A universal detection primer and detection method for animal beta coronavirus

Abstract

The present invention relates to a universal detection primer and detection method for animal beta coronavirus, belonging to the field of biotechnology, and the specific steps are: designing beta coronavirus RdRp gene primers βF1 and βR1, synthesizing and purifying; in vitro synthesis of cDNA: extracting viral RNA, adding random primers and dNTPs, and synthesizing cDNA by reverse transcriptase catalysis; preparing a PCR amplification system containing primers βF1 and βR1; executing an amplification procedure; product inspection: using 1% agarose gel electrophoresis. The present invention uses the beta coronavirus RdRp gene as a target gene to design a detection primer, and the use of the primer to amplify the beta coronavirus nucleic acid has good effect, strong specificity, high sensitivity, and can detect SARS-CoV-2 as low as 310 nucleic acid copies, which is universal for detecting members of the beta coronavirus genus.

Description

Technical Field

[0001] The invention belongs to the field of biotechnology, and in particular relates to a universal detection primer and a detection method for animal beta coronavirus. Background Art

[0002] Coronaviruses have a wide range of hosts and can infect humans and a variety of animals, causing damage to the respiratory tract, digestive tract, nerves, kidneys, blood vessels and other tissues. Among them, coronaviruses that have the ability to infect and cause disease in humans and mammals include the α and β genera. SARS-CoV-2, as a new member of the β coronavirus genus b subgroup, is considered an important zoonosis pathogen, which is particularly harmful to human health. Its natural transmission, circulation and continuous recombination between animals and humans are even more worrying. RT-PCR is the current domestic and international standard method for diagnosing SARS-CoV-2 infection, but there is no method that can achieve amplification and distinguish it from other coronavirus genera with only one pair of primers for molecular diagnosis or detection of any animal β coronavirus infection. Since coronavirus strains are prone to recombination and thus achieve cross-species transmission, from the perspective of finding the intermediate host of SARS-CoV-2, it is very necessary to establish a universal RT-PCR method that can specifically detect the β coronavirus genus for screening of β coronavirus infection in various animals and finding the intermediate host of SARS-CoV-2. Summary of the invention

[0003] In order to solve the problems existing in the background technology, the present invention provides a universal detection primer and detection method for animal beta coronavirus. Specific primers are designed with the RdRp (also known as NSP12 or ORF1ab) gene, which is the most evolutionarily conserved gene of the beta coronavirus genus, as the target gene. The RT-PCR method is used for detection and verification. The target fragment amplification effect is good and the sensitivity is high. It cannot amplify non-beta coronavirus nucleic acids such as alpha coronavirus and gamma coronavirus, and has strong specificity.

[0004] To achieve the above object, the present invention is implemented through the following technical solutions:

[0005] A universal detection primer for animal beta coronavirus, wherein the universal detection primer for animal beta coronavirus is:

[0006] βF1:TCTTTGCTCAGGATGGCAACGCT

[0007] βR1:GCTACGGTGCGAGCTCTATT.

[0008] A universal detection method for animal beta coronavirus, the specific steps are:

[0009] 1) Design of synthetic primers: Mouse hepatitis virus (AC_000192.1), a member of the β coronavirus genus included in GenBank, Porcine hemagglutinating encephalomyelitis virus (DQ011855.1, KY994645.1 and NC_048217.1), rat coronavirus (JF792616.1 and NC_012936.1), bovine coronavirus (NC_003045.1 and U00735.2), SARS-CoV-2 (NC_045512.2), human coronavirus OC43 strain (NC_006213.1), bat coronavirus HKU9 strain (NC_009021.1) and Middle East respiratory syndrome virus (NC_019843.3) were used as reference sequences, and SARS-CoV-1 (NC_004718.3) was used as a template. Based on the alignment of the RdRp gene sequence, primers βF1 and βR1 were designed for the conserved sequence, synthesized and purified;

[0010] 2) In vitro cDNA synthesis: Use RNA extraction kit or Trizol reagent to extract viral RNA from nasopharyngeal swabs, feces or tissue samples, add random primers and dNTPs, and synthesize cDNA by reverse transcriptase;

[0011] 3) Prepare PCR amplification system: The amplification system includes 10 μL of 2×Taq Mix Master, 1 μL of cDNA template (the positive control is changed to add 1 μL of sequencing-verified β coronavirus cDNA, and the negative control is changed to add 1 μL of sequencing-verified non-β coronavirus cDNA), 0.5 μL each of βF1 and βR1 primers (both at a concentration of 10 μmol / L), and make up to a total volume of 20 μL with ddH2O;

[0012] 4) Perform amplification program: pre-denaturation at 95°C for 10 min, denaturation at 94°C for 1 min, annealing for 30 s, extension at 72°C for 30 s, 35 cycles, and then extension at 72°C for 10 min;

[0013] 5) Amplification product inspection: Take 5 μL of amplification product and mix it with 1 μL of 6× nucleic acid loading buffer, add it to the loading well of 1% agarose gel, leave one loading well for adding DNA Marker, set the voltage according to 8-10 V / cm gel length, perform electrophoresis for 40 minutes, and observe the number and size of amplification product bands under ultraviolet irradiation.

[0014] Preferably, in step 4), the annealing temperature is 53°C.

[0015] Beneficial effects of the present invention: The present invention uses the RdRp gene of the β coronavirus genus as the target gene to design detection primers βF1 and βR1. After amplification and sequencing inspection, the β coronavirus RT-PCR detection method established based on the primer pair has strong specificity, will not amplify non-β coronaviruses such as α coronavirus and γ coronavirus and other viruses, has high sensitivity, and can detect SARS-CoV-2 as low as 310 nucleic acid copies. It is universal for detecting members of the β coronavirus genus and can detect β coronaviruses from various animal sources including SARS-CoV-1, SARS-CoV-2, etc. BRIEF DESCRIPTION OF THE DRAWINGS

[0016] Figure 1 This is the electrophoresis diagram of the beta coronavirus detection result of the sample to be tested (cattle) in Example 1 (M: DNA molecule standard DL2000; Lane 1: sample; Lane 2: positive control; Lane 3: negative control);

[0017] Figure 2 This is the electrophoresis diagram of the beta coronavirus detection result of the sample (pig) to be tested in Example 2 (M: DNA molecule standard DL2000; Lane 1: sample; Lane 2: positive control; Lane 3: negative control);

[0018] Figure 3 This is the electrophoresis diagram of the beta coronavirus detection result of the sample to be tested (mouse) in Example 3 (M: DNA molecule standard DL2000; 1: sample; 2: positive control; 3: negative control);

[0019] Figure 4 Electrophoresis diagram of the results of RT-PCR amplification of the reference plasmid containing the SARS-CoV-2-NSP12 gene at different annealing temperatures (M: DNA molecule standard DL 2000; lane 1: 52°C; lane 2: 53°C; lane 3: 54.8°C; lane 4: 56.5°C; lane 5: 57.5°C; lane 6: 58.5°C; lane 7: 60°C; lane 8: negative control);

[0020] Figure 5 The electrophoresis diagram of the sensitivity test results of RT-PCR of the present invention (M: DNA molecular standard DL 2000; Lanes 1-8: The reference plasmid containing the SARS-CoV-2-NSP12 gene was diluted 10 times in succession, and the copy numbers were 3.1×10 8 -3.1×10 1 );

[0021] Figure 6It is an electrophoresis diagram of the specific detection results of RT-PCR of the present invention (M: DNA molecule standard DL 2000; lane 1: porcine reproductive and respiratory syndrome virus; lane 2: Japanese encephalitis virus; lane 3: avian infectious bronchitis virus (γ coronavirus); lane 4: feline coronavirus (α coronavirus); lane 5: negative control; lane 6: reference plasmid containing SARS-CoV-2-NSP12 gene; lane 7: reference plasmid containing SARS-CoV-1-NSP12 gene). DETAILED DESCRIPTION

[0022] Example 1

[0023] A universal detection method for animal beta coronavirus, the specific steps are:

[0024] 1) Primer synthesis: Synthesize and purify the β coronavirus RdRp gene primers βF1 and βR1,

[0025] βF1:TCTTTGCTCAGGATGGCAACGCT

[0026] βR1:GCTACGGTGCGAGCTCTATT;

[0027] 2) In vitro cDNA synthesis: Use RNA extraction kit or Trizol reagent to extract viral RNA from the collected bovine nasal swab and rectal swab samples, add random primers and dNTPs, and synthesize cDNA using reverse transcriptase;

[0028] 3) Prepare PCR amplification system: The amplification system includes 10 μL of 2×Taq Mix Master, 1 μL of cDNA template, 0.5 μL of each of βF1 and βR1 primers (both at a concentration of 10 μmol / L), and add ddH2O to make the total volume 20 μL;

[0029] 4) Perform amplification program: pre-denaturation at 95°C for 10 min, denaturation at 94°C for 1 min, annealing at 53°C for 30 s, extension at 72°C for 30 s, 35 cycles, and extension at 72°C for 10 min;

[0030] 5) Amplification product inspection: Take 5 μL of amplification product and mix with 1 μL of 6× nucleic acid loading buffer, add the sample to the loading well of 1% agarose gel, leave one loading well for adding DNA Marker, set the voltage according to 8-10V / cm gel length, electrophoresis for 40 minutes, observe the number and size of amplification product bands under ultraviolet irradiation, and the amplification results are shown in Figure 1Gel electrophoresis showed that the PCR product band was consistent with the expected size (about 352 bp). Further cloning and sequencing analysis showed that the amplified product was consistent with the bovine coronavirus (BCoV), a member of the β-coronavirus genus included in GenBank.

[0031] Example 2

[0032] A universal detection method for animal beta coronavirus, the specific steps are:

[0033] 1) Primer synthesis: Synthesize and purify the β coronavirus RdRp gene primers βF1 and βR1,

[0034] βF1:TCTTTGCTCAGGATGGCAACGCT

[0035] βR1:GCTACGGTGCGAGCTCTATT;

[0036] 2) In vitro cDNA synthesis: Use RNA extraction kit or Trizol reagent to extract viral RNA from pig nasal swab and rectal swab samples, add random primers and dNTPs, and synthesize cDNA by reverse transcriptase;

[0037] 3) Prepare PCR amplification system: The amplification system includes 10 μL of 2×Taq Mix Master, 1 μL of cDNA template, 0.5 μL of each of βF1 and βR1 primers (both at a concentration of 10 μmol / L), and add ddH2O to make the total volume 20 μL;

[0038] 4) Perform amplification program: pre-denaturation at 95°C for 10 min, denaturation at 94°C for 1 min, annealing at 53°C for 30 s, extension at 72°C for 30 s, 35 cycles, and extension at 72°C for 10 min;

[0039] 5) Amplification product inspection: Take 5 μL of amplification product and mix with 1 μL of 6× nucleic acid loading buffer, add the sample to the loading well of 1% agarose gel, leave one loading well for adding DNA Marker, set the voltage according to 8-10V / cm gel length, electrophoresis for 40 minutes, observe the number and size of amplification product bands under ultraviolet irradiation, and the amplification results are shown in Figure 2 Gel electrophoresis showed that the PCR product band was consistent with the expected size (about 352 bp). Further cloning and sequencing analysis showed that the amplified product was consistent with porcine hemagglutinating encephalomyelitis virus (PHEV), a member of the β-coronavirus genus included in GenBank.

[0040] Example 3

[0041] A universal detection method for animal beta coronavirus, the specific steps are:

[0042] 1) Primer synthesis: Synthesize and purify the β coronavirus RdRp gene primers βF1 and βR1,

[0043] βF1:TCTTTGCTCAGGATGGCAACGCT

[0044] βR1:GCTACGGTGCGAGCTCTATT;

[0045] 2) In vitro cDNA synthesis: Use RNA extraction kit or Trizol reagent to extract viral RNA from mouse lung and intestinal tissue samples, add random primers and dNTPs, and synthesize cDNA using reverse transcriptase;

[0046] 3) Prepare PCR amplification system: The amplification system includes 10 μL of 2×Taq Mix Master, 1 μL of cDNA template, 0.5 μL of each of βF1 and βR1 primers (both at a concentration of 10 μmol / L), and add ddH2O to make the total volume 20 μL;

[0047] 4) Perform amplification program: pre-denaturation at 95°C for 10 min, denaturation at 94°C for 1 min, annealing at 53°C for 30 s, extension at 72°C for 30 s, 35 cycles, and extension at 72°C for 10 min;

[0048] 5) Amplification product inspection: Take 5 μL of amplification product and mix with 1 μL of 6× nucleic acid loading buffer, add the sample to the loading well of 1% agarose gel, leave one loading well for adding DNA Marker, set the voltage according to 8-10V / cm gel length, electrophoresis for 40 minutes, observe the number and size of amplification product bands under ultraviolet irradiation, and the amplification results are shown in Figure 3 Gel electrophoresis showed that the PCR product band was consistent with the expected size (about 352bp). Further cloning and sequencing analysis showed that the amplified product was consistent with the Murine coronavirus (Murine coronavirus), a member of the β-coronavirus genus included in GenBank.

[0049] The samples used in Examples 1-3 were cattle, pig, and rat samples collected from 9 counties and districts in Kunming in 2020-2021.

[0050] Experimental analysis

[0051] 1. Optimization of annealing temperature

[0052] The β-coronavirus RdRp gene primers βF1 and βR1 were designed and synthesized and purified by a professional reagent company.

[0053] The reference plasmid containing the SARS-CoV-2-NSP12 gene (plasmid vector is pcDNA6B) was used as a template, and βF1 and βR primers were used for RT-PCR amplification. The amplification system included 10 μL of 2×Taq Mix Master, 1 μL of positive plasmid template, 0.5 μL of βF1 and βR1 primers, and ddH2O was used to make up the total volume to 20 μL.

[0054] PCR amplification program: pre-denaturation at 95°C for 10 min, denaturation at 94°C for 1 min, annealing for 30 s, extension at 72°C for 30 s, 35 cycles, and extension at 72°C for 10 min.

[0055] A total of 7 gradients were set at 52°C, 53°C, 54.8°C, 56.5°C, 57.5°C, 58.5°C and 60°C, and PCR amplification was performed using primers βF1 / βR1. The results are as follows: Figure 4 As shown in the figure, the target band can be amplified at 7 annealing temperatures. A relatively weak mixed band is produced when the annealing temperature is 52°C, and the amplified product bands at 53°C to 60°C are all single (352bp). Considering that there are certain differences in the RdRp gene sequences of different virus species of the β-coronavirus genus, 53°C is determined to be the optimal annealing temperature.

[0056] 2. Sensitivity measurement

[0057] Using the reference plasmid containing the SARS-CoV-2-NSP12 gene (plasmid vector pcDNA6B) as a template, 10-fold serial dilution was performed, and 53°C was used as the annealing temperature for PCR amplification analysis. It was found that the detection limit of the PCR method of the present invention for SARS-CoV-2 was 2.9×10 -7 ng, which is about 310 plasmid copies. The results are as follows Figure 5 As shown, it can be seen that the sensitivity of the method of the present invention is high.

[0058] Specificity determination

[0059] Using feline coronavirus (FCoV), a member of the alphacoronavirus genus, avian infectious bronchitis virus (AIBV), a member of the gammacoronavirus genus, porcine reproductive and respiratory syndrome virus (PRRSV) vaccine strain, and a member of the Flaviviridae family, as negative controls, and two reference plasmids carrying the RdRp gene of SARS-CoVs (both plasmid vectors were pcDNA6B) as positive controls, amplification was performed according to the RT-PCR conditions of the method of the present invention (annealing temperature was 53°C), and the results are as follows: Figure 6 As shown. Figure 6It can be seen that PCR amplification of two positive reference plasmids produced a single product band of the same size (352 bp), while no amplification products were observed when amplifying FCoV, AIBV, PRRSV and JEV nucleic acids, indicating that the primers had good specificity.

[0060] In summary, the specific primers and RT-PCR detection method designed by the present invention can amplify the β coronavirus and SARS-CoVs nucleic acids in cattle, pigs, and mice samples, but cannot amplify non-β coronavirus nucleic acids such as α coronavirus and γ coronavirus, indicating that it is specific and universal for detecting members of the β coronavirus genus.

[0061] Finally, it should be noted that the above preferred embodiments are only used to illustrate the technical solutions of the present invention rather than to limit it. Although the present invention has been described in detail through the above preferred embodiments, those skilled in the art should understand that various changes or adjustments can be made in form and details without departing from the content clauses defined in the claims of the present invention.

Claims

1. A universal detection primer for animal beta coronavirus, characterized in that: The universal detection primers for animal beta coronavirus are: βF1:TCTTTGCTCAGGATGGCAACGCT βR1:GCTACGGTGCGAGCTCTATT.

2. A universal method for detecting animal beta coronavirus, characterized in that: The detection method described is not used for disease diagnosis purposes, and the specific steps are: 1) Designing synthetic primers: Designing, synthesizing and purifying the RdRp gene primers βF1 and βR1 of the βcoronavirus genus, wherein the sequence of the βF1 is TCTTTGCTCAGGATGGCAACGCT, and the sequence of the βR1 is GCTACGGTGCGAGCTCTATT; 2) In vitro cDNA synthesis: Use RNA extraction kit or Trizol reagent to extract viral RNA from nasopharyngeal swabs, feces or tissue samples, add random primers and dNTPs, and synthesize cDNA with reverse transcriptase; 3) Prepare PCR amplification system: The amplification system includes 10 μL of 2×Taq Mix Master, 1 μL of cDNA template, 0.5 μL of βF1 and βR1 primers with a concentration of 10 μmol / L, and add ddH2O to make the total volume 20 μL; 4) Perform amplification program: pre-denaturation at 95°C for 10 min, denaturation at 94°C for 1 min, annealing for 30 s, annealing temperature at 53°C, extension at 72°C for 30 s, 35 cycles, and extension at 72°C for 10 min; 5) Amplification product inspection: Take 5 μL of amplification product and mix it with 1 μL of 6× nucleic acid loading buffer, load it into the loading well of 1% agarose gel, leave one loading well for adding DNA Marker, set the voltage according to 8-10 V / cm gel length, perform electrophoresis for 40 minutes, and observe the number and size of amplification product bands under ultraviolet irradiation.

Images