. Proc Natl Acad Sci USA. 97(12): 6640-5). The resulting strain was named SGK_rGS_02:MG1655ΔaceBΔglcDEFGBΔgclΔedd-edaΔpgiΔaceE.

[0361] Expression of pyruvate carboxylase, citrate synthase, isocitrate lyase, and glyoxylate reductase to enhance carbon fixation, Glyoxylate shunt activity and glycolate synthesis

[0362] pass (Leipzig, Germany) synthesized pyruvate carboxylase (SEQ ID NO: 20) from Rhizobium etli strain CFN42 (Uniprot accession number: Q2K340). The genes for the native isocitrate lyase aceA (SEQ ID NO: 21) (GeneBank Gene ID: 948517) and glyoxylate reductase ghrA (SEQ ID NO: 23) (GeneBank Gene ID: 946431) were amplified by PCR from the genome of Escherichia coli MG1655 using the primers in Table 3. As described by Trichez et al. (Trichez D. (2018) Engineering of Escherichia coli for Krebs cycle-dependent production of malic acid. Microb Cell Fact. 17: 113), the plasmid pACT3w-ppc K620S -gltA R163L Recovery of NADH-insensitive citrate synthase mutant gltA R163L (SEQ ID NO:22).

[0363] To express these genes as a synthetic operon, the J23119 constitutive promoter (SEQ ID NO: 19) (http: / / parts.igem.org / Promoters / Catalog / Anderson) was first used to replace P A1lacO-1 The pZS13-Luc plasmid (Expressys) was modified with a promoter and a multiple cloning site was introduced. (Leipzig, Germany) synthesized J23119 promoter as a synthetic gene fragment. Subsequently, it was cloned into the pZS13-Luc plasmid by restriction cloning, cloned between the restriction sites AatII and KpnI. The multiple cloning site was recovered from the pZA21-MCS plasmid (Expressys) by digestion with KpnI and AvrII, and the multiple cloning site was incorporated into the plasmid by restriction cloning between the restriction sites KpnI and AvrII. The resulting plasmid is called pZS1-J23119-MCS.

[0364] All genes were amplified by PCR using the primers described in Table 3. PCR fragments were purified on gel using the EZ-10 Spin Column DNA Gel Extraction Kit (BioBasic) according to the manufacturer's protocol. The purified fragment was cloned into the pZS1-J23119-MCS plasmid linearized by restriction digestion with KpnI and HindIII using the HiFi DNA Assembly Cloning Kit (New England Biolabs). The construction was confirmed by PCR and sequencing. The resulting synthetic operon was designated J23119-pyc-aceA-gltA. R163L -ghrA (SEQ ID NO: 24), and the plasmid was called pZS1-pyc (see Table 4).

[0365] Table 3. Oligonucleotides used to construct the synthetic operon J23119-pyc-aceA-gltAR164L-ghrA. Binding regions are underlined. The HiFi DNA Assembly Cloning Kit (New England Biolabs) was used to assemble clones using the overhangs.

[0366]

[0367] Table 4. Oligonucleotides used to construct the synthetic operon PTac-sucCD-mcl. Binding regions are underlined. The HiFi DNA Assembly Cloning Kit (New England Biolabs) was used to assemble clones using the overhangs.

[0368]

[0369] Expression of malate thiokinase and malyl-CoA ligase for the introduction of reverse glyoxylate shunt activity

[0370] The sucC2-sucD2 operon encoding malate thiokinase from Methylococcus capsulatus strain Bath (SEQ ID NO:26) (Uniprot Q607L9 and Q607L8), and the gene encoding malyl-CoA lyase and mcl from Methylobacterium extorquens AM1 (SEQ ID NO:27) (Uniprot C5B113) were used as synthetic genes from To express these genes as a synthetic operon, the P Tac The inducible promoter (SEQ ID NO: 25) replaced P LtetO-1The pZS13-MCS plasmid (Expressys) was modified with the promoter and then cloned by restriction cloning between the restriction sites AatII and KpnI. The resulting plasmid was called pZA3-P Tac -MCS.

[0371] All genes were amplified by PCR using the primers described in Table 4. PCR fragments were purified on gel using the EZ-10 Spin Column DNA Gel Extraction Kit (BioBasic) according to the manufacturer's protocol. The purified fragment was cloned as a synthetic operon using the HiFi DNA Assembly Cloning Kit (New England Biolabs) into pZA3-P linearized by restriction digestion with EcoRI and MluI. Tac -MCS plasmid. The construction was confirmed by PCR and sequencing. The resulting synthetic operon was called P Tac -sucCD-mcl (SEQ ID NO: 28), and the plasmid was called pZA3-rGS (see Table 5).

[0372] Determination of glycolic acid production

[0373] Three E. coli strains were tested for GA production. (i) no plasmid as a negative control, (ii) only containing plasmid pZS1-pyc, (ii) containing plasmid pZA3-rGS, (iv) containing wild-type strain MG1655 and engineered strains SGK_rGS_01 and SGK_rGS_02 of two plasmids were tested. All strains were transformed with the corresponding plasmids using standard procedures (Woodall CA. (2003) Plasmid Vectors. Methods in Molecular Biology. 235). The genotypes of plasmids and strains are shown in Table 5.

[0374] Table 5. Plasmids and genotypes of strains used for glycolic acid production assays.

[0375]

[0376] The strain was grown for about 50 hours in M9 glucose medium (20 g / L glucose) supplemented with 15 mM acetic acid and 1 g / L casamino acids. Ampicillin and chloramphenicol were added to a final concentration of 100 μg / mL and 25 μg / mL, respectively (i.e., ampicillin for strains carrying pZS1-pyc and chloramphenicol for strains carrying pZA3-rGS). When the OD600 of the culture reached about 0.6-0.8, the culture was induced with IPTG (final concentration 0.5 mM). The OD600 was determined by PCR. 600 The growth was monitored. Samples were taken during the growth to stationary phase. Then, the cells were analyzed by HPLC-UV / RI (Dionex Ultimate 3000, Thermo Fisher Scientific) using a Rezex ROA-Organic Acid column (Phenomenex) at 80 °C using H 2 SO 4 Glucose consumption and metabolite production were analyzed using 0.5 mM as mobile phase (0.5 mL / min). GA titer and GA yield after 24 hours are shown in Table 6.

[0377] As shown in Table 6, no significant glycolate production was detected in the MG1655 wild-type control strain without plasmid or with only plasmid pZS1-pyc or pZA3-RGS. This was expected, since all major competing pathways (i.e., glyoxylate and glycolate degradation pathways) were still active in the wild-type strain. Interestingly, limited amounts of GA could be detected when the pZS1-pyc plasmid and pZA3-rGS were expressed in the MG1655 wild-type strain. The titer of GA reached 0.11 g / L, which was the first indication that the combination of the GS / rGS pathway had a positive effect on GA production even in the wild-type strain.

[0378] For the engineered strain SGK_rGS_01, no significant GA production was detected in the blank control strain or the strain with only pZA3-rGS. However, when the glyoxylate shunt activity and glyoxylate reductase activity were enhanced using plasmid pZS1-pyc, GA production up to a titer of about 0.18 g / L could be detected. After adding the pZA3-rGS plasmid to the strain, the GA titer was improved by 910% to 1.91 g / L. The production yield reached 0.24 g / L after 22.5 hours. GA / g 葡萄糖 , showing a 2400% improvement in production yield compared to that without rGS engineering.

[0379] For engineered strain SGK_rGS_02, no significant GA production was detected in the control strain with only a single plasmid. GA production was only detected in the combination of two plasmids, with a titer as high as about 0.28 g / L.

[0380] Table 6. Titers and yields of GA evaluated during the glycolate production assay after 24 h of growth

[0381]

[0382] Embodiment 3:

[0383] By combining the reverse glyoxylate shunt activity in Escherichia coli with carboxylation via pep carboxylase activity Synthetic biosynthesis and improved production of glycolic acid

[0384] The following experiments were performed in E. coli K12 strain MG1655 ΔaceB ΔglcDEFGB Δgcl Δedd-eda. This strain, called SGK_rGS_00, was a gift from Alkim et al. (Alkim C. et al. (2016) The Synthetic Xylulose-1 phosphate pathway increases production of glycolic acid from xylose-rich sugar mixtures. Biotechnol Biofuels, 9:201).

[0385] Deletion of the pgi locus encoding phosphoglucose isomerase

[0386] In order to construct a strain with enhanced pentose phosphate activity and NADPH collection, pgi (GenBank Gene ID: 948535) encoding glucose-6-phosphate isomerase was deleted by CRISPR-Cas9 according to standard procedures (Jiang Y. et al. (2015) Multigene editing in the Escherichia coli genome via the CRISPR-Cas9 system. Appl Environ Microbiol, 81: 2506-2514). The strain was destroyed as described in Example 2 before and was referred to as SGK_rGS_01 (Table 5).

[0387] Deletion of the pykF locus encoding pyruvate kinase I

[0388] Using the MG1655Δpgi::KanR strain JW1666 obtained from the Keio single gene deletion collection (Baba T. et al. (2006) Construction of Escherichia coli K-12 in-frame, single-gene knockout mutants: the Keio collection. Mol Syst Biol. 2: 2006.0008), transduction was performed according to standard procedures (Thomasson LC. (2007) E. coli Genome Manipulation by P1 Transduction. Curr Protoc Mol Biol. 79: 1.17), and pyruvate kinase I pykF (GenBank Gene ID: 946179) was deleted in strain SGK_rGS_01 to construct a strain that accumulates phosphoenolpyruvate to enhance the use of carboxylases (e.g., pep carboxylase) to enter the Krebs cycle. Transformants were selected on LB agar supplemented with 100 μg / ml of kanamycin and identified by colony PCR and sequencing. Using Flp recombination, as previously described in the literature, antibiotic markers were further removed by specific recombination in the FTR region (Datsenko KA. et al. (2000) One-step inactivation of chromosomal genes in Escherichia coli K-12 using PCR products. Proc Natl Acad Sci USA. 97 (12): 6640-5). The resulting strain was called SGK_rGS_03MG1655ΔaceBΔglcDEFGBΔgclΔedd-edaΔpgiΔpykF.

[0389] Expression of pep carboxylase, citrate synthase, isocitrate lyase, and glyoxylate reductase to enhance carbon fixation, glyoxylate shunt activity, and glycolate synthesis

[0390] Plasmid pACT3w-ppc K620S -gltA R163L Obtained from Trichez et al. (Trichez D. (2018) Engineering of Escherichia coli for Krebs cycle-dependent production of malic acid. Microb Cell Fact. 17: 113). The plasmid contains an inducible P Tac A malate-insensitive PEP carboxylase mutant ppc under the control of a promoterK620S and the NADH-insensitive citrate synthase mutant gltA R163L . It was further modified as described below and used as the backbone for the construction of the synthetic operon. The gene encoding the natural isocitrate lyase aceA (GeneBank Gene ID: 948517) and the gene encoding the glyoxylate reductase ghrA (GeneBank Gene ID: 946431) were amplified by PCR from the genome of Escherichia coli MG1655 using the primers aceA_FW / aceA_RV and ghrA_FW / ghrA_RV described in Table 7, respectively. The plasmid pACT3w-ppc K620S -gltA R163L As a template, and the primers pACT3_FW / ppc_RV described in Table 7, the gene ppc K620S (SEQ ID NO: 29) was amplified by PCR together with the plasmid backbone pACT3. Finally, the plasmid pACT3w-ppc K620S -gltA R163L As template, and the primers gltA_FW / gltA_RV described in Table 7, the gene gltA was amplified by PCR. R163L .

[0391] Table 7. Oligonucleotides used to construct the synthetic operon J23119-pyc-aceA-gltAR164L-ghrA. Binding regions are underlined. The HiFi DNA Assembly Cloning Kit (New England Biolabs) was used to assemble clones using the overhangs.

[0392]

[0393] The PCR fragment was purified on gel using EZ-10 Spin Column DNA Gel Extraction Kit (BioBasic) according to the manufacturer's protocol. The purified fragments were assembled using HiFi DNA Assembly Cloning Kit (New England Biolabs). The construction was confirmed by PCR and sequencing. The resulting synthetic operon was called P tac -ppc K620S -aceA-gltA R163L -ghrA (SEQ ID NO: 30), and the plasmid was called pACT3-ppc.

[0394] Expression of malate thiokinase and malyl-CoA ligase for the introduction of reverse glyoxylate shunt activity

[0395] As described in Example 2, the sucC2-sucD2 operon encoding malate thiokinase from Methylococcus capsulatus strain Bath (SEQ ID NO: 26) (Uniprot Q607L9 and Q607L8) and the mcl gene encoding malyl-CoA lyase from Methylobacterium extorquens AM1 (Uniprot C5B113) were synthesized from (Leipzig, Germany). As described in Example 2, a synthetic operon P Tac -sucCD-mcl (SEQ ID NO: 28) plasmid pZA3-rGS. To express P in a background compatible with plasmid pACT3-ppc Tac -sucCD-mcl, by restriction cloning between the restriction sites AvrII and BglII, P Tac -sucCD-mcl was further transferred into pZE23-MCS plasmid (Expressys). The resulting plasmid was named pZE2-rGS.

[0396] Determination of glycolic acid production

[0397] Two strains were tested for GA production assay. Wild-type MG1655 and engineered strain SGK_rGS_03 containing (i) only plasmid pACT3-ppc, (ii) only plasmid pZE2-rGS and (iii) two plasmids were tested. All strains were transformed with the corresponding plasmids using standard procedures (Woodall CA. (2003) Plasmid Vectors. Methods in Molecular Biology. 235). The genotypes of plasmids and strains are shown in Table 8.

[0398] Table 8. Plasmids and genotypes of strains used for glycolic acid production assays.

[0399]

[0400] The strain was grown for about 50 hours in M9 glucose medium (20 g / L glucose) supplemented with 15 mM acetic acid and 1 g / L casamino acids. Chloramphenicol and kanamycin were added to make final concentrations of 25 μg / mL and 50 μg / mL (i.e., chloramphenicol for the strain carrying pACT3-ppc, and kanamycin for the strain carrying pZE2-rGS). When the OD600 of the culture reached about 0.6-0.8, the culture was induced with IPTG (final 0.5 mM). The OD600 of the culture was 0.5 mM. The ... 600The growth was monitored. Samples were taken during the growth to stationary phase. Then, the cells were analyzed by HPLC-UV / RI (Dionex Ultimate 3000, Thermo Fisher Scientific) using a Rezex ROA-Organic Acid column (Phenomenex) at 80 °C using H 2 SO 4 Glucose consumption and metabolite production were analyzed using 0.5 mM as mobile phase (0.5 mL / min). Glucose titer, GA titer and GA yield are shown in Table 9.

[0401] As shown in Table 9, when pACT3-ppc and pZE2-rGS, and pACT3-ppc without pZE2-rGS were expressed, GA production could be detected in the wild-type control, but the maximum yield was only 0.02 g GA / g 葡萄糖 ; No glycolate production was detected in the SGK_rGS_03 strain with only the plasmid pZE2-rGS. However, when the plasmid pACT3-ppc was used to enhance carbon fixation, glyoxylate shunt activity, and glyoxylate reductase activity, GA production up to a titer of about 0.8 g / L could be detected in this strain. Addition of the pZE2-rGS plasmid to SGK_rGS_03 did not improve GA titers. The production yield reached 0.21 g / L after 46 h. GA / g 葡萄糖 , showing a 525% improvement compared to the strain expressing pACT3-ppc and a 1050% improvement compared to the wild-type strain expressing both plasmids.

[0402] Table 9. Evaluation of GA titers and yields during the glycolic acid production assay after 46 hours

[0403]

[0404] List of implementation plans

[0405] 1. A recombinant microorganism producing glyoxylic acid for synthesizing glycolic acid (GA) and / or glycine, comprising:

[0406] (a) a gene encoding malate dehydrogenase that catalyzes the conversion of pyruvate into malate;

[0407] (b) a gene encoding malate thiokinase that catalyzes the conversion of malate into malyl-CoA; and

[0408] (c) A gene encoding a malyl-CoA lyase that catalyzes the conversion of malyl-CoA into glyoxylate and acetyl-CoA.

[0409] 2. A recombinant microorganism producing glyoxylic acid for synthesizing glycolic acid (GA) and / or glycine, comprising:

[0410] (a) a gene encoding a pyruvate carboxylase that catalyzes the conversion of pyruvate into oxaloacetate (OAA), and / or a gene encoding a phosphoenolpyruvate carboxylase that catalyzes the conversion of phosphoenolpyruvate into OAA, and / or a gene encoding a phosphoenolpyruvate carboxykinase that catalyzes the conversion of phosphoenolpyruvate into OAA;

[0411] (b) a gene encoding malate dehydrogenase that catalyzes the conversion of OAA into malate;

[0412] (c) a gene encoding malate thiokinase that catalyzes the conversion of malate into malyl-CoA; and

[0413] (d) A gene encoding a malyl-CoA lyase that catalyzes the conversion of malyl-CoA into glyoxylate and acetyl-CoA, wherein the acetyl-CoA produced by the malyl-CoA lyase is combined with OAA to increase the biosynthesis of GA and / or glycine.

[0414] 3. A recombinant microorganism producing glyoxylic acid for synthesizing glycolic acid (GA) and / or glycine, comprising:

[0415] (a) a gene encoding a pyruvate carboxylase that catalyzes the conversion of pyruvate into oxaloacetate (OAA), and / or a gene encoding a phosphoenolpyruvate carboxylase that catalyzes the conversion of phosphoenolpyruvate into OAA, and / or a gene encoding a phosphoenolpyruvate carboxykinase that catalyzes the conversion of phosphoenolpyruvate into OAA;

[0416] (b) a gene encoding malate thiokinase that catalyzes the conversion of malate into malyl-CoA; and

[0417] (c) a gene encoding a malyl-CoA lyase that catalyzes the conversion of malyl-CoA into glyoxylate and acetyl-CoA, wherein the recombinant microorganism does not catalyze the conversion of oxaloacetate into malate.

[0418] 4. The recombinant microorganism of any preceding embodiment, wherein the recombinant microorganism does not produce isopropanol, ethanol, acetone, citric acid, itaconic acid, acetic acid, butyric acid, (poly)3-hydroxybutyric acid, 3-hydroxyisobutyric acid, 3-aminoisobutyric acid, 2-hydroxyisobutyric acid, methacrylic acid, (poly)glutamic acid, glutamic acid, arginine, ornithine, citrulline, leucine, isoleucine, or proline via acetyl-CoA produced by malyl-CoA lyase.

[0419] 5. The recombinant microorganism of any preceding embodiment, wherein acetyl-CoA produced by malyl-CoA lyase is combined with OAA to increase biosynthesis of GA and / or glycine.

[0420] 6. The recombinant microorganism of any preceding embodiment, wherein the microorganism comprises a mutation in a gene encoding malate dehydrogenase, wherein the mutation results in partial or complete inhibition of the activity of the malate dehydrogenase, the activity of the malate dehydrogenase catalyzing the conversion of oxaloacetate to malate, malate to pyruvate and / or malate to oxaloacetate.

[0421] 7. The recombinant microorganism of any preceding embodiment, wherein the microorganism comprises a gene encoding a NADH-dependent glyoxylate reductase that catalyzes the conversion of glyoxylate to glycolate, or a gene encoding a NADPH-dependent glyoxylate reductase that catalyzes the conversion of glyoxylate to glycolate.

[0422] 8. The recombinant microorganism of any preceding embodiment, wherein the microorganism comprises a gene encoding an alanine-glyoxylate aminotransferase, a gene encoding a glycine dehydrogenase, a gene encoding a glycine transaminase, a gene encoding a serine-glyoxylate transaminase, and / or a gene encoding a glycine oxidase that catalyzes the conversion of glyoxylate to glycine.

[0423] 9. The recombinant microorganism of any preceding embodiment, wherein the malate dehydrogenase that catalyzes the carboxylation of pyruvate to malate is from enzyme class (EC) 1.1.1.38, EC 1.1.1.39, or EC 1.1.1.40.

[0424] 10. The recombinant microorganism of any preceding embodiment, wherein the malate dehydrogenase that catalyzes the conversion of oxaloacetate to malate is from enzyme class (EC) 1.1.1.37.

[0425] 11. The recombinant microorganism of any preceding embodiment, wherein the gene encoding malate dehydrogenase that catalyzes the carboxylation of pyruvate to malate is selected from the group consisting of: maeA, maeB, dme, mez, mael, nad-me1 and nad-me2 or homologs thereof.

[0426] 12. The recombinant microorganism of any preceding embodiment, wherein the gene maeA is from Escherichia coli, Pseudomonas, or Bacillus; the gene maeB is from Escherichia coli or Salmonella; the gene dme is from Rhizobium; the gene mez is from Mycobacterium; the gene mae1 is from Saccharomyces cerevisiae; and the gene nad-me1 or nad-me2 is from Arabidopsis thaliana.

[0427] 13. The recombinant microorganism of any preceding embodiment, wherein the gene maeA is from Bacillus subtilis; the gene dme is from Rhizobium meliloti; or the gene mez is from Mycobacterium tuberculosis.

[0428] 14. The recombinant microorganism of any preceding embodiment, wherein the gene encoding malate dehydrogenase catalyzing the conversion of oxaloacetate into malate is selected from the group consisting of: genes mdh or homologs thereof from Escherichia coli, Corynebacterium, Streptomyces, yeast and Arabidopsis.

[0429] 15. The recombinant microorganism of any preceding embodiment, wherein the gene mdh is from Streptomyces coelicolor or the genes mdh1 / 2 / 3 are from Saccharomyces cerevisiae.

[0430] 16. The recombinant microorganism of any preceding embodiment, wherein the gene encoding malate thiokinase is sucCD and / or SucCD-2 and / or mtkAB from Methylobacterium, Methylobacterium extorquens, Escherichia coli, Thermus thermophilus, Hyphomicrobium sp., Methanocaldococcus jannaschii, Methanothermoautotrophic Thermobacillus, Rhizobium, Methylococcus capsulatus, or Pseudomonas, or a homolog thereof.

[0431] 17. The recombinant microorganism of any preceding embodiment, wherein the gene encoding malyl-CoA lyase is mcl and / or Mcl 1 and / or mclA from Methylobacterium extorquens, Rhodobacter sphaeroides, Streptomyces, Chloroflexus aurantiacus, Nitrosomonas europaea, Methylococcus capsulans, Nereida ignava, Hyphomicrobium methylovorum, Thalassobius activus, Roseobacter litoralis, Hyphomicrobium denitrificans, Rhodobacter sphaeroides, Mycobacterium smegmatis, or Rhodococcus fascians, or a homolog thereof.

[0432] 18. The recombinant microorganism of any preceding embodiment, wherein the gene encoding pyruvate carboxylase is pyc from Rhizobium etli, PYC1 or PYC2 from yeast, or pyc from Bacillus subtilis or a homolog thereof.

[0433] 19. The recombinant microorganism of any preceding embodiment, wherein the gene encoding phosphoenolpyruvate carboxylase is ppc from Escherichia coli, ppc or pepC from R. Marinus, ppcA from M. thermoautotrophicus, pep1 from Z. mays, ppc1 / 2 / 3 from A. thaliana, ppc from G. max, or ppc from Rhodothermus, Corynebacterium, Salmonella, Hyphomicrobium, Streptococcus and Streptomyces, Pantoea, Bacillus, Clostridium, Pseudomonas, Rhodopseudomonas, Nicotiana tabacum, Amaranthushy pochondriacus, Triticum aestivum or Medicago sativa; or a homologue thereof.

[0434] 20. The recombinant microorganism of any preceding embodiment, wherein the gene encoding phosphoenolpyruvate carboxykinase is pck or pckA from Escherichia coli, pckA from Selenomonas ruminantium, pckA from Salmonella typhimurium, pckA from Klebsiella sp., pckA from Thermus sp., pck or pckA from Ruminococcus albus and Ruminococcus flavefaciens, pckA from Actinobacillus succinogenes, pck or pckA from Streptococcus bovis, or pck or pckA from Bacillus, Ruminiclostridium thermofibrosum, or pck or pckA from Streptococcus bovis. thermocellum), Klebsiella, Mycobacterium; or their homologs.

[0435] 21. The recombinant microorganism of any preceding embodiment, wherein the microorganism comprises:

[0436] (a) a gene encoding citrate synthase, which converts OAA produced by malyl-CoA lyase and acetyl-CoA into citrate;

[0437] (b) a gene encoding a citrate hydrolase that converts citric acid into aconitic acid;

[0438] (c) a gene encoding D-threoisocitrate hydrolase or aconitase which converts aconitic acid into isocitrate;

[0439] (d) a gene encoding isocitrate lyase that converts isocitrate into succinate and glyoxylate;

[0440] (e) a gene encoding a succinate dehydrogenase that converts succinate into fumarate; and

[0441] (f) A gene encoding fumarase that converts fumarate into malate.

[0442] 22. The recombinant microorganism of any preceding embodiment, wherein the microorganism comprises a loss-of-function mutation in a gene encoding malate synthase, or a deletion of said gene.

[0443] 23. The recombinant microorganism of any preceding embodiment, wherein the gene encoding glyoxylate reductase activity is selected from: ycdW and / or yiaE from Escherichia coli, GOR1 from S. cerevisiae, gyaR from Thermococcus litoralis and / or GLYR1 from Arabidopsis thaliana.

[0444] 24. The recombinant microorganism of any preceding embodiment, wherein the pyruvate carboxylase that converts pyruvate into OAA is from the enzyme classification system number EC6.4.1.1; the phosphoenolpyruvate carboxylase that converts phosphoenolpyruvate into OAA is from EC4.1.1.31; and the phosphoenolpyruvate carboxykinase that converts phosphoenolpyruvate into OAA is from EC4.1.1.32 and EC4.1.1.49.

[0445] 25. The recombinant microorganism of any preceding embodiment, wherein the malate thiokinase that converts malate to malyl-CoA is from the enzyme classification system number EC6.2.1.4, EC6.2.1.5, EC6.2.1.9, or EC6.2.1.-; and / or the malyl-CoA lyase that converts malyl-CoA to glyoxylate and acetyl-CoA is from EC4.3.1.24 or EC4.3.1.25.

[0446] 26. The recombinant microorganism of any preceding embodiment, wherein one or more genes are heterologously expressed.

[0447] 27. The recombinant microorganism of any preceding embodiment, wherein the microorganism comprises a deletion or modification that reduces the activity of one or more endogenous genes selected from:

[0448] (a) a gene encoding isocitrate dehydrogenase;

[0449] (b) genes encoding pyruvate dehydrogenase, pyruvate oxidase, and / or pyruvate formate lyase;

[0450] (c) a gene encoding pyruvate kinase; and

[0451] (d) Gene encoding glycolate oxidase.

[0452] 28. The recombinant microorganism of any preceding embodiment, wherein the gene encoding malate synthase is aceB and / or glcB from Escherichia coli, or DAL7 and / or MLS1 from yeast.

[0453] 29. The recombinant microorganism of any preceding embodiment, wherein the gene encoding isocitrate dehydrogenase is icd from Escherichia coli, or IDP2 and / or IDH1 / 2 from yeast.

[0454] 30. The recombinant microorganism of any preceding embodiment, wherein the gene encoding pyruvate dehydrogenase is aceE and / or aceF from Escherichia coli.

[0455] 31. The recombinant microorganism of any preceding embodiment, wherein the gene encoding pyruvate kinase is pykA and / or pykF from Escherichia coli.

[0456] 32. The recombinant microorganism of any preceding embodiment, wherein the gene encoding glycolate oxidase is glcD, glcE, glcF and / or glcG from Escherichia coli.

[0457] 33. The recombinant microorganism of any preceding embodiment, wherein the yeast is Saccharomyces cerevisiae.

[0458] 34. The recombinant microorganism of any preceding embodiment, wherein the microorganism comprises a deletion or modification that reduces the activity of one or more endogenous genes selected from:

[0459] (a) a gene encoding glyoxylate-aldehyde ligase;

[0460] (b) a gene encoding 2-oxo-4-hydroxyglutarate aldolase;

[0461] (c) a gene encoding glycolaldehyde reductase; and

[0462] (d) A gene encoding a repressor of isocitrate lyase.

[0463] 35. The recombinant microorganism of any preceding embodiment, wherein the gene encoding glyoxylate aldehyde ligase is gcl; the gene encoding 2-oxo-4-hydroxyglutarate aldolase is edA; the gene encoding glycolaldehyde reductase is fucO and / or gldA; and the gene encoding the repressor of isocitrate lyase is iclR.

[0464] 36. The recombinant microorganism of any preceding embodiment, wherein the expression level of a gene encoding alanine-glyoxylate aminotransferase, a gene encoding glycine dehydrogenase, a gene encoding glycine transaminase, a gene encoding serine-glyoxylate transaminase, and / or a gene encoding glycine oxidase is increased.

[0465] 37. The recombinant microorganism of any preceding embodiment, wherein the expression level of a gene encoding alanine aminotransferase, and / or a gene encoding NADPH-dependent glutamate synthase is increased.

[0466] 38. The recombinant microorganism of any preceding embodiment, wherein the microorganism can utilize NADH and CO produced by other glycolate and / or glycine production pathways in reactions catalyzed by malate dehydrogenase, pyruvate carboxylase, phosphoenolpyruvate carboxylase, phosphoenolpyruvate carboxykinase, malate thiokinase, and malyl-CoA lyase. 2 .

[0467] 39. The recombinant microorganism of any preceding embodiment, wherein the microorganism can utilize exogenously added CO in a reaction catalyzed by malate dehydrogenase, pyruvate carboxylase, phosphoenolpyruvate carboxylase, phosphoenolpyruvate carboxykinase, malate thiokinase, and malyl-CoA lyase. 2 , carbonic acid, and / or a reducing agent.

[0468] 40. The recombinant microorganism of any preceding embodiment, wherein the reducing agent is hydrogen, electrons and / or NAD(P)H.

[0469] 41. The recombinant microorganism of any preceding embodiment, wherein the reducing agent is from an external source.

[0470] 42. The recombinant microorganism of any preceding embodiment, wherein the microorganism utilizes NADH and CO produced by the serine / hydroxypyruvate pathway in a reaction catalyzed by malate dehydrogenase, pyruvate carboxylase, phosphoenolpyruvate carboxylase, phosphoenolpyruvate carboxykinase, malate thiokinase, and malyl-CoA lyase. 2 .

[0471] 43. The recombinant microorganism of any preceding embodiment, wherein the microorganism utilizes NADH and CO produced by the glyoxylate shunt pathway in a reaction catalyzed by malate dehydrogenase, pyruvate carboxylase, phosphoenolpyruvate carboxylase, phosphoenolpyruvate carboxykinase, malate thiokinase, and malyl-CoA lyase. 2 .

[0472] 44. The recombinant microorganism of any preceding embodiment, wherein the microorganism utilizes NADH and CO produced by a D-erythrose to glycolaldehyde based pathway in a reaction catalyzed by malate dehydrogenase, pyruvate carboxylase, phosphoenolpyruvate carboxylase, phosphoenolpyruvate carboxykinase, malate thiokinase, and malyl-CoA lyase. 2 .

[0473] 45. The recombinant microorganism of any preceding embodiment, wherein the microorganism utilizes NADH and CO produced by a pentose derivative-to-glycolaldehyde pathway in a reaction catalyzed by malate dehydrogenase, pyruvate carboxylase, phosphoenolpyruvate carboxylase, phosphoenolpyruvate carboxykinase, malate thiokinase, and malyl-CoA lyase. 2 .

[0474] 46. ​​The recombinant microorganism of any preceding embodiment, wherein the microorganism is selected from the group consisting of bacteria, yeast and fungi.

[0475] 47. The recombinant microorganism of any preceding embodiment, wherein the microorganism is a bacterium selected from the group consisting of Enterobacteriaceae, Clostridium family, Bacillaceae, Streptomycetaceae and Corynebacteraceae.

[0476] 48. The recombinant microorganism of any preceding embodiment, wherein the microorganism is a species of Escherichia, Clostridium, Bacillus, Klebsiella, Pantoea, Salmonella, Lactobacillus, or Corynebacterium.

[0477] 49. The recombinant microorganism of any preceding embodiment, wherein the microorganism is Escherichia coli, or Corynebacterium glutamicum, or Clostridium acetobutylicum, or Bacillus subtilis.

[0478] 50. The recombinant microorganism of any preceding embodiment, wherein the microorganism is a yeast selected from the family Saccharomyces.

[0479] 51. The recombinant microorganism of any preceding embodiment, wherein the microorganism is a yeast species.

[0480] 52. The recombinant microorganism of any preceding embodiment, wherein the microorganism is Saccharomyces cerevisiae.

[0481] 53. The recombinant microorganism of any preceding embodiment, wherein the synthesis of glycolate and / or glycine is increased by increasing the expression level, activity, or specificity of at least one enzyme selected from the group consisting of pyruvate carboxylase, phosphoenolpyruvate carboxylase, phosphoenolpyruvate carboxykinase, malate dehydrogenase, malate thiokinase, malyl-CoA lyase, alanine-glyoxylate aminotransferase, glycine dehydrogenase, glycine transaminase, serine-glyoxylate transaminase, glycine oxidase, NADH-dependent glyoxylate reductase, and NADPH-dependent glyoxylate reductase.

[0482] 54. The recombinant microorganism of any preceding embodiment, wherein the synthesis of glycolate and / or glycine is increased by reducing the expression level, activity, or specificity of at least one enzyme selected from the group consisting of malate synthase, isocitrate dehydrogenase, pyruvate dehydrogenase, pyruvate oxidase and / or pyruvate formate lyase, pyruvate kinase, glucose-6-phosphate isomerase, glyoxylate-aldehyde ligase, 2-oxo-4-hydroxyglutarate aldolase, glycolaldehyde reductase, and glycolate oxidase.

[0483] 55. The recombinant microorganism of any preceding embodiment, wherein the synthesis of glycolate and / or glycine is increased by reducing the expression level of a gene encoding a repressor of isocitrate lyase.

[0484] 56. A method for producing glycolic acid and / or glycine using the recombinant microorganism of any preceding embodiment, wherein the method comprises culturing the recombinant microorganism in a culture medium containing a feedstock providing a carbon source until glycolic acid and / or glycine is produced.

[0485] 57. The method of any preceding embodiment, wherein the carbon source is selected from the group consisting of: sugars, glycerol, alcohols, organic acids, alkanes, fatty acids, hemicellulose, lignocellulose, proteins, carbon dioxide, and carbon monoxide.

[0486] 58. The method of any preceding embodiment, wherein the carbon source is a hexose and / or a pentose.

[0487] 59. The method of any preceding embodiment, wherein the carbon source is glucose.

[0488] 60. The method of any preceding embodiment, wherein the carbon source is sucrose.

[0489] 61. The method of any preceding embodiment, wherein the carbon source comprises a biomass hydrolysate containing hemicellulose.

[0490] 62. The method according to any of the preceding embodiments, wherein the carbon source is CO 2 Or carbonic acid.

[0491] 63. The method of any of the preceding embodiments, wherein the carbonic acid is HCO 3 - .

[0492] 64. A method for producing a recombinant microorganism that produces glycolic acid and / or glycine from glyoxylic acid, the method comprising introducing into the microorganism:

[0493] (a) a gene encoding malate dehydrogenase that catalyzes the conversion of pyruvate into malate;

[0494] (b) a gene encoding malate thiokinase that catalyzes the conversion of malate into malyl-CoA; and

[0495] (c) A gene encoding a malyl-CoA lyase that catalyzes the conversion of malyl-CoA into glyoxylate and acetyl-CoA.

[0496] 65. A method for producing a recombinant microorganism that produces glycolic acid and / or glycine from glyoxylic acid, the method comprising introducing into the microorganism:

[0497] (a) a gene encoding a pyruvate carboxylase that catalyzes the conversion of pyruvate into OAA, and / or a gene encoding a phosphoenolpyruvate carboxylase that catalyzes the conversion of phosphoenolpyruvate into OAA, and / or

[0498] The gene encoding phosphoenolpyruvate carboxykinase catalyzes the conversion of phosphoenolpyruvate to OAA;

[0499] (b) a gene encoding malate dehydrogenase that catalyzes the conversion of OAA into malate;

[0500] (c) a gene encoding malate thiokinase that catalyzes the conversion of malate into malyl-CoA; and

[0501] (d) A gene encoding a malyl-CoA lyase that catalyzes the conversion of malyl-CoA into glyoxylate and acetyl-CoA, wherein the acetyl-CoA produced by the malyl-CoA lyase is combined with OAA to increase the biosynthesis of GA and / or glycine.

[0502] 66. A method for producing a recombinant microorganism that produces glycolic acid and / or glycine from glyoxylic acid, the method comprising introducing into the microorganism:

[0503] (a) a gene encoding a pyruvate carboxylase that catalyzes the conversion of pyruvate into oxaloacetate (OAA), and / or a gene encoding a phosphoenolpyruvate carboxylase that catalyzes the conversion of phosphoenolpyruvate into OAA, and / or a gene encoding a phosphoenolpyruvate carboxykinase that catalyzes the conversion of phosphoenolpyruvate into OAA;

[0504] (b) a gene encoding malate thiokinase that catalyzes the conversion of malate into malyl-CoA; and

[0505] (c) a gene encoding a malyl-CoA lyase that catalyzes the conversion of malyl-CoA into glyoxylate and acetyl-CoA, wherein the recombinant microorganism does not catalyze the conversion of oxaloacetate into malate.

[0506] 67. The method of any preceding embodiment, wherein the gene encoding malate dehydrogenase comprises a mutation that results in partial or complete inhibition of the activity of malate dehydrogenase, the activity of which catalyzes the conversion of oxaloacetate to malate, malate to pyruvate, or malate to oxaloacetate.

[0507] 68. The method of any preceding embodiment, comprising introducing into the microorganism:

[0508] (a) a gene encoding a NADH-dependent glyoxylate reductase that catalyzes the conversion of glyoxylate into glycolate;

[0509] (b) a gene encoding an NADPH-dependent glyoxylate reductase that catalyzes the conversion of glyoxylate into glycolate; or

[0510] (i) A gene encoding alanine-glyoxylate aminotransferase, a gene encoding glycine dehydrogenase, a gene encoding glycine transaminase, a gene encoding serine-glyoxylate transaminase, and / or a gene encoding glycine oxidase that catalyzes the conversion of glyoxylate into glycine.

[0511] 69. The method of any preceding embodiment, comprising introducing into the microorganism a loss-of-function mutation in a gene encoding malate synthase, or a deletion of said gene.

[0512] 70. The method of any preceding embodiment, comprising introducing into the microorganism a deletion or modification that reduces the activity of one or more enzymes encoded by a gene selected from:

[0513] (a) a gene encoding isocitrate dehydrogenase;

[0514] (b) genes encoding pyruvate dehydrogenase, pyruvate oxidase, and / or pyruvate formate lyase;

[0515] (c) a gene encoding pyruvate kinase;

[0516] (d) a gene encoding glycolate oxidase; and

[0517] (e) A gene encoding glucose-6-phosphate isomerase.

[0518] 71. The method of any preceding embodiment, comprising introducing into the microorganism a deletion or modification that reduces the activity of one or more enzymes encoded by a gene selected from:

[0519] (a) a gene encoding glyoxylate-aldehyde ligase;

[0520] (b) a gene encoding 2-oxo-4-hydroxyglutarate aldolase;

[0521] (c) a gene encoding glycolaldehyde reductase; and

[0522] (d) A gene encoding a repressor of isocitrate lyase.

[0523] 72. The method of any preceding embodiment, comprising introducing a gain-of-function mutation into a gene encoding an alanine-glyoxylate aminotransferase, a gene encoding an alanine-glyoxylate aminotransferase that converts glyoxylate into glycine, a gene encoding a glycine dehydrogenase, a gene encoding a glycine transaminase, a gene encoding a serine-glyoxylate transaminase, and / or a gene encoding a glycine oxidase that catalyzes the conversion of glyoxylate into glycine.

[0524] 73. The method according to any of the preceding embodiments, comprising introducing a gain-of-function mutation into the gene encoding alanine aminotransferase and / or the gene encoding NADPH-dependent glutamate synthase.

[0525] 74. The method of any preceding embodiment, wherein the recombinant microorganism is selected from the group consisting of bacteria, yeast, and fungi.

[0526] 75. The method of any preceding embodiment, wherein the recombinant microorganism is a bacterium selected from the group consisting of Enterobacteriaceae, Clostridium family, Bacillaceae, Streptomycetaceae, and Corynebacteraceae.

[0527] 76. The method of any preceding embodiment, wherein the recombinant microorganism is a species of Escherichia, Clostridium, Bacillus, Klebsiella, Pantoea, Salmonella, Lactobacillus, or Corynebacterium.

[0528] 77. The method of any preceding embodiment, wherein the recombinant microorganism is Escherichia coli, or Corynebacterium glutamicum, or Clostridium acetobutylicum, or Bacillus subtilis.

[0529] 78. The method of any preceding embodiment, wherein the recombinant microorganism is a yeast selected from the family Saccharomyces.

[0530] 79. The method of any preceding embodiment, wherein the recombinant microorganism is a yeast species.

[0531] 80. The method of any preceding embodiment, wherein the recombinant microorganism is Saccharomyces cerevisiae.

[0532] Incorporate by reference

[0533] All references, articles, publications, patents, patent publications, and patent applications cited herein are incorporated by reference in their entirety for all purposes.

[0534] However, the reference to any references, articles, publications, patents, patent publications and patent applications cited herein is not and should not be taken as an admission or any form of suggestion that they constitute or form part of the common general knowledge in any country in the world. Sequence Listing <110> Braskem <120> Microorganisms and methods for producing glycolic acid and glycine by reversing the glyoxylate bypass <130> BRSK-010 / 02WO (331051-2041) <150> 62 / 806,195 <151> 2019-02-15 <160> 38 <170> PatentIn version 3.5 <210> 1 <211> 60 <212> DNA <213> Artificial sequence <220> <223> Primer Pgi_N20_FW <400> 1 gtcctaggta taatactagt ccgattatct ggggtgaacc gttttagagc tagaaatagc 60 <210> 2 <211> twenty four <212> DNA <213> Artificial sequence <220> <223> Primer Pgi_N20_RV <400> 2 actagtatta tacctaggac tgag 24 <210> 3 <211> twenty two <212> DNA <213> Artificial sequence <220> <223> Pgi_H1_FW <400> 3 atgaaaaaca tcaatccaac gc 22 <210> 4 <211> 29 <212> DNA <213> Artificial sequence <220> <223> Primer Pgi_H1_RV <400> 4 ggtggatcag tcggtcacca tgtatgggc 29 <210> 5 <211> 29 <212> DNA <213> Artificial sequence <220> <223> Pgi_H2_FW <400> 5 tggtgaccga ctgatccacc agggaacca 29 <210> 6 <211> twenty two <212> DNA <213> Artificial sequence <220> <223> Primer Pgi_H2_RV <400> 6 catatcgacg atgattaacc gc 22 <210> 7 <211> 46 <212> DNA <213> Artificial sequence <220> <223> Primer pvc_FW <400> 7 ttgtttaact ttaaggaggt ttggaggtac catgcccata tccaag 46 <210> 8 <211> 42 <212> DNA <213> Artificial sequence <220> <223> Primer pvc_RV <400> 8 ttttcatacg gttcctcctt ctagatcatc cgccgtaaac cg 42 <210> 9 <211> 48 <212> DNA <213> Artificial sequence <220> <223> Primer aceA_FW <400> 9 cggatgatct agaaggagga accgtatgaa aacccgtaca caacaaat 48 <210> 10 <211> 47 <212> DNA <213> Artificial sequence <220> <223> Primer aceA_RV <400> 10 ttgtatcagc catcgtgtgc ctcctttaga actgcgattc ttcagtg 47 <210> 11 <211> 49 <212> DNA <213> Artificial sequence <220> <223> Primer gltA_FW <400> 11 atcgcagttc taaaggaggc acacgatggc tgatacaaaa gcaaaactc 49 <210> 12 <211> 52 <212> DNA <213> Artificial sequence <220> <223> Primer gltA_RV <400> 12 agatgatatc catcgtgtgc ctcctttaac gcttgatatc gcttttaaag tc 52 <210> 13 <211> 51 <212> DNA <213> Artificial sequence <220> <223> Primer ghrA_FW <400> 13 tatcaagcgt taaaggaggc acacgatgga tatcatcttt tatcacccaa c 51 <210> 14 <211> 43 <212> DNA <213> Artificial sequence <220> <223> Primer ghrA_RV <400> 14 ggctgcagga attcgatatc atagattagt agccgcgtgc gcg 43 <210> 15 <211> 49 <212> DNA <213> Artificial sequence <220> <223> Primer sucCD_FW <400> 15 acaatttcac acaggaaaca gaattcctat aattttgttt aactttaag 49 <210> 16 <211> 29 <212> DNA <213> Artificial sequence <220> <223> Primer sucCD_RV <400> 16 tatagtctag atcagaatct gattccgtg 29 <210> 17 <211> 49 <212> DNA <213> Artificial sequence <220> <223> Primer mcl_FW <400> 17 gaatcagatt ctgatctaga ctataatttt gtttaacttt aaggaggtt 49 <210> 18 <211> 29 <212> DNA <213> Artificial sequence <220> <223> Primer mcl_RV <400> 18 tagcacgcgtttactttccgcccatcgcg 29 <210> 19 <211> 148 <212> DNA <213> Artificial sequence <220> <223> J23119 promoter <400> 19 gacgtccaca gctaacacca cgtcgtccct atctgctgcc ctaggtctat gagtggttgc 60 tggataactt gacagctagc tcagtcctag gtataatgct agctaataga aataattttg 120 tttaacttta aggaggtttg gaggtacc 148 <210> 20 <211> 3465 <212> DNA <213> Rhizobium phaseoli pyc <400> 20 atgcccatat ccaagatact cgttgccaat cgctctgaaa tagccatccg cgtgttccgc 60 gcggccaacg agcttggaat aaaaacggtg gcgatctggg cggaagagga caagctggcg 120 ctgcaccgct tcaaggcgga cgagagttat caggtcggcc gcggaccgca tcttgcccgc 180 gacctcgggc cgatcgaaag ctatctgtcg atcgacgagg tgatccgcgt cgccaagctt 240 tccggtgccg acgccatcca tccgggctac ggcctcttgt cggaaagccc cgaattcgtc 300 gatgcctgca acaaggccgg catcatcttc atcggcccga aggccgatac gatgcgccag 360 cttggcaaca aggtcgcagc gcgcaacctg gcgatctcgg tcggcgtacc ggtcgtgccg 420 gcgaccgagc cactgccgga cgatatggcc gaagtggcga agatggcggc ggcgatcggc 480 tatcccgtca tgctgaaggc atcctggggc ggcggcggtc gcggcatgcg cgtcattcgt 540 tccgaggccg acctcgccaa ggaagtgacg gaagccaagc gcgaggcgat ggcggccttc 600 ggcaaggacg aggtctatct cgaaaaactg gtcgagcgcg cccgccacgt cgaaagccag 660 atcctcggcg acacccacgg caatgtcgtg catctcttcg agcgcgactg ttccgttcag 720 cgccgcaatc agaaggtcgt cgagcgcgcg cccgcaccct atctttcgga agcgcagcgc 780 caggaactcg ccgcctattc gctgaagatc gcaggggcga ccaactatat cggcgccggc 840 accgtcgaat atctgatgga tgccgatacc ggcaaatttt acttcatcga agtcaatccg 900 cgcatccagg tcgagcacac ggtgaccgaa gtcgtcaccg gcatcgatat cgtcaaggcg 960 cagatccaca tcctggacgg cgccgcgatc ggcacgccgc aatccggcgt gccgaaccag 1020 gaagacatcc gtctcaacgg tcacgccctg cagtgccgcg tgacgacgga agatccggag 1080 cacaacttca ttccggatta cggccgcatc accgcctatc gctcggcttc cggcttcggc 1140 atccggcttg acggcggcac ctcttattcc ggcgccatca tcacccgcta ttacgatccg 1200 ctgctcgtca aggtcacggc ctgggcgccg aacccgctgg aagccatttc ccgcatggac 1260 cgggcgctgc gcgaattccg catccgtggc gtcgccacca acctgacctt cctcgaagcg 1320 atcatcggcc atccgaaatt ccgcgacaac agctacacca cccgcttcat cgacacgacg 1380 ccggagctct tccagcaggt caagcgccag gaccgcgcga cgaagcttct gacctatctc 1440 gccgacgtca ccgtcaatgg ccatcccgag gccaaggaca ggccgaagcc cctcgagaat 1500 gccgccaggc cggtggtgcc ctatgccaat ggcaacgggg tgaaggacgg caccaagcag 1560 ctgctcgata cgctcggccc gaaaaaattc ggcgaatgga tgcgcaatga gaagcgcgtg 1620 cttctgaccg acaccacgat gcgcgacggc caccagtcgc tgctcgcaac ccgcatgcgt 1680 acctatgaca tcgccaggat cgccggcacc tattcgcatg cgctgccgaa cctcttgtcg 1740 ctcgaatgct ggggcggcgc caccttcgac gtctcgatgc gcttcctcac cgaagatccg 1800 tgggagcggc tggcgctgat ccgagagggg gcgccgaacc tgctcctgca gatgctgctg 1860 cgcggcgcca atggcgtcgg ttacaccaac tatcccgaca atgtcgtcaa atacttcgtc 1920 cgccaggcgg ccaaaggcgg catcgatctc ttccgcgtct tcgactgcct gaactgggtc 1980 gagaatatgc gggtgtcgat ggatgcgatt gccgaggaga acaagctctg cgaggcggcg 2040 atctgctaca ccggcgatat cctcaattcc gcccgcccga aatacgactt gaaatattac 2100 accaaccttg ccgtcgagct tgagaaggcc ggcgcccata tcattgcggt caaggatatg 2160 gcgggccttc tgaagccggc tgctgccaag gttctgttca aggcgctgcg tgaagcaacc 2220 ggcctgccga tccatttcca cacgcatgac acctcgggca ttgcggcggc aacggttctt 2280 gccgccgtcg aagccggtgt cgatgccgtc gatgcggcga tggatgcgct ctccggcaac 2340 acctcgcaac cctgtctcgg ctcgatcgtc gaggcgctct ccggctccga gcgcgatccc 2400 ggcctcgatc cggcatggat ccgccgcatc tccttttatt gggaagcggt gcgcaaccag 2460 tatgccgcct tcgaaagcga cctcaaggga ccggcatcgg aagtctatct gcatgaaatg 2520 ccgggcggcc agttcaccaa cctcaaggag caggcccgct cgctggggct ggaaacccgc 2580 tggcaccagg tggcgcaggc ctatgccgac gccaaccaga tgttcggcga tatcgtcaag 2640 gtgacgccat cctccaaggt cgtcggcgac atggcgctga tgatggtctc ccaggacctg 2700 accgtcgccg atgtcgtcag ccccgaccgc gaagtctcct tcccggaatc ggtcgtctcg 2760 atgctgaagg gcgatctcgg ccagcctccg tctggatggc cggaagcgct gcaagaaa 2820 gcattgaagg gcgaaaagcc ctatacggtg cgccccggct cgctgctcaa ggaagccgat 2880 ctcgatgcgg aacgcaaagt catcgagaag aagcttgagc gcgaggtcag cgacttcgaa 2940 ttcgcttcct atctgatgta tccgaaggtc ttcaccgact ttgcgcttgc ctccgatacc 3000 tacggtccgg tttcggtgct gccgacgccc gcctattttt acgggttggc ggacggcgag 3060 gagctgttcg ccgacatcga gaagggcaag acgctcgtca tcgtcaatca ggcggtgagc 3120 gccaccgaca gccagggcat ggtcactgtc ttcttcgagc tcaacggcca gccgcgccgt 3180 atcaaggtgc ccgatcgggc ccacggggcg acgggagccg ccgtgcgccg caaggccgaa 3240 cccggcaatg ccgcccatgt cggtgcgccg atgccgggcg tcatcagccg tgtctttgtc 3300 tcttcaggcc aggccgtcaa tgccggcgac gtgctcgtct ccatcgaggc catgaagatg 3360 gaaaccgcga tccatgcgga aaaggacggc accattgccg aagtgctggt caaggccggc 3420 gatcagatcg atgccaagga cctgctggcg gtttacggcg gatga 3465 <210> 21 <211> 1305 <212> DNA <213> Escherichia coli aceA <400> 21 atgaaaaccc gtacacaaca aattgaagaa ttacagaaag agtggactca accgcgttgg 60 gaaggcatta ctcgcccata cagtgcggaa gatgtggtga aattacgcgg ttcagtcaat 120 cctgaatgca cgctggcgca actgggcgca gcgaaaatgt ggcgtctgct gcacggtgag 180 tcgaaaaaag gctacatcaa cagcctcggc gcactgactg gcggtcaggc gctgcaacag 240 gcgaaagcgg gtattgaagc agtctatctg tcgggatggc aggtagcggc ggacgctaac 300 ctggcggcca gcatgtatcc ggatcagtcg ctctatccgg caaactcggt gccagctgtg 360 gtggagcgga tcaacaacac cttccgtcgt gccgatcaga tccaatggtc cgcgggcatt 420 gagccgggcg atccgcgcta tgtcgattac ttcctgccga tcgttgccga tgcggaagcc 480 ggttttggcg gtgtcctgaa tgcctttgaa ctgatgaaag cgatgattga agccggtgca 540 gcggcagttc acttcgaaga tcagctggcg tcagtgaaga aatgcggtca catgggcggc 600 aaagttttag tgccaactca ggaagctatt cagaaactgg tcgcggcgcg tctggcagct 660 gacgtgacgg gcgttccaac cctgctggtt gcccgtaccg atgctgatgc ggcggatctg 720 atcacctccg attgcgaccc gtatgacagc gaatttatta ccggcgagcg taccagtgaa 780 ggcttcttcc gtactcatgc gggcattgag caagcgatca gccgtggcct ggcgtatgcg 840 ccatatgctg acctggtctg gtgtgaaacc tccacgccgg atctggaact ggcgcgtcgc 900 tttgcacaag ctatccacgc gaaatatccg ggcaaactgc tggcttataa ctgctcgccg 960 tcgttcaact ggcagaaaaa cctcgacgac aaaactattg ccagcttcca gcagcagctg 1020 tcggatatgg gctacaagtt ccagttcatc accctggcag gtatccacag catgtggttc 1080 aacatgtttg acctggcaaa cgcctatgcc cagggcgagg gtatgaagca ctacgttgag 1140 aaagtgcagc agccggaatt tgccgccgcg aaagatggct ataccttcgt atctcaccag 1200 caggaagtgg gtacaggtta cttcgataaa gtgacgacta ttattcaggg cggcacgtct 1260 tcagtcaccg cgctgaccgg ctccactgaa gaatcgcagt tctaa 1305 <210> 22 <211> 1284 <212> DNA <213> Escherichia coli gltAR163L <400> 22 atggctgata caaaagcaaa actcaccctc aacggggata cagctgttga actggatgtg 60 ctgaaaggca cgctgggtca agatgttatt gatatccgta ctctcggttc aaaaggtgtg 120 ttcacctttg acccaggctt cacttcaacc gcatcctgcg aatctaaaat tacttttatt 180 gatggtgatg aaggtatttt gctgcaccgc ggtttcccga tcgatcagct ggcgaccgat 240 tctaactacc tggaagtttg ttacatcctg ctgaatggtg aaaaaccgac tcaggaacag 300 tatgacgaat ttaaaactac ggtgacccgt cataccatga tccacgagca gattacccgt 360 ctgttccatg ctttccgtcg cgactcgcat ccaatggcag tcatgtgtgg tattaccggc 420 gcgctggcgg cgttctatca cgactcgctg gatgttaaca atcctcgtca ccgtgaaatt 480 gccgcgttcc tcctgctgtc gaaaatgccg actatggccg cgatgtgtta caagtattcc 540 attggtcagc catttgttta cccgcgcaac gatctctcct acgccggtaa cttcctgaat 600 atgatgttct ccacgccgtg cgaaccgtat gaagttaatc cgattctgga acgtgctatg 660 gaccgtattc tgatcctgca cgctgaccat gaacagaacg cctctacctc caccgtgcgt 720 accgctggct cttcgggtgc gaacccgttt gcctgtatcg cagcaggtat tgcttcactg 780 tggggacctg cgcacggcgg tgctaacgaa gcggcgctga aaatgctgga agaaatcagc 840 tggggacctg cgcacggcgg tgctaacgaa gcggcgctga aaatgctgga agaaatcagc 840 tccgttaaac acattccgga atttgttcgt cgtgcgaaag acaaaaatga ttctttccgc 900 tccgttaaac acattccgga atttgttcgt cgtgcgaaag acaaaaatga ttctttccgc 900 ctgatgggct tcggtcaccg cgtgtacaaa aattacgacc cgcgcgccac cgtaatgcgt 960 ctgatgggct tcggtcaccg cgtgtacaaa aattacgacc cgcgcgccac cgtaatgcgt 960 gaaacctgcc atgaagtgct gaaagagctg ggcacgaagg atgacctgct ggaagtggct 1020 gaaacctgcc atgaagtgct gaaagagctg ggcacgaagg atgacctgct ggaagtggct 1020 atggagctgg aaaacatcgc gctgaacgac ccgtacttta tcgagaagaa actgtacccg 1080 atggagctgg aaaacatcgc gctgaacgac ccgtacttta tcgagaagaa actgtacccg 1080 aacgtcgatt tctactctgg tatcatcctg aaagcgatgg gtattccgtc ttccatgttc 1140 aacgtcgatt tctactctgg tatcatcctg aaagcgatgg gtattccgtc ttccatgttc 1140 accgtcattt tcgcaatggc acgtaccgtt ggctggatcg cccactggag cgaaatgcac 1200 accgtcattt tcgcaatggc acgtaccgtt ggctggatcg cccactggag cgaaatgcac 1200 agtgacggta tgaagattgc ccgtccgcgt cagctgtata caggatatga aaaacgcgac 1260 agtgacggta tgaagattgc ccgtccgcgt cagctgtata caggatatga aaaacgcgac 1260 tttaaaagcg atatcaagcg ttaa 1284 tttaaaagcg atatcaagcg ttaa 1284 <210> 23<210> 23 <211> 939 <211> 939 <212> DNA <212> DNA <213> 大肠杆菌ghrA <213> Escherichia coli ghrA <400> 23 <400> 23 atggatatca tcttttatca cccaacgttc gatacccaat ggtggattga ggcactgcgc 60 atggatatca tcttttatca cccaacgttc gatacccaat ggtggattga ggcactgcgc 60 aaagctattc ctcaggcaag agtcagagca tggaaaagcg gagataatga ctctgctgat 120 aaagctattc ctcaggcaag agtcagagca tggaaaagcg gagataatga ctctgctgat 120 tatgctttag tctggcatcc tcctgttgaa atgctggcag ggcgcgatct taaagcggtg 180 ttcgcactcg gggccggtgt tgattctatt ttgagcaagc tacaggcaca ccctgaaatg 240 ctgaaccctt ctgttccact ttttcgcctg gaagataccg gtatgggcga gcaaatgcag 300 gaatatgctg tcagtcaggt gctgcattgg tttcgacgtt ttgacgatta tcgcatccag 360 caaaatagtt cgcattggca accgctgcct gaatatcatc gggaagattt taccatcggc 420 attttgggcg caggcgtact gggcagtaaa gttgctcaga gtctgcaaac ctggcgcttt 480 ccgctgcgtt gctggagtcg aacccgtaaa tcgtggcctg gcgtgcaaag ctttgccgga 540 cgggaagaac tgtctgcatt tctgagccaa tgtcgggtat tgattaattt gttaccgaat 600 acccctgaaa ccgtcggcat tattaatcaa caattactcg aaaaattacc ggatggcgcg 660 tatctcctca acctggcgcg tggtgttcat gttgtggaag atgacctgct cgcggcgctg 720 gatagcggca aagttaaagg cgcaatgttg gatgttttta atcgtgaacc cttaccgcct 780 gaaagtccgc tctggcaaca tccacgcgtg acgataacac cacatgtcgc cgcgattacc 840 cgtcccgctg aagctgtgga gtacatttct cgcaccattg cccagctcga aaaaggggag 900 agggtctgcg ggcaagtcga ccgcgcacgc ggctactaa 939 <210> 24 <211> 7260 <212> DNA <213> Artificial sequence <220> <223> The operon synthesized by J23119-pyc-aceA-gltAR163L-ghrA <400> 24 ttgacagcta gctcagtcct aggtataatg ctagctaata gaaataattt tgtttaactt 60 taaggaggtt tggaggtacc atgcccatat ccaagatact cgttgccaat cgctctgaaa 120 tagccatccg cgtgttccgc gcggccaacg agcttggaat aaaaacggtg gcgatctggg 180 cggaagagga caagctggcg ctgcaccgct tcaaggcgga cgagagttat caggtcggcc 240 gcggaccgca tcttgcccgc gacctcgggc cgatcgaaag ctatctgtcg atcgacgagg 300 tgatccgcgt cgccaagctt tccggtgccg acgccatcca tccgggctac ggcctcttgt 360 cggaaagccc cgaattcgtc gatgcctgca acaaggccgg catcatcttc atcggcccga 420 aggccgatac gatgcgccag cttggcaaca aggtcgcagc gcgcaacctg gcgatctcgg 480 tcggcgtacc ggtcgtgccg gcgaccgagc cactgccgga cgatatggcc gaagtggcga 540 agatggcggc ggcgatcggc tatcccgtca tgctgaaggc atcctggggc ggcggcggtc 600 gcggcatgcg cgtcattcgt tccgaggccg acctcgccaa ggaagtgacg gaagccaagc 660 gcgaggcgat ggcggccttc ggcaaggacg aggtctatct cgaaaaactg gtcgagcgcg 720 cccgccacgt cgaaagccag atcctcggcg acacccacgg caatgtcgtg catctcttcg 780 agcgcgactg ttccgttcag cgccgcaatc agaaggtcgt cgagcgcgcg cccgcaccct 840 atctttcgga agcgcagcgc caggaactcg ccgcctattc gctgaagatc gcaggggcga 900 ccaactatat cggcgccggc accgtcgaat atctgatgga tgccgatacc ggcaaatttt 960 acttcatcga agtcaatccg cgcatccagg tcgagcacac ggtgaccgaa gtcgtcaccg 1020 gcatcgatat cgtcaaggcg cagatccaca tcctggacgg cgccgcgatc ggcacgccgc 1080 aatccggcgt gccgaaccag gaagacatcc gtctcaacgg tcacgccctg cagtgccgcg 1140 tgacgacgga agatccggag cacaacttca ttccggatta cggccgcatc accgcctatc 1200 gctcggcttc cggcttcggc atccggcttg acggcggcac ctcttattcc ggcgccatca 1260 tcacccgcta ttacgatccg ctgctcgtca aggtcacggc ctgggcgccg aacccgctgg 1320 aagccatttc ccgcatggac cgggcgctgc gcgaattccg catccgtggc gtcgccacca 1380 acctgacctt cctcgaagcg atcatcggcc atccgaaatt ccgcgacaac agctacacca 1440 cccgcttcat cgacacgacg ccggagctct tccagcaggt caagcgccag gaccgcgcga 1500 cgaagcttct gacctatctc gccgacgtca ccgtcaatgg ccatcccgag gccaaggaca 1560 ggccgaagcc cctcgagaat gccgccaggc cggtggtgcc ctatgccaat ggcaacgggg 1620 tgaaggacgg caccaagcag ctgctcgata cgctcggccc gaaaaaattc ggcgaatgga 1680 tgcgcaatga gaagcgcgtg cttctgaccg acaccacgat gcgcgacggc caccagtcgc 1740 tgctcgcaac ccgcatgcgt acctatgaca tcgccaggat cgccggcacc tattcgcatg 1800 cgctgccgaa cctcttgtcg ctcgaatgct ggggcggcgc caccttcgac gtctcgatgc 1860 gcttcctcac cgaagatccg tgggagcggc tggcgctgat ccgagagggg gcgccgaacc 1920 tgctcctgca gatgctgctg cgcggcgcca atggcgtcgg ttacaccaac tatcccgaca 1980 atgtcgtcaa atacttcgtc cgccaggcgg ccaaaggcgg catcgatctc ttccgcgtct 2040 tcgactgcct gaactgggtc gagatatgc gggtgtcgat ggatgcgatt gccgaggaga 2100 acaagctctg cgaggcggcg atctgctaca ccggcgatat cctcaattcc gcccgcccga 2160 aatacgactt gaatattac accaaccttg ccgtcgagct tgagaaggcc ggcgcccata 2220 tcattgcggt caaggatatg gcgggccttc tgaagccggc tgctgccaag gttctgttca 2280 aggcgctgcg tgaagcaacc ggcctgccga tccatttcca cacgcatgac acctcgggca 2340 ttgcggcggc aacggttctt gccgccgtcg aagccggtgt cgatgccgtc gatgcgggga 2400 tggatgcgct ctccggcaac acctcgcaac cctgtctcgg ctcgatcgtc gaggcgctct 2460 ccggctccga gcgcgatccc ggcctcgatc cggcatggat ccgccgcatc tccttttatt 2520 gggaagcggt gcgcaaccag tatgccgcct tcgaaagcga cctcaaggga ccggcatcgg 2580 aagtctatct gcatgaaatg ccgggcggcc agttcaccaa cctcaaggag caggcccgct 2640 cgctggggct ggaaacccgc tggcaccagg tggcgcaggc ctatgccgac gccaaccaga 2700 tgttcggcga tatcgtcaag gtgacgccat cctccaaggt cgtcggcgac atggcgctga 2760 tgatggtctc ccaggacctg accgtcgccg atgtcgtcag ccccgaccgc gaagtctcct 2820 tcccggaatc ggtcgtctcg atgctgaagg gcgatctcgg ccagcctccg tctggatggc 2880 cggaagcgct gcagaagaaa gcattgaagg gcgaaaagcc ctatacggtg cgccccggct 2940 cgctgctcaa ggaagccgat ctcgatgcgg aacgcaaagt catcgagaag aagcttgagc 3000 gcgaggtcag cgacttcgaa ttcgcttcct atctgatgta tccgaaggtc ttcaccgact 3060 ttgcgcttgc ctccgatacc tacggtccgg tttcggtgct gccgacgccc gcctattttt 3120 acgggttggc ggacggcgag gagctgttcg ccgacatcga gaagggcaag acgctcgtca 3180 tcgtcaatca ggcggtgagc gccaccgaca gccagggcat ggtcactgtc ttcttcgagc 3240 tcaacggcca gccgcgccgt atcaaggtgc ccgatcgggc ccacggggcg acgggagccg 3300 ccgtgcgccg caaggccgaa cccggcaatg ccgcccatgt cggtgcgccg atgccgggcg 3360 tcatcagccg tgtctttgtc tcttcaggcc aggccgtcaa tgccggcgac gtgctcgtct 3420 ccatcgaggc catgaagatg gaaaccgcga tccatgcgga aaaggacggc accattgccg 3480 aagtgctggt caaggccggc gatcagatcg atgccaagga cctgctggcg gttacggcg 3540 gatgatctag aaggaggaac cgtatgaaaa cccgtacaca acaaattgaa gaattacaga 3600 aagagtggac tcaaccgcgt tgggaaggca ttactcgccc atacagtgcg gaagatgtgg 3660 tgaaattacg cggttcagtc aatcctgaat gcacgctggc gcaactgggc gcagcgaaaa 3720 tgtggcgtct gctgcacggt gagtcgaaaa aaggctacat caacagcctc ggcgcactga 3780 ctggcggtca ggcgctgcaa caggcgaaag cgggtattga agcagtctat ctgtcgggat 3840 ggcaggtagc ggcggacgct aacctggcgg ccagcatgta tccggatcag tcgctctatc 3900 cggcaaactc ggtgccagct gtggtggagc ggatcaacaa caccttccgt cgtgccgatc 3960 agatccaatg gtccgcgggc attgagccgg gcgatccgcg ctatgcgat tacttcctgc 4020 cgatcgttgc cgatgcggaa gccggttttg gcggtgtcct gaatgccttt gaactgatga 4080 aagcgatgat tgaagccggt gcagcggcag ttcacttcga agatcagctg gcgtcagtga 4140 agaaatgcgg tcacatgggc ggcaaagttt tagtgccaac tcaggaagct attcagaaac 4200 tggtcgcggc gcgtctggca gctgacgtga cgggcgttcc aaccctgctg gttgcccgta 4260 ccgatgctga tgcggcggat ctgatcacct ccgattgcga cccgtatgac agcgaattta 4320 ttaccggcga gcgtaccagt gaaggcttct tccgtactca tgcgggcatt gagcaagcga 4380 tcagccgtgg cctggcgtat gcgccatatg ctgacctggt ctggtgtgaa acctccacgc 4440 cggatctgga actggcgcgt cgctttgcac aagctatcca cgcgaaatat ccgggcaaac 4500 tgctggctta taactgctcg ccgtcgttca actggcagaa aaacctcgac gacaaaacta 4560 ttgccagctt ccagcagcag ctgtcggata tgggctacaa gttccagttc atcaccctgg 4620 caggtatcca cagcatgtgg ttcaacatgt ttgacctggc aaacgcctat gcccagggcg 4680 agggtatgaa gcactacgtt gagaaagtgc agcagccgga atttgccgcc gcgaaagatg 4740 gctatacctt cgtatctcac cagcaggaag tgggtacagg ttacttcgat aaagtgacga 4800 ctattattca gggcggcacg tcttcagtca ccgcgctgac cggctccact gaagaatcgc 4860 agttctaaag gaggcacacg atggctgata caaaagcaaa actcaccctc aacggggata 4920 cagctggtga actggatgtg ctgaaaggca cgctgggtca agatgttat gatatccgta 4980 ctctcggttc aaaaggtgtg ttcacctttg acccaggctt cacttcaacc gcatcctgcg 5040 aatctaaaat tacttttatt gatggtgatg aaggttttt gctgcaccgc ggtttcccga 5100 tcgatcagct ggcgaccgat tctaactacc tggaagtttg ttacatcctg ctgaatggtg 5160 aaaaaccgac tcaggaacag tatgacgaat ttaaaactac ggtgacccgt cataccatga 5220 tccacgagca gattacccgt ctgttccatg ctttccgtcg cgactcgcat ccaatggcag 5280 tcatgtgtgg tattaccggc gcgctggcgg cgttctatca cgactcgctg gatgttaaca 5340 atcctcgtca ccgtgaaatt gccgcgttcc tcctgctgtc gaaaatgccg actatggccg 5400 cgatgtgtta caagtattcc attggtcagc catttgttta cccgcgcaac gatctctcct 5460 acgccggtaa cttcctgaat atgatgttct ccacgccgtg cgaaccgtat gaagttaatc 5520 cgattctgga acgtgctatg gaccgtattc tgatcctgca cgctgaccat gaacagaacg 5580 cctctacctc caccgtgcgt accgctggct cttcgggtgc gaacccgttt gcctgtatcg 5640 cagcaggtat tgcttcactg tggggacctg cgcacggcgg tgctaacgaa gcggcgctga 5700 aaatgctgga agaaatcagc tccgttaaac acattccgga atttgttcgt cgtgcgaaag 5760 acaaaaatga ttctttccgc ctgatgggct tcggtcaccg cgtgtacaaa aattacgacc 5820 cgcgcgccac cgtaatgcgt gaaacctgcc atgaagtgct gaaagagctg ggcacgaagg 5880 atgacctgct ggaagtggct atggagctgg aaaacatcgc gctgaacgac ccgtacttta 5940 tcgagaagaa actgtacccg aacgtcgatt tctactctgg tatcatcctg aaagcgatgg 6000 gtattccgtc ttccatgttc accgtcattt tcgcaatggc acgtaccgtt ggctggatcg 6060 cccactggag cgaaatgcac agtgacggta tgaagattgc ccgtccgcgt cagctgtata 6120 caggatatga aaaacgcgac tttaaaagcg atatcaagcg ttaaagggagg cacacgatgg 6180 atatcatctt ttatcaccca acgttcgata cccaatggtg gattgaggca ctgcgcaaag 6240 ctattcctca ggcaagagtc agagcatgga aaagcggaga taatgactct gctgattatg 6300 ctttagtctg gcatcctcct gttgaaatgc tggcagggcg cgatcttaaa gcggtgttcg 6360 cactcggggc cggtgttgat tctattttga gcaagctaca ggcacaccct gaaatgctga 6420 acccttctgt tccacttttt cgcctggaag ataccggtat gggcgagcaa atgcaggaat 6480 atgctgtcag tcaggtgctg cattggtttc gacgttttga cgattatcgc atccagcaaa 6540 atagttcgca ttggcaaccg ctgcctgaat atcatcggga agattttacc atcggcattt 6600 tgggcgcagg cgtactgggc agtaaagttg ctcagagtct gcaaacctgg cgctttccgc 6660 tgcgttgctg gagtcgaacc cgtaaatcgt ggcctggcgt gcaaagcttt gccggacggg 6720 aagaactgtc tgcatttctg agccaatgtc gggtattgat taatttgtta ccgaataccc 6780 ctgaaaccgt cggcattatt aatcaacaat tactcgaaaa attaccggat ggcgcgtatc 6840 tcctcaacct ggcgcgtggt gttcatgttg tggaagatga cctgctcgcg gcgctggata 6900 gcggcaaagt taaaggcgca atgttggatg tttttaatcg tgaaccctta ccgcctgaaa 6960 gtccgctctg gcaacatcca cgcgtgacga taacaccaca tgtcgccgcg attacccgtc 7020 ccgctgaagc tgtggagtac atttctcgca ccattgccca gctcgaaaaa ggggagaggg 7080 tctgcgggca agtcgaccgc gcacgcggct actaatctat gatatcgaat tcctgcagcc 7140 cgggggatcc catggtacgc gtgctagagg catcaaataa aacgaaaggc tcagtcgaaa 7200 gactgggcct ttcgttttat ctgttgtttg tcggtgaacg ctctcctgag taggacaaat 7260 <210> 25 <211> 260 <212> DNA <213> Artificial sequence <220> <223> Ptac promoter from pACT3 <400> 25 cggagcttat cgactgcacg gtgcaccaat gcttctggcg tcaggcagcc atcggaagct 60 gtggtatggc tgtgcaggtc gtaaatcact gcataattcg tgtcgctcaa ggcgcactcc 120 cgttctggat aatgtttttt gcgccgacat cataacggtt ctggcaaata ttctgaaatg 180 agctgttgac aattaatcat cggctcgtat aatgtgtgga attgtgagcg gataacaatt 240 tcacacagga aacagaattc 260 <210> 26 <211> 2123 <212> DNA <213> Artificial Sequence <220> <223> sucCD of Methylococcus capsulatus strain Bath <400> 26 gaattcctat aattttgttt aactttaagg aggggtacca tgaatatcca tgagtaccag 60 gccaaggagc tgctcaagac ctatggcgtg cccgtgcccg acggcgccgt tgcctattcc 120 gacgcgcagg ccgccagcgt cgccgaggag atcggcggca gccgctgggt ggtcaaggcg 180 cagatccatg ccggcggtcg cggcaaggcc gggggcgtaa aggtcgccca ctccatcgag 240 gaagtccgcc aatacgccga cgccatgctc ggcagccacc tcgtcaccca tcagaccggc 300 ccgggaggct cgctggttca gcgtctgtgg gtggaacagg ccagccatat caaaaaggaa 360 tactacctgg gcttcgtgat cgatcgcggc aatcaacgca tcaccctgat cgcctccagc 420 gagggcggca tggaaatcga ggaagtcgca aaggaaaccc cggagaaaat cgtcaaggaa 480 gtcgtcgatc cggccatagg cctgctggac ttccagtgcc gcaaggtcgc cacggcgatc 540 ggcctgaaag gcaaactgat gccccaggcc gtcaggctga tgaaggccat ctaccgctgc 600 atgcgcgaca aagatgccct gcaggccgaa atcaatcctc tggccatcgt gggcgaaagc 660 gacgaatcgc tcatggtcct ggatgccaag ttcaacttcg acgacaacgc cctgtaccgg 720 cagcgcacca tcaccgagat gcgcgacctg gccgaggaag acccgaaaga ggtcgaagcc 780 tccggccacg gtctcaatta catcgccctc gacggcaaca tcggctgcat cgtcaatggc 840 gccggcctcg ccatggcttc gctcgacgcc atcaccctgc atggcggccg tccggccaac 900 ttcctcgacg tgggcggcgg cgcctccccc gagaaggtca ccaatgcctg ccgcatcgta 960 ctggaagatc ccaacgtccg ctgcatcctg gtcaacatct ttgccggcat caaccgctgt 1020 gactggatcg ccaagggcct gatccaggcc tgcgacagcc tgcagatcaa ggtgccgctg 1080 atcgtgcgcc tggccgggac gaacgtcgac gagggccgca agatcctggc cgaatccggc 1140 ctctccttca tcaccgcgga aaatctggac gacgcggccg ccaaggccgt cgccatcgtc 1200 aagggataac agtcatgagc gtattcgtta acaagcactc caaggtcatc ttccagggct 1260 tcaccggcga gcacgccacc ttccacgcca aggacgccat gcggatgggc acccgggtgg 1320 tcggcggtgt cacccctggc aaaggcggca cccgccatcc cgatcccgaa ctcgctcatc 1380 tgccggtgtt cgacaccgtg gctgaagccg tggccgccac cggcgccgac gtctccgccg 1440 tgttcgtgcc gccgcccttc aatgcggacg cgttgatgga agccatagac gccggcatcc 1500 gggtcgccgt gaccatcgcc gacggcatcc cggtacacga catgatccga ctgcagcgct 1560 accgggtggg taaggattcc atcgtgatcg gaccgaacac ccccggcatc atcacgccgg 1620 gcgagtgcaa ggtgggcatc atgccttcgc acatttacaa gaagggcaac gtcggcatcg 1680 tgtcgcgctc cggcaccctc aattacgagg cgacggaaca gatggccgcg cttgggctgg 1740 gcatcaccac ctcggtcggt atcggcggtg accccacatcaa cggaaccgat ttcgtcactg 1800 tcctgcgcgc cttcgaagcc gacccggaaa ccgagatcgt ggtgatgatc ggcgaaatcg 1860 gcggcccccca ggaagtcgcc gccgcccgct gggccaagga aaacatgaca aagccggtca 1920 tcggcttcgt cgcaggcctt gccgcaccga ccggccgacg catgggccat gccggcgcca 1980 tcatctccag cgaggccgac accgccggag ccaagatgga cgccatggaa gccttggggc 2040 tgtatgtcgc ccgcaacccg gcacagatcg gccagaccgt gctacgcgcc gcgcaggaac 2100 acggaatcag attctgatct aga 2123 <210> 27 <211> 975 <212> DNA <213> Artificial Sequence <220> <223> mcl of Methylobacterium extorquens AM1 <400> 27 atgagcttca ccctgatcca gcaggccacc ccgcgcctgc accgctcgga actcgcggtt 60 cccggctcca acccgacctt catggagaag tcggccgcct cgaaggccga cgtgatcttc 120 ctcgacctcg aggacgcggt tgcgcccgac gacaaggagc aggcccgcaa gaacatcatc 180 caggccctca acgacctgga ttggggcaac aagaccatga tgatccgcat caacggtctc 240 gacacccact acatgtaccg cgacgtggtg gacatcgtgg aggcctgccc gcgcctcgac 300 atgatcctga tccccaaggt cggcgtgccg gccgacgtct acgccatcga cgtgctgacg 360 acgcagatcg agcaggccaa gaagcgcgag aagaagatcg gcttcgaggt gctgatcgag 420 accgcgctcg gcatggccaa tgtcgaggcg atcgcgacct cgtctaagcg ccttgaggcg 480 atgtccttcg gtgtcgccga ctacgccgct tccacccgcg cccgctccac cgtgatcggc 540 ggcgtcaacg ccgattacag cgtgctcacc gacaaggacg aggccggcaa ccgccagacc 600 cactggcagg atccgtggct gttcgcccag aaccgcatgc tggtcgcctg ccgcgcctac 660 ggcctgcgcc cgatcgacgg tcccttcggc gacttctccg atccggacgg ctacacctcg 720 gccgctcgcc gctgcgccgc gctcggcttc gagggcaagt gggcgatcca cccctcgcag 780 atcgatctcg ccaacgaggt cttcaccccc tccgaggccg aggtcaccaa ggcccgccgc 840 atcctggaag ccatggaaga ggccgccaag gccggccgcg gcgccgtctc gctcgacggc 900 cgtctcatcg acatcgcctc gatccgcatg gccgaggcgc tgatccagaa ggccgacgcg 960 atgggcggaa agtaa 975 <210> 28 <211> 3489 <212> DNA <213> Artificial sequence <220> <223> Ptac_sucC_sucD_mcl synthetic operon <400> 28 cggagcttat cgactgcacg gtgcaccaat gcttctggcg tcaggcagcc atcggaagct 60 gtggtatggc tgtgcaggtc gtaaatcact gcataattcg tgtcgctcaa ggcgcactcc 120 cgttctggat aatgtttttt gcgccgacat cataacggtt ctggcaaata ttctgaaatg 180 agctgttgac aattaatcat cggctcgtat aatgtgtgga attgtgagcg gataacaatt 240 tcacacagga aacagaattc ctataatttt gtttaacttt aaggaggggt accatgaata 300 tccatgagta ccaggccaag gagctgctca agacctatg cgtgcccgtg cccgacggcg 360 ccgttgccta ttccgacgcg caggccgcca gcgtcgccga ggagatcggc ggcagccgct 420 gggtggtcaa ggcgcagatc catgccggcg gtcgcggcaa ggccgggc gtaaaggtcg 480 cccactccat cgaggaagtc cgccaatacg ccgacgccat gctcggcagc cacctcgtca 540 cccatcagac cggcccggga ggctcgctgg ttcagcgtct gtgggtggaa caggccagcc 600 atatcaaaaa ggaatactac ctgggcttcg tgatcgatcg cggcaatcaa cgcatcaccc 660 tgatcgcctc cagcgagggc ggcatggaaa tcgaggaagt cgcaaaggaa accccggaga 720 aaatcgtcaa ggaagtcgtc gatccggcca taggcctgct ggacttccag tgccgcaagg 780 tcgccacggc gatcggcctg aaaggcaaac tgatgcccca ggccgtcagg ctgatgaagg 840 ccatctaccg ctgcatgcgc gacaaagatg ccctgcaggc cgaaatcaat cctctggcca 900 960 acgccctgta ccggcagcgc accatcaccg agatgcgcga cctggccgag gaagacccga 1020 aagaggtcga agcctccggc cacggtctca attacatcgc cctcgacggc aacatcggct 1080 gcatcgtcaa tggcgccggc ctcgccatgg cttcgctcga cgccatcacc ctgcatggcg 1140 gccgtccggc caacttcctc gacgtgggcg gcggcgcctc ccccgagaag gtcaccaatg 1200 cctgccgcat cgtactggaa gatcccaacg tccgctgcat cctggtcaac atctttgccg 1260 gcatcaaccg ctgtgactgg atcgccaagg gcctgatcca ggcctgcgac agcctgcaga 1320 tcaaggtgcc gctgatcgtg cgcctggccg ggacgaacgt cgacgagggc cgcaagatcc 1380 tggccgaatc cggcctctcc ttcatcaccg cggaaaatct ggacgacgcg gccgccaagg 1440 ccgtcgccat cgtcaaggga taacagtcat gagcgtattc gttaacaagc actccaaggt 1500 catcttccag ggcttcaccg gccagcacgc caccttccac gccaagggacg ccatgcggat 1560 gggcacccgg gtggtcggcg gtgtcacccc tggcaaaggc ggcacccgcc atcccgatcc 1620 cgaactcgct catctgccgg tgttcgacac cgtggctgaa gccgtggccg ccaccggcgc 1680 cgacgtctcc gccgtgttcg tgccgccgcc cttcaatgcg gacgcgttga tggaagccat 1740 agacgccggc atccgggtcg ccgtgaccat cgccgacggc atcccggtac acgacatgat 1800 ccgactgcag cgctaccggg tgggtaagga ttccatcgtg atcggaccga acacccccgg 1860 catcatcacg ccgggcgagt gcaaggtggg catcatgcct tcgcacattt acaagaaggg 1920 caacgtcggc atcgtgtcgc gctccggcac cctcaattac gaggcgacgg aacagatggc 1980 cgcgcttggg ctgggcatca ccacctcggt cggtatcggc ggtgacccca tcaacggaac 2040 cgatttcgtc actgtcctgc gcgccttcga agccgacccg gaaaccgaga tcgtggtgat 2100 gatcggcgaa atcggcggcc cccaggaagt cgccgccgcc cgctgggcca aggaaaacat 2160 gacaaagccg gtcatcggct tcgtcgcagg ccttgccgca ccgaccggcc gacgcatggg 2220 ccatgccggc gccatcatct ccagcgaggc cgacaccgcc ggagccaaga tggacgccat 2280 ggaagccttg gggctgtatg tcgcccgcaa cccggcacag atcggccaga ccgtgctacg 2340 cgccgcgcag gaacacggaa tcagattctg atctagacta taattttgtt taactttaag 2400 gaggtttgga atgagcttca ccctgatcca gcaggccacc ccgcgcctgc accgctcgga 2460 actcgcggtt cccggctcca acccgacctt catggagaag tcggccgcct cgaaggccga 2520 cgtgatcttc ctcgacctcg aggacgcggt tgcgcccgac gacaaggagc aggcccgcaa 2580 gaacatcatc caggccctca acgacctgga ttggggcaac aagaccatga tgatccgcat 2640 caacggtctc gacacccact acatgtaccg cgacgtggtg gacatcgtgg aggcctgccc 2700 gcgcctcgac atgatcctga tccccaaggt cggcgtgccg gccgacgtct acgccatcga 2760 cgtgctgacg acgcagatcg agcaggccaa gaagcgcgag aagaagatcg gcttcgaggt 2820 gctgatcgag accgcgctcg gcatggccaa tgtcgaggcg atcgcgacct cgtctaagcg 2880 ccttgaggcg atgtccttcg gtgtcgccga ctacgccgct tccacccgcg cccgctccac 2940 cgtgatcggc ggcgtcaacg ccgattacag cgtgctcacc gacaaggacg aggccggcaa 3000 ccgccagacc cactggcagg atccgtggct gttcgcccag aaccgcatgc tggtcgcctg 3060 ccgcgcctac ggcctgcgcc cgatcgacgg tcccttcggc gacttctccg atccggacgg 3120 ctacacctcg gccgctcgcc gctgcgccgc gctcggcttc gagggcaagt gggcgatcca 3180 cccctcgcag atcgatctcg ccaacgaggt cttcacccc tccgaggccg aggtcacca 3240 ggcccgccgc atcctggaag ccatggaaga ggccgccaag gccggccgcg gcgccgtctc 3300. gctcgacggc cgtctcatcg acatcgcctc gatccgcatg gccgaggcgc tgatccagaa 3360 ggccgacgcg atgggcgga agtaaacgcg tgctagaggc atcaaataaa acgaaaggct cagtcgaaag actgggcctt tcgttttatc tgttgtttgt cggtgaacgc tctcctgagt 3480. aggacaaat 3489 <210> 29 <211> 2652 <212> DNA <213> Pipeline ppcK620S <400> 29 atgaacgaac aatattccgc attgcgtagt aatgtcagta tgctcggcaa agtgctggga 120. gaaaccatca aggatgcgtt gggagaacac attcttgaac gcgtagaaac tatccgtaag ttgtcgaaat cttcacgcgc tggcaatgat gctaaccgcc aggagttgct caccacctta 180 caaaatttgt cgaacgacga gctgctgccc gttgcgcgtg cgtttagtca gttcctgaac 240 ctggccaaca ccgccgagca atacacagc atttcgccga aaggcgaagc tgccagcaac 300 ccggaagtga tcgcccgcac cctgcgtaaa ctgaaaaacc agccggaact gagcgaagac 360 accatcaaaa aagcagtgga atcgctgtcg ctggaactgg tcctcacggc tcacccaacc 420 gaaattaccc gtcgtacact gatccacaaa atggtggaag tgaacgcctg tttaaaacag 480 ctcgataaca aagatatcgc tgactacgaa cacaaccagc tgatgcgtcg cctgcgccag 540 ttgatcgccc agtcatggca taccgatgaa atccgtaagc tgcgtccaag cccggtagat 600 gaagccaaat ggggctttgc cgtagtggaa aacagcctgt ggcaaggcgt accaaattac 660 ctgcgcgaac tgaacgaaca actggaagag aacctcggct acaaactgcc cgtcgaattt 720 gttccggtcc gttttacttc gtggatgggc ggcgaccgcg acggcaaccc gaacgtcact 780 gccgatatca cccgccacgt cctgctactc agccgctgga aagccaccga tttgttcctg 840 aaagatattc aggtgctggt ttctgaactg tcgatggttg aagcgacccc tgaactgctg 900 gcgctggttg gcgaagaagg tgccgcagaa ccgtatcgct atctgatgaa aaacctgcgt 960 tctcgcctga tggcgacaca ggcatggctg gaagcgcgcc tgaaaggcga agaactgcca 1020 aaaccagaag gcctgctgac acaaaacgaa gaactgtggg aaccgctcta cgcttgctac 1080 cagtcacttc aggcgtgtgg catgggtatt atcgccaacg gcgatctgct cgacaccctg 1140 cgccgcgtga aatgtttcgg cgtaccgctg gtccgtattg atatccgtca ggagagcacg 1200 cgtcataccg aagcgctggg cgagctgacc cgctacctcg gtatcggcga ctacgaaagc 1260 tggtcagagg ccgacaaaca ggcgttcctg atccgcgaac tgaactccaa acgtccgctt 1320 ctgccgcgca actggcaacc aagcgccgaa acgcgcgaag tgctcgatac ctgccaggtg 1380 attgccgaag caccgcaagg ctccattgcc gcctacgtga tctcgatggc gaaaacgccg 1440 tccgacgtac tggctgtcca cctgctgctg aaagaagcgg gtatcgggtt tgcgatgccg 1500 gttgctccgc tgtttgaaac cctcgatgat ctgaacaacg ccaacgatgt catgacccag 1560 ctgctcaata ttgactggta tcgtggcctg attcagggca aacagatggt gatgattggc tattccgact cagcaaaaga tgcgggagtg atggcagctt cctgggcgca atatcaggca caggatgcat taatcaaaac ctgcgaaaaa gcgggtattg agctgacgtt gttccacggt cgcggcggtt ccattggtcg cggcggcgca cctgctcatg cggcgctgct gtcacaaccg ccaggaagcc tgaaaggcgg cctgcgcgta accgaacagg gcgagatgat ccgctttagc tatggtctgc cagaaatcac cgtcagcagc ctgtcgcttt ataccggggc gattctgga gccaacctgc tgccaccgcc ggagccgaaa gagagctggc gtcgcattat ggatgaactg tcagtcatct cctgcgatgt ctaccgcggc tacgtacgtg aaaacaaaga ttttgtgcct tacttccgct ccgctacgcc ggacaaga ctgggcaaac tgccgttggg ttcacgtccg gcgaaacgtc gcccaaccgg cggcgtcgag tcactacgcg ccattccgtg gatcttcgcc tggacgcaaa accgtctgat gctccccgcc tggctgggtg caggtacggc gctgcaaaaa gtggtcgaag acggcaaaca gagcgagctg gaggctatgt gccgcgattg gccattcttc 2280 tcgacgcgtc tcggcatgct ggagatggtc ttcgccaaag cagacctgtg gctggcggaa 2340 tactatgacc aacgcctggt agacaaagca ctgtggccgt taggtaaaga gttacgcaac 2400 ctgcaagaag aagacatcaa agtggtgctg gcgattgcca acgattccca tctgatggcc 2460 gatctgccgt ggattgcaga gtctattcag ctacggaata tttacaccga cccgctgaac 2520 gtattgcagg ccgagttgct gcaccgctcc cgccaggcag aaaaagaagg ccaggaaccg 2580 gatcctcgcg tcgaacaagc gttaatggtc actattgccg ggattgcggc aggtatgcgt 2640 aataccggct aa 2652 <210> 30 <211> 6602 <212> DNA <213> Artificial Sequence <220> <223> Ptac-ppcK620S-aceA-gltAR163L-ghrA synthetic operon <400> 30 cggagcttat cgactgcacg gtgcaccaat gcttctggcg tcaggcagcc atcggaagct 60 gtggtatggc tgtgcaggtc gtaaatcact gcataattcg tgtcgctcaa ggcgcactcc 120 cgttctggat aatgtttttt gcgccgacat cataacggtt ctggcaaata ttctgaaatg 180 agctgttgac aattaatcat cggctcgtat aatgtgtgga attgtgagcg gataacaatt 240 tcacacagga aacagaattc gagctcggta cccgggatga acgaacaata ttccgcattg 300 cgtagtaatg tcagtatgct cggcaaagtg ctgggagaaa ccatcaagga tgcgttggga 360 gaacacattc ttgaacgcgt agaaactatc cgtaagttgt cgaaatcttc acgcgctggc 420 aatgatgcta accgccagga gttgctcacc accttacaaa atttgtcgaa cgacgagctg 480 ctgcccgttg cgcgtgcgtt tagtcagttc ctgaacctgg ccaacaccgc cgagcaatac 540 cacagcattt cgccgaaagg cgaagctgcc agcaacccgg aagtgatcgc ccgcaccctg 600 cgtaaactga aaaaccagcc ggaactgagc gaagacacca tcaaaaaagc agtggaatcg 660 ctgtcgctgg aactggtcct cacggctcac ccaaccgaaa ttacccgtcg tacactgatc 720 cacaaaatgg tggaagtgaa cgcctgttta aaacagctcg ataacaaaga tatcgctgac 780 tacgaacaca accagctgat gcgtcgcctg cgccagttga tcgcccagtc atggcatacc 840 gatgaaatcc gtaagctgcg tccaagcccg gtagatgaag ccaaatgggg ctttgccgta 900 gtggaaaaca gcctgtggca aggcgtacca aattacctgc gcgaactgaa cgaacaactg 960 gaagagaacc tcggctacaa actgcccgtc gaatttgttc cggtccgttt tacttcgtgg 1020 atgggcggcg accgcgacgg caacccgaac gtcactgccg atatcacccg ccacgtcctg 1080 ctactcagcc gctggaaagc caccgatttg ttcctgaaag atattcaggt gctggtttct 1140 gaactgtcga tggttgaagc gacccctgaa ctgctggcgc tggttggcga agaaggtgcc 1200 gcagaaccgt atcgctatct gatgaaaaac ctgcgttctc gcctgatggc gacacaggca 1260 tggctggaag cgcgcctgaa aggcgaagaa ctgccaaaac cagaaggcct gctgacacaa 1320 aacgaagaac tgtgggaacc gctctacgct tgctaccagt cacttcaggc gtgtggcatg 1380 ggtattatcg ccaacggcga tctgctcgac accctgcgcc gcgtgaaatg tttcggcgta 1440 ccgctggtcc gtattgatat ccgtcaggag agcacgcgtc ataccgaagc gctgggcgag 1500 ctgacccgct acctcggtat cggcgactac gaaagctggt cagaggccga caaacaggcg 1560 ttcctgatcc gcgaactgaa ctccaaacgt ccgcttctgc cgcgcaactg gcaaccaagc 1620 gccgaaacgc gcgaagtgct cgatacctgc caggtgattg ccgaagcacc gcaaggctcc attgccgcct acgtgatctc gatggcgaaa acgccgtccg acgtactggc tgtccacctg 1740. ctgctgaaag aagcgggtat cgggtttgcg atgccggttg ctccgctgtt tgaaacccctc gatgatctga acaacgccaa cgatgtcatg acccagctgc tcaatattga ctggtatcgt ggcctgattc agggcaaaca gatggtgatg attggctatt ccgactcagc aaaagatgcg ggagtgatgg cagcttcctg ggcgcaatat caggcacagg atgcattaat caaaacctgc gaaaaagcgg gtattgagct gacgttgttc cacggtcgcg gcggttccat tggtcgcggc ggcgcacctg ctcatgcggc gctgctgtca caaccgccag gaagcctgaa aggcggcctg 2160. cgcgtaaccg aacagggcga gatgatccgc tttagctatg gtctgccaga aatcaccgtc agcagcctgt cgctttatac cggggcgatt ctggaagcca acctgctgcc accgccggag 2220 ccgaaagaga gctggcgtcg cattatggat gaactgtcag tcatctcctg cgatgtctac cgcggctacg tacgtgaaaa caaagatttt gtgccttact tccgctccgc tacgccgga caagaactgg gcaaactgcc gttgggttca cgtccggcga aacgtcgccc aaccggcggc 2400 gtcgagtcac tacgcgccat tccgtggatc ttcgcctgga cgcaaaaccg tctgatgctc 2460 cccgcctggc tgggtgcagg tacggcgctg caaaaagtg tcgaagacgg caaacagagc 2520 gagctggagg ctatgtgccg cgattggcca ttcttctcga cgcgtctcgg catgctggag 2580 atggtcttg ccaaagcaga cctgtggctg gcggaatact atgaccaacg cctggtagac 2640 aaagcactgt ggccgttagg taagagtta cgcaacctgc aagaagaaga catcaaagtg 2700 gtgctggcga ttgccaacga ttcccatctg atggccgatc tgccgtggat tgcagagtct 2760 attcagctac ggaatattta caccgacccg ctgaacgtat tgcaggccga gttgctgcac 2820 cgctcccgcc aggcagaaaa agaaggccag gaaccggatc ctcgcgtcga acaagcgtta 2880 atggtcacta ttgccgggat tgcggcaggt atgcgtaata ccggctaatc tagaaggagg 2940 aaccgtatga aaacccgtac acaacaaatt gaagaattac agaaagagtg gactcaaccg 3000 cgttgggaag gcattactcg cccatacagt gcggaagatg tggtgaaatt acgcggttca 3060 gtcaatcctg aatgcacgct ggcgcaactg ggcgcagcga aaatgtggcg tctgctgcac 3120 ggtgagtcga aaaaaggcta catcaacagc ctcggcgcac tgactggcgg tcaggcgctg 3180 caacaggcga aagcgggtat tgaagcagtc tatctgtcgg gatggcaggt agcggcggac 3240 gctaacctgg cggccagcat gtatccggat cagtcgctct atccggcaaa ctcggtgcca 3300 gctgtggtgg agcggatcaa caacaccttc cgtcgtgccg atcagatcca atggtccgcg 3360 ggcattgagc cgggcgatcc gcgctatgtc gattacttcc tgccgatcgt tgccgatgcg 3420 gaagccggtt ttggcggtgt cctgaatgcc tttgaactga tgaaagcgat gattgaagcc 3480 ggtgcagcgg cagttcactt cgaagatcag ctggcgtcag tgaagaaatg cggtcacatg 3540 ggcggcaaag ttttagtgcc aactcaggaa gctattcaga aactggtcgc ggcgcgtctg 3600 gcagctgacg tgacgggcgt tccaaccctg ctggttgccc gtaccgatgc tgatgcggcg 3660 gatctgatca cctccgattg cgacccgtat gacagcgaat ttattaccgg cgagcgtacc 3720 agtgaaggct tcttccgtac tcatgcgggc attgagcaag cgatcagccg tggcctggcg 3780 tatgcgccat atgctgacct ggtctggtgt gaaacctcca cgccggatct ggaactggcg 3840 cgtcgctttg caaagctat ccacgcgaaa tatccgggca aactgctggc ttataactgc 3900 tcgccgtcgt tcaactggca gaaaaacctc gacgacaaaa ctattgccag cttccagcag 3960 cagctgtcgg atatgggcta caagttccag ttcatcaccc tggcaggtat ccacagcatg 4020 tggttcaaca tgtttgacct ggcaaacgcc tatgcccagg gcgagggtat gaagcactac 4080 gttgagaaag tgcagcagcc ggaatttgcc gccgcgaaag atggctatac cttcgtatct 4140 caccagcagg aagtgggtac aggtacttc gataaagtga cgactattat tcagggcggc 4200 acgtcttcag tcaccgcgct gaccggctcc actgaagaat cgcagttcta aaagggcac 4260 acgatggctg atacaaaagc aaaactcacc ctcaacgggg atacagctgt tgaactggat 4320 gtgctgaaag gcaacgctggg tcaagatgtt attgatatcc gtactctcgg ttcaaaaggt 4380 gtgttcacct ttgacccagg cttcacttca accgcatcct gcgaatctaa aattactttt 4440 attgatggtg atgaaggtat tttgctgcac cgcggtttcc cgatcgatca gctggcgacc 4500 gattctaact acctggaagt ttgttacatc ctgctgaatg gtgaaaaacc gactcaggaa 4560 cagtatgacg aatttaaaac tacggtgacc cgtcatacca tgatccacga gcagattacc 4620 cgtctgttcc atgctttccg tcgcgactcg catccaatgg cagtcatgtg tggtattacc 4680 ggcgcgctgg cggcgttcta tcacgactcg ctggatgtta acaatcctcg tcaccgtgaa 4740 attgccgcgt tcctcctgct gtcgaaaatg ccgactatgg ccgcgatgtg ttacaagtat 4800 tccattggtc agccatttgt ttacccgcgc aacgatctct cctacgccgg taacttcctg 4860 aatatgatgt tctccacgcc gtgcgaaccg tatgaagtta atccgattct ggaacgtgct 4920 atggaccgta ttctgatcct gcacgctgac catgaacaga acgcctctac ctccaccgtg 4980 cgtaccgctg gctcttcggg tgcgaacccg tttgcctgta tcgcagcagg tattgcttca 5040 ctgtggggac ctgcgcacgg cggtgctaac gaagcggcgc tgaaaatgct ggaagaaatc 5100 agctccgtta aacacattcc ggaatttgtt cgtcgtgcga aagacaaaaa tgattctttc 5160 cgcctgatgg gcttcggtca ccgcgtgtac aaaaattacg acccgcgcgc caccgtaatg 5220 cgtgaaacct gccatgaagt gctgaaagag ctgggcacga aggatgacct gctggaagtg 5280 gctatggagc tggaaaacat cgcgctgaac gacccgtact ttatcgagaa gaaactgtac 5340 ccgaacgtcg atttctactc tggtatcatc ctgaaagcga tgggtattcc gtcttccatg 5400 ttcaccgtca ttttcgcaat ggcacgtacc gttggctgga tcgcccactg gagcgaaatg 5460 cacagtgacg gtatgaagat tgcccgtccg cgtcagctgt atacaggata tgaaaaacgc 5520 gactttaaaa gcgatatcaa gcgttaaagg aggcacacga tggatatcat cttttatcac 5580 ccaacgttcg atacccaatg gtggattgag gcactgcgca aagctattcc tcaggcaaga 5640 gtcagagcat ggaaaagcgg agataatgac tctgctgatt atgctttagt ctggcatcct 5700 cctgttgaaa tgctggcagg gcgcgatctt aaagcggtgt tcgcactcgg ggccggtgtt 5760 gattctattt tgagcaagct acaggcacac cctgaaatgc tgaacccttc tgttccactt 5820 tttcgcctgg aagataccgg tatgggcgag caaatgcagg aatatgctgt cagtcaggtg 5880 ctgcattggt ttcgacgttt tgacgattat cgcatccagc aaaatagttc gcattggcaa 5940 ccgctgcctg aatatcatcg ggaagatttt accatcggca ttttgggcgc aggcgtactg 6000 ggcagtaaag ttgctcagag tctgcaaacc tggcgctttc cgctgcgttg ctggagtcga 6060 acccgtaaat cgtggcctgg cgtgcaaagc tttgccggac gggaagaact gtctgcattt 6120 ctgagccaat gtcgggtatt gattaatttg ttaccgaata cccctgaaac cgtcggcatt 6180 attaatcaac aattactcga aaaattaccg gatggcgcgt atctcctcaa cctggcgcgt 6240 ggtgttcatg ttgtggaaga tgacctgctc gcggcgctgg atagcggcaa agttaaaggc 6300 gcaatgttgg atgtttttaa tcgtgaaccc ttaccgcctg aaagtccgct ctggcaacat 6360 ccacgcgtga cgataacacc acatgtcgcc gcgattaccc gtcccgctga agctgtggag 6420 tacatttctc gcaccattgc ccagctcgaa aaaggggaga gggtctgcgg gcaagtcgac 6480 cgcgcacgcg gctactaatc tagaaagctt ctgttttggc ggatgagaga agaaattcgt 6540 cgcccgccat aaactgccag gcatcaaatt aagcagaagg ccatcctgac ggatggcctt 6600 tt 6602 <210> 31 <211> 22 <212> DNA <213> Artificial sequence <220> <223> Primer pACT_FW <400> 31 tctagaaagc ttctgttttg gc 22 <210> 32 <211> twenty two <212> DNA <213> Artificial sequence <220> <223> ppc_RV <400> 32 gttcctcctt ctagattagc cg 22 <210> 33 <211> 48 <212> DNA <213> Artificial sequence <220> <223> Primer aceA_FW <400> 33 cggctaatct agaaggagga accgtatgaa aacccgtaca caacaaat 48 <210> 34 <211> 47 <212> DNA <213> Artificial sequence <220> <223> Primer aceA_RV <400> 34 ttgtatcagc catcgtgtgc ctcctttaga actgcgattc ttcagtg 47 <210> 35 <211> 49 <212> DNA <213> Artificial sequence <220> <223> Primer gltA_FW <400> 35 atcgcagttc taaaggaggc acacgatggc tgatacaaaa gcaaaactc 49 <210> 36 <211> 52 <212> DNA <213> Artificial sequence <220> <223> Primer gltA_RV <400> 36 agatgatatc catcgtgtgc ctcctttaac gcttgatatc gcttttaaag tc 52 <210> 37 <211> 51 <212> DNA <213> Artificial sequence <220> <223> Primer ghrA_FW <400> 37 tatcaagcgt taaaggaggc acacgatgga tatcatcttt tatcacccaa c 51 <210> 38 <211> 43 <212> DNA <213> Artificial sequence <220> <223> Primer ghrA_RV <400> 38 tccgccaaaa cagaagcttt ctagattagt agccgcgtgc gcg 43

Claims

1. A recombinant microorganism for producing glyoxylic acid, which is used for synthesizing glycolic acid (GA), comprising: (a) A gene encoding a malate thiokinase that catalyzes the conversion of malate to malyl-CoA; and (b) A gene encoding a malyl-CoA lyase that catalyzes the conversion of malyl-CoA to glyoxylic acid and acetyl-CoA, wherein the acetyl-CoA produced by the malyl-CoA lyase is combined with oxaloacetate (OAA) to increase the biosynthesis of GA; It further comprises (c) A gene encoding a pyruvate carboxylase that catalyzes the conversion of pyruvate to OAA, and / or a gene encoding a phosphoenolpyruvate carboxylase that catalyzes the conversion of phosphoenolpyruvate to OAA, and / or a gene encoding a phosphoenolpyruvate carboxykinase that catalyzes the conversion of phosphoenolpyruvate to OAA; (d) A gene encoding an NADH-dependent glyoxylate reductase that catalyzes the conversion of glyoxylic acid to glycolic acid, or a gene encoding an NADPH-dependent glyoxylate reductase that catalyzes the conversion of glyoxylic acid to glycolic acid; (e) A gene encoding isocitrate lyase aceA ； and (f) A gene encoding citrate synthase gltA; wherein the recombinant microorganism is Escherichia coli.

2. The recombinant microorganism according to claim 1, wherein the microorganism further comprises a deletion of the gene encoding malate dehydrogenase, and the deletion results in complete inhibition of the activity of malate dehydrogenase in catalyzing the conversion of oxaloacetate to malate, the conversion of malate to pyruvate, and / or the conversion of malate to oxaloacetate.

3. The recombinant microorganism according to claim 2, wherein the gene encoding malate dehydrogenase that catalyzes the conversion of oxaloacetate to malate is the gene mdh from Escherichia coli.

4. The recombinant microorganism according to claim 1, wherein the gene encoding malate thiokinase is sucCD and / or SucCD-2 and / or mtkAB from Methylobacterium sp., Methylobacterium extorquens, Escherichia coli, Thermus thermophiles, Hyphomicrobium sp., Methanocaldococcus jannaschii, Methanothermobacter thermautotrophicus, Rhizobium, Methylococcus capsulatus, or Pseudomonas.

5. The recombinant microorganism according to claim 1, wherein the gene encoding malyl-CoA lyase is mcl and / or Mcl1 and / or mclA from Methylobacterium extorquens, Rhodobacter sphaeroides, Streptomyces, Chloroflexus aurantiacus, Nitrosomonas europaea, Methylococcus capsulans, Nereida ignava, Hyphomicrobium methylovorum, Thalassobius activus, Roseobacter litoralis, Hyphomicrobium denitrificans, R. sphaeroides, Mycobacterium smegmatis or Rhodococcus fascians.

6. The recombinant microorganism according to claim 1, wherein the gene encoding pyruvate carboxylase is pyc from Rhizobium etli, PYC1 or PYC2 from yeast, or pyc from Bacillus subtilis.

7. The recombinant microorganism according to claim 1, wherein the gene encoding phosphoenolpyruvate carboxylase is ppc from Escherichia coli, ppc or pepC from Rhodothermus marinus, ppcA from Methanothermobacter thermoautotrophicus, pep1 from Zea mays, ppc1 / 2 / 3 from Arabidopsis thaliana, ppc from Glycine max, or from Rhodothermus, Corynebacterium, Salmonella, Hyphomicrobium, Streptococcus, Streptomyces, Pantoea, Bacillus, Clostridium, Pseudomonas, Rhodopseudomonas, Nicotiana tabacum, Amaranthus hypochondriacus, Triticum aestivum, or Medicago sativa.

8. The recombinant microorganism according to claim 1, wherein the gene encoding phosphoenolpyruvate carboxykinase is pck or pckA from Escherichia coli, pckA from Selenomonas ruminantium, pckA from Salmonella typhimurium, pckA from Klebsiella sp., pckA from Thermus sp., pck or pckA from Ruminococcus albus and Ruminococcus flavefaciens, pckA from Actinobacillus succinogenes, pck or pckA from Streptococcus bovis, or from Bacillus, Ruminiclostridium thermocellum, Klebsiella, Mycobacterium.

9. The recombinant microorganism according to claim 1, wherein the microorganism comprises: (a) a gene encoding a citric acid hydrolase that converts citric acid to cis-aconitic acid; (b) a gene encoding a D-threo-isocitrate hydrolase or aconitase that converts cis-aconitic acid to isocitric acid; (c) a gene encoding a succinate dehydrogenase that converts succinic acid to fumaric acid; and (d) a gene encoding a fumarase that converts fumaric acid to malic acid.

10. The recombinant microorganism according to claim 1, wherein the microorganism further comprises a deletion of the gene encoding malate synthase, wherein the gene encoding malate synthase is aceB and / or glcB from Escherichia coli.

11. The recombinant microorganism according to claim 1, wherein the gene encoding NADH-dependent or NADPH-dependent glyoxylate reductase is selected from: ycdW and / or yiaE from Escherichia coli, GOR1 from Saccharomyces cerevisiae, gyaR from Thermococcus litoralis, and / or GLYR1 from Arabidopsis thaliana.

12. The recombinant microorganism according to claim 1, wherein the microorganism further comprises a deletion of one or more endogenous genes selected from: (a) a gene encoding isocitrate dehydrogenase, wherein the gene encoding isocitrate dehydrogenase is icd from Escherichia coli; (b) a gene encoding pyruvate dehydrogenase, pyruvate oxidase, and / or pyruvate formate-lyase; (c) a gene encoding pyruvate kinase; and (d) a gene encoding glycolate oxidase.

13. The recombinant microorganism according to claim 1, wherein the microorganism further comprises a deletion of one or more endogenous genes selected from: (a) a gene encoding glyoxylate aldehyde ligase; (b) The gene encoding 2-oxo-4-hydroxypentanedioate aldolase; (c) The gene encoding glycolaldehyde reductase; and (d) The gene encoding the repressor of isocitrate lyase.

14. The recombinant microorganism according to claim 1, wherein the microorganism further comprises a deletion of the endogenous gene encoding glucose-6-phosphate isomerase (pgi).

15. The recombinant microorganism according to claim 1, wherein the citrate synthase gtlA consists of SEQ ID NO:

22.

16. The recombinant microorganism according to claim 1, wherein the pyruvate carboxylase consists of SEQ ID NO:

20.

17. A method for producing glycolic acid using the recombinant microorganism according to claim 1, wherein the method comprises culturing the recombinant microorganism in a medium until glycolic acid is produced, the medium containing a raw material providing a carbon source.

18. The method according to claim 17, wherein the carbon source is selected from: sugars, glycerol, alcohols, organic acids, alkanes, fatty acids, hemicellulose, lignocellulose, proteins, carbon dioxide, and carbon monoxide.

19. The method according to claim 17, wherein the carbon source is hexose and / or pentose.

20. The method according to claim 17, wherein the carbon source is glucose.

21. The method according to claim 17, wherein the carbon source is sucrose.

22. The method according to claim 17, wherein the carbon source is CO 2 or carbonic acid.

Images