Method for differentiating stem cells by regulating MIR-124

Abstract

The present invention provides a method for differentiating trophoblast stem cells by regulating miR-124, and the differentiated cells produced thereby. The present invention also provides a method for treating a disease using the differentiated cells. The differentiated cells are pancreatic progenitor cells that express insulin, beta-opsonin, and C-peptide.

Description

[0001] This application is a divisional application of an invention patent application with an application date of November 26, 2013, application number 201380071949.4, and invention name “Method for differentiating stem cells by regulating MIR-124”.

[0002] Cross-references

[0003] This application claims the benefit of U.S. Provisional Application No. 61 / 732,162, filed November 30, 2012, and U.S. Provisional Application No. 61 / 877,156, filed September 12, 2013, both of which are incorporated herein by reference.

[0004] Sequence Listing

[0005] This application contains a Sequence Listing which has been submitted electronically in ASCII format and is incorporated herein by reference in its entirety. The ASCII copy, created on November 25, 2013, is named 44980-703601_SL.txt and is 26,919 bytes in size. Background Art

[0006] During gastrulation, epiblast cells give rise to primitive streak mesendoderm, which subsequently gives rise to the three germ layers including definitive endoderm (DE). DE differentiates into primitive endoderm, from which the ventral and dorsal pancreatic buds develop into the pancreas. Advanced human embryonic stem (hES) cell research has inspired the vision of generating glucose-sensing and insulin-secreting β-cells to treat type 1 diabetes through DE specification. However, current hES cell methods are time-consuming and complex.

[0007] Incorporation by reference

[0008] All publications, patents, and patent applications herein are incorporated by reference to the same extent as if each individual publication, patent, or patent application was specifically and individually indicated to be incorporated by reference. In the event of a conflict in a terminology herein and that of an incorporated document, the terminology herein controls. Summary of the invention

[0009] The embodiments of the invention provided in this summary are intended to be exemplary only and to provide an overview of the selective embodiments disclosed herein. The summary, which is exemplary and selective, does not limit the scope of any claim, does not provide the entire scope of the embodiments of the invention disclosed or contemplated herein, and should not be interpreted as limiting or restricting the scope of the disclosure or any claimed embodiments of the invention.

[0010] In one aspect of many aspects, there is provided herein a method for differentiating mammalian trophoblast stem cells, the method including regulating miR-124 to induce differentiation of mammalian trophoblast stem cells to differentiated cells. In one case, the mammalian trophoblast stem cells are human trophoblast stem (hTS) cells. In one case, the mammalian trophoblast stem cells herein are from rodents (e.g., mice, rats, guinea pigs, hamsters or squirrels), rabbits, cattle, sheep, pigs, dogs, cats, monkeys, apes (e.g., chimpanzees, gorillas or orangutans) or people. In one case, the differentiated cells are progenitor cells, e.g., pancreatic progenitor cells. In one case, the differentiated cells are pluripotent stem cells. In one case, the differentiated cells are endoderm, mesoderm or ectoderm progenitor cells. In one case, the differentiated cells are definitive endoderm progenitor cells. In one case, the differentiated cells are pancreatic endoderm progenitor cells. In one case, the differentiated cells are multipotent progenitor cells. In one case, the differentiated cells are oligopotent progenitor cells. In one case, the differentiated cell is a unipotent, bipotent or tripotent progenitor cell. In one case, the differentiated cell is an endocrine, exocrine or duct progenitor cell, such as an endocrine progenitor cell. In one case, the differentiated cell is a β-cell. In one case, the differentiated cell is a cell that produces insulin. One or more differentiated cells can be used in any method disclosed herein. In some embodiments, the regulation activates miR-124. In one case, the regulation activates miR-124 in time and space, such as between about 1 hour and about 8 hours in the definitive endoderm stage. In one case, the regulation promotes miR-124 expression. In one case, the regulation inactivates miR-124. In one case, the regulation reduces miR-124 expression. In one case, the regulation includes contacting mammalian trophoblast stem cells with one or more agents such as proteins or steroid hormones. In one case, the one or more agents include growth factors, such as fibroblast growth factor (FGF). In one embodiment, the FGF is FGF1, FGF2, FGF3, FGF4, FGF5, FGF6, FGF7, FGF8, FGF9 or FGF10. In one embodiment, the one or more agents include FGF2 (basic fibroblast growth factor, bFGF). In one embodiment, the concentration of bFGF herein is no more than about 100 ng / mL, such as about 1 to about 100 ng / mL. In one embodiment, the concentration of bFGF herein is about: 1-10, 10-20, 20-30, 30-40, 40-50, 50-60, 50-70, 80-90, or 90-100 ng / mL.In one embodiment, the concentration of bFGF herein is about: 1, 2, 3, 4, 5, 6, 7, 8, 9, 10, 11, 12, 13, 14, 15, 16, 17, 18, 19, 20, 25, 30, 35, 40, 45, 50, 60, 70, 80 or 90 ng / mL. In one embodiment, the one or more agents further include an antioxidant or a reducing agent, such as 2-mercaptoethanol. In one embodiment, the concentration of 2-mercaptoethanol is no more than about 10 mmol / L, such as about 0.1 to about 10 mmol / L. In one embodiment, the concentration of 2-mercaptoethanol is about 0.1-1, 1-2, 2-3, 3-4, 4-5, 5-6, 6-7, 7-8, 8-9 or 9-10 mmol / L. In one instance, the concentration of 2-mercaptoethanol is about: 0.2, 0.5, 1, 1.5, 2, 3, 4, 5, 6, 7, 8 or 9 mmol / L. In one instance, the one or more agents further include a vitamin, such as nicotinamide. In one instance, the concentration of nicotinamide is no greater than about 100 mmol / L, such as about 1 to about 100 mmol / L. In one instance, the concentration of nicotinamide is about: 1-10, 10-20, 20-30, 30-40, 40-50, 50-60, 50-70, 80-90 or 90-100 mmol / L. In one instance, the concentration of nicotinamide is about: 2, 4, 6, 8, 10, 12, 14, 16, 18, 20, 30, 40, 50, 60, 70, 80 or 90 mmol / L. In one case, the regulation includes contacting mammalian trophoblast stem cells with bFGF, 2-mercaptoethanol and nicotinamide. In one case, the one or more agents regulate the activity or expression level of cAMP response element binding protein 1 (CREB1). In one case, the one or more agents regulate CREB1 phosphorylation. In one case, the one or more agents include vitamin metabolites, such as retinoic acid. In one case, the one or more agents include CREB1-binding protein. In one case, the one or more agents regulate one or more factors including mixl1, Cdx2, Oct4, Sox17, Foxa2 or GSK3β. In one case, the one or more agents include exogenous miR-124 precursor or exogenous anti-miR-124. In one case, mammalian trophoblast stem cells are transfected with exogenous miR-124 precursor or exogenous anti-miR-124. In one instance, the cis-regulatory element (CRE) of TGACGTCA (SEQ ID NO: 158) of the promoter of miR-124 is regulated. In one instance, the miR-124 is miR-124a, miR-124b, miR-124c, miR-124d or miR-124e.In one instance, the miR-124 is miR-124a, e.g., Homo sapiens miR-124a (hsa-miR-124a). In one instance, the hsa-miR-124 is hsa-miR-124-5p (SEQ ID NO: 1: CGUGUUCACAGCGGACCUUGAU) or a fragment thereof. In one instance, the hsa-miR-124 is hsa-miR-124-3p (SEQ ID NO: 2: UAAGGCACGCGGUGAAUGCC) or a fragment thereof. In one instance, the miR-124 comprises a sequence selected from Tables 1 and 2 or a fragment thereof. In one instance, the mammalian trophoblast stem cells differentiate into differentiated cells within one day after the start of conditioning.

[0011] In one aspect, the present invention provides one or more differentiated cells separated by one or more methods herein. In one case, the differentiated cells separated are human cells. In one case, the differentiated cells separated have a normal karyotype. In one case, the differentiated cells separated have one or more immune-privileged characteristics, such as low or lack of CD33 expression and / or CD133 expression. One or more differentiated cells separated disclosed herein can be used in any method disclosed herein.

[0012] In another aspect, provided herein is an isolated progenitor cell expressing one or more transcription factors including Foxa2, Pdx1, Ngn3, Ptf1a, Nkx6.1 or any combination thereof. In one case, the isolated progenitor cell is an induced pluripotent stem cell. In one case, the isolated progenitor cell is derived from a mammalian trophoblast stem cell, such as an hTS cell. In one case, the isolated progenitor cell is a pancreatic progenitor cell. In one case, the isolated progenitor cell is an endoderm, mesoderm or ectoderm progenitor cell. In one case, the isolated progenitor cell is a definitive endoderm progenitor cell. In one case, the isolated progenitor cell is a pancreatic endoderm progenitor cell. In one case, the isolated progenitor cell is a multipotent progenitor cell. In one case, the isolated progenitor cell is an oligopotent progenitor cell. In one case, the isolated progenitor cell is a unipotent, bipotent or tripotent progenitor cell. In one case, the isolated progenitor cell is an endocrine, exocrine or tubular progenitor cell, such as an endocrine progenitor cell. In one case, the isolated progenitor cell is a β-cell. In one case, the progenitor cell of separation is a cell that produces insulin. In one case, the progenitor cell of separation is from a rodent (e.g., mouse, rat, guinea pig, hamster, squirrel), rabbit, cattle, sheep, pig, dog, cat, monkey, ape (e.g., chimpanzee, gorilla, orangutan) or human. In one case, the progenitor cell of separation is a human cell. In one case, the progenitor cell of separation has a normal karyotype. In one case, the progenitor cell of separation has one or more characteristics of immune pardon, such as low or lack of CD33 expression and / or CD133 expression. The progenitor cell of separation disclosed herein can be used in any method disclosed herein.

[0013] In another aspect, the present invention provides a progenitor cell expressing betatrophin, betatrophin mRNA, C-peptide or insulin, wherein the progenitor cell of the separation is differentiated from a mammalian trophoblast stem cell. In one case, the progenitor cell of separation is from a rodent (e.g., mouse, rat, guinea pig, hamster, squirrel), rabbit, cattle, sheep, pig, dog, cat, monkey, ape (e.g., chimpanzee, gorilla, orangutan) or human. In one case, the progenitor cell of separation is a pancreatic progenitor cell. In one case, the progenitor cell of separation is a human cell. In one case, the progenitor cell of separation has a normal karyotype. In one case, the progenitor cell of separation has one or more characteristics of immune pardon, for example, low or lacking CD33 expression and / or CD133 expression. The progenitor cell of one or more separations disclosed herein can be used in any method disclosed herein.

[0014] In one instance, the isolated progenitor cells herein are insulin-producing cells.One or more isolated progenitor cells herein can be used in any of the methods disclosed herein.

[0015] In one instance, the differentiated cells herein are insulin-producing cells.One or more differentiated cells herein can be used in any of the methods disclosed herein.

[0016] In one aspect, provided herein is a method for screening a substance for treating or preventing a disease, the method comprising: a) contacting at least one isolated progenitor cell herein with the substance; and b) detecting a change in the level of at least one transcript or protein in the isolated progenitor cell.

[0017] In one case, the level of at least one transcript or protein in the isolated progenitor cell is reduced compared to a corresponding isolated progenitor cell not contacted with the substance. In one case, the level of at least one transcript or protein in the isolated progenitor cell is increased compared to a corresponding isolated progenitor cell not contacted with the substance. In one case, the disease is an insulin disorder. In one case, the disease is diabetes, such as type 1 diabetes or type 2 diabetes.

[0018] In one aspect, the present invention provides a method for screening a substance for cytotoxicity or regulation of a cell, the method comprising: a) contacting at least one isolated progenitor cell of the present invention with the substance; b) determining the phenotypic and / or metabolic changes of the isolated progenitor cell caused by contact with the substance; and c) correlating the changes with cytotoxicity or regulation. In one case, the cell is an insulin-producing cell. In one case, the substance is a drug. In one case, the substance is a chemical. In one case, the substance is an antibody or a fragment thereof. In one case, the substance is added to a culture medium. In one case, the method comprises determining the effect of the substance on the growth of the isolated progenitor cell. In one case, the method comprises determining whether the substance affects the expression of a marker or receptor of the isolated progenitor cell. In some embodiments, the isolated progenitor cell is a pancreatic progenitor cell.

[0019] In one aspect, provided herein is a method for treating or preventing a disease in a mammal in need, the method comprising administering the progenitor cells separated herein to a mammal in need. In one case, the progenitor cells separated are immune-pardoned. In one case, the progenitor cells separated have low levels of CD33 expression and / or CD133 expression. In one case, the administration includes injection, implantation or surgical operation. In one case, the disease is an insulin disorder. In one case, the disease is diabetes, such as type 1 diabetes or type 2 diabetes. In one case, the mammal in need is a mouse, rat, pig, dog, monkey, gorilla, ape or human. In one case, the mammal in need has one or more symptoms associated with diabetes, such as polyuria (frequent urination), polydipsia (increased thirst), polyphagia (increased hunger), weight loss, blurred vision, itching, peripheral neuropathy, recurrent vaginal infection, fatigue, slow healing of wounds or ulcers and any combination thereof. In some embodiments, the progenitor cells separated are pancreatic progenitor cells.

[0020] In one aspect, the present invention provides a method for producing insulin, the method includes contacting mammalian trophoblast stem cells with one or more agents to activate miR-124, thereby producing a separated progenitor cell that secretes insulin in response to glucose stimulation. In another aspect, the present invention provides a method for producing β-opsonin protein and / or β-opsonin mRNA, the method includes contacting mammalian trophoblast stem cells with one or more agents to activate miR-124, thereby producing pancreatic progenitor cells, which produce β-opsonin protein and / or β-opsonin mRNA. In one case, β-opsonin protein or β-opsonin mRNA is produced during about 12-28 hours after induction, for example, during about 12-16, 16-20, 20-24 or 24-28 hours after induction. In one case, the separated progenitor cell is a pancreatic progenitor cell. In one case, the separated progenitor cell produces C-peptide and / or insulin. In some embodiments, the mammalian trophoblast stem cell is an hTS cell. In some embodiments, the mammalian trophoblast stem cells herein are from rodents, rabbits, cattle, sheep, pigs, dogs, cats, monkeys or apes. In some embodiments, the rodents herein are mice, rats, guinea pigs, hamsters or squirrels. In some embodiments, the apes herein are chimpanzees, gorillas or orangutans. In some embodiments, miR-124 is activated in time and space at the definitive endoderm stage, for example, between about 1 hour and about 8 hours at the definitive endoderm stage. In some embodiments, the expression of miR-124 is improved. In some embodiments, the one or more agents include proteins or steroid hormones, such as growth factors. In some embodiments, the growth factor is fibroblast growth factor (FGF), such as FGF1, FGF2 (bFGF), FGF3, FGF4, FGF5, FGF6, FGF7, FGF8, FGF9 or FGF10. In some embodiments, the one or more agents include bFGF (basic fibroblast growth factor). In some embodiments, bFGF is not more than about 100ng / mL, for example, about 1 to about 100ng / mL. In some embodiments, the concentration of bFGF used herein is about: 1-10, 10-20, 20-30, 30-40, 40-50, 50-60, 50-70, 80-90 or 90-100ng / mL. In some embodiments, the concentration of bFGF used herein is about: 1, 2, 3, 4, 5, 6, 7, 8, 9, 10, 11, 12, 13, 14, 15, 16, 17, 18, 19, 20, 25, 30, 35, 40, 45, 50, 60, 70, 80 or 90ng / mL. In some embodiments, bFGF is about 10ng / mL. In some embodiments, the one or more agents further include an antioxidant or a reducing agent (e.g., 2-mercaptoethanol).In some embodiments, the one or more agents further include vitamins (e.g., nicotinamide). In some embodiments, mammalian trophoblast stem cells are contacted with bFGF, 2-mercaptoethanol, and nicotinamide. In some embodiments, the concentration of 2-mercaptoethanol is no more than about 10 mmol / L, for example, from about 0.1 to about 10 mmol / L. In some embodiments, the concentration of 2-mercaptoethanol is about: 0.1-1, 1-2, 2-3, 3-4, 4-5, 5-6, 6-7, 7-8, 8-9 or 9-10 mmol / L. In some embodiments, the concentration of 2-mercaptoethanol is about: 0.2, 0.5, 1, 1.5, 2, 3, 4, 5, 6, 7, 8 or 9 mmol / L. In some embodiments, 2-mercaptoethanol is about 1 mmol / L. In some embodiments, the concentration of nicotinamide is no more than about 100 mmol / L, for example, from about 1 to about 100 mmol / L. In some embodiments, the concentration of nicotinamide is about: 1-10, 10-20, 20-30, 30-40, 40-50, 50-60, 50-70, 80-90 or 90-100 mmol / L. In some embodiments, the concentration of nicotinamide is about: 2, 4, 6, 8, 10, 12, 14, 16, 18, 20, 30, 40, 50, 60, 70, 80 or 90 mmol / L. In some embodiments, nicotinamide is about 10 mmol / L. In some embodiments, mammalian trophoblast stem cells are contacted with one or more agents to modulate the activity or expression level of CAMP response element binding protein 1 (CREB1), such as CREB1 phosphorylation. In some embodiments, the one or more agents include vitamin metabolites, such as retinoic acid. In some embodiments, the one or more agents include CREB1-binding protein. In some embodiments, the one or more agents regulate one or more factors selected from mixl1, Cdx2, Oct4, Sox17, Foxa2 and GSK3β. In some embodiments, the miR-124 herein is miR-124a, miR-124b, miR-124c, miR-124d or miR-124e, such as miR-124a. In some embodiments, miR-124a is Homo sapiens miR-124a (hsa-miR-124a), such as hsa-miR-124-5p (SEQ ID NO: 1: CGUGUUCACAGCGGACCUUGAU) or hsa-miR-124-3p (SEQ ID NO: 2: UAAGGCACGCGGUGAAUGCC) or a fragment thereof. In some embodiments, miR-124 comprises a sequence selected from Table 1 and Table 2 or a fragment thereof.

[0021] The present invention also relates to the following items:

[0022] 1. A method for differentiating mammalian trophoblast stem cells, comprising regulating miR-124 to induce the differentiation of the mammalian trophoblast stem cells into differentiated cells.

[0023] 2. The method according to item 1, wherein the mammalian trophoblast stem cells are human trophoblast stem cells (hTS cells).

[0024] 3. The method according to item 1, wherein the mammalian trophoblast stem cells are from rodents, rabbits, cows, sheep, pigs, dogs, cats, monkeys or apes.

[0025] 4. The method according to any one of items 1 to 3, wherein the differentiated cells are progenitor cells.

[0026] 5. The method according to item 4, wherein the differentiated cells are pancreatic progenitor cells.

[0027] 6. The method according to any one of items 1 to 3, wherein the differentiated cells are pluripotent stem cells.

[0028] 7. The method according to any one of items 1-3, wherein the differentiated cells are endodermal, mesodermal or ectodermal progenitor cells.

[0029] 8. The method according to any one of items 1-3, wherein the differentiated cells are definitive endoderm progenitor cells.

[0030] 9. The method according to any one of items 1-3, wherein the differentiated cells are pancreatic endoderm progenitor cells.

[0031] 10. The method according to any one of items 1 to 3, wherein the differentiated cells are multipotent progenitor cells.

[0032] 11. The method according to any one of items 1-3, wherein the differentiated cells are oligopotent progenitor cells.

[0033] 12. The method according to any one of items 1-3, wherein the differentiated cells are unipotent, bipotent or tripotent progenitor cells.

[0034] 13. The method according to any one of items 1 to 3, wherein the differentiated cells are endocrine, exocrine or tubular progenitor cells.

[0035] 14. The method according to item 13, wherein the differentiated cells are endocrine progenitor cells.

[0036] 15. The method according to any one of items 1-3, wherein the differentiated cells are β-cells.

[0037] 16. The method according to any one of items 1-15, wherein the differentiated cells are insulin-producing cells.

[0038] 17. A method according to any one of items 1-16, wherein the modulation activates miR-124.

[0039] 18. The method according to item 17, wherein miR-124 is activated spatiotemporally at the definitive endoderm stage.

[0040] 19. The method according to item 18, wherein miR-124 is activated between about 1 hour and about 8 hours at the definitive endoderm stage.

[0041] 20. The method according to any one of items 1-16, wherein the modulation increases miR-124 expression.

[0042] 21. A method according to any one of items 1-16, wherein the modulation inactivates miR-124.

[0043] 22. The method according to any one of items 1-16, wherein the modulation reduces miR-124 expression.

[0044] 23. A method according to any one of items 1-22, wherein the modulation comprises contacting the mammalian trophoblast stem cells with one or more agents.

[0045] 24. The method of claim 23, wherein the one or more agents comprise a protein or a steroid hormone.

[0046] 25. The method according to item 24, wherein the protein or steroid hormone comprises a growth factor.

[0047] 26. The method according to item 25, wherein the growth factor is fibroblast growth factor (FGF).

[0048] 27. The method according to item 26, wherein the FGF is FGF1, FGF2 (bFGF), FGF3, FGF4, FGF5, FGF6, FGF7, FGF8, FGF9 or FGF10.

[0049] 28. The method according to item 27, wherein the FGF is bFGF (basic fibroblast growth factor).

[0050] 29. The method of item 28, wherein the concentration of bFGF is no greater than about 100 ng / mL.

[0051] 30. The method of item 29, wherein the concentration of bFGF is about 1 to about 100 ng / mL.

[0052] 31. The method of claim 30, wherein the concentration of bFGF is about: 1-10, 10-20, 20-30, 30-40, 40-50, 50-60, 50-70, 80-90 or 90-100 ng / mL.

[0053] 32. The method of claim 31, wherein the concentration of bFGF is about: 1, 2, 3, 4, 5, 6, 7, 8, 9, 10, 11, 12, 13, 14, 15, 16, 17, 18, 19, 20, 25, 30, 35, 40, 45, 50, 60, 70, 80 or 90 ng / mL.

[0054] 33. The method of claim 32, wherein the concentration of bFGF is about 10 ng / mL.

[0055] 34. A method according to any one of items 24-33, wherein the one or more agents further include an antioxidant or a reducing agent.

[0056] 35. The method according to item 34, wherein the antioxidant or reducing agent is 2-mercaptoethanol.

[0057] 36. The method of claim 35, wherein the concentration of 2-mercaptoethanol is no greater than about 10 mmol / L.

[0058] 37. The method of item 36, wherein the concentration of 2-mercaptoethanol is about 0.1 to about 10 mmol / L.

[0059] 38. The method of claim 37, wherein the concentration of 2-mercaptoethanol is about: 0.1-1, 1-2, 2-3, 3-4, 4-5, 5-6, 6-7, 7-8, 8-9 or 9-10 mmol / L.

[0060] 39. The method of claim 38, wherein the concentration of 2-mercaptoethanol is about: 0.2, 0.5, 1, 1.5, 2, 3, 4, 5, 6, 7, 8 or 9 mmol / L.

[0061] 40. The method according to item 39, wherein the concentration of 2-mercaptoethanol is about 1 mmol / L.

[0062] 41. The method of any one of items 24-40, wherein the one or more agents further comprise vitamins.

[0063] 42. The method according to item 41, wherein the vitamin is niacinamide.

[0064] 43. The method of claim 42, wherein the concentration of nicotinamide is no greater than about 100 mmol / L.

[0065] 44. The method of item 43, wherein the concentration of nicotinamide is about 1 to about 100 mmol / L.

[0066] 45. The method of claim 44, wherein the concentration of nicotinamide is about: 1-10, 10-20, 20-30, 30-40, 40-50, 50-60, 50-70, 80-90 or 90-100 mmol / L.

[0067] 46. ​​The method of claim 45, wherein the concentration of nicotinamide is about: 2, 4, 6, 8, 10, 12, 14, 16, 18, 20, 30, 40, 50, 60, 70, 80 or 90 mmol / L.

[0068] 47. The method according to item 46, wherein the concentration of nicotinamide is about 10 mmol / L.

[0069] 48. The method according to item 23, wherein one or more agents modulate the activity or expression level of CAMP response element binding protein 1 (CREB1).

[0070] 49. The method of item 48, wherein the one or more agents modulate CREB1 phosphorylation.

[0071] 50. The method of claim 48 or 49, wherein the one or more agents comprise vitamin metabolites.

[0072] 51. The method according to item 50, wherein the vitamin metabolite is retinoic acid.

[0073] 52. The method according to item 48 or 49, wherein the one or more agents include a CREB1-binding protein.

[0074] 53. A method according to any one of items 23-52, wherein the one or more agents modulate one or more factors including mixl1, Cdx2, Oct4, Sox17, Foxa2 or GSK3β.

[0075] 54. A method according to item 23, wherein the one or more agents include exogenous miR-124 precursor or exogenous anti-miR-124.

[0076] 55. The method according to item 54, wherein the mammalian trophoblast stem cells are transfected with exogenous miR-124 precursor or exogenous anti-miR-124.

[0077] 56. The method according to item 55, wherein the cis-regulatory element (CRE) of TGACGTCA (SEQ ID NO: 158) of the promoter of miR-124 is regulated.

[0078] 57. A method according to any one of the preceding items, wherein the miR-124 is miR-124a, miR-124b, miR-124c, miR-124d or miR-124e.

[0079] 58. A method according to item 57, wherein the miR-124 is miR-124a.

[0080] 59. A method according to item 58, wherein the miR-124a is Homo sapiens miR-124a (hsa-miR-124a).

[0081] 60. A method according to item 59, wherein the hsa-miR-124a is hsa-miR-124-5p (SEQ ID NO: 1: CGUGUUCACAGCGGACCUUGAU) or a fragment thereof.

[0082] 61. A method according to item 59, wherein the hsa-miR-124a is hsa-miR-124-3p (SEQ ID NO: 2: UAAGGCACGCGGUGAAUGCC) or a fragment thereof.

[0083] 62. A method according to any one of items 1-55, wherein the miR-124 comprises a sequence or a fragment thereof selected from Table 1 and Table 2.

[0084] 63. A method according to any one of items 1-62, wherein the mammalian trophoblast stem cells differentiate into differentiated cells within one day after the start of the conditioning.

[0085] 64. A differentiated cell isolated according to any one of items 1-63.

[0086] 65. An isolated progenitor cell expressing one or more transcription factors comprising Foxa2, Pdx1, Ngn3, Ptf1a, Nkx6.1, or any combination thereof.

[0087] 66. The isolated progenitor cell according to item 65, wherein the isolated progenitor cell is derived from an induced pluripotent stem cell.

[0088] 67. The isolated progenitor cell according to item 65, wherein the isolated progenitor cell is derived from a mammalian trophoblast stem cell.

[0089] 68. The isolated progenitor cell of item 67, wherein the mammalian trophoblast stem cell is from a rodent, rabbit, cow, sheep, pig, dog, cat, monkey, ape or human.

[0090] 69. The isolated progenitor cell according to item 65, wherein the isolated progenitor cell is derived from hTS cells.

[0091] 70. The isolated progenitor cell according to any one of items 65-69, wherein the isolated progenitor cell is a pancreatic progenitor cell.

[0092] 71. An isolated progenitor cell according to any one of items 65-69, wherein the isolated progenitor cell is an endodermal, mesodermal or ectodermal progenitor cell.

[0093] 72. The isolated progenitor cell according to any one of items 65-69, wherein the isolated progenitor cell is a definitive endoderm progenitor cell.

[0094] 73. An isolated progenitor cell according to any one of items 65-69, wherein the isolated progenitor cell is a pancreatic endoderm progenitor cell.

[0095] 74. An isolated progenitor cell according to any one of items 65-69, wherein the isolated progenitor cell is a multipotent progenitor cell.

[0096] 75. An isolated progenitor cell according to any one of items 65-69, wherein the isolated progenitor cell is an oligopotent progenitor cell.

[0097] 76. An isolated progenitor cell according to any one of items 65-69, wherein the isolated progenitor cell is a unipotent, bipotent or tripotent progenitor cell.

[0098] 77. An isolated progenitor cell according to any one of items 65-69, wherein the isolated progenitor cell is an endocrine, exocrine or tubular progenitor cell.

[0099] 78. The isolated progenitor cell according to item 77, wherein the isolated progenitor cell is an endocrine progenitor cell.

[0100] 79. An isolated progenitor cell according to any one of items 65-69, wherein the isolated progenitor cell is a β-cell.

[0101] 80. An isolated progenitor cell according to any one of items 65-79, wherein the isolated progenitor cell is an insulin-producing cell.

[0102] 81. An isolated progenitor cell expressing beta-opsonin, beta-opsonin mRNA, C-peptide or insulin, wherein the isolated progenitor cell is differentiated from a mammalian trophoblast stem cell.

[0103] 82. An isolated progenitor cell according to any one of items 65-81, wherein the isolated progenitor cell is a human cell.

[0104] 83. An isolated progenitor cell according to any one of items 65-81, wherein the isolated progenitor cell is from a rodent, rabbit, cow, sheep, pig, dog, cat, monkey or ape.

[0105] 84. An isolated progenitor cell according to any one of items 65-82, wherein the isolated progenitor cell has a normal karyotype.

[0106] 85. An isolated progenitor cell according to any one of items 65-84, wherein the isolated progenitor cell has one or more immune privileged properties.

[0107] 86. The isolated progenitor cell of item 85, wherein the one or more immune privileged properties include low or absent CD33 expression or CD133 expression.

[0108] 87. A method for screening a substance for treating a disease, comprising:

[0109] a) contacting the isolated progenitor cells according to any one of items 65-86 with said substance; and

[0110] b) detecting a change in the level of at least one transcript or protein in said isolated progenitor cells.

[0111] 88. A method according to item 87, wherein the level of at least one transcript or protein in the isolated progenitor cells is reduced compared to corresponding isolated progenitor cells that have not been contacted with the substance.

[0112] 89. A method according to item 87, wherein the level of at least one transcript or protein in the isolated progenitor cells is increased compared to corresponding isolated progenitor cells that have not been contacted with the substance.

[0113] 90. A method according to any one of items 87-89, wherein the disease is an insulin disorder.

[0114] 91. The method according to item 90, wherein the disease is diabetes.

[0115] 92. A method according to item 91, wherein the disease is type 1 diabetes.

[0116] 93. A method according to item 91, wherein the disease is type 2 diabetes.

[0117] 94. A method according to any one of items 87-93, wherein the isolated progenitor cells are pancreatic progenitor cells.

[0118] 95. A method for screening a substance for cell regulation of a cell, comprising:

[0119] a) contacting the isolated progenitor cells according to any one of items 65-86 with said substance;

[0120] b) determining a phenotypic or metabolic change in the isolated progenitor cell resulting from contact with the substance; and

[0121] c) correlating said changes to cellular regulation.

[0122] 96. A method for screening a substance for cytotoxicity to a cell, comprising:

[0123] a) contacting the isolated progenitor cells according to any one of items 65-86 with said substance;

[0124] b) determining a phenotypic or metabolic change in the isolated progenitor cell resulting from contact with the substance; and

[0125] c) correlating said changes with cytotoxicity.

[0126] 97. The method according to item 95 or 96, wherein the substance is a drug.

[0127] 98. The method according to item 97, wherein the substance is a hormone, a steroid or an antibody or a fragment thereof.

[0128] 99. The method according to item 95 or 96, wherein the substance is a chemical.

[0129] 100. The method according to any one of items 95-98, wherein the substance is added to the culture medium.

[0130] 101. A method according to any one of items 95-99, wherein the change is the growth of the isolated progenitor cells.

[0131] 102. A method according to any one of items 95-101, wherein the change is in the expression of a marker or receptor by the isolated progenitor cells.

[0132] 103. A method according to any one of items 95-101, wherein the isolated progenitor cells are pancreatic progenitor cells.

[0133] 104. A method of treating a disease in a mammal in need thereof, comprising administering to the mammal in need thereof the isolated progenitor cells according to any one of items 65-86.

[0134] 105. A method according to item 104, wherein the isolated progenitor cells are immune privileged.

[0135] 106. A method according to item 105, wherein the immune privilege comprises low or absent CD33 expression or CD133 expression.

[0136] 107. A method according to any one of items 104-106, wherein the disease is an insulin disorder.

[0137] 108. The method according to item 107, wherein the disease is diabetes.

[0138] 109. The method according to item 108, wherein the disease is type 1 diabetes or type 2 diabetes.

[0139] 110. The method of any one of items 104-109, wherein the mammal in need thereof has one or more symptoms associated with diabetes.

[0140] 111. The method of claim 110, wherein the one or more symptoms are selected from polyuria (frequent urination), polydipsia (increased thirst), polyphagia (increased hunger), weight loss, blurred vision, itching, peripheral neuropathy, recurrent vaginal infections, fatigue, slow healing of wounds or ulcers, and any combination thereof.

[0141] 112. The method of any one of items 104-111, wherein the mammal in need thereof is a rodent, rabbit, cow, sheep, pig, dog, cat, monkey or ape.

[0142] 113. A method according to any one of items 104-111, wherein the mammal in need is a human.

[0143] 114. A method according to any one of items 104-113, wherein the administration comprises injection or implantation.

[0144] 115. A method according to any one of items 104-114, wherein the isolated progenitor cells are pancreatic progenitor cells.

[0145] 116. A method of producing insulin comprising contacting mammalian trophoblast stem cells with one or more agents to activate miR-124, thereby generating progenitor cells that secrete insulin in response to glucose stimulation.

[0146] 117. A method of producing beta-opsonin protein or beta-opsonin mRNA, comprising contacting mammalian trophoblast stem cells with one or more agents to activate miR-124, thereby producing progenitor cells that produce beta-opsonin protein or beta-opsonin mRNA.

[0147] 118. The method according to item 117, wherein the beta-opsonin protein or beta-opsonin mRNA is produced during about 12-28 hours after induction.

[0148] 119. A method according to item 118, wherein the beta-opsonin protein or beta-opsonin mRNA is produced during about 12-16, 16-20, 20-24 or 24-28 hours after induction.

[0149] 120. A method according to any one of items 117-119, wherein the progenitor cells produce C-peptide or insulin.

[0150] 121. A method according to any one of items 116-120, wherein the progenitor cells are pancreatic progenitor cells.

[0151] 122. A method according to any one of items 116-121, wherein the mammalian trophoblast stem cells are hTS cells.

[0152] 123. A method according to any one of items 116-121, wherein the mammalian trophoblast stem cells are from a rodent, rabbit, cow, sheep, pig, dog, cat, monkey or ape.

[0153] 124. A method according to any one of items 116-122, wherein miR-124 is activated spatiotemporally at the definitive endoderm stage.

[0154] 125. The method of item 123, wherein miR-124 is activated between about 1 hour and about 8 hours at the definitive endoderm stage.

[0155] 126. A method according to any one of items 116-125, wherein activation of miR-124 comprises increased expression of miR-124.

[0156] 127. A method according to any one of items 116-126, wherein the one or more agents include a protein or a steroid hormone.

[0157] 128. A method according to item 127, wherein the protein or steroid hormone comprises a growth factor.

[0158] 129. A method according to item 128, wherein the growth factor is FGF.

[0159] 130. A method according to item 129, wherein the FGF is FGF1, FGF2 (bFGF), FGF3, FGF4, FGF5, FGF6, FGF7, FGF8, FGF9 or FGF10.

[0160] 131. A method according to item 130, wherein the FGF is bFGF.

[0161] 132. The method of claim 131, wherein the concentration of bFGF is no greater than about 100 ng / mL.

[0162] 133. The method of claim 132, wherein the concentration of bFGF is about 1 to about 100 ng / mL.

[0163] 134. The method of claim 133, wherein the concentration of bFGF is about: 1-10, 10-20, 20-30, 30-40, 40-50, 50-60, 50-70, 80-90 or 90-100 ng / mL.

[0164] 135. The method of claim 134, wherein the concentration of bFGF is about: 1, 2, 3, 4, 5, 6, 7, 8, 9, 10, 11, 12, 13, 14, 15, 16, 17, 18, 19, 20, 25, 30, 35, 40, 45, 50, 60, 70, 80 or 90 ng / mL.

[0165] 136. The method of claim 135, wherein the concentration of bFGF is about 10 ng / mL.

[0166] 137. A method according to any one of items 127-136, wherein the one or more agents further include an antioxidant or a reducing agent.

[0167] 138. A method according to item 137, wherein the antioxidant or reducing agent is 2-mercaptoethanol.

[0168] 139. The method of claim 138, wherein the concentration of 2-mercaptoethanol is no greater than about 10 mmol / L.

[0169] 140. The method according to item 139, wherein the concentration of 2-mercaptoethanol is about 0.1 to about 10 mmol / L.

[0170] 141. The method of claim 140, wherein the concentration of 2-mercaptoethanol is about: 0.1-1, 1-2, 2-3, 3-4, 4-5, 5-6, 6-7, 7-8, 8-9 or 9-10 mmol / L.

[0171] 142. A method according to claim 141, wherein the concentration of 2-mercaptoethanol is about: 0.2, 0.5, 1, 1.5, 2, 3, 4, 5, 6, 7, 8 or 9 mmol / L.

[0172] 143. The method according to claim 142, wherein the concentration of 2-mercaptoethanol is about 1 mmol / L.

[0173] 144. A method according to any one of items 127-143, wherein the one or more agents further include vitamins.

[0174] 145. The method of claim 144, wherein the vitamin is niacinamide.

[0175] 146. The method of item 145, wherein the concentration of nicotinamide is about 100 mmol / L or less.

[0176] 147. The method of item 146, wherein the concentration of nicotinamide is about 1 to about 100 mmol / L.

[0177] 148. The method of claim 147, wherein the concentration of nicotinamide is about: 1-10, 10-20, 20-30, 30-40, 40-50, 50-60, 50-70, 80-90 or 90-100 mmol / L.

[0178] 149. The method of claim 148, wherein the concentration of nicotinamide is about: 2, 4, 6, 8, 10, 12, 14, 16, 18, 20, 30, 40, 50, 60, 70, 80 or 90 mmol / L.

[0179] 150. The method of item 149, wherein the concentration of nicotinamide is about 10 mmol / L.

[0180] 151. A method according to any one of items 116-126, wherein the one or more agents modulate the activity or expression level of CAMP response element binding protein 1 (CREB1).

[0181] 152. A method according to item 151, wherein the one or more agents regulate CREB1 phosphorylation.

[0182] 153. A method according to item 151 or 152, wherein the one or more agents include vitamin metabolites.

[0183] 154. A method according to item 153, wherein the vitamin metabolite is retinoic acid.

[0184] 155. A method according to item 151 or 152, wherein the one or more agents include a CREB1-binding protein.

[0185] 156. A method according to any one of items 116-155, wherein the one or more agents regulate one or more factors selected from mixl1, Cdx2, Oct4, Sox17, Foxa2 and GSK3β.

[0186] 157. A method according to any one of items 116-156, wherein the miR-124 is miR-124a, miR-124b, miR-124c, miR-124d or miR-124e.

[0187] 158. A method according to item 157, wherein the miR-124 is miR-124a.

[0188] 159. A method according to item 158, wherein the miR-124a is Homo sapiens miR-124a (hsa-miR-124a).

[0189] 160. A method according to item 159, wherein the hsa-miR-124 is hsa-miR-124-5p (SEQ ID NO: 1: CGUGUUCACAGCGGACCUUGAU) or a fragment thereof.

[0190] 161. A method according to item 159, wherein the hsa-miR-124 is hsa-miR-124-3p (SEQ ID NO: 2: UAAGGCACGCGGUGAAUGCC) or a fragment thereof.

[0191] 162. A method according to any one of items 116-156, wherein the miR-124 comprises a sequence or a fragment thereof selected from Table 1 and Table 2. BRIEF DESCRIPTION OF THE DRAWINGS

[0192] Figures 1A to 1C is a set of diagrams illustrating the pathway from hTS cells to pancreatic progenitor cells. Figure 1A The time-course profile of pancreatic development-related transcription factors during the differentiation of hTS cells into pancreatic progenitor cells is shown. Data represent mean ± SD, n = 3 independent experiments, ★ p<0.05 (t-test). Figure 1B Shown are the changes in Mixl1 intensity during DE formation. Figure 1C shows the segregation of mesendoderm into two cell populations: one expressing Pdx1 specific to mesoderm + Mixl1+ , while the other expresses Pdx1, which is targeted to the endoderm + Mixl1 - .

[0193] FIG. 2A to FIG. 2C is a set of images showing the dynamic distribution of pluripotency transcription factors during pancreatic differentiation. Figure 2A The transition of unique pluripotency transcription factors in each stage-specific cell phase is shown. Data represent mean ± SD, n = 3 independent experiments, ★ p<0.05 (t-test). Figure 2B Immunofluorescence images of Mixl1, Cdx2, and Oct4 during the transition to DE are shown. Figure 2C Immunofluorescence images of Oct4, a representative marker of DE stage, are shown.

[0194] FIG. 3A to FIG. 3M is a set of figures illustrating the biological origin and multifaceted functions of miR-124a. Figure 3A is a mechanistic illustration of the regulation of DE formation and β-opsonin activation. Figure 3B The correlation between miR-124a and p-CREB1 expression observed over time is shown, and it is shown that the active PI3K / Akt / CREB1 signaling pathway targets different sites of miR-124a. Figure 3C Shown are the parallel expression of p-CREB1 and miR-124a determined by qPCR assay, as well as the promoter regions of miR-124-2 containing CREB1-binding site 1 (acgccgtcatt, SEQ ID NO: 148) and site 2 (ggtgacgtcagc, SEQ ID NO: 149) and miR-124-3 containing a CREB1-binding site (ggtgacgtcacc, SEQ ID NO: 150) quantified by CREB1 ChIP and qPCR. Figures 3D to 3F The construction of plasmids used for luciferase reporter assay is shown: Figure 3D pGL4.51-Luc reporter constructs for Smad4 3'UTR containing common binding sites Smad4(1) (5'-guuuguccagugccuuu-3', SEQ ID NO: 151) and Smad4(2) (5'-auccagaauugccuua-3', SEQ ID NO: 152) targeting miR-124a (SEQ ID NO: 2, presented in 3 to 5 orientation) are shown; Figure 3EpGL4.51-Luc reporter construct for Cdx2 3′UTR (5′-gggaguauuugaacaca-3′, SEQ ID NO: 153) targeting hsa-miR-124a (5′-cguguucacagcggacc-3′, SEQ ID NO: 154, a fragment of SEQ ID NO: 1) is shown; Figure 3F The pGL4.51-Luc reporter construct for GSK3β 3'UTR (5'-guuuggagugccuuc-3', SEQ ID NO: 155) targeting miR-124a (5'-uaaggcacgcgguga-3', SEQ ID NO: 156, a fragment of SEQ ID NO: 2) is shown. Data are presented as mean ± SD, n = 5, ★ p<0.05 (t test). Cells transfected with nonspecific shRNA were used as positive control. Empty vector was used as negative control. Figure 3G Shown are the effects of pre-transfection of miR124a or anti-miR-124a on the induced expressions of Smad4, Mixl1, Cdx2, GSK3β, and Oct4. Figure 3H Oct4 targeting of gene Sox17 to produce Sox17 at 4 hr (arrow) is shown. Input: positive control, IgG: negative control. Fig. 3I It is shown that β-catenin targets the gene Foxa2 (cctgtttgttttagtt, SEQ ID NO: 157) in the ChIP assay to significantly produce Foxa2 (4 hr) (arrow). Input: positive control, IgG: negative control. Figure 3J -M shows the synthesis and regulation of beta-opsonin: Figure 3J It is shown that Foxa2 targets the gene C19orf80 to produce β-opsonin (arrow) according to ChIP assay; Figure 3K Shown is a transient increase in β-opsonin mRNA at 16 hr (normalized to glyceraldehyde-3-phosphate dehydrogenase) according to qPCR analysis. Figure 3L is a set of Western blot data showing parallel correlations between β-opsonin, C-peptide, and insulin. Data are expressed as mean ± SD, n = 3, ★ p<0.05 (t-test). Figure 3M Immunofluorescence co-expression of β-opsonin and insulin over 24 hr induction is shown.

[0195] FIG. 4A to FIG. 4E is a set of graphs showing the properties of hTS cell-derived pancreatic progenitor cells. FIG. 4A to FIG. 4C An in vitro functional glucose stimulation assay is shown. Figure 4AShown is the response of cells to high glucose concentration (15 mM, grey bars) to produce immunoreactive insulin as determined by ELISA. Figure 4B is a representative excerpt of a set of images showing morphological changes and positive DTZ staining recorded by a computer-microscope-video system (Olympus, IX-81, DP30, MIU-IBC-IF-2). Figure 4C According to radioimmunoassay, high glucose (25 mM) stimulated the expression of 7.6 ng / hr / 10 6 The cells produced C-peptide (indicated by the upper line) at a rate of 393.8 μIU / hr / 10 6 The cells produced insulin (indicated by the line below). Data were measured by area under the curve and expressed as mean ± SD, n = 5. ★ p<0.05 (t-test). Figure 4D A set of ultrastructural micrographs of grape-like cell clusters after high glucose stimulation. White arrows in the middle image: desmosome junctions. Bottom arrows: β-insulin granules (β-G). Two upper arrows: α-glucagon granules (α-G). N: nucleus. Im-G: immature granules. M: mitochondria. RER: rough endoplasmic reticulum. Figure scale bar: 1 μm. Figure 4E Immunofluorescence staining of pancreatic progenitor cell markers at 24 hr after bFGF induction in hTS cells is shown. Control staining is not shown.

[0196] Figure 5 is a bar graph showing the induction efficacy of various combinations of factors including bFGF, 2-mercaptoethanol (2-ME) and nicotinamide on insulin-expressing cells from hTS cells as measured by immunofluorescence assay.

[0197] Fig. 6A is a set of TissueQuest analysis images showing the dose-effect of bFGF on the generation of insulin-expressing cells from hTS cells based on the co-expression of insulin and Ngn3; Figure 6B is a bar chart that represents Fig. 6A The data are mean ± SD determined in triplicate.

[0198] Figure 7 is a TissueQuest analysis image showing that bFGF (10 ng / ml) achieved a similar percentage of insulin expressing cells based on the co-expression of insulin and glucagon.

[0199] Figure 8is a set of images from representative immunoblot analysis illustrating the dynamic patterns of transcription factor levels over time during different cellular processes. Dashed boxes indicate DE states. β-actin was used as a control. Data are presented as mean ± SD n = 3, ★ p<0.05.

[0200] Fig. 9 is a schematic diagram illustrating the negative autoregulatory feedback loop between pluripotent transcription factors (Nanog, Sox2, Cdx2, and Oct4) in bFGF-induced cellular processes.

[0201] Fig.10 A set of flow cytometry images showing the mutual inhibitory relationship between Cdx2 (left) and Oct4 (right). Nonspecific shRNA was used as a control.

[0202] Fig.11 is a set of Western blot images showing that knockdown of Cdx2 upregulated Oct4. Cells transfected with nonspecific shRNA were used as controls. β-actin was used as a loading control.

[0203] Fig.12 is a set of flow cytometry images showing that knockdown of Oct4 upregulated Nanog (left) and vice versa (right).

[0204] Fig.13 is a set of flow cytometry images showing that knockdown of Nanog upregulated Sox2 (right) and vice versa (left).

[0205] Fig.14 Schematic diagram illustrating the autoregulatory loop of mutual inhibition among pluripotent transcription factors.

[0206] Fig.15 is a set of Western blot images showing that FGFR inhibitor (PD 166866) blocks bFGF-induced PI3K. β-actin was used as a loading control.

[0207] Fig.16 The data are from IP experiments showing that Akt directly interacts with CREB1.

[0208] Fig.17 is a set of Western blot images showing that PI3K siRNA inhibits the expression of PI3K and p-Akt. Cells transfected with nonspecific shRNA were used as controls. β-actin was used as a loading control.

[0209] Fig.18is a set of Western blot images showing that siRNA against Akt subunits inhibited bFGF-induced expression of p-Akt and p-CREB1. Cells transfected with nonspecific shRNA were used as controls. β-actin was used as a loading control.

[0210] Fig.19 is a bar graph showing relative miR-124a expression when plasmids containing miR-124a or anti-miR-124a cDNA were transfected into hTS cells for the experimental setting in this assay. Data are presented as mean±SD, n=5.

[0211] Fig. 20 is a bar graph showing the relative miR-124a expression in hTS cells induced with bFGF alone and bFGF-induced hTS cells transfected with CREB1 shRNA. Nonspecific shRNA was used as a control. Data are presented as mean ± SD, n = 3, ★ p<0.05.

[0212] Fig.21 is a set of Western blot images showing inhibition of bFGF-induced Mixl1 repression by using Smad4 shRNA. Cells transfected with nonspecific shRNA were used as controls. β-actin was used as a loading control.

[0213] Fig. 22 is a set of Western blot images showing inhibition of bFGF-induced Oct4 and Sox17 expression by using Oct4 shRNA. Cells transfected with nonspecific shRNA were used as controls. β-actin was used as a loading control.

[0214] Fig.23 is a set of Western blot images showing that inhibitory GSK3β between 1-4 hr after bFGF induction resulted in accumulation of β-catenin over the same time period. β-actin was used as a loading control.

[0215] Fig.24 is a set of Western blot images showing that bFGF-induced Foxa2 expression is attenuated in the presence of shRNA against Foxa2. Cells transfected with nonspecific shRNA were used as controls. β-actin was used as a loading control.

[0216] Fig.25is a set of Western blot images showing the dynamic correlation of expression between β-opsonin, C-peptide and insulin before 24 hr after bFGF induction. At 28 hr, the trend of β-opsonin levels decreased while the levels of C-peptide and insulin remained at a high level. β-actin was used as a loading control.

[0217] Fig.26 is a set of immunocytochemical images showing the co-expression of β-opsonin (light dots) and insulin (dark dots) in bFGF-induced pancreatic progenitor cells. DETAILED DESCRIPTION

[0218] The details of one or more embodiments of the invention are set forth in the drawings, claims and specification herein.Other features, objects and advantages of the embodiments of the invention disclosed and contemplated herein may be combined with any other embodiments unless expressly excluded.

[0219] The terms "modulate" and "modulation" refer to inducing, directly or indirectly, an increase or decrease, stimulation, inhibition, interference or blocking of a cell activity such as cell growth or differentiation, for example inducing mammalian trophoblast stem cells to become differentiated cells, such as pancreatic progenitor cells.

[0220] The term "agent" refers to a compound for cell growth and differentiation, such as a differentiation of mammalian trophoblast stem cells, such as a biomolecule or chemical. The example of an agent includes, but is not limited to, a growth factor (e.g., fibroblast growth factor (FGF)), an antioxidant / reducing agent (e.g., 2-mercaptoethanol), a vitamin (e.g., nicotinamide) and its metabolite (e.g., retinoic acid), a nucleic acid (e.g., RNA or DNA, such as microRNA), a hormone, a peptide and a protein (e.g., CREB1-binding protein). The example of a growth factor can include FGF1, FGF2 (bFGF), FGF3, FGF4, FGF5, FGF6, FGF7, FGF8, FGF9 and FGF10. More examples of antioxidants can include 2-mercaptoethanol (2-ME), dithiothreitol (DTT) and tris (2-carboxyethyl) phosphine (TCEP). Examples of vitamins can include vitamin A, vitamin B1, B2, B3, B5, B6, B7, B9 or B12, vitamin C, vitamin D, vitamin E and vitamin K. In some embodiments, the agent herein regulates the activity or expression level of CAMP response element binding protein 1 (CREB1), such as CREB1 phosphorylation. In some embodiments, the agent herein activates miR124. In some embodiments, the agent herein regulates one or more transcription factors, such as mix1, Cdx2, Oct4, Sox17, Foxa2 or GSK3β.

[0221] The term "drug" is intended to include compounds having utility for treatment and / or diagnosis and / or prevention purposes, such as therapeutic, diagnostic or preventive compounds. Therapeutic compounds include, for example, antibiotics, antivirals, antifungals, antiangiogenic agents, analgesics, anesthetics, anti-inflammatory agents (including steroidal and non-steroidal anti-inflammatory agents (NSAIDs)), corticosteroids, antihistamines, mydriatics, anti-tumor agents, immunosuppressants, anti-allergic agents, metalloproteinase inhibitors, tissue inhibitors of metalloproteinases (TIMPs), inhibitors or antagonists or intraceptors, receptor antagonists, RNA aptamers, antibodies or fragments thereof, hydroxamic acids and macrocyclic antisuccinic acid hydroxamate derivatives, nucleic acids, plasmids, siRNA, vaccines, DNA binding (minor groove) compounds, hormones, vitamins, proteins, peptides, polypeptides and peptide-like therapeutic agents. Diagnostic compounds include, for example, dyes, contrast agents, fluorescent agents, radioisotopes (e.g., P-32, Tc-99, F-18, I-131), and analogs that can be used to diagnose a disease, condition, syndrome, or symptom thereof. Therapeutic compounds that are administered prior to detecting a disease, condition, syndrome, or symptom are prophylactic compounds.

[0222] As used herein, open ended terms such as "including," "comprising," and the like are intended to mean comprising unless otherwise indicated.

[0223] Some embodiments herein relate to numerical ranges. When a numerical range is provided, the range includes the range endpoints. Numerical ranges include all values ​​and subranges therein as if explicitly written out.

[0224] As used herein, the term "about" means ± 15%. For example, the term "about 10" includes 8.5 to 11.5.

[0225] As used herein, the articles "a" or "an" mean one or more, unless expressly stated otherwise.

[0226] "Vector" refers to a recombinant DNA or RNA construct, such as a plasmid, bacteriophage, recombinant virus, or other vector that, when introduced into a suitable host cell, results in modification of the cell as described herein. Suitable expression vectors are well known to those of ordinary skill in the art and include those vectors that are replicable in eukaryotic cells and / or prokaryotic cells and those vectors that remain episomal or integrate into the host cell genome.

[0227] The construction of the vector can be achieved using the technology described in, for example, Sambrook et al., 1989. In some embodiments, the isolated plasmid or DNA fragment is cut, tailored and reconnected in the desired form to produce a plasmid. If necessary, any suitable method is used to confirm the analysis of the correct sequence in the constructed plasmid. Suitable methods for constructing expression vectors, preparing in vitro transcripts, introducing DNA into host cells and evaluating gene expression and functional analysis are known. For example, using a probe that can be based on the appropriate labeling of the sequence provided herein, by conventional Southern blotting, Northern blotting for quantifying the transcription of mRNA, dot blotting (DNA or RNA analysis) or in situ hybridization, the presence, amplification and / or expression of genes are directly measured in the sample.

[0228] As used herein, terms such as "transfection", "transformation" and the like are intended to refer to the transfer of nucleic acids into a cell or organism in a functional form. Such terms include various means of transferring nucleic acids into cells, including transfection with CaPO4, electroporation, viral transduction, lipofection, delivery using liposomes and / or other delivery vehicles.

[0229] Cells can be sorted by affinity techniques or by cell sorting (e.g., fluorescence activated cell sorting), wherein they are labeled with a suitable marker, such as a fluorophore coupled to, for example, an antisense nucleic acid molecule or an immunoglobulin or a portion thereof, or an intrinsically fluorescent protein such as green fluorescent protein (GFP) or a variant thereof. "Sorting" as used herein refers to at least partial physical separation of a first cell type from a second cell type.

[0230] The terms "treat", "treat" and the like may refer to obtaining a desired pharmacological and / or physiological effect, for example, partial or complete cure of a condition, and / or reversal of adverse effects attributable to the condition, and / or stabilization of the condition, and / or delaying progression of the condition, and / or causing regression of the condition.

[0231] Administration (e.g., transplantation) of stem cells to an area in need of treatment can be accomplished by, for example, but not limited to, local infusion during surgery, by injection, by catheter, or by implants of porous, non-porous, or gel-like materials, including membranes such as silicone rubber membranes or fibers.

[0232] "Transplanting" a composition into a mammal may refer to introducing the composition into the body of the mammal. The introduced composition is the "graft," and the mammal is the "recipient." The graft and recipient may be syngeneic, allogeneic, or xenogeneic. In addition, the transplant may be an autologous transplant.

[0233] An "effective amount" can be an amount of a therapeutic agent sufficient to achieve the intended purpose. For example, an effective amount of a factor for increasing the number of hTS cells is an amount sufficient to cause an increase in the number of stem cells in vivo or in vitro (as the case may be). An effective amount of a composition for treating or alleviating a neurodegenerative disease or condition is an amount of the composition sufficient to reduce or remove the symptoms of the neurodegenerative disease or condition. The effective amount of a given therapeutic agent will vary with factors such as the nature of the agent, the route of administration, the size and species of the animal receiving the therapeutic agent, and the purpose of the administration.

[0234] 2-Mercaptoethanol (also known as β-mercaptoethanol, BME, 2BME, 2-ME or β-met) is a chemical compound with the formula HOCH2CH2SH.

[0235] Niacinamide, also known as niacinamide and niacinamide, is the amidate of niacin (vitamin B3 / nicotinic acid) and has the formula C6H6N2O.

[0236] In some embodiments, the mammalian trophoblast stem cells herein are from a rodent (e.g., mouse, rat, guinea pig, hamster, or squirrel), rabbit, cow, sheep, pig, dog, cat, monkey, ape (e.g., chimpanzee, gorilla, or orangutan), or human.

[0237] In some embodiments, the mammal herein is a rodent (e.g., a mouse, rat, guinea pig, hamster, or squirrel), rabbit, cow, sheep, pig, dog, cat, monkey, ape (e.g., a chimpanzee, gorilla, or orangutan), or human.

[0238] In some embodiments, in embryogenesis, pancreatic development requires the key derivation of definitive endoderm (DE) for further differentiation. MicroRNA (miR) works at multiple levels, thereby controlling the timing of cell transformation in the entire differentiation process. One of many aspects of the present invention is to use FGF (e.g., bFGF) to differentiate mammalian trophoblast stem cells into pancreatic progenitor cells by DE specialization driven by miR-124. Another aspect of the present invention is to promote beta opsonin for beta cell proliferation by the regulation of miR-124 during pancreatic differentiation. Another aspect of the present invention is to provide pancreatic progenitor cells secreting insulin differentiated by mammalian trophoblast stem cells.

[0239] In some embodiments, in mammalian trophoblast stem cells, FGF (eg, bFGF) effectively induces differentiation toward insulin-secreting pancreatic progenitor cells through the formation of definitive endoderm (DE) within one day.

[0240] In some embodiments, FGF (e.g., bFGF) activates the temporal and spatial promotion of microRNA (miR)-124 through the FGFR1 / PI3K / Akt / CREB1 pathway to perform two functions: 1) inhibiting Smad4 and thus inhibiting Mixl1 for DE formation, and 2) inhibiting Cdx2, and in turn mutually activating Oct4 for DE regulation through an autoregulatory feedback loop. Subsequently, DE differentiates into multipotent pancreatic progenitor cells through the transformation of the primitive gut tube. Each stage-specific cellular process is mainly regulated by a unique multipotent transcription factor during differentiation.

[0241] In some embodiments, mammalian trophoblast stem cell-derived pancreatic progenitor cells are glucose-sensitive and secrete immunoreactive C-peptide and insulin in vitro and / or in vivo.

[0242] In some embodiments, FGF (eg, bFGF) induction effectively promotes activation of miRNA-124a, which directs pancreatic progenitor cell differentiation in mammalian trophoblast stem cells.

[0243] In some embodiments, the mammalian trophoblast stem cells herein are a renewable source of stem cells for cell-based therapy for diabetic patients and for drug toxicity screening.

[0244] In some embodiments, FGF (e.g., bFGF) is able to effectively differentiate mammalian trophoblast stem cells (e.g., hTS cells) into pancreatic progenitor cells, providing evidence for the use of insulin-secreting pancreatic progenitor cells as a renewable source of stem cells in the generation of cell-based therapies for patients with type 1 DM.

[0245] In some embodiments, mammalian trophoblast stem cells offer major advantages for screening drugs related to pancreatic diseases because: 1) they are easy to produce in sufficient numbers for evaluation in multi-well plates; 2) the cells are genotypically and phenotypically stable; 3) pancreatic differentiation and proliferation are characterized and elucidated through the specialization of DE; 4) single inducer and simple culture medium conditions are conducive to evaluation in toxicity screening; and 5) differentiation into insulin-secreting β-cells can be completed in a very short time, such as 1 day, which is economically feasible.

[0246] In one instance, treatment of mammalian trophoblast stem cells with 10 ng / ml fibroblast growth factor (e.g., bFGF) produced approximately 10% insulin-producing cells in the population that expressed pancreatic progenitor cell-associated markers and islet components. In cellular processes, miRNA-124 effectively inhibited Cdx2 and Smad4 and their downstream effector Mixl1, thereby directing the formation of DE and differentiation toward pancreatic progenitor cells. The cells were capable of glucose-stimulated insulin secretion.

[0247] In some embodiments, FGF (e.g., bFGF) activates the PI3K / Akt pathway through RTK to phosphorylate CREB1. CREB1-p transiently targets the promoter of miR-124. In one case, miR-124 works in two ways: a) inhibiting Smad4 and Mixil1 for DE formation; and b) inhibiting Cdx2, and in turn activating Oct4 for DE regulation. In one case, FGF (e.g., bFGF) induces the cell process of mediating mesendoderm, DE and primitive gut tube to form functional pancreatic progenitor cells in mammalian trophoblast stem cells within one day.

[0248] In some embodiments, the mammalian trophoblast stem cells herein are human trophoblast stem cells (hTS cells).

[0249] miR-124a is also known as miR-124a, mir-124a, microRNA-124a, miRNA-124a, miR-124, mir-124, microRNA-124 or miRNA-124.

[0250] For miR-124, the coding sequence of interest includes, but is not limited to, the sequence encoding the precursor of miR-124, for example, wherein the example of such coding sequence is reported in the miRBase database, which is hosted and maintained by the School of Life Sciences of the University of Manchester funded by BBSRC. A given vector may include a single coding sequence or multiple repeats of the coding sequence as required.

[0251] The precursor of miR-124 can also be found in the miRBase database.

[0252] For example, >hsa-mir-124-1MI0000443

[0253] AGGCCUCUCUCCGUGUUCACAGCGGACCUUGAUUUAAAUGUCCAUACAAUUAAGGCACGCGGUGAAUGCCAAGAAUGGGGCCUG (SEQ ID NO: 3)

[0254] >hsa-mir-124-2MI0000444

[0255] AUCAAGAUUAGAGGCUGCUCUCCGUGUUCACAGCGGACCUUGAUUUAAUGUCAUACAAUUAAGGCACGCGGUGAAUGCCAAGAGCGGAGCCUACGGCUGCACUUGAA (SEQ ID NO: 146)

[0256] >hsa-mir-124-3MI0000445

[0257] UGAGGGCCCCUCUGCGUGUUCACAGCGGACCUUGAUUUAAUGUCUAUACAAUUAAGGCACGCGGUGAAUGCCAAGAGGCGCCUCC (SEQ ID NO: 147).

[0258] The nucleic acid sequence of miR-124 herein may include a fragment or full-length nucleic acid sequence of any miR-124 family member, such as in the accompanying drawings, Tables 1 and 2 of the present invention, for example, as identified in flies (MI0000373), nematodes (MI0000302), mice (MI0000150) and humans (MI0000443), or those found in miRBase, a microRNA database of the University of Manchester, UK. In some embodiments, anti-miR-124 may have a sequence that has any complementarity with the sequence of miR-124, such as miRZIP124. In some embodiments, using a miRZip-based TM Lentiviral microRNA knockdown methods can be used to generate anti-miR-124, such as that produced by System Biosciences.

[0259] Table 1. Examples of miR-124 family members

[0260]

[0261]

[0262]

[0263] Note: The sequence names in Table 1 are represented according to standard naming conventions, for example, as -5p or -3p.

[0264] Table 2. Examples of miR-124a family members

[0265] name Accession Number sequence hsa-miR-124-5p MIMAT0004591 CGUGUUCACAGCGGACCUUGAU(SEQ ID NO:1) hsa-miR-124-3p MIMAT0000422 UAAGGCACGCGGUGAAUGCC(SEQ ID NO:2) aca-miR-124a MIMAT0021725 UAAGGCACGCGGUGAAUGCCA(SEQ ID NO:5) age-miR-124a MIMAT0002466 UUAAGGCACGCGGGUGAAUGCCA(SEQ ID NO:8) bta-miR-124a MIMAT0003811 UAAGGCACGCGGUGAAUGCCAAG(SEQ ID NO:17) ccr-miR-124a MIMAT0026331 UCAAGGUCCGCUGUGAACAC(SEQ ID NO:20) egr-miR-124a MIMAT0020240 UAAGGCACGCGGUGAAUGCCA(SEQ ID NO:50) emu-miR-124a MIMAT0020266 UAAGGCACGCGGUGAAUGCCA(SEQ ID NO:53) gga-miR-124a MIMAT0001128 UUAAGGCACGCGGGUGAAUGCCA(SEQ ID NO:56) ggo-miR-124a MIMAT0002465 UUAAGGCACGCGGGUGAAUGCCA(SEQ ID NO:59) lla-miR-124a MIMAT0002471 UUAAGGCACGCGGGUGAAUGCCA(SEQ ID NO:64) mdo-miR-124a MIMAT0004102 UUAAGGCACGCGGGUGAAUGCCA(SEQ ID NO:65) mml-miR-124a MIMAT0002470 UUAAGGCACGCGGGUGAAUGCCA(SEQ ID NO:66) mmu-miR-124-3p MIMAT0000134 UAAGGCACGCGGUGAAUGCC(SEQ ID NO:68) mmu-miR-124-5p MIMAT0004527 CGUGUUCACAGCGGACCUUGAU(SEQ ID NO:67) odi-miR-124a MIMAT0006082 UAAGGCACGCGGUGAAUGCUAA(SEQ ID NO:73) ppa-miR-124a MIMAT0002467 UUAAGGCACGCGGGUGAAUGCCA(SEQ ID NO:81) ppy-miR-124a MIMAT0002468 UUAAGGCACGCGGGUGAAUGCCA(SEQ ID NO:84) ptr-miR-124a MIMAT0002469 UUAAGGCACGCGGGUGAAUGCCA(SEQ ID NO:85) rno-miR-124-3p MIMAT0000828 UAAGGCACGCGGUGAAUGCC(SEQ ID NO:87) rno-miR-124-5p MIMAT0004728 CGUGUUCACAGCGGACCUUGAU(SEQ ID NO:86) sme-miR-124a-3p MIMAT0003992 UAAGGCACGCGGUGAAUGCUU(SEQ ID NO:93) sme-miR-124a-5p MIMAT0012112 UGCUUUUAACGCGGAGCUUUAGU(SEQ ID NO:92) ssc-miR-124a MIMAT0002156 UAAGGCACGCGGUGAAUGCCA(SEQ ID NO:103)

[0266] Note: The sequence names in Table 2 are represented according to standard naming conventions, for example, as -5p or -3p.

[0267] Table 3. Promoter sequences of Smad4 shRNA

[0268]

[0269]

[0270] Mammalian trophoblast stem cells

[0271] In some embodiments, the mammalian trophoblast stem cells herein are from rodents (e.g., mice, rats, guinea pigs, hamsters, squirrels), rabbits, cattle, sheep, pigs, dogs, cats, monkeys, apes (e.g., chimpanzees, gorillas, orangutans) or humans. In one case, the mammalian trophoblast stem cells herein are not from primates, e.g., monkeys, apes, humans. In another case, the mammalian trophoblast stem cells herein are from primates, e.g., monkeys, apes, humans. In another case, the mammalian trophoblast stem cells herein are human or humanized.

[0272] The mammalian trophoblast stem cells of the present invention can be induced to differentiate into one or more differentiated cells. In one case, the differentiated cells are progenitor cells, such as pancreatic progenitor cells. In one case, the differentiated cells are pluripotent stem cells. In one case, the differentiated cells are endoderm, mesoderm or ectoderm progenitor cells. In one case, the differentiated cells are definitive endoderm progenitor cells. In one case, the differentiated cells are pancreatic endoderm progenitor cells. In one case, the differentiated cells are multipotent progenitor cells. In one case, the differentiated cells are oligopotent progenitor cells. In one case, the differentiated cells are unipotent, bipotent or tripotent progenitor cells. In one case, the differentiated cells are endocrine, exocrine or tubular progenitor cells, such as endocrine progenitor cells. In one case, the differentiated cells are β-cells. In one case, the differentiated cells are cells that produce insulin. One or more differentiated cells can be used in any method disclosed herein.

[0273] In one aspect, the present invention provides one or more differentiated cells separated by one or more methods herein. In one case, the differentiated cells separated are human cells. In one case, the differentiated cells separated have a normal karyotype. In one case, the differentiated cells separated have one or more characteristics of immune privilege, for example, low or lack of CD33 expression and / or CD133 expression. One or more separated differentiated cells disclosed herein can be used in any method disclosed herein.

[0274] In another aspect, provided herein is an isolated progenitor cell expressing one or more transcription factors including Foxa2, Pdx1, Ngn3, Ptf1a, Nkx6.1 or any combination thereof. In one case, the isolated progenitor cell expresses two, three or four transcription factors in Foxa2, Pdx1, Ngn3, Ptf1a, Nkx6.1. In one case, the isolated progenitor cell expresses Foxa2, Pdx1, Ngn3, Ptf1a and Nkx6.1. In one case, the isolated progenitor cell is an induced pluripotent stem cell. In one case, the isolated progenitor cell is derived from a mammalian trophoblast stem cell, for example, an hTS cell. In one case, the isolated progenitor cell is a pancreatic progenitor cell. In one case, the isolated progenitor cell is an endoderm, mesoderm or ectoderm progenitor cell. In one case, the isolated progenitor cell is a definitive endoderm progenitor cell. In one case, the isolated progenitor cell is a pancreatic endoderm progenitor cell. In one case, the progenitor cell of separation is a multipotent progenitor cell. In one case, the progenitor cell of separation is an oligopotent progenitor cell. In one case, the progenitor cell of separation is a unipotent, bipotent or tripotent progenitor cell. In one case, the progenitor cell of separation is an endocrine, exocrine or tubular progenitor cell, such as an endocrine progenitor cell. In one case, the progenitor cell of separation is a β-cell. In one case, the progenitor cell of separation is a cell that produces insulin. In one case, the progenitor cell of separation is from a rodent (e.g., mouse, rat, guinea pig, hamster, squirrel), rabbit, cattle, sheep, pig, dog, cat, monkey, ape (e.g., chimpanzee, gorilla, orangutan) or human. In one case, the progenitor cell of separation is a human cell. In one case, the progenitor cell of separation has a normal karyotype. In one case, the progenitor cell of separation has one or more characteristics of immune pardon, such as low or lack of CD33 expression and / or CD133 expression. The progenitor cell of separation disclosed herein can be used in any method disclosed herein.

[0275] In another aspect, the present invention provides the progenitor cell of separation expressing beta opsonin, beta opsonin mRNA, C-peptide and insulin, wherein the progenitor cell of separation is differentiated from mammalian trophoblast stem cell. In one case, the progenitor cell of separation is from rodent (for example, mouse, rat, guinea pig, hamster, squirrel), rabbit, cattle, sheep, pig, dog, cat, monkey, ape (for example, chimpanzee, gorilla, orangutan) or people. In one case, the progenitor cell of separation is pancreatic progenitor cell. In one case, the progenitor cell of separation is human cell. In one case, the progenitor cell of separation has normal karyotype. In one case, the progenitor cell of separation has the characteristic of one or more immune pardons, such as low or lack CD33 expression and / or CD133 expression. The progenitor cell of one or more separations disclosed herein can be used in any method disclosed herein.

[0276] In one instance, the isolated progenitor cells herein are insulin-producing cells.One or more isolated progenitor cells herein can be used in any of the methods disclosed herein.

[0277] In one instance, the differentiated cells herein are insulin-producing cells. One or more differentiated cells herein can be used in any of the methods disclosed herein.

[0278] Human Trophoblast Stem Cells

[0279] The human fallopian tube is the fertilization site and common ectopic pregnancy site of women, in which several biological events occur, such as the distinction between the inner cell mass (ICM) and the trophectoderm and the transition from totipotency to pluripotency with major epigenetic changes. These observations provide support for the fallopian tube as a niche reservoir for collecting blastocyst-related stem cells in the preimplantation period. Ectopic pregnancy accounts for 1 to 2% of all pregnancies in industrialized countries, and is much higher in developing countries. Considering the lack of availability of human embryonic stem cells (hES cells) and fetal brain tissue, this article describes the use of human trophoblast stem cells (hTS cells) derived from ectopic pregnancy as a substitute for hES cells that are almost unavailable for the production of progenitor cells.

[0280] In some embodiments, the hTS cells derived from ectopic pregnancy do not involve the destruction of human embryos. In another case, the hTS cells derived from ectopic pregnancy do not involve the destruction of living human embryos. In another case, the hTS cells are derived from the trophoblast tissue associated with the non-viable ectopic pregnancy. In another case, the ectopic pregnancy cannot be saved. In another case, the ectopic pregnancy does not lead to a living human embryo. In another case, the ectopic pregnancy threatens the life of the mother. In another case, the ectopic pregnancy is tubal, abdominal, ovarian or cervical.

[0281] In some embodiments, during blastocyst development, ICM contacts itself or its derived diffusible "inducer" triggers a high rate of cell proliferation in the polar trophectoderm, causing cells to move toward the cavity wall area throughout the blastocyst stage, and can continue even after the trophectoderm is distinguished from the ICM. The cavity wall trophectoderm cells covering the ICM can retain the "cellular memory" of the ICM. Usually, at the beginning of implantation, due to mechanical constraints from the endometrium, the cavity wall cells relative to the ICM stop dividing. However, this constraint does not exist in the fallopian tube, resulting in the continued division of polar trophectoderm cells to form extraembryonic ectoderm (ExE) in the stagnant ectopic pregnancy blastocyst. In some embodiments, ExE-derived TS cells exist in a window period of at least 4 days in a proliferative state, which depends on the interaction of fibroblast growth factor 4 (FGF4) secreted by the ICM and its receptor fibroblast growth factor receptor 2 (Fgfr2). In another instance, ExE-derived TS cells exist in a proliferative state for a window period of at least 1 day, at least 2 days, at least 3 days, at least 4 days, at least 5 days, at least 6 days, at least 7 days, at least 8 days, at least 9 days, at least 10 days, at least 11 days, at least 12 days, at least 13 days, at least 14 days, at least 15 days, at least 16 days, at least 17 days, at least 18 days, at least 19 days, at least 20 days. Until clinical intervention occurs, these cellular processes can generate an unlimited number of hTS cells in the preimplantation embryo; these cells retain a cellular memory from the ICM, which is reflected by the expression of ICM-related genes.

[0282] This article provides an aspect using Affymetrix TMThe GeneChip Human Genome U133plus 2.0GeneChip was interrogated using the platform for the total gene comparison between hTS cells and placenta-derived mesenchymal stem (PDMS) cells, describing the distinction between hTS cells and PDMS cells. In some embodiments, hTS cells exhibit less than about 10%, about 15%, about 20%, about 25%, about 30%, about 35%, about 40%, about 45%, about 50%, about 55%, about 60%, about 65%, about 70% or about 75% gene expression than in PDMS cells. In another case, hTS cells showed a total of 2,140 genes (fold change> 2 times), which was about 40% less than PDMS cells (3,730 genes). In some embodiments, the gene intensity distribution of hTS cells shows a uniform pattern different from that in PDMS cells. In another embodiment, hTS cells represent a distinct group of cytotrophoblasts during the preimplantation period, whereby they have molecular portraits of the inner cell mass (ICM) and / or trophectoderm. In another embodiment, hTS cells exhibit similar pluripotency and self-renewal properties to hES cells. Methods for obtaining and isolating mammalian trophoblast stem cells

[0283] In some embodiments, the mammalian trophoblast stem cells (eg, hTS cells) herein can be isolated from the umbilical cord, amniotic fluid, amniotic membrane, Wharton's jelly, chorionic villi, placenta, or ectopic pregnancy.

[0284] In one case, mammalian trophoblast stem cells (e.g., hTS cells) herein can be isolated from amniocentesis biopsy or from amniotic fluid. In one case, amniocentesis can be a procedure for obtaining a small sample of the amniotic fluid surrounding the fetus during pregnancy. In one case, amniocentesis can be provided to women with increased risk of chromosomal abnormalities at 15 to 20 weeks of pregnancy, such as women over 35 years of age at childbirth, or those women with increased risk of abnormal maternal serum (blood) screening tests, showing chromosomal abnormalities or neural tube defects. In one case, a needle, such as a long, thin hollow needle, can be used under ultrasound guidance to enter the uterus and amniotic sac through the abdomen. A predetermined amount of amniotic fluid, such as 1 ounce, can be drawn into a syringe.

[0285] In another case, mammalian trophoblast stem cells (e.g., hTS cells) herein can be obtained from blastomere biopsies during preimplantation genetic diagnosis (PGD), e.g., in combination with reproductive therapies such as in vitro fertilization (IVF). In one case, cells herein can be produced by a method for biopsy of a blastocyst, wherein the remainder of the blastocyst is implanted and results in pregnancy and subsequent live birth, e.g., removing the zona pellucida from the blastocyst and then biopsying the blastocyst.

[0286] In another case, the mammalian trophoblast stem cells (e.g., hTS cells) herein can be obtained by prenatal chorionic villus sampling (CVS). In one case, CVS can be a prenatal examination involving obtaining a tissue sample from the placenta to test for chromosomal abnormalities and certain other genetic problems. In one case, CVS can be performed at 10 to 12 weeks of gestation. In one case, the CVS procedure is transcervical, for example, a catheter is inserted through the cervix into the placenta to obtain a tissue sample. In one case, the CVS procedure is transabdominal, for example, a needle is inserted through the abdomen and uterus into the placenta to obtain a tissue sample.

[0287] In one case, mammalian trophoblast stem cells (e.g., hTS cells) herein can be obtained from placental biopsies after full-term pregnancy. In one case, mammalian trophoblast stem cells (e.g., hTS cells) herein can be isolated from placenta after vaginal delivery or cesarean section delivery.

[0288] In some embodiments, the mammalian trophoblast stem cells (eg, hTS cells) herein can be sampled from early gestational chorionic villi (eg, 8 +3 to 12 +0 The chorionic villus tissue can be isolated from amniotic membranes that have been minced and / or enzymatically digested (e.g., with 0.05% trypsin EDTA, e.g., for 20 min). The cells are then centrifuged (e.g., at 1500 rpm, e.g., for 5 min), counted, and / or replated (e.g., per cm 2 10 4 In one embodiment, the isolated cells can be plastic-attached. In one embodiment, the cells can be used at passage 4-8.

[0289] In one case, the mammalian trophoblast stem cells (e.g., hTS cells) herein can be isolated from a full-term (e.g., 38–40 weeks of gestation) placenta according to the following procedure. The umbilical cord blood is drained from the placenta, and then the placenta is carefully cut. The collected tissue pieces are washed several times (in phosphate-buffered saline), and then minced (e.g., mechanically) and enzymatically digested (e.g., with 0.25% trypsin-EDTA). The homogenate is then precipitated by centrifugation and suspended in a complete medium (e.g., Dulbecco's modified Eagle medium, which is supplemented with 10% fetal bovine serum, 100U / ml penicillin and / or 100g / ml streptomycin). The cell culture is maintained under suitable conditions, such as 37°C and a water-saturated atmosphere and 5% CO2. The culture medium is replaced regularly, for example, 1 to 2 times a week. When the cells reach the desired level of confluence, for example, when greater than 80% confluence, the cells are recovered with, for example, 0.25% trypsin / EDTA and re-seeded at a dilution of, for example, 1:3.

[0290] In another case, the mammalian trophoblast stem cells (e.g., hTS cells) herein can be isolated from the human placenta after delivery according to the following procedure. The chorion is separated from the amnion by peeling them off. The decidual tissue is scraped (e.g., mechanically) and washed (e.g., in Dulbecco's phosphate buffered saline), and then cut into small pieces (e.g., -2×2 cm). The chorion is chopped into small pieces and subjected to an enzyme (e.g., 0.5% trypsin-EDTA, for example, for 5 min), followed by digestion with collagenase I (e.g., at 0.3% in a 37° C. incubator for 20 to 30 min). The mobilized cells are then collected and passed through a cell strainer (e.g., 100 μm). The filtered cells are collected by centrifugation (e.g., at 2,500 rpm, for example, for 5 min). The cells are resuspended in a culture medium (e.g., α-modified minimal essential medium supplemented with 10% fetal bovine serum and / or 1% penicillin-streptomycin) and cultured in a container (e.g., T25 flask) under appropriate conditions (e.g., at 37° C. and / or 5% CO 2 ). The culture medium is replaced regularly, e.g., every 3 days, until the chorionic MSCs reach a desired confluence level, e.g., 70% confluence.

[0291] In another case, the present invention also provides a method for obtaining mammalian trophoblast stem cells (e.g., hTS cells), the method comprising: (a) obtaining an embryo at the fallopian tube of an ectopic pregnancy (e.g., 4-6, 5-7, or 6-8 weeks of pregnancy); and (b) obtaining stem cells from the chorionic trophoblast of the embryo. In some embodiments, the embryo can be obtained from an unruptured ectopic pregnancy. In some embodiments, the unruptured ectopic pregnancy can be a stage of less than 6 weeks after fertilization. The chorionic trophoblast can include a cytotrophoblast.

[0292] In another case, embryonic chorionic villi can be obtained from the fallopian tube of an unruptured preimplantation embryo of a woman with an ectopic pregnancy (e.g., gestational age: 5-7 weeks). The fine chorionic tissue can be completely minced in a suitable culture medium (e.g., serum-free α-MEM) and identified under a microscope, followed by trypsinization (e.g., with 0.025% trypsin / EDTA) for a period of time (e.g., 15 min), and then adding culture medium (e.g., α-MEM containing 10% FBS) to stop the reaction. Adherent cells can be obtained and cultured under suitable conditions (e.g., at 37°C in 5% CO2 in condition α-MEM, 10% FBS and 1% penicillin-streptomycin). After two passages, the level of hCG will become undetectable using a commercial kit (e.g., Dako, Carpinteria, CA) to measure.

[0293] Methods for differentiation of mammalian trophoblast stem cells

[0294] In one aspect of many aspects, the present invention provides a method for differentiating mammalian trophoblast stem cells, the method comprising regulating miR-124 to induce differentiation of mammalian trophoblast stem cells to differentiated cells. In one case, the mammalian trophoblast stem cell is a human trophoblast stem (hTS) cell. In one case, the differentiated cell is a pluripotent stem cell. In one case, the differentiated cell is a progenitor cell, such as a pancreatic progenitor cell. In one case, the differentiated cell is an endoderm, mesoderm or ectoderm progenitor cell, such as a definitive endoderm progenitor cell. In one case, the differentiated cell is a pancreatic endoderm progenitor cell. In one case, the differentiated cell is a multipotent progenitor cell. In one case, the differentiated cell is an oligopotent progenitor cell. In one case, the differentiated cell is a unipotent, bipotent or tripotent progenitor cell. In one case, the differentiated cell is an endocrine, exocrine or tubular progenitor cell, for example, an endocrine progenitor cell. In one case, the differentiated cell is a β-cell. In one case, the differentiated cell is a cell that produces insulin. One or more differentiated cells can be used in any method disclosed herein.

[0295] In some embodiments, the mammalian trophoblast stem cells herein are from a rodent (e.g., mouse, rat, guinea pig, hamster, squirrel), rabbit, cow, sheep, pig, dog, cat, monkey, ape (e.g., chimpanzee, gorilla, orangutan), or human.

[0296] In some embodiments, the regulation activates miR-124. In one case, the regulation is spatially and temporally activated, for example, at the definitive endoderm stage, between about 1 hour and about 8 hours. In one case, the regulation promotes miR-124 expression. In one case, the regulation inactivates miR-124. In one case, the regulation reduces miR-124 expression. In one case, the regulation includes contacting mammalian trophoblast stem cells with one or more agents such as proteins or steroid hormones. In one case, the one or more agents include growth factors, such as fibroblast growth factor (FGF). In one case, the FGF is one or more of FGF1, FGF2, FGF3, FGF4, FGF5, FGF6, FGF7, FGF8, FGF9 or FGF10. In one case, the one or more agents include FGF2 (basic fibroblast growth factor, bFGF). In one case, the modulation includes contacting mammalian trophoblast stem cells with no more than about 200 ng / mL, for example, 100 to 200 ng / mL of FGF (e.g., bFGF). In one case, the modulation includes contacting mammalian trophoblast stem cells with no more than about 100 ng / mL of FGF (e.g., bFGF), for example, about 0.1 to 1 ng / mL; or about 1 to about 100 ng / mL of FGF (e.g., bFGF). In one case, the concentration of FGF (e.g., bFGF) used herein is about: 0.1-1, 1-10, 10-20, 20-30, 30-40, 40-50, 50-60, 50-70, 80-90 or 90-100 ng / mL. In one case, the concentration of FGF (e.g., bFGF) used herein is about: 0.1, 0.2, 0.4, 0.6, 0.8, 1, 2, 3, 4, 5, 6, 7, 8, 9, 10, 11, 12, 13, 14, 15, 16, 17, 18, 19, 20, 25, 30, 35, 40, 45, 50, 60, 70, 80 or 90 ng / mL. In one case, the one or more agents further include an antioxidant or reducing agent (e.g., 2-mercaptoethanol). In one case, the one or more agents further include vitamins (e.g., nicotinamide). In one case, the modulation includes contacting mammalian trophoblast stem cells with FGF (e.g., bFGF), 2-mercaptoethanol and nicotinamide. In one case, the concentration of the antioxidant / reducing agent (e.g., 2-mercaptoethanol) is no more than about 10 mmol / L, such as about 0.1 to about 10 mmol / L. In one instance, the concentration of the antioxidant / reducing agent (e.g., 2-mercaptoethanol) is about: 0.1-1, 1-2, 2-3, 3-4, 4-5, 5-6, 6-7, 7-8, 8-9, or 9-10 mmol / L.In one instance, the concentration of the antioxidant / reducing agent (e.g., 2-mercaptoethanol) is about: 0.2, 0.5, 1, 1.5, 2, 3, 4, 5, 6, 7, 8, or 9 mmol / L. In one instance, the concentration of the antioxidant / reducing agent (e.g., 2-mercaptoethanol) is about 1 mmol / L. In one instance, the concentration of the vitamin (e.g., nicotinamide) is no greater than about 100 mmol / L, such as about 1 to about 100 mmol / L. In one instance, the concentration of the vitamin (e.g., nicotinamide) is about: 1-10, 10-20, 20-30, 30-40, 40-50, 50-60, 50-70, 80-90, or 90-100 mmol / L. In one instance, the concentration of the vitamin (e.g., niacinamide) is about: 2, 4, 6, 8, 10, 12, 14, 16, 18, 20, 30, 40, 50, 60, 70, 80 or 90 mmol / L. In one instance, the concentration of the vitamin (e.g., niacinamide) is about 10 mmol / L.

[0297] In one case, the regulation includes contacting mammalian trophoblast stem cells with one or more agents to regulate the activity or expression level of cAMP response element binding protein 1 (CREB1). In one case, the one or more agents regulate CREB1 phosphorylation. In one case, the one or more agents include vitamin metabolites, such as retinoic acid. In one case, the one or more agents include CREB1-binding proteins. In one case, the one or more agents regulate one or more factors comprising mixl1, Cdx2, Oct4, Sox17, Foxa2 or GSK3β.

[0298] In one embodiment, the one or more agents include exogenous miR-124 precursors or exogenous anti-miR-124. In one embodiment, mammalian trophoblast stem cells are transfected with exogenous miR-124 precursors or exogenous anti-miR-124. In one embodiment, the cis-regulatory element (CRE) of TGACGTCA (SEQ ID NO: 158) of the promoter of miR-124 is regulated.

[0299] In some embodiments, miR-124 is miR-124a, miR-124b, miR-124c, miR-124d or miR-124e. In one case, miR-124 is miR-124a, such as Homo sapiens miR-124a (hsa-miR-124a). In one case, miR-124a is hsa-miR-124-5p (SEQ ID NO: 1: CGUGUUCACAGCGGACCUUGAU) or a fragment thereof. In one case, miR-124a is hsa-miR-124-3p (SEQ ID NO: 2: UAAGGCACGCGGUGAAUGCC) or a fragment thereof. In one case, miR-124 comprises a sequence selected from Table 1, Table 2 and the accompanying drawings or a fragment thereof.

[0300] In one instance, mammalian trophoblast stem cells differentiate into differentiated cells within one day after initiation of conditioning.

[0301] In some embodiments, the induction of differentiation of mammalian trophoblast stem cells comprises culturing undifferentiated mammalian trophoblast stem cells in a culture medium comprising a growth factor (e.g., bFGF) under conditions sufficient to induce differentiation (e.g., 12, 24, 48, 76, or 96 hours). The culture medium may further comprise serum (e.g., FBS), carbohydrates (e.g., glucose), antioxidants / reducing agents (e.g., β-mercaptoethanol), and / or vitamins (e.g., nicotinamide). The yield of differentiated cells is measured, e.g., insulin as an indicator of pancreatic progenitor cells. + / Ngn3 + cells or insulin + / glucagon + In one instance, FBS and insulin levels are positively correlated during FGF (eg, bFGF) induction, for example, as indicated by Western blot analysis.

[0302] In some embodiments, when cells are induced (e.g., by bFGF), a time course analysis can be performed, for example, for 4, 8, 16, 24, 32, 40 or 48 hours to monitor the levels of transcription factors that identify the cascade stages of cell differentiation and development. In some embodiments, decreased Mixl1 and high levels of T and Gsc may imply a transition from mammalian trophoblast stem cells to mesendoderm. In some embodiments, the leading pluripotent transcription factors at each differentiation stage include Cdx2 for mesendoderm, Oct4 or Nanog for DE, Cdx2 or Nanog for gastrula endoderm, or Sox2 for pancreatic progenitor cells. In some embodiments, FGF (e.g., bFGF) induces the multifaceted functions of miR-124a by upregulating Oct4, Sox17 or Foxa2, but downregulating Smad4 or Mixl1 in the DE stage.

[0303] In some embodiments, during cell differentiation, time course analysis (e.g., for 4, 8, 16, 24, 32, 40, or 48 hours) is also used to measure the level of proteins or hormones specific to the target differentiated cells. For example, for pancreatic progenitor cells, beta-opsonin, C-peptide, and insulin are measured, for example, using qPCR analysis.

[0304] In some embodiments, growth factors are used herein to induce differentiation of mammalian trophoblast stem cells. In one case, the growth factor is FGF (e.g., bFGF), bone morphogenetic protein (BMP) or vascular endothelial growth factor (VEGF). In some embodiments, the effective amount of the growth factor is no more than about 100 ng / ml, for example, about: 1, 2, 5, 10, 15, 20, 25, 30, 35, 40, 45, 50, 60, 70, 80, 90 or 100 ng / mL. In one case, the mammalian trophoblast stem cell is a hTS cell.

[0305] In some embodiments, the culture medium for differentiating mammalian trophoblast stem cells may further include an effective amount of a second agent, which acts synergistically with the first agent to induce differentiation in the direction of the mesendoderm. In some embodiments, the first and second agents are different growth factors. In some embodiments, the first agent is added to the culture medium before the second agent. In some embodiments, the second agent is added to the culture medium before the first agent. In one case, the first agent is FGF (e.g., bFGF). In some embodiments, the second agent is a BMP added before or after the first agent, such as BMP2, BMP7 or BMP4. In some embodiments, the effective amount of BMP is not more than about 100 ng / ml, for example, about: 1, 2, 5, 10, 15, 20, 25, 30, 35, 40, 45, 50, 60, 70, 80, 90 or 100 ng / mL. In one case, mammalian trophoblast stem cells are hTS cells.

[0306] In some embodiments, the culture medium used for differentiating mammalian (eg, human) trophoblast stem cells herein may contain feeder cells. Feeder cells are a type of cell that is co-cultured with another type of cell to provide an environment in which the second type of cell can grow.

[0307] In some embodiments, the culture medium used herein is free or substantially free of feeder cells.

[0308] In some embodiments, a GSK-3 inhibitor is used to induce differentiation of mammalian (eg, human) trophoblast stem cells.

[0309] Pharmaceutical compositions and administration

[0310] In some embodiments, provided herein are compositions comprising the differentiated cells herein. In one case, the composition further comprises a buffer solution or a pharmaceutically acceptable carrier, which is provided to maintain the biological activity of mammalian trophoblast stem cells (e.g., hTS cells). For example, but not limited to, the buffer solution is saline, PBS (phosphate buffered saline) or FBS (fetal bovine serum) buffer.

[0311] In some embodiments, the composition of the present invention further comprises a therapeutic compound. For example, but not limited to, the therapeutic compound is a chemical or an antibody or a fragment thereof.

[0312] In some embodiments, the compositions herein may be administered by injection, implantation, or surgical procedure.

[0313] In some embodiments, the patient is a mammal. In some embodiments, the mammal herein is a rodent (e.g., mouse, rat, guinea pig, hamster or squirrel), rabbit, cattle, sheep, pig, dog, cat, monkey, ape (e.g., chimpanzee, gorilla or orangutan) or human. In one case, the patient is a human.

[0314] In some embodiments, provided herein is a composition for treating or preventing diabetes, the composition comprising mammalian trophoblast stem cells (e.g., hTS cells) or differentiated cells as described above. In one case, mammalian trophoblast stem cells (e.g., hTS cells) are obtained from an ectopic pregnancy embryo. The diabetes is type 1 diabetes, type 2 diabetes, or latent autoimmune diabetes in adults (LADA).

[0315] In some embodiments, provided herein is a composition for treating or preventing a nervous system disease, the composition comprising mammalian trophoblast stem cells (e.g., hTS cells) or differentiated cells. In one case, the mammalian trophoblast stem cells herein are obtained from an embryo of an ectopic pregnancy. The nervous system disease is a neurodegenerative disease. Neurodegenerative diseases may refer to any condition characterized by the gradual loss of neurons in the central nervous system of a subject due to cell death. In one case, the neurodegenerative disease is Parkinson's disease, Huntington's disease, Alzheimer's disease, amyotrophic lateral sclerosis (ALS), multiple system atrophy, Lewy body dementia, peripheral sensory neuropathy or spinal cord injury. In one case, the neurodegenerative disease is Parkinson's disease.

[0316] The administration mode of the isolated stem cell preparation described herein includes, but is not limited to, systemic intravenous injection and injection directly to the expected active site. The preparation can be administered by any convenient route, such as by infusion or bolus injection, and can be administered together with other bioactive agents. In one case, administration is systemic topical administration.

[0317] In some embodiments, the stem cell preparation or composition is formulated as a pharmaceutical composition suitable for intravenous administration to mammals, including humans. In one case, the composition for intravenous administration is a solution in a sterile isotonic aqueous buffer. When necessary, the composition also includes a local anesthetic to relieve any pain at the injection site. When the composition is to be administered by infusion, it can be distributed with an infusion bottle containing sterile pharmaceutical grade water or saline. When the composition is administered by injection, an ampoule of sterile water for injection or saline can be provided so that the ingredients are mixed before administration.

[0318] In some embodiments, a suitable pharmaceutical composition comprises a therapeutically effective amount of progenitor stem cells and a pharmaceutically acceptable carrier or excipient. Such carriers include, but are not limited to, saline, buffered saline, dextrose, water, and combinations thereof.

[0319] In some embodiments, the isolated stem cells are delivered to a target site (e.g., pancreas, brain, spinal cord, or any other site of nerve damage and / or degeneration) by a delivery system suitable for targeting cells to a specific tissue. For example, the cells are encapsulated in a delivery vehicle that allows the cells to be slowly released at the target site. The delivery vehicle is modified so that it is specifically targeted to a specific tissue. The surface of the targeted delivery system is modified in a variety of ways. In the case of a liposome targeted delivery system, a lipid group is incorporated into the lipid bilayer of the liposome to maintain a stable association of the targeting ligand with the liposome bilayer.

[0320] In another example, a colloidal dispersion system is used. Colloidal dispersion systems include macromolecular complexes, nanocapsules, microspheres, beads, and lipid-based systems, including oil-in-water emulsions, micelles, mixed micelles, and liposomes.

[0321] In some embodiments, administration of stem cells described herein is optionally tailored to an individual by: (1) increasing or decreasing the amount of cells injected; (2) changing the number of injections; (3) changing the method of delivering the cells; or (4) changing the source of the cells, e.g., by genetically engineering the cells, or from in vitro cell culture.

[0322] In some embodiments, the stem cell preparation is used in an amount effective to promote engraftment of the cells in a recipient. Administration is adjusted to achieve optimal efficacy and pharmacological dosing at the physician's discretion.

[0323] Screening methods

[0324] Provided herein is a method for screening compounds for treating or preventing diseases. In one case, the method includes contacting an isolated mammalian trophoblast stem cell or its differentiated cells with the compound. In another case, the method further includes detecting changes in the activity of at least one gene, transcript, or protein in a mammalian trophoblast stem cell or differentiated cell. In another case, the method further includes detecting changes in the level of at least one transcript or protein in a mammalian trophoblast stem cell or differentiated cell. In another case, the method includes detecting changes in the activity of at least one gene, transcript, or protein in a mammalian trophoblast stem cell or differentiated cell. In some embodiments, the disease is associated with an insulin disorder, such as diabetes. In some embodiments, the mammalian trophoblast stem cell is an hTS cell. In some embodiments, the differentiated cell is a pancreatic progenitor cell. In some embodiments, the differentiated cell is a cell that produces insulin.

[0325] A situation provided herein describes a method for screening compounds for the ability to regulate cell changes. In another case, the method includes contacting the mammalian trophoblast stem cells (e.g., hTS cells) separated with the compound and detecting the induction of growth and differentiation of the mammalian trophoblast stem cells. In one case, the method includes contacting the differentiated cells (e.g., progenitor cells) herein with the compound and detecting changes in cell proliferation or cell function. In some embodiments, the progenitor cells separated are pancreatic progenitor cells. In some embodiments, the progenitor cells separated are cells that produce insulin.

[0326] In some embodiments, provided herein are methods for screening a compound for its ability to modulate pancreatic cell function (e.g., β-cell function), the method comprising combining the compound with a pancreatic progenitor cell or differentiated cell described herein, determining any phenotypic or metabolic changes in the cell, and correlating the changes with the ability of the compound to modulate the secretion of insulin, glucagon, or β-opsonin.

[0327] Also provided herein is a method for screening compounds for cytotoxicity of cells, the method comprising contacting the differentiated cells herein with the compound. In another case, the method further comprises determining the phenotypic or metabolic changes of the cells caused by contacting with the compound, and associating the changes with any other changes in cytotoxicity or cell function or biochemistry. In another case, screening of therapeutic compounds, toxins or potential differentiation regulators is facilitated. These substances (e.g., therapeutic compounds, toxins or potential regulators) can be added to the culture medium.

[0328] Also provided herein is a method for screening proliferation factors, differentiation factors and therapeutic compounds. In one case, mammalian trophoblast stem cells are used to screen factors (e.g., small molecule drugs, peptides, polynucleotides, etc.) or conditions (e.g., culture conditions or operations) that affect the characteristics of mammalian trophoblast stem cells or differentiated cells in culture. In one case, the system has the advantage of not being complicated by the secondary effects caused by the interference of test compounds to feeder cells. In another case, the test affects the substance of growth. In another case, the conditioned medium is taken out from the culture and replaced with a simpler culture medium. In another case, different wells are then treated with different mixtures of soluble factors as candidates for components of the substituted conditioned medium. If the treated cells are maintained and propagated in a satisfactory manner (optimally still in the conditioned medium), the efficacy of each mixture is determined. Potential differentiation factors or conditions can be tested by treating cells according to the test protocol and then determining whether the treated cells develop the function or phenotypic characteristics of differentiated cells of a specific lineage. In some embodiments, mammalian trophoblast stem cells are hTS cells.

[0329] In some embodiments, mammalian trophoblast stem cells (e.g., hTS cells) herein are used to screen potential regulators of cell differentiation. In one case, the cell differentiation is pancreatic differentiation. For example, in an assay for screening regulators of cell differentiation, mammalian trophoblast stem cells may be cultured under serum-free, low-density conditions, in the presence or absence of LIF, in the presence of regulators, and in the presence or absence of RA, as required by the situation, and the effect on differentiation may be detected. In another case, the screening methods described herein may be used to study conditions associated with cell development and to screen potential therapeutic or corrective drugs or regulators for the conditions. For example, in one case, the development of normal mammalian trophoblast stem cells is compared with the development of cells with conditions. In some embodiments, mammalian trophoblast stem cells are hTS cells.

[0330] In some embodiments, gene and protein expression between different cell populations obtained from mammalian trophoblast stem cells (e.g., hTS cells) can be compared and used to identify and characterize factors that are up- or down-regulated during differentiation, as well as to generate nucleotide copies of affected genes.

[0331] In some embodiments, mammalian trophoblast stem cell cultures without feeder cells can also be used for the test of drug compounds in drug research. The evaluation of the activity of candidate drug compounds generally includes combining the differentiated cells of this article with the candidate compound, determining any changes produced, and then associating the influence of the compound with the observed changes. In another case, for example, because the compound is designed to have a pharmacological effect on certain cell types, or because the compound is designed to have an effect with unexpected side effects in other cases, the screening is completed. In another case, two or more drugs are tested in combination (by combining with cells simultaneously or sequentially) to detect possible drug-drug interaction effects. In another case, compounds are screened for potential toxicity at the beginning. In another case, cytotoxicity depends on the influence on cell viability, survival rate, morphology, the influence on the expression or release of certain markers, receptors or enzymes, and the influence on DNA synthesis or repair. In some embodiments, mammalian trophoblast stem cells are hTS cells.

[0332] Treatment of disease

[0333] In one aspect, provided herein is a method for treating or preventing a disease in a mammal in need, the method comprising administering the cell herein (e.g., isolated progenitor cell) to a mammal in need. In one case, the cell is immune-pardoned. In one case, the cell has low levels of CD33 expression and / or CD133 expression. In one case, the administration includes injection, implantation or surgical operation. In one case, the disease is an insulin disorder. In one case, the disease is diabetes, e.g., type 1 diabetes or type 2 diabetes. In one case, the mammal in need is a rodent, rabbit, cattle, sheep, pig, dog, cat, monkey or ape. In some embodiments, the rodent herein is a mouse, rat, guinea pig, hamster or squirrel. In some embodiments, the ape herein is a chimpanzee, gorilla or orangutan. In one instance, the mammal in need thereof has one or more symptoms associated with diabetes, such as polyuria (frequent urination), polydipsia (increased thirst), polyphagia (increased hunger), weight loss, blurred vision, itching, peripheral neuropathy, recurrent vaginal infections, fatigue, slow healing of wounds or ulcers, and any combination thereof.

[0334] In one aspect, provided herein is a method for treating or preventing a disease or condition, the method comprising administering to a subject in need thereof an effective amount of isolated mammalian trophoblast stem cells or differentiated cells prepared using the methods of the invention disclosed herein. In one instance, the disease is an immunodeficiency disease, a neurological disease, a hematopoietic disease, a cancer or diabetes.

[0335] In some embodiments, provided herein are methods of generating insulin-secreting cells to treat diabetic patients, for example, using the isolated mammalian trophoblast stem cells or differentiated cells herein.

[0336] In some embodiments, diabetes herein may refer to any metabolic defect in the production and utilization of carbohydrates (eg, glucose) or any insulin disorder.

[0337] In some embodiments, diabetic patients suffer from type 1 diabetes, type 2 diabetes, gestational diabetes or latent autoimmune diabetes in adults (LADA). In type 1 diabetes or insulin-dependent diabetes (IDDM), the patient produces very little insulin or does not produce insulin (the hormone regulating glucose utilization). In type 2 diabetes or non-insulin-dependent diabetes (NIDDM), the patient usually has the plasma insulin level that is identical or even raised compared with non-diabetic subjects, but has developed resistance to the insulin stimulating effect of glucose and lipid metabolism in major insulin-sensitive tissues (it is muscle, liver and adipose tissue), and the plasma insulin level is not enough to overcome significant insulin resistance when improving. Gestational diabetes (or gestational diabetes, GDM) can be the situation that the women of diabetes without previous diagnosis show high blood sugar level during pregnancy. Latent autoimmune diabetes in adults (LADA) can be the situation that type 1 diabetes develops in adults.

[0338] In some embodiments, the cells, compositions and methods herein can be used to treat or prevent diabetes (e.g., diabetes, diabetic nephropathy, diabetic neuropathy, diabetic angiopathy and microangiopathy), hyperglycemia, obesity, lipid disorders (e.g., dyslipidemia, hyperlipidemia, hypertriglyceridemia, hypercholesterolemia, low HDL, high LDL, metabolic syndrome (dyslipidemia), systemic and pulmonary hyperfunction, cardiovascular disease (e.g., cardiac fibrosis after myocardial infarction, cardiac hypertrophy and cardiac insufficiency, atherosclerosis), renal disease (e.g., glomerulosclerosis, nephrosclerosis, nephritis, renal disease, electrolyte excretion disorders) and / or fibrotic and inflammatory processes (e.g., cirrhosis of the liver, pulmonary fibrosis, fibrosing pancreatitis, rheumatism and osteoarthritis (arthroses), Crohn's disease, chronic bronchitis, radiation fibrosis, sclerodermatitis, cystic fibrosis, scarring, Alzheimer's disease). The cells, compositions and methods herein can also inhibit the growth of cancer, tumor cells and tumor metastasis and are therefore suitable for tumor treatment.

[0339] In some embodiments, the cells, compositions and methods herein can be used to treat insulin resistance syndrome in a subject having type 2 diabetes or impaired glucose tolerance or a family history of diabetes and at least one of the following conditions: dyslipidemia, hypertension, hyperuricemia, procoagulant states, atherosclerosis, and central obesity.

[0340] In some embodiments, the cells, compositions, and methods herein can be used to treat or prevent one or more diabetes-related conditions, including metabolic syndrome (Syndrome X or elevated blood sugar, hypertension, obesity, dyslipidemia), hyperglycemia, hyperinsulinemia, impaired glucose tolerance, impaired fasting glucose, insulin resistance, obesity, atherosclerotic disease, cardiovascular disease, cerebrovascular disease, peripheral vascular disease, lupus, polycystic ovary syndrome, carcinogenesis, diabetic neuropathy, diabetic nephropathy, diabetic retinopathy, diabetic macular edema and hyperplasia.

[0341] In some embodiments, the cells, compositions and methods described herein can be used to treat or prevent one or more diseases, disorders and conditions, including: (1) hyperglycemia, (2) low glucose tolerance, (3) insulin resistance, (4) obesity, (5) lipid disorders, (6) dyslipidemia, (7) hyperlipidemia, (8) hypertriglyceridemia, (9) hypercholesterolemia, (10) low HDL levels, (11) high LDL levels, (12) atherosclerosis and its aftermath sequelae, (13) vascular restenosis, (14) irritable bowel syndrome, (15) inflammatory bowel disease, including Crohn's disease and ulcerative colitis, (16) other inflammatory conditions, (17) pancreatitis, (18) abdominal obesity, (19) neurodegenerative diseases, (20) retinopathy, (21) nephropathy, (22) neuropathy, (23) syndrome X, (24) ovarian hyperandrogenism (polycystic ovary syndrome), and other conditions in which insulin resistance is a component.

[0342] In some embodiments, the cells, compositions and methods herein can be used, for example, in combination with antihyperlipidemic agents to treat or prevent cardiovascular disease (CVD). Examples of antihyperlipidemic agents include statin compounds, which are cholesterol synthesis inhibitors (e.g., cerivastatin, pravastatin, simvastatin, lovastatin, atorvastatin, fluvastatin, itavastatin or their salts, etc.); squalene synthase inhibitors; or fibrate compounds with triglyceride lowering effects (e.g., bezafibrate, clofibrate, bisfibrate, clinofibrate), etc.

[0343] In some embodiments, the cells, compositions and methods herein can be used, for example, in combination with antihypertensive agents to treat or prevent abnormal blood vessel growth and renal sodium retention caused by high insulin levels and thereby reduce hypertension. Examples of antihypertensive agents include angiotensin converting enzyme inhibitors (e.g., captopril, enalapril, delapril), angiotensin II antagonists (e.g., candesartan cilexetil, losartan, eprosartan, valsantan, telmisartan, irbesartan, tasosartan), calcium antagonists (e.g., manidipine, nifedipine, nicardipine, amlodipine, efonidipine) and clonidine.

[0344] In some embodiments, the cells, compositions and methods herein can be used, for example, in combination with a weight loss agent. Examples of weight loss agents include weight loss drugs acting on the central nervous system, pancreatic lipase inhibitors (e.g., orlistat), beta-3 agonists (e.g., CL-3 16243, SR-5861 1-A, UL-TG-307, SB-226552, AJ-9677, BMS-196085, AZ-40140), anorectic peptides (e.g., leptin), CNTF (ciliary neurotrophic factor) and cholecystokinin agonists (e.g., lintitript, FPL-15849).

[0345] In some embodiments, provided herein is a method for treating a neurodegenerative disease, the method comprising administering to a patient an effective amount of trophoblast stem cells or differentiated cells thereof. Mammalian trophoblast stem cells are obtained from trophoblast villi at the fallopian tube of an ectopic pregnancy. In one case, the neurodegenerative disease is Parkinson's disease, Huntington's disease, Alzheimer's disease, or chemical-induced neuronal damage.

[0346] In some embodiments, provided herein is a method for treating a disorder, wherein the method comprises transplanting a pure neuron population or a complex of a specific neural stem cell population generated by the methods herein to a patient in need thereof. In one case, the patient is diagnosed with a neurological disease. In another case, the patient is diagnosed with a neuropsychiatric disorder. In another case, the patient is diagnosed with a neurodegenerative disorder. In another case, the pure neuron population comprises dopaminergic neurons.

[0347] In one case, the disease is a neurological disease. In another case, the disease is a neurodegenerative disease or disorder. Non-limiting examples of neurological disorders include Parkinson's disease, Alzheimer's disease, Huntington's chorea, amyotrophic lateral sclerosis, Friedreich's ataxia, Lewy body disease, spinal muscular atrophy, multiple system atrophy, dementia, schizophrenia, paralysis, multiple sclerosis, spinal cord injury, brain injury (e.g., stroke), cranial nerve disorders, peripheral sensory neuropathy, epilepsy, prion disorders, Creutzfeldt-Jakob disease, Alper's disease, cerebellum / spinocerebellar degeneration, Batten disease, corticobasal degeneration, Bell's palsy, Guillain-Barre Syndrome, Pick's disease and autism.

[0348] In some embodiments, the methods described herein can be used to reduce or ameliorate symptoms of a neurological disease or disorder. Non-limiting examples of symptoms associated with a neurological disease or disorder include tremor, gait disturbance, maldispositional gait, dementia, excessive swelling (edema), muscle weakness, lower limb atrophy, movement disorders (chorea), muscle stiffness, slowing of physical movement (bradykinesia), loss of physical movement (akinesia), forgetfulness, cognitive (intelligence) impairment, cognitive loss (acognitionlessness), impairment of functions such as decision making and planning, hemifacial paralysis, sensory loss, numbness, tingling, paresthesia of pain in the extremities, weakness, cranial nerve palsies, speech difficulties, eye movements, visual field defects, blindness, hemorrhages, exudates, proximal muscle atrophy, movement disorders, dystonia of limb muscles, myotonia, incoordination, false indications in the finger-to-finger test or finger-to-nose test, dysmetria, Holmes-Stewart phenomenon, incomplete or complete generalized paralysis, optic neuritis, multiple vision, ocular motor disorders, disturbances such as nystagmus, spastic paralysis, painful tonic seizures, Lhermitte syndrome, ataxia, stuttering, vesicorectal disturbance, orthostatic hypotension, decreased motor function, enuresis, poor speech, poor sleep patterns, sleep disturbances, appetite disturbances, weight changes, psychomotor agitation or retardation, decreased energy, feelings of worthlessness or excessive or inappropriate guilt, difficulty thinking or concentrating, recurrent thoughts of death or suicidal ideation or attempts, fears, anxiety, irritability, rumination or obsessive thinking, excessive concern about physical health, panic attacks, and phobias.

[0349] In some embodiments, the methods herein can be used to treat or prevent cancer, wherein the cancer is a carcinoma. Further, the carcinoma is an adenocarcinoma or a choriocarcinoma. In one case, the choriocarcinoma is a malignant syncytial tumor.

[0350] Production of insulin, C-peptide, β-opsonin protein, and β-opsonin mRNA

[0351] In one aspect, the present invention provides a method for producing insulin, the method includes contacting mammalian trophoblast stem cells with one or more agents to activate miR-124, thereby producing a progenitor cell that secretes insulin in response to glucose stimulation. In another aspect, the present invention provides a method for producing β-opsonin protein and / or β-opsonin mRNA, the method includes contacting mammalian trophoblast stem cells with one or more agents to activate miR-124, thereby producing pancreatic progenitor cells, which produce β-opsonin protein and / or β-opsonin mRNA. In one case, β-opsonin protein or β-opsonin mRNA are produced during about 12-28 hours after induction, for example, during about 12-16, 16-20, 20-24 or 24-28 hours after induction. In one case, the progenitor cell is a pancreatic progenitor cell. In one case, the progenitor cell produces C-peptide and / or insulin.

[0352] In some embodiments, the mammalian trophoblast stem cells are hTS cells. In some embodiments, the mammalian trophoblast stem cells herein are from rodents (e.g., mice, rats, guinea pigs, hamsters or squirrels), rabbits, cattle, sheep, pigs, dogs, cats, monkeys or apes (e.g., chimpanzees, gorillas or orangutans).

[0353] In some embodiments, miR-124 is activated in time and space at the definitive endoderm stage, for example, between about 1 hour and about 8 hours at the definitive endoderm stage. In some embodiments, the expression of miR-124 is improved. In some embodiments, the one or more agents include proteins or steroid hormones, such as growth factors. In some embodiments, the one or more agents include FGF, such as FGF1, FGF2 (bFGF), FGF3, FGF4, FGF5, FGF6, FGF7, FGF8, FGF9 or FGF10. In some embodiments, FGF (for example, bFGF) is not more than about 200ng / mL, for example 100-200ng / mL. In some embodiments, FGF (for example, bFGF) is not more than about 100ng / mL, for example, about 0.1 to 1ng / mL; or about 1 to about 100ng / mL. In some embodiments, the concentration of FGF (e.g., bFGF) used herein is about: 0.1-1, 1-10, 10-20, 20-30, 30-40, 40-50, 50-60, 50-70, 80-90 or 90-100 ng / mL. In some embodiments, the concentration of FGF (e.g., bFGF) used herein is about: 0.1, 0.2, 0.4, 0.6, 0.8, 1, 2, 3, 4, 5, 6, 7, 8, 9, 10, 11, 12, 13, 14, 15, 16, 17, 18, 19, 20, 25, 30, 35, 40, 45, 50, 60, 70, 80 or 90 ng / mL. In some embodiments, FGF (e.g., bFGF) is about 10 ng / mL. In some embodiments, the one or more agents further include an antioxidant or a reducing agent (e.g., 2-mercaptoethanol). In some embodiments, the one or more agents further include vitamins (e.g., nicotinamide). In some embodiments, mammalian trophoblast stem cells are contacted with FGF (e.g., bFGF), 2-mercaptoethanol, and nicotinamide. In some embodiments, the concentration of the antioxidant or reducing agent (e.g., 2-mercaptoethanol) is no more than about 10 mmol / L, such as about 0.1 to about 10 mmol / L. In some embodiments, the concentration of the antioxidant or reducing agent (e.g., 2-mercaptoethanol) is about: 0.1-1, 1-2, 2-3, 3-4, 4-5, 5-6, 6-7, 7-8, 8-9, or 9-10 mmol / L. In some embodiments, the concentration of the antioxidant or reducing agent (e.g., 2-mercaptoethanol) is about: 0.2, 0.5, 1, 1.5, 2, 3, 4, 5, 6, 7, 8, or 9 mmol / L. In some embodiments, the concentration of the antioxidant or reducing agent (eg, 2-mercaptoethanol) is about 1 mmol / L.In some embodiments, the concentration of vitamin (e.g., nicotinamide) is no greater than about 100 mmol / L, such as about 1 to about 100 mmol / L. In some embodiments, the concentration of vitamin (e.g., nicotinamide) is about: 1-10, 10-20, 20-30, 30-40, 40-50, 50-60, 50-70, 80-90 or 90-100 mmol / L. In some embodiments, the concentration of vitamin (e.g., nicotinamide) is about: 2, 4, 6, 8, 10, 12, 14, 16, 18, 20, 30, 40, 50, 60, 70, 80 or 90 mmol / L. In some embodiments, the concentration of vitamin (e.g., nicotinamide) is about 10 mmol / L.

[0354] In some embodiments, mammalian trophoblast stem cells are contacted with one or more agents to regulate the activity or expression level of CAMP response element binding protein 1 (CREB1), such as CREB1 phosphorylation. In some embodiments, the one or more agents include vitamin metabolites, such as retinoic acid. In some embodiments, the one or more agents include CREB1-binding proteins. In some embodiments, the one or more agents regulate one or more factors selected from mixl1, Cdx2, Oct4, Sox17, Foxa2 and GSK3β.

[0355] In some embodiments, the miR-124 herein is miR-124a, miR-124b, miR-124c, miR-124d or miR-124e, such as miR-124a. In some embodiments, miR-124a is Homo sapiens miR-124a (hsa-miR-124a), such as hsa-miR-124-5p (SEQ ID NO: 1: CGUGUUCACAGCGGACCUUGAU) or hsa-miR-124-3p (SEQ ID NO: 2: UAAGGCACGCGGUGAAUGCC) or a fragment thereof. In some embodiments, miR-124 comprises a sequence selected from Table 1, Table 2 and the accompanying drawings or a fragment thereof.

[0356] Regenerative medicine research and therapy

[0357] In some embodiments, mammalian trophoblast stem cells (e.g., hTS cells) or differentiated cells thereof herein can be used for the growth and / or generation of organs and / or tissues. In one case, mammalian trophoblast stem cells can be used to generate organs or tissues or their constructs without a scaffold or on a scaffold (e.g., a natural tissue scaffold or a scaffold made of a biodegradable material). In one case, the material in the bioscaffold herein can be a hydrogel, such as type I collagen, collagen / fibrin, fibrin, Extracel TM Hydrogel, Extracel TM UV, tyramine substituted hyaluronic acid (TS-NaHy) - Corgel TM , methylcellulose-hyaluronic acid (MC-HA), chitosan, chitosan / collagen, alginate, alginate / gelatin, polyethylene glycol diacrylate (PEGDA), or any combination thereof. In one case, the mammalian trophoblast stem cells herein can be used to generate organs and / or tissues using 3D cell bioprinting technology. 3D cell bioprinting technology includes those disclosed in U.S. Patent Application Publication Nos. 20130017564, 2012 / 0190078, 2012 / 0116568, 2011 / 0250688, 2011 / 0136162, and 2009 / 0263849. In one case, 3D cell bioprinting technology can maintain high cell viability and / or pluripotency, and / or produce spheroids with uniform size. In one case, the mammalian trophoblast stem cells herein can be used to generate pancreatic tissue. In one case, the mammalian trophoblast stem cells herein can be used to generate a functional pancreas. In some embodiments, the mammalian trophoblast stem cells are hTS cells.

[0358] Example

[0359] The following examples are non-limiting and merely represent various aspects and features of the present invention.

[0360] Example 1

[0361] Isolation of hTS cells

[0362] This experiment was approved by the Institutional Review Board on Human Subjects Research and Ethics Committee of Kaohsiung Medical University Hospital. hTS cells derived from ectopic pregnancy were obtained from informed consent donors. Embryonic chorionic villi were obtained from the fallopian tubes of unruptured preimplantation embryos of women with ectopic pregnancy (gestational age: 5-7 weeks) approved by the Institutional Review Board of the Humanities Research and Ethics Committee. The fine villus tissue was completely minced in serum-free α-MEM (Sigma-Aldrich, St.Louis, MO) and identified under a microscope, followed by trypsinization with 0.025% trypsin / EDTA (Sigma-Aldrich) for 15 min, and then α-MEM containing 10% FBS was added to stop the reaction. Adherent cells were obtained and cultured in conditional α-MEM, 10% FBS and 1% penicillin-streptomycin at 37°C in 5% CO2. After two passages, the levels of hCG became undetectable as measured by a commercial kit (Dako, Carpinteria, CA).

[0363] Example 2

[0364] Differentiation of hTS cells into pancreatic progenitor cells in vitro by regulating miR-124a

[0365] The combination of α-MEM medium containing 5.5 mM glucose, 1 mmol / L β-mercaptoethanol (ME), 10 mmol / L nicotinamide, 20% FBS and 10 ng / ml bFGF generated a maximum immunoreactive insulin-positive cell population of 11.2% compared to the other combinations that expressed 2.1% and 1.9% insulin-positive cells in the population. Figure 5 bFGF induction was performed using multiple levels of bFGF (i.e., 10, 20, 40, and 80 ng / ml) and FBS (i.e., serum-free, 1%, 5%, 10%, and 20%). The results showed that different doses of bFGF produced 8.6%, 2.2%, and 0.6% insulin, respectively. + / Ngn3 + cells (Figure 6). + / glucagon + Similar results were obtained with cells (8.5%) as indicators ( Figure 7 ).insulin + Glucagon + Total cell count of expressing cells = 1,232 cells.+ Ngn3 + Total cell counts of expressing cells = 502 cells (bFGF 10 ng / ml), 712 cells (bFGF 20 ng / ml), 485 cells (bFGF 40 ng / ml), and 571 cells (80 ng / ml). Western blot analysis indicated a positive correlation between FBS and insulin levels during bFGF induction.

[0366] After bFGF induction, time-course analysis revealed a dynamic profile of transcription factors that mark cascade stages of pancreatic development ( Figure 1A and Figure 8 ). At the beginning of induction, Mix-like 1 homeobox protein (Mixl1), a mesendoderm-associated protein, was elevated 15 min after induction. In combination with elevated Brachyury (T) or Goosecoid (Gsc), the evidence indicated a stage for the migration of the nascent mesendoderm. Mixl1 decreased at 1 hr, while T and Gsc remained high, suggesting an early transition from hTS cells to mesendoderm.

[0367] At 1-8 hr, the level of Mixl1 dropped to the lowest point at 4 hr and returned to the initial level at 8 hr. This result can keep the cells in the endoderm stationary during gastrulation. Figure 1B ) leads to the segregation of the mesendoderm into two cell populations: one expressing Pdx1 specific to the mesoderm + Mixl1 + , while the other expresses Pdx1, which is targeted to the endoderm + Mixl1 - ( Figure 1C Mixl1 mRNA expression is restricted to the mesoderm; it is not present in the endoderm. Upregulation of SRY homeobox 17 (Sox17), forkhead box protein A2 (Foxa2), and pancreatic and duodenal homeobox 1 (Pdx1) marks the outgrowth of the pancreatic bud. Sox17 is required to initiate the separation of Pdx1 + Ventral pancreas and Sox17 + Coexpression of Foxa2 and Pdx1 enhances differentiation into distinct pancreatic cell subtypes. Overexpression of Pdx1 defines pancreatic specification but does not induce insulin production even at late stages of differentiation.

[0368] At 8-16 hr, SRY homeobox 9 (Sox9) and Pdx1, markers of the foregut pancreatic endoderm, are elevated. Sox9 maintains multipotent pancreatic progenitors. Genetic ablation of Pdx1 results in defects in the pancreas, caudal stomach, and duodenum during intestinal organogenesis. Evidence suggests differentiation to the foregut pancreatic endoderm stage.

[0369] At 16-24 hr, the levels of neurogenin 3 (Ngn3) and Nkx6 homeobox 1 (Nkx6.1) remain at high levels, while the levels of T, Sox17, Foxa2, Pdx1, Sox9 and Ptf1a gradually decrease, thereby causing cell differentiation toward pancreatic progenitor cells. Pdx1 regulates Ngn3 to turn endoderm cells into endocrine cells, thereby forming islets through the expression of glucagon and somatostatin in the mesenchyme. The rise of Nkx6.1 increases β-cell proliferation. In short, these results indicate that within 24 hr, bFGF induces hTS cell differentiation toward pancreatic progenitor cells through DE formation and gastrula endoderm.

[0370] Figure 2A and Fig. 9 The dynamic distribution of Cdx2, Oct4, Nanog, and Sox2 in the time course analysis is shown. The dominant pluripotent transcription factors in each differentiation stage include Cdx2 for mesendoderm, Oct4 and Nanog for DE, Cdx2 and Nanog for gastrula endoderm, and Sox2 for pancreatic progenitors. Immunocytochemical studies indicate cell transitions ( Figure 2B , Fig.14 ) during the reciprocal negative autoregulatory feedback loop ( Figure 10-13 ), which is consistent with the findings in hES cells. Figure 2C Immunocytochemical overexpression of Oct4 with Sox17, Foxa2, Pdx1, and Gsc at 4 hr is shown, confirming Oct4 at the DE stage. These results demonstrate a unique interaction of pluripotency transcription factors with phenotypic changes that determine cell fate during pancreatic differentiation.

[0371] Figure 3A The molecular pathways that are specialized to DE by miR-124a were described. Immunoblotting analysis revealed that bFGF activated the PI3K / Akt pathway and its downstream effector cAMP response element binding protein 1 (CREB1) through FGFR1. Figure 15-18 A correlation between miR-124a and p-CREB1 expression was observed over time ( Figure 3B ), indicating that CREB1 promotes the production of miR-124a ( Figure 3C , Figure 19-20 ). These results suggest that bFGF induces the biogenesis of miR-124a via phosphorylation of CREB1.

[0372] miRNAs are post-transcriptional regulators of genes that target mRNA sequences within the 3' untranslated region (3'UTR), inhibiting translation and / or causing RNA degradation. Sequence analysis and luciferase reporter assays showed that miR-124a inhibited Smad4 ( Figure 3D )、Cdx2( Figure 3E ) and GSK3β( Figure 3F ). These results were confirmed by pre-transfection of miR-124a and anti-miR-124a ( Figure 3G ). Consistent with the report, knockdown of Smad4 inhibited Mixl1( Fig.21 ), explaining the downregulation of Mixl1 during DE transition. Cdx2 inhibition then promoted Oct4 activation. Chromatin immunoprecipitation (ChIP) assays revealed that Oct4 targets the promoter of Sox 17 ( Figure 3H ) for Sox17 expression ( Fig. 22 In turn, inhibition of GSK3β at 1-4 hr resulted in stabilization and accumulation of β-catenin in the cytoplasm ( Fig.23 ). The nuclear translocation target gene of β-catenin is Foxa2 ( Fig. 3I ) for Foxa2 expression ( Figure 8 ). It was previously reported that miR-124a regulates Foxa2 in β-cell lines. To this end, bFGF induced the multifaceted functions of miR-124a by upregulating Oct4, Sox17, and Foxa2 but downregulating Smad4 and Mixl1 at the DE stage.

[0373] β-opsonin, a protein hormone, is primarily expressed in the liver and functionally induces a high rate of pancreatic β-cell proliferation. Foxa2 targets the promoter of the gene C19orf80 to produce β-opsonin at 12 hr ( Figure 3J , Fig.24 ). qPCR analysis revealed that the temporal and spatial increase of β-opsonin mRNA began at 12 hr, reached a peak of approximately 100% at 16 hr, and then decreased until 24 hr ( Figure 3K During the 20-28 hr period (covering both the gastrula endoderm and pancreatic progenitor cell stages), parallel expression between β-opsonin, C-peptide, and insulin was observed ( Figure 3L , Fig.25 ). In immunocytochemistry, hTS cell-derived pancreatic progenitor cells co-expressed β-opsonin and insulin ( Figure 3M , Fig.26Without being bound or limited to any particular theory, it is believed that beta-opsonin may also regulate the proliferation of pancreatic progenitor cells during pancreatic development.

[0374] Example 3

[0375] hTS cell-derived pancreatic progenitor cells secrete insulin in response to glucose stimulation

[0376] Pancreatic progenitor cells monitor glucose levels by secreting immunoreactive insulin into the culture medium ( Figure 4A Interestingly, there was evidence that cells rapidly aggregated to form 3D grape-like clusters that stained positive for dithizone (DTZ), a specific stain for β-cells. Once high glucose was removed, the clusters reverted to fibroblast-like features ( Figure 4B ). This cellular process is recorded by a computer-microscope-video system.

[0377] Radioimmunoassays measured a significant increase in immunoreactive C-peptide and insulin levels in response to high glucose (25 mM) stimulation ( Figure 4C Ultrastructural studies of DTZ-positive cell clusters revealed round cells with a large cytoplasm / nuclear ratio, intercellular bridges (desmosomal junctions), abundant mitochondria, immature granules, and the presence of secretory granules that mimic the secretory granules of pancreatic α- and β-cells ( Figure 4D ).

[0378] Immunocytochemically, hTS cell-derived pancreatic progenitor cells expressed multiple markers, including Sox2, Nkx6.1, Ptf1a, Ngn3, Pdx1, Sox9, β-opsonin, as well as endocrine components such as insulin (β-cells), somatostatin (δ-cells), glucagon (α-cells), pancreatic polypeptide (PP-cells), the glucose metabolic transporter Glut2, and the catalytic enzyme amylase ( Figure 4E ). All evidence indicated the existence of pancreatic progenitor cells, and they responded positively to glucose stimulation as tested by expressing C-peptide and insulin.

[0379] Materials and Methods Used in the Experiments Described in Examples 2-3

[0380] Cell culture and differentiation

[0381] Undifferentiated hTS cells were maintained in α-MEM (Gibco) supplemented with 10% (v / v) fetal bovine serum (SAFC Biosciences). Cultures were manually passaged every 2-3 days at a split ratio of 1:3–1:6. Differentiation of pancreatic progenitor cells was performed in conditioned α-MEM medium containing 20% ​​FBS, 1 mM 2-mercaptoethanol, 10 mM nicotinamide, and 10 ng / ml bFGF for 24 hr in a 37°C, 5% CO2 incubator. The differentiation protocol was as follows Figure 5-7 The stage-specific differentiation of the lineages was determined by the empirical practice shown in . The stage-specific differentiation of the lineages was referenced to various cell markers as previously described (M. Borowiak, Rev. Diabet. Stud. 7, 93-104 (2010); KAD'Amour et al., Nat. Biotech. 23, 1534-1541 (2005); E. Kroon et al., Nat. Biotech. 26, 443-452 (2008)). Cells were collected at the time indicated for different experiments.

[0382] Reagents

[0383] DTZ (Merck KGaA, Darmstadt, Germany), bFGF (Sigma), fluorescein isothiocyanate (FITC), Texas Red 594 (Invitrogen), DyLight 488-, DyLight 594- (Thermo Scientific), phycoerythrin (PE)-conjugated secondary antibodies (Jackson ImmunoResearch, Baltimore, MD).

[0384] Western blotting

[0385] The method of this test has been described previously (TTYLee et al., PLoS ONE7, e52491 (2012)). In brief, cells were collected into RIPA lysis solution (Millipore, Billerica, MA) supplemented with protease and phosphatase inhibitors (Roche). After electrophoresis of 30-μg lysate on polyacrylamide gel, electroblotting to PDVF membrane (Millipore) was performed. The target protein was blocked in 5% skim milk powder in PBS for 1 hr at room temperature and detected by using the first antibody. All membranes were incubated with chemiluminescent agents (Millipore) and images were captured by the ChemiDoc XRS system (Bio-RAD). The antibodies used are listed in Table S1. Data were analyzed by AlphaEaseFC (version 4.0.0).

[0386] Immunofluorescence

[0387] Slides with cell cultures were fixed in 95% (v / v) ethanol at room temperature for 30 min, washed 3 times in PBS, and incubated with blocking buffer PBS containing 0.1% (wt / v) Triton X-100 (Sigma) and 5% (v / v) normal donkey serum (Millipore) for 60 min. The first and second antibodies were diluted in blocking buffer. The first antibody was incubated at 4 ° C (24 hr) or incubated at room temperature for 2 hr. After incubation with the specific first antibody in PBS, a suitable second antibody coupled to fluorescein isothiocyanate (FITC, Invitrogen) or Alexa Fluor 488, 594, 647 (Invitrogen) or Dylight 488, 594 (BioLegend) was added at room temperature for 1 hr. The cells were microscopically examined for nuclei (5 min) by staining with 4', 6-diamidino-2-phenylindole (DAPI). Subsequently, the slides were incubated with the second antibody at room temperature (1 hr) and washed, and fixed with 50% glycerol. Images were captured on a confocal laser scanning microscope (LSM700; Zeiss Z1 or Olympus FluoView1000 confocal laser scanning microscope) or TissueFAXS system (TissueQnostics GmbH, Vienna, Austria), and data were analyzed by TissueQuest software as previously described (TTY Lee et al., PLoS ONE 7, e52491 (2012)).

[0388] TaqMan miRNA and quantitative real-time PCR assays

[0389] RNA was isolated from hTS cells in triplicate or quintuplicate samples using TRIZOL reagent (Invitrogen) and DNAase I on-column digestion (Qiagen, Valencia, CA) according to the manufacturer's protocol. Total RNA (500 ng) was used for reverse transcription using iScript cDNA synthesis kit (Bio-Rad). PCR was performed in duplicate using 1 / 40 of cDNA per reaction and 400 nM forward and reverse primers. For miRNA stem-loop qPCR, a single-tube TaqMan miRNA assay was used according to the manufacturer's instructions (Applied Biosystems). All RT reactions, including no template controls and RT-controls, were performed in a GeneAmp PCR 9700 thermal cycler (Applied Biosystems). Comparative real-time PCR, including no template controls, was performed in triplicate or quintuplicate using specific primers for miR-124 or RNU6B (Applied Biosystems). U6 snRNA (RNU6B; Applied Biosystems) was used as an endogenous control. Relative expression was calculated using SDS2.2.2 software (Applied Biosystems) for comparison of ΔC t Analysis. Sequences of primers for β-opsonin mRNA: Primer 1, forward: 5'-acatctccctccccagactc-3' (SEQ ID NO: 122) and reverse: 5'-tgctctgtgctcagaagtgg-3' (SEQ ID NO: 123); Primer 2: forward: 5'-ctgtcggctgagggtttccat-3' (SEQ ID NO: 124) and reverse: 5'-gagtctggggagggagatgt-3' (SEQ ID NO: 125).

[0390] Immunoprecipitation (IP) assay

[0391] Cell lysates of bFGF-treated hTS cells were collected. Total proteins (100 μg) were treated with specific primary antibodies listed in (Table S1) overnight by incubation with protein G-agarose (Minipore) for 30 min. After 2 h of treatment with protein G-agarose beads, samples were washed 3 times with RIPA lysis buffer (Minipore), followed by addition of protein loading dye and boiling for 5 min. Samples were resolved by 8% SDS-PAGE and subjected to immunoblot analysis.

[0392] Chromatin immunoprecipitation (ChIP) assay

[0393] ChIP assay was performed by using ChIP assay kit (Millipore) according to the manufacturer's instructions. Briefly, hTS cells (1×10 6 ) Immunoprecipitated DNA fragments were extracted and anti-CREB1 or anti-Oct4 or anti-β-catenin antibodies were used as previously described (TTY Lee et al., PLoS ONE 7, e52491 (2012)). Specific primers were used to amplify the conserved binding sites at the promoter region of miR-124a or Sox17 or Foxa2 and are listed as follows:

[0394] Promoter for miR124-2: forward, 5'-tctgcggctctttggtttca-3' (SEQ ID NO: 126), and reverse, 5'-tctgccttcagcacaagagg-3' (SEQ ID NO: 127); and forward, 5'-gcggctctttggtttcaagg-3' (SEQ ID NO: 128); reverse, 5'-ctgccttcagcacaagagga-3' (SEQ ID NO: 129); Promoter for miR124-3: 5'-cccgcagttctcaaggacac-3' (SEQ ID NO: 130), and reverse, 5'-agaagggagccaggcaagtc-3' (SEQ ID NO: 131); Promoter for Sox17: 5'-ttgtagattgctctctctcctcc-3' (SEQ ID NO:132), and reverse, 5'-gtgaagccttggctagggg-3' (SEQ ID NO:133); for the promoter of Foxa2: 5'-cccatcattgattcctggat-3' (SEQ ID NO:134), and reverse, 5'-ttgggaggctgagatttgtc-3' (SEQ ID NO:135); for the promoter of β-opsonin: 5'-gtcagccctccctgactgat-3' (SEQ ID NO:136), and reverse, 5'-catgtggatttccagcctgc-3' (SEQ ID NO:137).

[0395] Dual luciferase assay

[0396] To prepare the luciferase-3'UTR reporter plasmid, the amplified 3'UTR fragment was amplified from the genomic DNA extract of hTS cells. The 3'UTR PCR fragment was cloned downstream of the luciferase gene in the pGL4.51 vector (Promega, Madison, WI) using PsiI and MfeI (Thermo Scientific, Rockford, IL). The primers used for the 3'UTR reporter construct are listed below:

[0397] For Cdx2 3'UTR: forward, 5'-aaattataagctgtttgggttgttggtct-3' (SEQ ID NO: 138), and reverse, 5'-aaacaattgcccccataatttctgactgc-3' (SEQ ID NO: 139); for Smad4 3'UTR region 1: forward, 5'-aaattataactcccaaagtgctgggatta-3' (SEQ ID NO: 140), and reverse, 5'-aaacaattgctgcactgttcacaggagga-3' (SEQ ID NO: 141); for Smad4 3'UTR region 2: forward, 5'-aaattataacagttgtcccagtgctgcta-3' (SEQ ID NO: 142), and reverse, 5'-aaacaattgatgacttgcccaaaggtcac-3' (SEQ ID NO: 143); for GSK3β 3'UTR: forward, 5'-aaattataacccacaactggggtaaaaga-3' (SEQ ID NO: 144), and reverse, 5'-aaacaattgctgtggaaggggcaaagata-3' (SEQ ID NO: 145).

[0398] For the dual luciferase assay, the firefly luciferase reporter gene (500 ng) or the empty vector without any 3'UTR was co-transfected with the pGL4.74 Renilla luciferase plasmid (500 ng; Promega) and the expression of luciferase was determined using Nonspecific control miRNA (30 pmol) or miR-124a precursor (30 pmol; System Biosciences, Mountain View, CA) were co-transfected into hTS cells (1.5 × 10 4Cells). After transfection (36 hr), luciferase activity was analyzed by dual luciferase reporter assay system (Promega) and Centro LB 960 microplate luminometer (Microplate Luminometer) (Berthold Technologies, Bad Wildbad, Germany). For evaluation, the Renilla luciferase value was first normalized to the firefly luciferase activity, and the calculated activity of each 3'UTR reporter gene was further normalized to the activity of the control vector. Data are expressed as mean ± SD, n = 8, p < 0.05 as statistical significance. Whole cell extracts prepared in cell lysis buffer were subjected to immunoblotting analysis using Cdx2, Smad4, GSK3β and β-actin antibodies.

[0399] Transfection of miR-124a precursor or anti-miR-124a

[0400] MiR-124a precursor and anti-miR-124a were purchased from System Biosciences. Briefly, miR-124a precursor (60 pmol) or anti-miR-124a (60 pmol) were transfected into hTS cells in 12-well culture dishes using TransIT-LT1 transfection reagent (Mirus, Madison, WI). Total RNA was used to quantify miR-124a at 36 hr after transfection.

[0401] Radioimmunoassay of C-peptide and insulin

[0402] In the glucose stimulation test, high glucose (25mM) was added to α-MEM medium (5ml) after bFGF treatment when more than 80% of the cells were confluent. The culture medium was collected at different times (5, 10, 20, 30, 60 and 120min). The collected culture medium was lyophilized with a freeze dryer (VirTis, Warminster, PA) and rehydrated with sterile water (400μl) for radioimmunoassay. C-peptide and insulin levels in the culture medium were determined by C-PEP II-RIA-CT (DIAsource ImmunoAssays SABelgium) and Coat-A-Count insulin (Siemens Healthcare Diagnostics Inc.LA, CA), respectively. n=5, p<0.05 was used as statistical significance.

[0403] Flow cytometry

[0404] After transfection with nonspecific shRNA or shRNA against Cdx2, Oct4, Sox2, or Nanog, cells (5 × 10 6 Cells / ml) were incubated with specific primary antibodies (listed in Table S1) for 30 min. The samples were washed and resuspended in PBS at 4°C at adjusted dilutions for 1 hr, then passed through polystyrene round-bottom tubes with cell strainer caps (BD Falcon) before flow cytometry (FACScan, BD Biosciences, San Jose, CA). Data were analyzed using Cell-Quest software (BD Biosciences).

[0405] Transmission electron microscopy

[0406] After high glucose stimulation, hTS cell-derived islet-like cell clusters on culture dishes were cut open with tungsten needles. For transmission electron microscopy, cell blocks were fixed at room temperature for 1 hr in 0.1M sodium cacodylate buffer (pH 7.4) containing 3% wt / vol formaldehyde, 1.5% (wt / vol) glutaraldehyde and 2.5% (wt / vol) sucrose and overnight at 4°C. Before and after osmium treatment (osmication) 2 hr in Palade fixative containing 1% (vol / vol) OsO4 at 4°C, samples were washed with sodium cacodylate buffer, treated with tannic acid, stained with uranyl acetate, dehydrated through a graded series of ethanol solutions, and embedded in TABB epoxy resin (Agar Scientific Ltd.). Ultrathin sections were stained with uranyl acetate and lead citrate and examined using JEM-2000EXII (JEOL, Tokyo). The imaging of vesicle particles was described previously (KAD'Amour et al., Nat. Biotech. 23, 1534-1541 (2005)).

[0407] Statistical analysis

[0408] All experiments were performed in triplicate and repeated twice or as indicated. Data obtained from Western blots, qPCR, luciferase assays, and flow cytometry were calculated by Student's t test. p-values ​​< 0.05 were considered statistically significant.

[0409] Table S1. Antibodies used in this study

[0410]

[0411]

[0412] One or more embodiments, examples or aspects disclosed herein may be combined with any other embodiments, examples or aspects disclosed herein, where appropriate.

[0413] Although some embodiments have been shown and described herein, these embodiments are provided by way of example only. Various changes, modifications and substitutions may be made without departing from the present invention. It should be understood that the various alternatives of the embodiments of the present invention described herein may be used to implement the present invention.

Claims

1. Use of isolated pancreatic progenitor cells expressing insulin and beta-opsonin in the preparation of a medicament for treating hyperglycemia or diabetes in a subject in need thereof, wherein the isolated pancreatic progenitor cells are produced by contacting mammalian trophoblast stem cells with bFGF to activate miR-124, thereby producing isolated progenitor cells that secrete insulin in response to glucose stimulation, wherein the concentration of bFGF is 10-80 ng / mL.

2. The use according to claim 1, wherein the isolated pancreatic progenitor cells also express C-peptide.

3. The use according to claim 1 or 2, wherein the isolated pancreatic progenitor cells also express Ngn3.

4. The use according to claim 1 or 2, wherein the isolated pancreatic progenitor cells are differentiated from human trophoblast stem cells. 5 . The use according to claim 1 or 2 , wherein the isolated pancreatic progenitor cells are differentiated from trophoblast stem cells, and the isolated pancreatic progenitor cells have a normal karyotype compared with the trophoblast stem cells.

6. The use according to claim 1 or 2, wherein the isolated pancreatic progenitor cells have one or more immune privileged properties.

7. The use according to claim 1 or 2, wherein the isolated pancreatic progenitor cells are differentiated from trophoblast stem cells, and the isolated pancreatic progenitor cells have low or absent CD133 expression compared with the trophoblast stem cells.

8. The use according to claim 1 or 2, wherein the isolated pancreatic progenitor cells are differentiated from trophoblast stem cells, and the isolated pancreatic progenitor cells have low or absent CD33 expression compared with the trophoblast stem cells.

9. The method according to claim 1 or 2, wherein the isolated pancreatic progenitor cells are from rodents, cows, sheep, pigs, dogs, cats, monkeys or apes.

10. The use according to claim 1 or 2, wherein the isolated pancreatic progenitor cells are from rabbits.

11. The use according to claim 1 or 2, wherein the diabetes is type 1 diabetes.

12. The use according to claim 1 or 2, wherein the diabetes is type 2 diabetes.

13. The use according to claim 1 or 2, wherein the diabetes is gestational diabetes.

14. The use according to claim 1 or 2, wherein the diabetes is latent autoimmune diabetes in adults.

15. A method for producing insulin in vitro, comprising contacting mammalian trophoblast stem cells with 10-80 ng / mL of bFGF to activate miR-124, thereby producing the isolated pancreatic progenitor cells according to claim 1, wherein the isolated pancreatic progenitor cells secrete insulin and beta-opsonin in response to glucose stimulation, and wherein the method is not used to treat a disease.

Images