Use of engineered enterococcus faecalis in the treatment of phenylketonuria

By using the genetically engineered strain EPR1901, which expresses phenylalanine hydroxylase in Enterococcus faecalis, the problem of the inability of existing technologies to cure phenylketonuria has been solved, and the effect of significantly reducing the level of phenylalanine in the blood and improving the symptoms of patients has been achieved.

CN113755516BActive Publication Date: 2026-03-20INST OF MATERIA MEDICA CHINESE ACAD OF MEDICAL SCI
View PDF 2 Cites 0 Cited by

Patent Information

Authority / Receiving Office
CN · China
Patent Type
Patents(China)
Current Assignee / Owner
Filing Date
2020-06-05
Publication Date
2026-03-20

AI Technical Summary

Technical Problem

Current technology lacks effective drugs for treating phenylketonuria. Existing methods can only relieve symptoms and cannot cure the disease, and strict dietary restrictions affect the quality of life of young and adult patients.

Method used

A human protein expression system was established in Enterococcus faecalis through genetic engineering, enabling it to express phenylalanine hydroxylase exogenously, thereby enhancing the production of tyrosine in the intestinal flora and reducing the entry of phenylalanine into the body through the intestine. The engineered Enterococcus faecalis EPR1901 was then used for oral treatment.

Benefits of technology

It significantly reduces the level of phenylalanine in the blood, treats phenylketonuria, reduces it by 46.8%, and improves patients' intellectual development and quality of life.

✦ Generated by Eureka AI based on patent content.

Smart Images

  • Figure BDA0002526307310000031
    Figure BDA0002526307310000031
  • Figure BDA0002526307310000051
    Figure BDA0002526307310000051
  • Figure BDA0002526307310000052
    Figure BDA0002526307310000052
Patent Text Reader

Abstract

The application belongs to the technical field of biotechnology, and provides application of an engineered Enterococcus faecalis capable of expressing human phenylalanine hydroxylase in a medicine for treating phenylketonuria, a plasmid with a human-derived phenylalanine hydroxylase gene after codon optimization of the Enterococcus faecalis is introduced into the Enterococcus faecalis, so that the human phenylalanine hydroxylase is expressed in the intestinal tract. Experimental results show that the human phenylalanine hydroxylase is successfully expressed in the Enterococcus faecalis through genetic engineering technology; the engineered Enterococcus faecalis can significantly metabolize phenylalanine in an in-vitro culture medium system; meanwhile, the engineered Enterococcus faecalis can significantly treat phenylketonuria, and can reduce plasma phenylalanine of a phenylketonuria suckling mouse by 46.8% after 4 weeks of treatment. It is indicated that the engineered Enterococcus faecalis has an outstanding therapeutic effect in preventing and / or treating phenylketonuria.
Need to check novelty before this filing date? Find Prior Art

Description

TECHNICAL FIELD

[0001] The application belongs to the field of biotechnology, and more particularly relates to an application of an engineered Enterococcus faecalis in a medicine for preventing and / or treating phenylketonuria. BACKGROUND

[0002] Phenylketonuria (PKU) is a congenital autosomal recessive genetic metabolic disease, mainly due to the deficiency of phenylalanine hydroxylase in the body, so that phenylalanine in the phenylalanine metabolic pathway cannot be converted into tyrosine, and a large amount of phenylalanine and phenylpyruvic acid accumulates in the body. The incidence of PKU in China is 8.84 / 10 5 , mainly in children aged 3-6 months, and the symptoms worsen at 1 year old. The main clinical features are mental retardation in children, depression, hyperactivity, autism tendency, appearance of eczema / scratching marks on the skin, and abnormal electroencephalogram, etc. If early diagnosis and early intervention treatment can be obtained, the above clinical manifestations will not occur, the intelligence level of children is normal, and the abnormal electroencephalogram can also be relieved accordingly. At present, most of the treatment methods are to reduce the content of phenylalanine in breast milk or infant formula milk, and there is no specific drug or other cure in clinic. And the existing method requires strict restriction of natural protein intake, is expensive, has a long taking time, and can only relieve symptoms but cannot cure, the brain function development problem of young children patients cannot be solved, and the life quality of adult patients is difficult to guarantee.

[0003] In recent years, the concept of gut-brain axis has attracted the attention of many scholars to the role of intestinal flora or oral probiotics in the central nervous system of animals. Changes in intestinal flora can affect changes in the central nervous system of animals, thereby changing behavior.

[0004] The bacterial cell strain with high expression of exogenous genes by genetic engineering technology is called "engineered bacteria". The core technologies of genetic engineering are DNA recombination technology, gene expression technology, gene mutation technology, and gene introduction technology. Genetic engineering probiotics can not only regulate the microecological balance of the intestinal tract, but also play a role by expressing exogenous proteins with biological activity. Therefore, oral probiotics or genetically engineered probiotics are expected to play an important role in improving phenylketonuria disease. For example, the engineered strain SYNB1618 based on probiotic Escherichia coli published in Nature Biotechnology can reduce the blood phenylalanine of PKU mouse models by 38%. The genetically engineered strain based on the common probiotic Enterococcus faecalis in the present application has higher safety and efficiency (reducing phenylalanine by 46.8% in 30 days of treatment) than the engineered strain published in the above document. Enterococcus faecalis is a facultative anaerobic lactic acid bacteria with good acid tolerance, bile salt tolerance and heat resistance. It can produce bacteriocins to inhibit the proliferation of intestinal pathogenic bacteria such as Escherichia coli and Salmonella. Enterococcus preparations are often used to treat diarrhea in medicine. SUMMARY

[0005] The technical problem to be solved by the present application is to provide a new engineered bacterium and a preparation method of an active engineered bacterium with high expression of phenylalanine hydroxylase. The engineered bacterium can reduce the content of phenylalanine in the blood of experimental animals and play a role in preventing and / or treating phenylketonuria.

[0006] At present, there is a lack of effective drugs for treating pediatric phenylketonuria in clinical practice. In order to achieve this purpose, the technical solution adopted by the present patent is to establish a human protein expression system in Enterococcus faecalis, so that Enterococcus faecalis can express phenylalanine hydroxylase exogenously, the phenylalanine hydroxylase pathway in the intestinal flora is enhanced, the generation of tyrosine in the intestinal flora is increased, the in vivo conversion function of patients with metabolic defects is supplemented, less phenylalanine penetrates into the body through the intestinal tract, and the content of plasma phenylalanine is reduced to treat phenylketonuria. Oral administration of engineered Enterococcus faecalis (EPR1901) can significantly reduce the content of phenylalanine in the in vitro phenylalanine conversion experiment; at the same time, oral administration of engineered Enterococcus faecalis (EPR1901) can significantly reduce the content of phenylalanine in the blood of SD rats induced by alpha-methylphenylalanine, suggesting that engineered Enterococcus faecalis can be used in the prevention and / or treatment of phenylketonuria drugs, and its mechanism of action is related to the expression of phenylalanine hydroxylase by engineered Enterococcus faecalis.

[0007] In the first aspect of the present application, a genetically engineered bacterium producing human-derived phenylalanine hydroxylase is provided, and the technical scheme comprises the processes of strain construction (synthesis and connection of target genes, plasmid construction and modification, transformation, and screening), strain activation, inoculation fermentation, induction, and collection of bacterial bodies. In order to improve the expression efficiency of human phenylalanine hydroxylase in Enterococcus faecalis, the Enterococcus faecalis preferred codon is used in the process of strain construction.

[0008] (1) Plasmid construction: taking the human phenylalanine hydroxylase gene fragment as a template, all codons thereof are changed into the codons preferred by Enterococcus faecalis, and a full-length 1359 bp phenylalanine hydroxylase gene is obtained by artificial synthesis, and the DNA sequence thereof is SEQ ID NO: 1; the gene sequence of the front end of SEQ ID NO: 1 is added with the gene sequence of the Usp45 signal peptide, and then connected with the expression vector pNZ8148, and the expression vector contains the Pnis promoter sequence; taking the lactococcus nisRK gene fragment as a template, the gene sequence is amplified by PCR, and the P8 promoter is added at the front end, and then connected into the expression vector obtained in the previous step, and finally the recombinant plasmid p8nis-PAH is constructed, and the DNA sequence thereof is described in SEQ ID NO: 2; the plasmid contains in sequence: the Pnis promoter sequence, Usp45, the coding sequence of the codon-optimized human-derived phenylalanine hydroxylase SEQ ID NO: 1, the terminator sequence, the P8 promoter, and the nisRK element; wherein the promoter Pnis needs to add the inducer nisin (Nisin) to work.

[0009] (2) Transformation: transforming the recombinant expression vector into the competent Enterococcus faecalis;

[0010] (3) Screening: screening to obtain a high-efficiency expression strain, obtaining a genetically engineered bacterium, preferably an engineered Enterococcus faecalis (EPR1901);

[0011] (4) Strain activation: carrying out strain activation in MRS liquid medium;

[0012] (5) Inoculation fermentation: carrying out inoculation fermentation in MRS liquid medium;

[0013] (6) Induction: the inducer is nisin (Nisin);

[0014] (7) Collection of bacterial bodies: collecting bacterial bodies by high-speed centrifugation using a centrifuge;

[0015] More preferably, the human-derived phenylalanine hydroxylase optimized according to the Enterococcus faecalis codon has the DNA sequence of SEQ ID NO: 1, and the expressed protein has the function of human phenylalanine hydroxylase. The said engineered Enterococcus faecalis (EPR1901) can effectively degrade phenylalanine in an in vitro culture system. The said inducer is Nisin, and the final concentration of the inducer is 5-20 ng / mL, and the preferred concentration is 10 ng / mL.

[0016] In the second aspect of the present application, a scheme for treating phenylketonuria by administering engineered Enterococcus faecalis to phenylketonuria mice is provided, which can significantly reduce the content of blood phenylalanine.

[0017] Further, the said phenylketonuria is caused by the increase of phenylalanine in blood.

[0018] Beneficial technical effects

[0019] The use of genetic engineering methods to express human phenylalanine hydroxylase in Enterococcus faecalis and to treat phenylketonuria mice is an important experiment of the present application.

[0020] From the genetic optimization of phenylalanine hydroxylase, the construction of plasmid vector, the construction of engineered bacteria, the condition exploration, the in vitro phenylalanine metabolism experiment, and the treatment of α-methylphenylalanine-induced mice. The present application uses engineered Enterococcus faecalis as a delivery system, successfully expresses human phenylalanine hydroxylase in Enterococcus faecalis by genetic engineering technology; engineered Enterococcus faecalis can significantly metabolize phenylalanine in an in vitro culture medium system; at the same time, oral administration of engineered Enterococcus faecalis, the secreted phenylalanine hydroxylase will reach the intestinal tract completely, and decompose the phenylalanine existing in the intestinal cavity, thereby reducing the acquisition of phenylalanine from the intestinal tract and reducing the content of phenylalanine in blood plasma, which can significantly treat phenylketonuria, and can reduce the plasma phenylalanine of phenylketonuria mice by 46.8% after 4 weeks of treatment, achieving the effect of preventing / treating phenylketonuria by engineered Enterococcus faecalis. BRIEF DESCRIPTION OF DRAWINGS

[0021] Figure 1 .JCAT software CAI value change results of codon optimization of phenylalanine hydroxylase gene

[0022] Figure 2 .pNZ8148 transformed Enterococcus faecalis PCR amplification electrophoresis verification results

[0023] Figure 3 .p8nis-PAH plasmid schematic diagram

[0024] Figure 4 Agarose gel electrophoresis detection of Cm and SEQ ID NO: 1 gene PCR product size in mutant strains

[0025] Figure 5 SDS-PAGE detection of protein size produced by engineered E. faecalis (EPR1901)

[0026] Figure 6 Results of experiments on phenylalanine metabolism by engineered E. faecalis (P8) induced by different concentrations of Nisin

[0027] Figure 7 In vitro conversion of phenylalanine by engineered E. faecalis (EPR1901)

[0028] Figure 8 Phenylalanine content in the blood of PKU mice after 5 days of treatment with engineered E. faecalis (EPR1901)

[0029] Figure 9 Phenylalanine content in the blood of PKU mice after 2 weeks of treatment with engineered E. faecalis (EPR1901)

[0030] Figure 10 Phenylalanine content in the blood of PKU mice after 3 weeks of treatment with engineered E. faecalis (EPR1901)

[0031] Figure 11 Phenylalanine content in the blood of PKU mice after 4 weeks of treatment with engineered E. faecalis (EPR1901) DETAILED DESCRIPTION

[0032] Example 1. Construction of a plasmid vector for human recombinant phenylalanine hydroxylase

[0033] 1. Experimental animals, instruments, and reagents

[0034] Restriction endonucleases Kpnl and Sad, and Gibson Assembly premix were purchased from New England Biolabs, USA, and nucleic acid sequence synthesis services were provided by Shenguo Bioengineering (Shanghai) Co., Ltd. The lactic acid bacterial secretion plasmid pNZ8148 was purchased from Hangzhou Ziyun Biotechnology Co., Ltd.

[0035] 2. Experimental design

[0036] The gene sequence of human phenylalanine hydroxylase was obtained from the NCBI database, and codon optimization was performed using JCAT software with reference to the codon bias of Enterococcus faecalis (ATCC47077) to obtain the gene sequence SEQ ID NO: 1. Figure 1The change of CAI value in codon optimization process is shown, and the specific DNA sequence information is shown below, and the full synthesis of gene SEQ ID NO: 1 is carried out, and the Usp45 signal peptide DNA sequence is added at the front end of the SEQ ID NO: 1 gene (the sequence information is from reference 1, and the sequence is obtained by synthesis in the experiment). After the synthesized gene sequence is verified correct by sequencing, it is cut by KpnI and SacI and connected to the lactic acid bacteria expression plasmid pNZ8148 to obtain the plasmid pNZ8148-PAH. The SEQ ID NO: 1 gene is provided with the Pnis promoter, which is located on the plasmid pNZ8148, and is a Nisin inducible promoter, so that the protein is expressed when Nisin is added, and is not expressed during the growth and reproduction of the strain, which can reduce the influence of protein overexpression on the host. It has been proved that pNZ8148 can autonomously replicate in Enterococcus faecalis, and the plasmid pNZ8148 is introduced into Enterococcus faecalis by electroporation, and the stable presence of the plasmid in the host bacteria is verified by PCR technology Figure 2 The nisRK gene fragment from Lactococcus lactis is further amplified by PCR (the sequence information is from reference 2) and recombined into the plasmid by Gibson assembly, and the P8 promoter is added in front of nisRK (the sequence information is from reference 3, and the sequence is obtained by synthesis,) and is constructed into pNZ8148-PAH by Gibson assembly. The primers are designed by Primer Premier 5.0, and the sequence is shown in Table 1, and the constructed plasmid p8nis-PAH is shown as Figure 3 .

[0037] Table 1 Primer design for plasmid recombination and modification

[0038]

[0039] The codon-optimized human phenylalanine hydroxylase coding sequence is shown as SEQ ID NO: 1.

[0040] The coding sequence of the recombinant plasmid p8nis-PAH is shown as SEQ ID NO: 2.

[0041] 3. Results

[0042] As shown in Figure 1 , the JCAT software shows the change of CAI value of the codon-optimized phenylalanine hydroxylase gene, and the CAI value is optimized from 0.21 to 0.96, indicating that the sequence after optimization has greatly enhanced adaptability in Enterococcus faecalis.

[0043] As shown in Figure 2Figure 1 shows the results of electrophoresis verification of PCR amplification of E. faecalis transformed by pNZ8148. Lanes 1-10 and 11-18 are verification of E. faecalis transformants; M is a DL5000 DNA marker; + is a positive control; and - is a negative control. The results show that pNZ8148 was successfully transformed into E. faecalis.

[0044] As shown in Figure 2, the schematic diagram of the successfully constructed p8nis-PAH plasmid is shown. Figure 3

[0045] Example 2. Transformation of the recombinant plasmid into the host bacteria and screening of the engineered E. faecalis (EPR1901)

[0046] 1. Experimental animals, instruments and reagents

[0047] The recombinant plasmid p8nis-PAH was obtained from the above experiment, the MRS medium was from Beijing Solabio Technology Co., Ltd., and the chloramphenicol was purchased from Beijing Solabio Technology Co., Ltd. The competent cells were prepared in the laboratory.

[0048] 2. Experimental instruments and analysis methods

[0049] The MicroPulser electroporation instrument and the electroporation cup were purchased from the United States BIO-RAD company.

[0050] 3. Experimental design

[0051] We used the recombinant plasmid p8nis-PAH obtained from the above experiment to perform electroporation of the target host bacteria (E. faecalis). The transformation method was as follows: the electroporation cup was pre-cooled on ice, 100 μL of prepared competent cells were taken, the plasmid DNA was added to 100 μL of competent cells, and ice bath was performed for 5 min; the plasmid and cell mixture was added to the pre-cooled electroporation cup, and ice bath was performed for 10 min; the outer wall of the electroporation cup was wiped dry, and the MicroPulser electroporation instrument was placed in the electroporation cup, the electroporation program was 200 ohms, 25 μF, 1.5 kilovolts, and the reaction time constant was about 5 ms; 1 mL of MRS liquid culture was added to the cup, the cells were resuspended, and they were transferred to a centrifuge tube, and incubated at 37°C for 1 h; centrifuged at 5000 rpm for 5 min, the supernatant was discarded, and the remaining 100 μl of bacterial solution was plated on MRS solid selective medium containing 5 μg / mL chloramphenicol, and incubated at 37°C overnight to observe the transformation results. The clones obtained by transformation were cultured in MRS liquid medium at 37°C overnight, and the bacterial solution was obtained for PCR amplification and sequencing verification. Thus, the positive strain containing the recombinant plasmid p8nis-PAH was screened.

[0052] 4. Results

[0053] As shown in Figure 3, the results of electrophoresis verification of PCR amplification of E. faecalis transformed by p8nis-PAH are shown. Figure 4 ​As shown, after electroporation and resistant plate screening, we obtained dozens of clones. We picked the clones for resistant liquid medium culture, amplified the marker fragments by colony PCR, and preliminarily verified that the clones contained the corresponding plasmids by size (e.g. Figure 4 As shown, the Cm gene is 712 bp in size, and the SEQ ID NO: 1 gene is 1500 bp in size). Further, the plasmid was extracted for sequencing, and the result showed that the DNA sequences were consistent. This indicated that the plasmid was successfully transformed into the Enterococcus faecalis mutant strain, which was the engineered Enterococcus faecalis (EPR1901).

[0054] Example 3. Strain activation and inoculation fermentation of the engineered Enterococcus faecalis (EPR1901), phenylalanine hydroxylase protein expression, concentration experiment, and inducer Nisin concentration screening experiment

[0055] 1. Experimental strains, instruments, and reagents

[0056] Nisin was purchased from Beijing Solabio Technology Co., Ltd., the SDS-PAGE kit was purchased from Beijing Solabio Technology Co., Ltd., and the Coomassie blue staining solution was purchased from Beijing Solabio Technology Co., Ltd.

[0057] 2. Experimental instruments and analysis methods

[0058] The electrophoresis tank was purchased from Bio-Rad Company.

[0059] 3. Experimental design

[0060] The nisin-controlled expression (NICE) system can recognize nisin when the cell is exposed to nisin, the NisK protein with a sensor function can phosphorylate NisR to deactivate the nisA promoter, leading to the expression of downstream genes. This system is widely present in gram-positive bacteria, and the product expressed by this system can reach 10% to 60% of the total cell protein, with a yield increase of thousands of times. Therefore, the NICE system is added during plasmid construction. The engineered Enterococcus faecalis (EPR1901) obtained in Example 2 was activated regularly, and the activated seed liquid was inoculated into the fermentation medium MRS liquid medium at a ratio of 1:50; the fermentation temperature was 37°C, and the fermentation liquid was cultured until the OD value was 0.4 to 0.6; then, the Nisin inducer was added, and the bacteria were induced at 25°C for 4 to 6 hours; finally, the bacteria were collected by centrifugation at a speed of 7000 rpm for 5 minutes.

[0061] The SDS-PAGE method was used to detect the target protein-human phenylalanine hydroxylase.

[0062] Further explore the concentration of the engineering bacteria inducer, take engineering Enterococcus faecalis (EPR1901) as the representative strain, add different concentrations of inducer Nisin (5 ng, 10 ng, 20 ng / mL), detect the concentration of phenylalanine in the culture medium, and evaluate the influence of different concentrations of inducers on the metabolic capacity of engineering bacteria.

[0063] 4. Results

[0064] The results are shown in Figure 5 The size of the human phenylalanine hydroxylase protein expressed by the modified engineering Enterococcus faecalis (EPR1901) is 55 kD, indicating that the engineering Enterococcus faecalis (EPR1901) successfully expresses the target protein-human phenylalanine hydroxylase, and the size of the expressed protein is consistent with the predicted size.

[0065] The results are shown in Figure 6 The results show that the concentration of phenylalanine in the system of the comparative engineering Enterococcus faecalis P8 after adding different concentrations of inducers is 10 ng / mL, which is the optimal concentration, and the induction of engineering Enterococcus faecalis reduces phenylalanine by 48.9%. Therefore, the concentration of Nisin added in the subsequent experiment is 10 ng / mL.

[0066] Example 4. In vitro phenylalanine conversion experiment of engineering Enterococcus faecalis (EPR1901)

[0067] The concentration of phenylalanine in the in vitro culture system is one of the important indicators for evaluating the ability of engineering Enterococcus faecalis to degrade phenylalanine.

[0068] 1. Experimental strains, instruments and reagents

[0069] Phenylalanine was purchased from Beijing Solabio Technology Co., Ltd. Engineering Enterococcus faecalis (EPR1901) was obtained by the above modification steps in the laboratory, and MRS culture medium was from Beijing Solabio Technology Co., Ltd.

[0070] 2. Experimental instruments and analysis methods

[0071] High performance liquid chromatography-triple quadrupole tandem mass spectrometry (LC-MS / MS 8050, Shimadzu Corporation, Japan) was used to quantitatively determine the content of phenylalanine in the culture medium. Alltima C 18A Phenomenex® Luna® C18 (5 pm, 4.6 x 150 mm) column was used at 40 °C. The mobile phase was water-formic acid (100:0.1 v / v) and methanol. A gradient elution (A:B, 0 min, 90:10; 1 min, 90:10; 1.01 min, 60:40; 5 min, 5:95; 7 min, 5:95; 7.01 min 90:10; 10 min 90:10) was used at a flow rate of 0.8 mL / min. Quantification was performed in the multiple reaction monitoring (MRM) mode with the quantification ion pair phenylalanine 165.85→120.20.

[0072] 3. Experimental design

[0073] Experimental design: EPR1901 strain was inoculated overnight, the next day 2% volume of bacteria was inoculated into new MRS medium, cultured at 37°C to OD600=0.4-0.6, centrifuged in large centrifuge tubes to collect bacteria, aliquoted into small tubes, and the same number of bacteria was added to the medium (0h sampling), Nisin inducer (10 ng / mL final concentration) was added to the medium at the same time, induced at 25°C for 4-6h, cultured at 37°C for 12h, 24h sampling, and the concentration of phenylalanine was determined.

[0074] 4. Results

[0075] As shown in Table 2, Figure 7 Enterococcus faecalis was co-cultured with MRS liquid medium containing 1 mg / L phenylalanine for 12h and 24h, which reduced by 24.5% and 51.1% respectively, indicating that the engineered Enterococcus faecalis has excellent ability to degrade phenylalanine and can significantly reduce the content of phenylalanine in the medium.

[0076]

[0077] Table 2 Phenylalanine concentration (pg / mL, n=5) in the system after metabolism by engineered Enterococcus faecalis (EPR1901)

[0078] Example 5. Therapeutic effect of engineered Enterococcus faecalis (EPR1901) in phenylketonuria model SD mice induced by a-methylphenylalanine.

[0079] The concentration of phenylalanine in the blood is one of the important indicators for evaluating the therapeutic effect of phenylketonuria SD mice.

[0080] 1. Experimental animals, instruments and reagents

[0081] SD rats (1 day old) were purchased from Beijing Vital River Laboratory Animal Technology Co., Ltd. The animals were housed with their mothers in a SPF level environment (21 ± 2℃, 12-hour light cycle) and had free access to food and water during the experiment. Phenylalanine was purchased from Beijing Solabio Technology Co., Ltd. Alpha-methylphenylalanine was purchased from Nanjing Sankay Bio-engineering Co., Ltd. Engineered E. faecalis (EPR1901) was obtained by culture amplification in the laboratory.

[0082] 2. Experimental instruments and analysis methods

[0083] The content of phenylalanine in blood was quantitatively determined by high performance liquid chromatography-triple quadrupole tandem mass spectrometry (LC-MS / MS 8050, Shimadzu Corporation, Japan). The determination of phenylalanine used an Alltima C 18 (5 μm, 4.6 x 150 mm) chromatographic column, and the column temperature was 40℃. The mobile phase was water-formic acid (100:0.1 v / v) and methanol. Gradient elution (A:B, 0 min, 90:10; 1 min, 90:10; 1.01 min, 60:40; 5 min, 5:95; 7 min, 5:95; 7.01 min 90:10; 10 min 90:10) was used at a flow rate of 0.8 mL / min. The quantification was performed in the multiple reaction monitoring (MRM) mode, and the quantitative ion pair was phenylalanine 165.85→120.20.

[0084] 3. Experimental design and animal grouping

[0085] Experimental design: The experimental animals were divided into 3 groups, including a normal control group (N), a model group (M), and a model group + engineered E. faecalis (EPR1901). The model was established by subcutaneous injection of alpha-methyl-L-phenylalanine 0.05 g / kg and Phe 0.2 g / kg to 6-day-old SD rats for 10 days, and then treated for 30 days. The plasma phenylalanine content was determined at 1 week, 2 weeks, 3 weeks, and 4 weeks after administration.

[0086] Animal grouping:

[0087] (1) Normal group (N): subcutaneous injection of normal saline 0.1 mL;

[0088] (2) Model control group (M): subcutaneous injection of alpha-methylphenylalanine (50 mg / kg / day) + subcutaneous injection of phenylalanine (200 mg / kg / day);

[0089] (3) Model group + engineered E. faecalis (EPR1901): subcutaneous injection of alpha-methylphenylalanine (50 mg / kg / day) + subcutaneous injection of phenylalanine (200 mg / kg / day), oral administration of engineered E. faecalis (EPR1901) (1*10 9 g / 10 g).

[0090] 4. Results

[0091] As shown in Table 3, Figure 8 As shown, in the blood of suckling mice treated with engineered Enterococcus faecalis (EPR1901) orally for 5 days, the phenylalanine content in the blood of the model group was significantly higher than that in the normal control group, indicating that the model was successfully established; while the phenylalanine content of the model group was significantly reduced by the oral engineered Enterococcus faecalis (EPR1901), with a reduction level of 47.3% of that in the model group, indicating that the oral engineered Enterococcus faecalis (EPR1901) treatment was effective.

[0092] Table 3. Serum phenylalanine levels (×20 ng / mL, n=8) in neonatal rats with phenylketonuria after 5 days of treatment with engineered Enterococcus faecalis (EPR1901).

[0093]

[0094]

[0095] As shown in Table 4, Figure 9 and Table 5, Figure 10 and Table 6, Figure 11 As shown, the serum phenylalanine level in the model group was significantly higher than that in the normal group, indicating that the model was successfully established. Similarly, on days 14, 21, and 30 after oral administration of engineered Enterococcus faecalis (EPR1901), serum phenylalanine levels decreased by 23.7%, 46.3%, and 46.8%, respectively, indicating that oral administration of engineered Enterococcus faecalis (EPR1901) was effective and had a certain time-dependent effect. Specific experimental data are summarized in Table 7.

[0096] Table 4. Serum phenylalanine levels (×20 ng / mL, n=8) in neonatal rats with phenylketonuria after 14 days of treatment with engineered Enterococcus faecalis (EPR1901).

[0097]

[0098] Note: * indicates an outlier.

[0099] Table 5. Serum phenylalanine levels (×20 ng / mL, n=8) in neonatal rats with phenylketonuria after 21 days of treatment with engineered Enterococcus faecalis (EPR1901).

[0100]

[0101] Note: * indicates an outlier.

[0102] Table 6. Serum phenylalanine levels in neonatal rats with phenylketonuria after 30 days of treatment with engineered Enterococcus faecalis (EPR1901) (×20 ng / mL, n=8)

[0103]

[0104] Table 7 Summary of phenylalanine reduction in blood of PAH milk rats treated with engineered E. faecalis (EPR1901) for 5 days, 2 weeks, 3 weeks, and 4 weeks

[0105]

[0106] Note: ** indicates p<0.01, * indicates p<0.05.

[0107] 1. Reference: van Asseldonk M, Rutten G, Oteman M, Siezen RJ, de Vos WM, Simons G (1990) Cloning, expression in Escherichia coli and characterization of usp45, a gene encoding a highly secreted protein from Lactococcus lactis MG1363. Gene 95: 155-160.

[0108] 2. van der Meer JR, Polman J, Beerthuyzen MM, Siezen RJ, Kuipers OP, De Vos WM. (1993) Characterization of the Lactococcus lactis nisin A operon genes nisP, encoding a subtilisin-like serine protease involved in precursor processing, and nisR, encoding a regulatory protein involved in nisin biosynthesis. J. Bacteriol. 175, 2578-2588.

[0109] 3. Zhu DL, Liu FL, Xu HJ, Bai YL, Zhang XM (2015) Isolation of strong constitutive promoters from Lactococcus lactis subsp. lactis N8. FEMS Microbiol Lett. 2015 Aug;362(16). SEQUENCE LISTING <110> CHINESE ACADEMY OF MEDICAL SCIENCES, INSTITUTE OF MEDICINAL <120> Use of engineered Enterococcus faecalis in the treatment of phenylketonuria <160> 8 <170> SIPOSequenceListing 1.0 <210> 1 <211> 1359 <212> DNA <213> Enterococcus faecalis <400> 1 atgtcaacag ctgttttaga aaacccaggt ttaggtcgta aattatcaga tttcggtcaa 60 gaaacatcat acatcgaaga taactgtaac caaaacggtg ctatctcatt aatcttctca 120 ttaaaagaag aagttggtgc tctcgcgaaa gtgctccgtt tattcgaaga aaacgatgtt 180 aacttaacac acatcgaatc acgtccatca cgtttaaaaa aagatgaata cgaattcttc 240 acacacttag ataaacgttc attaccagct ttaacaaaca tcatcaaaat cttacgtcac 300 gatatcggtg ctacagttca cgaattatca cgtgataaaa aaaaagatac agttccatgg 360 ttcccacgta caatccaaga attagatcgt ttcgctaacc aaatcttatc atacggtgct 420 gaattagatg ctgatcaccc aggtttcaaa gatccagttt accgtgctcg tcgtaaacaa 480 ttcgctgata tcgcttacaa ctaccgtcac ggtcaaccaa tcccacgtgt tgaatacatg 540 GAAGAAGAAA AAAACATGGG GTACAGTTTC AAAACATTA AATCATTATA CAAAACA 600 CACGCTTGTT ACGAATACAA CCACATCTTC CCATTATTAG AAAAATACTG TG GTTTCAC 660 GAAGATAACA TCCCACAATT AGAAGATGTT TCACAATTCT TACAAACATG TACAG GTTTC 720 Cgtttacgtc cagtcgcggg cttattatca agtcgtgatt tcttaggtgg tttagctttc 780 Cgtgttttcc actgtacaca atacatccgt cacggttcaa aaccaatgta cacaccagaa 840 CCAGATATCT GTCACGAACT TATTAGGTCAC GTTCCATTAT TCTCAGATCG TTCATTCGCT 900 CAATTCTCAC AAGAAATCGG TTtagcttca ttaggtgctc cagatgaata catcgaaaaa 960 Ttagctacaa tctactggtt cacagttgaa ttcggtttat gtaaacaagg tgattcaatc 1020 AAAGCTTACG GTGCTGGTTT ATTATCATCA TTCGgtgaat tacaatactg tttatcagaa 1080 AAACCAAAT TATTACCATT AGAATTAGAA AAAACAGCTA TCCAAAACTA CACAGTTACA 1140 GAATTCCAAC CATTATACTA CGTTGCTGAA TCATTCAACG ATGCTAAAGA AAAAGTTCGT 1200 Aacttcgctg ctacaatccc acgtccattc tcagttcgtt acgatccata cacacaacgt 1260 atcgaagttt tagataacac acaacaatta aaaatcttag ctgattcaat caactcagaa 1320 atcggtatct tatgttcagc tttacaaaaa atcaaataa 1359 <210> 2 <211> 6784 <212> DNA <213> Enterococcus faecalis <400> 2 agatctagtc ttataactat actgacaata gaaacattaa caaatctaaa acagtcttaa 60 ttctatcttg agaaagtatt ggtaataata ttattgtcga taacgcgagc ataataaacg 120 gctctgatta aattctgaag tttgttagat acaatgattt cgttcgaagg aactacaaaa 180 taaattataa ggaggcactc accatgggta ctgcaggcat gcggtaccat gaagaaaaaa 240 ttaatttcta gtttagttat atcaacaata attttatctg tggtgtctcc tagctatgaa 300 ggtgtcgcaa tgtcaacagc tgttttagaa aacccaggtt taggtcgtaa attatcagat 360 ttcggtcaag aaacatcata catcgaagat aactgtaacc aaaacggtgc tatctcatta 420 atcttctcat taaaagaaga agttggtgct ctcgcgaaag tgctccgttt attcgaagaa 480 aacgatgtta acttaacaca catcgaatca cgtccatcac gtttaaaaaa agatgaatac 540 gaattcttca cacacttaga taaacgttca ttaccagctt taacaaacat catcaaaatc 600 ttacgtcacg atatcggtgc tacagttcac gaattatcac gtgataaaaa aaaagataca 660 gttccatggt tcccacgtac aatccaagaa ttagatcgtt tcgctaacca aatcttatca 720 tacggtgctg aattagatgc tgatcaccca ggtttcaaag atccagttta ccgtgctcgt 780 cgtaaacaat tcgctgatat cgcttacaac taccgtcacg gtcaaccaat cccacgtgtt 840 gaatacatgg aagaagaaaa aaaaacatgg ggtacagttt tcaaaacatt aaaatcatta 900 tacaaaacac acgcttgtta cgaatacaac cacatcttcc cattattaga aaaatactgt 960 ggtttccacg aagataacat cccacaatta gaagatgttt cacaattctt acaaacatgt 1020 acaggtttcc gtttacgtcc agtcgcgggc ttattatcaa gtcgtgattt cttaggtggt 1080 ttagctttcc gtgttttcca ctgtacacaa tacatccgtc acggttcaaa accaatgtac 1140 acaccagaac cagatatctg tcacgaatta ttaggtcacg ttccattatt ctcagatcgt 1200 tcattcgctc aattctcaca agaaatcggt ttagcttcat taggtgctcc agatgaatac 1260 atcgaaaaat tagctacaat ctactggttc acagttgaat tcggtttatg taaacaaggt 1320 gattcaatca aagcttacgg tgctggttta ttatcatcat tcggtgaatt acaatactgt 1380 ttatcagaaa aaccaaaatt attaccatta gaattagaaa aaacagctat ccaaaactac 1440 acagttacag aattccaacc attatactac gttgctgaat cattcaacga tgctaaagaa 1500 aaagttcgta acttcgctgc tacaatccca cgtccattct cagttcgtta cgatccatac 1560 acacaacgta tcgaagtttt agataacaca caacaattaa aaatcttagc tgattcaatc 1620 aactcagaaa tcggtatctt atgttcagct ttacaaaaaa tcaaagagct caagctttct 1680 ttgaaccaaa attagaaaac caaggcttga aacgttcaat tgaaatggca attaaacaaa 1740 ttacagcacg tgttgctttg attgatagcc aaaaagcagc agttgataaa gcaattactg 1800 atattgctga aaaattgtaa tttaataaata aaaatcacct tttagaggtg gtttttttat 1860 ttataaatta ttcgtttgat ttcgctttcg atagaacaat caaatcgttt ctgagacgtt 1920 ttagcgttta tttcgtttag ttatcggcat aatcgttaaa acaggcgtta tcgtagcgta 1980 GAGAATTCATGGAGTTTGGAGGAATGAAATTCCTCATGGGTTTGATTTTAAAAATTC GTTGCATTTCG 60 CGATGACTGAATGAAATAATAAGCGCGCGTCCTTCTATTTCGGTTGGAGGAGGCTC AAG 240 GGAGTTTGGAGGAATGAAATTCCTCATGGGTTTGATTTTAAAAATTCGTTGCATTT CG 300 CCGAGCGGTAGCGCTGGAAGAATTTTTGAAAAAATTGGAATTTGGAAAAAATGGG GGG 360 AAAGGAAGCGAATTTTGCTTCCGTACTACGACCCCCATTAAATGCCCAGTGCCAA TT 420 TTGTGCCAAAAACGCTCTATCCCAACTGGCTCAAGGTTTTAGGGGTTTTTCATCGC CAA 480 CGAATCGCCAACTTTTCGCCAACGTTTTTTATAAATCTATATTTAAGTAGCTTTAT TTT 540 TGTCTTTATGATTACAAAGTGATACACTAATTTTATAAAATTATTTGATTGGAGT TTTT 600 AAATGGTGATTTTCAGAATCGAAAAAAAGAGTTATGATTTCTCTGACAAAAAGA GCAAGATA 660 AAAAATTAACAGATATGGCGAAACAAAAAGATTTTTCAAATCTGCGGTTGCGGCG TTAG 720 CTATAGAAGAATATGCAAGAAAGGAATCAGAACAAAAAAAATAAGCGAAAGCTCG CTT 780 TTAGAAGGATACGAGTTTTCGCTACTTGTTTTTGATAAGGTAATATATCATGGCTA TTA 840 AAAATACTAA AGCTAGAAATTTGGATTTTTATTATATCCTGACTCAATT CCTAATGATT 2760 GGAAAGAAAA ATTAGAGAGT TTGGGCGTAT CTATGGCTGT CAGTCCTTTA CAGATATGG 2820 ACGAAAAAAA AGATAAAGAT ACATGGAATA GTAGTGATGT TATACGAAAT GGAAAGCACT 2880 ATAAAAAACC ACAC TATCAC GTTATATAT AT TGCACGAAA TCCTGTAACA ATAGAAAGCG 2940 T TAGGAACAA GATTAAGCGA AAATTGGGGA ATAGTTCAGT TGCTCATGTT GAGATACTTG 3000 ATTATATCAA AGGTTCATAT GAATATTTGA CT CATGAATCAA AGGACGCTAT TGCTAAGA 3060 ATAAACATAT ATACGACAAA AAAGATATTT TGAACATTAAT GATT TTGATATTG ACCGCT 3120 ATATAACACT TGATGAAAGC CAAAAAAGAG AATTGAAGAA TTTACTTTTA GATATAGTGG 3180 ATGACTATAA TTTGGTAAAT ACAAAAGATT TAATGGCTTT TATTCGCCTT AGGGGAGCGG 3240 AGTTTGG AATT TTAATA CGAATGATGTA AAGATATTT GTTTCAACAA ACTCTAGCGCCT 3300 T TAGATTATG GTTTGAGGGC AATTATCAGT GTGGATATAG AGCAAGTTAT GCAAAGGTT C 3360 TTGATGCTGA AACGGGGGAA ATAAAATGAC AAACAAAGAAA AAGAGTTATT TGCTGAAAAA 3420 TGAGGAATTA AAAAAAGAAA TTAAGGACTT AAAAGAGCGT ATTGAAAGAT ACAGAGAAAT 3480 GGAAGTTGAA TTAAGTGATA AAATTTCTAA TGATTTTTTT AGGACAATTT TTCTCATAA 3540 AAAGCAGATT TTAGAAAGAA AATTGTATTT TTTTAACAGC TTTGACTGCC CTTTTTGGAA 3600 GAGTTTATGT ATATAAGAAT TAGT TAGTTTTGCTATTGAT ATAGCAGCAG AAATGGAGAG 3660 ATATAGTGTA TAAAATTTAA TAGTTGATGA TGATCAGGAA TTTTAAAAAT TAATGAAGA 3720 CAGCATTAGA AATGAGAAAC TATGAAGTTG CGACGCATCA AAACATTTCA CTTCCCTTGG 3780 ATATTACTGA TTTTCAGGGA TTTGATTTGA TTTTGTAGAT ATCATGATGT CAAATATTG 3840 AAGGGACAGA AATTGTAAAA GGATTGCGAG AAAATACACA CTC AATTATCT TTGTTA 3900 GTGCGAAAGA TACAGAAGAG GATATTATAA ACGGCTTAGG TATTGGTGGG GATGACTATA 3960 TTACTAAGCC TTTTAGCCTT AAACAGTTGG TTGCAAAGTG GAAGCAAAT ATA AAGCGAG 4020 AGGAACGC AA TAAACATGC AGTTCATGTTTTTTCAGAGATT CGTAGAGATT TAGGACCAA 4080 TTACATTTTA TT TAGAAGAAA GGC GAGTCTGTGTCAATGGT CAAACAATT CC ACTGACTT 4140 gtcgtgaata cgatattctt gattact cacaacgaac ttctaagtt tatacgagag 4200 aggatattta tgatgacgta tatgatgaat attctaatgc actttcgg tcaatctcgg 4260 agtatatta tcagattagg agtaagttg caccatacga tattaatccg ataaaaacgg 4320 ttcggggact tgggtatcag tggcatggtt aaaaatatt caatgcgtcg acggatatgg 4380 caagctgtca tgaaattat cataggtact tgtctactta tcctgttgtt actgggcttg 4440 actttctttc tacgacaat tggacaatc agtggttcag aaactattcg ttatcttta 4500 gattcagata attaactat ttctgatatc gaacgtgata tgaacacta cccatatgat 4560 tatatgt ttgacaatga tacagtaaa attttggg gatatgt caagtcggat 4620 gtacctagtt ttgtagcttc aaaacagtct tcacataata ttacagaagg agaaattact 4680 tatacttatt caagcaata gcattttca gttgtttta gataaacag tatgccagaa 4740 tttacaatc atacgctcg ttcaatttct tataatcaat attack ttcttttttt 4800 cttggtgaaa taatactcat tattttttct gtctatcatc tacattagaga attttctaag 4860 aattttcaag ccgttcaaaa gattgcattg aagatggggg aaataactac ttttcctgaa 4920 caagaggaat caaaaattat tgaatttgat caggttctga ataacttata ttcgaaaagt 4980 aaggagttag ctttccttat tgaagcggag cgtcatgaaa agcatgattt atccttccag 5040 gttgctgcac tttcacatga tgttaagaca cctttaacag tattaaaagg aaatattgaa 5100 ctgctagaga tgactgaagt aaatgaacaa caagctgatt ttattgagtc aatgaaaaat 5160 agtttaactg tttttgacaa gtattttaac acaatgatta gttatacaaa acttttgaat 5220 gatgaaaatg attacaaagc gagaatctcc ctggaggatt ttttgataga tttatcagtt 5280 gagttggaag agttgtcaac aacttatcaa gtggattatc agctagttaa aaaaacagat 5340 ttaaccactt tttacggaaa tacattagct ttaagtcgag cacttatcaa tatctttgtt 5400 aatgcctgtc agtatgctaa agagggtgaa aaaatagtta gtttgagtat ttatgatgat 5460 gaaaaatatc tctattttga aatctggaat aatggtcatc ctttttctga acaagcaaaa 5520 aaaaatgctg gaaaactatt tttcacagaa gatactggac gtagtgggaa acactatggg 5580 attggactat cttttgctca aggtgtagct ttaaaacatc aaggaaactt aattctcagt 5640 aatcctcaaa aaggtggggc agaagttatc ctaaaaataa aaaagtaaac aacaatagat 5700 ttattgagag gagggattat tgaataaata aaagcccccc tgacgaaagt cgacggcaat 5760 agttaccctt attatcaaga taagaaagaa aggattttt cgctacgctc aaatccttta 5820 aaaaaacaca aaagaccaca ttttttaatg tggtctttta ttcttcaact aaagcaccca 5880 ttagttcaac aaacgaaaat tggataaagt gggatatttt taaaatatat atttatgtta 5940 cagtaatatt gacttttaaa aaaggattga ttctaatgaa gaaagcagac aagtaagcct 6000 cctaaattca ctttagataa aaatttagga ggcatatcaa atgaacttta ataaaattga 6060 tttagacaat tggaagagaa aagagatatt taatcattat ttgaaccaac aaacgacttt 6120 tagtataacc acagaaattg atattagtgt tttataccga aacataaaac aagaaggata 6180 taaattttac cctgcattta ttttcttagt gacaagggtg ataaactcaa atacagcttt 6240 tagaactggt tacaatagcg acggagagtt aggttattgg gataagttag agccacttta 6300 tacaattttt gatggtgtat ctaaaacatt ctctggtatt tggactcctg taaagaatga 6360 cttcaaagag ttttatgatt tatacctttc tgatgtagag aaatataatg gttcggggaa 6420 attgtttccc aaaacaccta tacctgaaaa tgctttttct ctttctatta ttccttggac 6480 ttcatttact gggtttaact taaatatcaa taataatagt aattaccttc tacccattat 6540 tacagcagga aaattcatta ataaaggtaa ttcaatatat ttaccgctat ctttacaggt 6600 acatcattct gtttgtgatg gttatcatgc tggattgttt atgaactcta ttcaggaatt 6660 gtcagatagg cctaatgact ggcttttata atatgagata atgccgactg tactttttac 6720 agtcggtttt ctaatgtcac taacctgccc cgttagttga agaaggtttt tatattacag 6780 ctcc 6784 <210> 3 <211> 27 <212> DNA <213> Enterococcus faecalis <400> 3 acaacaatag atttattgag aggaggg 27 <210> 4 <211> 29 <212> DNA <213> Enterococcus faecalis <400> 4 acttaattca acttccattt ctctgtatc 29 <210> 5 <211> 50 <212> DNA <213> Enterococcus faecalis <400> 5 aaatggaagt tgaattaagt gataaaattt ctaatgattt ttttaggaca 50 <210> 6 <211> 30 <212> DNA <213> Enterococcus faecalis <400> 6 ctatatctct ccatttctgc tgctatatca 30 <210> 7 <211> 51 <212> DNA <213> Enterococcus faecalis <400> 7 gcagaaatgg agagatatag tgtataaaat tttaatagtt gatgatgatc a 51 <210> 8 <211> 50 <212> DNA <213> Enterococcus faecalis <400> 8 ctcaataaat ctattgttgt ttactttttt atttttagga taacttctgc 50

Claims

1. A genetically engineered bacterium, characterized in that, Prepared by the following method: (1) Plasmid construction: the human phenylalanine hydroxylase gene fragment is used as a template, all codons are changed to the codons preferred by Enterococcus faecalis, and the full-length 1359bp phenylalanine hydroxylase gene is artificially synthesized, and the DNA sequence is SEQ ID NO: 1; the gene sequence of the front end of SEQ ID NO: 1 is added with the Usp45 signal peptide, and then linked with the expression vector containing the Pnis promoter sequence; the nisRK gene fragment of Lactococcus lactis is used as a template to amplify the gene sequence by PCR, and the P8 promoter is added at the front end, and then connected into the expression vector of the previous step, and finally the recombinant plasmid is constructed, and the DNA sequence is SEQ ID NO: 2; wherein the promoter Pnis needs to add the inducer nisin, and the concentration of the inducer is 5-20ng / mL; (2) Transformation: the recombinant expression vector is transformed into the competent Enterococcus faecalis; (3) Screening: high-efficiency expression strains are screened to obtain genetically engineered bacteria.

2. The genetically engineered bacteria according to claim 1, characterized in that, The concentration of the inducer is 10ng / mL.

3. The genetically engineered bacteria according to claim 1, characterized in that, In the enterococcus derived from human intestine, the human phenylalanine hydroxylase gene sequence optimized for Enterococcus faecalis codon is introduced as SEQ ID NO:

1.

4. Enterococcus en¬ gineered according to claim 1, characterized in that The host bacteria of the said engineered enterococcus are Enterococcus faecalis, and the constructed engineered bacteria are engineered Enterococcus faecalis.

5. The engineered Enterococcus faecalis according to claim 4, characterized in that, The said engineered Enterococcus faecalis can effectively degrade phenylalanine in an in vitro culture system.

6. The engineered Enterococcus faecalis according to claim 4, characterized in that, The said engineered Enterococcus faecalis introduced plasmid is the lactic acid bacteria secretory plasmid p8nis-PAH added with Pnis promoter, nisRK element and P8 promoter.

7. The genetically engineered bacteria according to claim 1, characterized by, The said genetically engineered bacteria introduced plasmid contains Pnis promoter, that is, when Nisin is added, the recombinant human phenylalanine hydroxylase is expressed.

8. The genetically engineered bacteria of claim 1 are used for preparing a medicine for preventing and / or treating phenylketonuria.

9. Use according to claim 8, characterised in that, The said phenylketonuria is caused by elevated phenylalanine in blood.

Citation Information

Patent Citations

  • Genetically-Modified Probiotic for Treatment of Phenylketonuria

    US20150246085A1

  • Method of treating phenylketonuria and means therefor

    WO2001068822A2