A fluorescent cross-linked RNase H mutant conjugate and its application

By combining fluorescent crosslinked RNase H mutant conjugates with DNA probes, single-tube multiple RNA detection is realized, solving the high throughput, sensitivity and cost problems of miRNA detection in the prior art, and is suitable for disease diagnosis and new drug development.

CN113913404BActive Publication Date: 2025-08-12SHANGHAI MIRAN BIOTECH CO LTD
View PDF 3 Cites 0 Cited by

Patent Information

Application Number
CN202011389005.X
Authority / Receiving Office
CN · China
Patent Type
Patents(China)
Current Assignee / Owner
Priority Date
2020-09-30
Filing Date
2020-12-01
Publication Date
2025-08-12
Estimated Expiration
2040-12-01

AI Technical Summary

Technical Problem

Existing RNA detection technologies are difficult to detect multiple miRNAs quickly, accurately, cost-effectively and highly throughput, especially lack methods to directly identify DNA/RNA hybrid strands and convert and generate detectable signals, and multiple miRNA detection technologies are not yet mature.

Method used

Fluorescent crosslinking RNase H mutant conjugates are used to bind RNA or RNA-DNA hybrid strands through specific site-directed crosslinking and modification, and use fluorescent substances to generate detection signals, combining sequence-specific DNA probes and fluorescent coding microspheres to achieve single-tube multiple RNA detection.

Benefits of technology

It realizes high-throughput detection of multiple RNAs in single-tube reactions, reduces sample consumption, improves detection sensitivity and accuracy, and reduces costs. It is suitable for rapid analysis of multiple body fluid samples.

✦ Generated by Eureka AI based on patent content.

Smart Images

  • Figure CN113913404B_ABST
    Figure CN113913404B_ABST
Patent Text Reader

Abstract

The present invention discloses a fluorescent cross-linked RNase H mutant conjugate, a preparation method and use thereof, a kit containing the same, and a method for RNA detection using the RNase H mutant conjugate. The RNase H mutant conjugate, such as RNase Hv-(L x ‑I‑F) n RNase Hv is an RNase H mutant that can bind to RNA or RNA-DNA hybrids but cannot cleave RNA; see the detailed definition herein. The fluorescent cross-linked RNase H mutant conjugate of the present invention can directly recognize DNA / RNA hybrids and convert them into a detectable signal without the need for PCR amplification, making it suitable for sensitive and rapid RNA detection.
Need to check novelty before this filing date? Find Prior Art

Description

Technical Field

[0001] The present invention belongs to the field of biological detection, relates to a fluorescent cross-linked RNase H mutant conjugate and its application in detecting RNA, and in particular to a technology for synchronously detecting one or more miRNA combinations of diseases. Background Art

[0002] Early diagnosis of tumors and other chronic diseases is gaining increasing attention. New tumor diagnostic markers include ctDNA and RNA. The latest clinical research progress shows that RNA markers, especially microRNA (miRNA), have more obvious advantages in the diagnosis of early tumors, mainly reflected in sensitivity and specificity (Liu et al.Ann.Onc., 2020, 31(6), 745-759; Fehlmann, et al., JAMA Oncol. 2020, 6(5), 714-723). miRNA is a class of endogenous small RNAs with a length of about 19-25 nucleotides, which plays a key regulatory role in important processes such as embryonic development, cell differentiation and organogenesis. Therefore, monitoring the role of miRNA markers in tumor occurrence and development is the basis for their use as tumor diagnosis, prognostic markers and therapeutic targets. MiRNA in peripheral blood is an ideal target for non-invasive liquid biopsy, which can achieve early diagnosis of patients and facilitate dynamic continuous monitoring. However, the analysis or detection of small RNA, especially miRNA, remains a difficult problem.

[0003] Existing methods for RNA analysis or detection include real-time PCR fluorescence detection based on the PCR amplification principle or reverse transcription PCR followed by gene chip hybridization detection methods. These existing methods are subject to systemic bias due to the need to perform ligation and PCR amplification to detect target miRNAs (for detailed description, see Raabe et al., Nucleic Acids Res. 2014, 42(3), 1414-1426; Levin et al. Nat Methods. 2010, 7(9), 709-715; Jayaprakash et al, Nucleic Acids Res. 2011, 39(21), e141). They can only identify a few small RNAs with limited throughput, and are unable to achieve rapid, accurate, economical, and high-throughput detection, making it difficult to transform and apply RNA markers of great value. How to accurately quantify and effectively detect miRNA in tissues and body fluids has become a common problem that has become a key point in the widespread commercial use of this marker in disease analysis and drug development. Detection of miRNA by PCR-free amplification is the core of solving this common problem. The PCR-free amplification miRNA detection method uses S9.6 monoclonal antibody to recognize DNA / RNA hybrid chains, and then uses a second polyclonal antibody that recognizes S9.6 monoclonal antibody to generate detection signals (Hu et al., Nucleic Acids Res. 2006, 34(7), e52). This detection method requires multiple steps of washing and solution addition, and the hybridization condition is 16 hours at 45°C, which limits its practical application. Another type of PCR-free amplification method for RNA detection is the gap hybridization method, which hybridizes four single-stranded nucleic acid molecules including the target RNA. The target RNA sequence that can be detected depends on the longest complementary probe sequence. For different RNAs, complementary probes with different sequences need to be used in a detection system. Therefore, it can only identify a limited number of miRNAs within a restricted sequence range and cannot be used as a universal miRNA detection technology (Pohlmann et al., 2010, Anal Chem, 82, 4434-4440).Another gap hybridization method developed by Panomics, a subsidiary of Thermo Fisher Scientific, is QuantiGene chemistry. It is not only limited by the relevant detection probes, but also the RNA / DNA hybridization reaction needs to be carried out at 54°C for 20 hours, which poses a great challenge to the thermal stability of RNA. The detection process requires multiple washing and reagent additions, which has great application limitations (Kibriya et al., Cancer Epidemiol Biomarkers Prev, 2014, 23(12), 2667-2672).

[0004] Therefore, there is an urgent need for a one-step method that can directly identify DNA / RNA hybrid chains and convert RNA detection technology that can produce detectable signals. Carter et al. use a mutant RNase H to detect RNA sequences by identifying DNA / RNA hybrids (US7560232B2, Methods of capturing, detecting and quantifying RNA DNA hybrids and a modified RNase H useful therein). However, this method cannot meet the needs of actual application scenarios in terms of sensitivity, convenience and practicality in detecting RNA.

[0005] In addition, tumors, other chronic diseases and sudden public health events require rapid and accurate screening, identification, analysis or detection of samples. Multiple biomarker detection mainly involves simultaneous detection of multiple marker targets present or suspected in a sample. Using single target detection technology to analyze multiple targets to be detected in a sample requires repeated operations on the same sample, which not only increases the workload, but also prolongs the detection cycle, increases the risk of sample contamination and detection personnel and biosafety, and most importantly, brings great challenges to the reliability of the test results. Therefore, multiple biological detection technologies for different targets of the same type are extremely critical (Zhang Pingping et al., Research Progress of Multiple Biological Detection Technology, Military Medicine, 2012, 36, 173-177).

[0006] With the development of instruments capable of high-throughput biomarker detection, clinical diagnostic tests have evolved from meeting basic requirements for sensitivity and specificity to multi-dimensional requirements for both performance (sensitivity, specificity, repeatability, result reliability, and sample volume) and operational performance (ease and speed). Clinical diagnostic biomarkers have also evolved from the most basic cytokines (such as tumor markers CEA and PSA) identified through antigen-antibody reactions to nucleic acid mutation detection through PCR, such as single nucleotide polymorphisms (SNPs) and transmembrane nucleotide polymorphisms (TMBs). With the in-depth development of modern biotechnology, the demand for understanding and monitoring diseases has progressed from cytokine changes and nucleic acid mutation detection to the latest omics research level, such as RNA expression profiling / epigenetics (China Patent 201880058078, multiplex detection of short nucleic acids; Chuang et al. Pediatric Research, 2007, 61, 24-29; Fransquet et al., 58, 5-14; Yao et al., Curr Opin Chem Biol. 2019, 51, 11-17).

[0007] The latest clinical research progress shows that RNA markers, especially microRNA (miRNA), have more obvious advantages in the diagnosis of early tumors, mainly reflected in sensitivity and specificity (Liu et al., Annual of Oncology, 2020, 31, 745-759; Fehlmann, et al., JAMA Oncol. 2020, 6, 714-723). The same miRNA can affect multiple protein-coding genes, and the same gene can be affected by multiple miRNAs, and its effect is a complex network. Therefore, monitoring the role of miRNA markers in tumor occurrence and development is the basis for their use as tumor diagnosis, prognostic markers and therapeutic targets. miRNA markers in body fluids are ideal targets for non-invasive liquid biopsy, enabling early diagnosis of patients and facilitating dynamic continuous monitoring (Bracken et al., Nat Rev Genet. 2016, 17, 719-732; Hayes et al., Trends in Molecular Medicine 2014, 20, 460-469; Lebanony et al., J Clin Oncol, 2009, 27, 2030-2037; Gilad et al., J Mol Diagn, 2012, 14, 510-517). In summary, miRNA markers that can meet these requirements require the detection of multiple miRNA targets.

[0008] A variety of methods have been developed to detect RNA (miRNA) expression levels. Several miRNA detection methods are based on PCR principles, with quantitative real-time PCR being the most commonly used method for miRNA quantitative detection. Other commonly used methods include stem-loop RT-PCR and poly A-tailing-based RT-PCR. However, the expression data obtained by different researchers for specific miRNAs from quantitative PCR vary significantly. Marzi et al. reported that miR-34a levels in the blood were low and undetectable, so they added synthetic exogenous miR-34a as an external reference (Marzi et al., Clinical Chemistry, 2016, 62, 743-754). However, the detection data of several other research groups showed that miR-34a could be easily detected (Cui et al., Acta Pharmacologica Sinica, 2013, 34, 309-313; Gallardo et al., Carcinogenesis, 2009, 30, 1903-1909). In response to the directional deviation in the detection results of miRNA markers, in addition to solving the factors of the RT-PCR detection system itself, a technology that can simultaneously detect multiple miRNAs in a single tube can avoid completely opposite detection results (Tentori et al, Lab Chip, 2018, 18(16), 2410-2424; Microsyst Nanoeng, 2020, 6, 51; Zhang et al, Chem. Sci., 2020, 11, 3812-3819).

[0009] Multiplex miRNA detection technology is the focus of the miRNA detection field, but there is currently no mature system that is universal and can be used for rapid and high-throughput detection. QuantiGene plex, developed by Panomics, a subsidiary of Thermo Corporation, has achieved the simultaneous determination of 3-80 mRNAs (message RNAs) in a single well. However, for the multiplex determination of miRNA, due to the limitation that the length of miRNA is only 19-25 nucleotides, this system cannot achieve the goal of simultaneous multiplex detection in a single well: each reaction well can only measure one miRNA (QuantiGene TM Singleplex microRNA, www.thermofisher.com). Summary of the Invention

[0010] In order to solve the problem of the lack of RNA detection technology in the prior art that can directly recognize DNA / RNA hybrid chains and convert them into detectable signals without PCR amplification, the present invention provides a fluorescent cross-linked RNase H mutant conjugate and its application. Specifically, the RNase H mutant modified with a specific molecule of similar function is specifically site-specifically cross-linked and modified with a fluorescent substance that can produce high signal intensity, providing a real application in the field of disease research that can meet the needs of RNA markers. Among them, wild-type RNase H can bind to DNA / RNA hybrid chains ( Figure 1 A), and then hydrolyzes the bound RNA, the hydrolysis mechanism is as follows Figure 1 B. The fluorescent cross-linked RNase H mutant conjugate of the present invention is obtained by mutation, modification and chemical labeling of RNase H, thereby meeting the requirements of efficient recognition of RNA, especially small RNA, and is used for analysis and detection related to disease screening, early diagnosis, treatment effect evaluation or drug development. Its detection principle is as follows Figure 2 As shown, detection probes such as DNA are immobilized on the surface of a carrier and hybridize with the target RNA to form a DNA / RNA hybrid chain. This hybrid chain is recognized by a fluorescent cross-linked RNase H mutant conjugate. The expression level of the target RNA is obtained by measuring the fluorescence intensity generated by the RNase H mutant conjugate. The present invention can detect RNAs with a length of 15-200 nucleotides, including microRNAs (19-25 nt), long non-coding RNAs, message RNAs, and their fragments, and other single-stranded RNAs.

[0011] In order to solve the above technical problems, the first aspect of the technical solution of the present invention is to provide a fluorescent cross-linked RNaseH mutant conjugate, wherein the RNase H mutant conjugate is RNase Hv-(L x -SH-F) n As shown, RNaseHv is a mutant of RNase H that can bind to RNA or RNA-DNA hybrid chains but cannot cleave RNA; L is a linker, x is 1-10; SH is an amino acid containing a thiol group; F is a luminescent functional group, and n is 1-7.

[0012] In a preferred embodiment, in the RNase H mutant conjugate, the SH is cysteine; and / or the L is a non-polar amino acid such as alanine, proline, valine or glycine.

[0013] And / or, L is a non-polar amino acid such as alanine, proline, valine or glycine.

[0014] In a preferred embodiment, in the RNase H mutant conjugate, (L x -SH-F) n Connected to the C-terminus or N-terminus of RNase Hv, x is 1-3, and n is 3-5.

[0015] Preferably, the L x is Gly, Gly-Gly, Gly-Gly-Gly or Ala-Gly.

[0016] In a more preferred embodiment, in the RNase H mutant conjugate, F is a luminescent substance having an excitation wavelength between 300 nm and 700 nm and an emission wavelength between 300 nm and 700 nm, which can undergo covalent cross-linking with SH; preferably, F is a luminescent substance having an excitation wavelength between 480 nm and 580 nm and an emission wavelength between 520 nm and 680 nm; more preferably, F is Alexa Fluor 555 or Alexa Fluor 532.

[0017] In a more preferred embodiment, in the RNase H mutant conjugate, the RNase H is derived from bacteria, humans, or viruses. Preferably, the bacteria is E. coli K12, and the virus is HIV.

[0018] In a more preferred embodiment, in the RNase H mutant conjugate, the RNase Hv undergoes one or more amino acid additions, deletions, or substitutions in the domain of RNase H that catalyzes the hydrolysis of RNA, such that the domain loses its function of catalyzing the hydrolysis of RNA, but maintains or enhances its function of binding to RNA-DNA hybrid chains; preferably, the amino acid sequence of the RNase Hv is as shown in SEQ ID NO: 20.

[0019] In order to solve the above technical problems, the second aspect of the technical solution of the present invention is to provide a method for preparing the RNase H mutant conjugate as described above, wherein when the RNase H mutant conjugate such as RNase Hv-(L x -SH-F) n When, the method is selected from the following schemes:

[0020] Option 1:

[0021] (1) (L x -SH) n Mix with RNase Hv in proportion to obtain RNase Hv-(L x -SH) n ;

[0022] (2) Add an excess of preferably 2 to 10 times the amount of F to the RNase Hv-(L x -SH) n , thereby preparing RNase Hv-(L x -SH-F) n ;

[0023] Preferably, the method further comprises preparing RNase Hv before step (1);

[0024] Option 2:

[0025] (a) Expressing N-terminal or C-terminal (L x -SH) n RNase Hv was obtained to obtain RNase Hv-(L x -SH) n ;

[0026] (b) adding an excess of preferably 2 to 10 times excess F, thereby preparing RNase Hv-(L x -SH-F) n .

[0027] In the above technical solution, the excess amount, i.e., the molar number of F, is greater than that of RNase Hv-(L x -SH) n The number of moles.

[0028] To solve the above technical problems, a third aspect of the technical solution of the present invention is to provide a kit for RNA detection, wherein the kit comprises the RNase H mutant conjugate as described above.

[0029] Preferably, the kit further comprises a DNA probe.

[0030] More preferably, the 5' end of the DNA probe is a free end, and / or the 3' end is an immobilized end, preferably the 3' end has NH2-C6 modification, and more preferably is immobilized on a microsphere or a planar medium;

[0031] Even more preferably, the nucleotide sequence of the DNA probe is shown as SEQ ID NO: 1-13.

[0032] To solve the above technical problems, a fourth aspect of the technical solution of the present invention is to provide a method for RNA detection, characterized in that it comprises the following steps:

[0033] When the RNase H mutant conjugate is RNase Hv-(L x -SA-F) n hour,

[0034] (1) hybridizing the DNA probe to the RNA first, and then adding the RNase H mutant conjugate as described above; or,

[0035] (2) adding the DNA probe, RNA, and the RNase H mutant conjugate described above simultaneously, and detecting the fluorescence;

[0036] Preferably, the ratio of the DNA probe to the RNase H mutant conjugate is 2000-100000:1;

[0037] More preferably, the RNA detection is a single-tube detection or a multi-tube detection of multiple RNAs; the single-tube detection means detecting one or more RNAs in one reaction, and the multi-tube detection means detecting only one RNA in each reaction;

[0038] Further more preferably, the 5' end of the DNA probe is a free end, and / or the 3' end is an immobilized end, preferably the 3' end has an NH2-C6 modification, and more preferably is immobilized on a microsphere or a planar medium; and / or the RNA is mRNA, non-coding RNA or miRNA, and the miRNA is a mature miRNA or precursor miRNA.

[0039] The present invention provides a universal, single-tube method for quantitative or qualitative analysis or detection of RNA, particularly multiple miRNAs. This method enables sensitive, specific, convenient, accurate, and high-throughput miRNA detection, meeting the multidimensional analysis or detection needs in disease diagnosis, treatment, and drug development. This system, based on the DNA / RNA recognition molecule RH3CF and sequence-specific DNA probes cross-linked to the surface of fluorescently encoded microspheres, simultaneously identifies and analyzes multiple target miRNAs.

[0040] Hybridization methods require sequence-specific probes for the detection of different target RNAs, especially miRNAs. In the detection of multiple RNAs in a single-tube reaction, probes complementary to the target need to be fixed on different identifiable medium surfaces or specific medium positions. The present invention uses carboxylated polystyrene microspheres with different fluorescent chromatographic codes. After cross-linking probes with different sequences, the specific response target miRNA can be reflected through the coding or position of the solid-phase microspheres. The DNA probes are cross-linked to the surface of the solid-phase carrier. The various coded microspheres used in the liquid-phase chip that can be excited to produce various wavelengths have their surfaces activated and carry carboxyl groups. Therefore, a DNA probe with an amino-modified end is prepared, and the probe and microsphere can be cross-linked in a one-step reaction using the chemical cross-linking agent N-(3-dimethylaminopropyl)-N'-ethylcarbodiimide (EDC). Microspheres cross-linked with different DNA probe sequences are mixed to form a single tube for the detection of different miRNAs.

[0041] The principle of multiple RNA single tube simultaneous detection is as follows Figure 9 As shown. First, microspheres encoded with different fluorescent chromatograms for different target RNA sequences are mixed. Then, the target RNA to be detected and the fluorescent molecule conjugate RH3CF for DNA / RNA recognition are added. The microsphere probes in the suspension specifically bind to the target RNA to be detected through hybridization of complementary DNA / RNA sequences to form a double strand. RH3CF binds to the DNA / RNA double strand, thereby labeling the DNA / RNA hybrid with reporter fluorescence. Detection and analysis are performed using a Luminex instrument based on the principle of flow fluorescence detection: the microspheres pass through a microchannel in a single file and are simultaneously excited by two dual-color laser beams: a red laser determines the fluorescence code of the microspheres, classifying the microspheres and thus identifying different reaction types (i.e., qualitative); the other green laser measures the fluorescence intensity of the reporter molecules on the microspheres, determining the number of reporter fluorescent molecules bound to the microspheres, and thus determining the number of target molecules bound to the microspheres (i.e., quantitative). Therefore, through the simultaneous detection of the dual-color lasers, real-time, qualitative and quantitative analysis of the reaction is completed, thereby realizing the single-tube detection of multiple RNA markers of the present invention.

[0042] In order to solve the above technical problems, the fifth aspect of the technical solution of the present invention is to provide a use of the RNaseH mutant conjugate or kit as described above in the preparation of reagents for analyzing and detecting RNA.

[0043] Preferably, the RNA is mRNA, non-coding RNA or miRNA, and / or the agent is a diagnostic agent for detecting cancer.

[0044] More preferably, the miRNA is a mature miRNA or a precursor miRNA.

[0045] On the basis of conforming to the common sense in this field, the above-mentioned preferred conditions can be arbitrarily combined to obtain the preferred embodiments of the present invention.

[0046] The reagents and raw materials used in the present invention are commercially available.

[0047] The positive progress effect of the present invention is:

[0048] 1. Single-tube reaction enables multiple RNA detection. A single reaction tube can simultaneously analyze multiple different target RNA molecules in the same sample. The detection throughput is equal to the number of microsphere types, currently up to 500.

[0049] 2. No PCR amplification required. The test results are more accurate and the false negative rate is reduced.

[0050] 3. It can analyze miRNAs markers from various body fluid sources such as blood, saliva and urine.

[0051] 4. Low sample consumption and high sensitivity: Since 500 different RNA molecules can be detected simultaneously in the same reaction well, the sample consumption is greatly saved; samples with concentrations as low as nM can be detected, which can meet the needs of most biological tests.

[0052] 5. Fast: Because it is a liquid phase system, the reaction time is greatly shortened, and multiple RNA molecule detection can be completed within 30 minutes.

[0053] 6. Low cost: Simultaneously testing multiple indicators of a sample can save time, samples, reagents, consumables and labor, reduce testing costs and improve analysis efficiency.

[0054] 7.Flexible: Users only need to add or remove microspheres with probes to meet the needs of different detection projects;

[0055] 8. Universality: It can detect various RNAs of different lengths (15-200nt), such as miRNAs, especially short miRNAs, without the need for miRNA ligation or labeling. BRIEF DESCRIPTION OF THE DRAWINGS

[0056] Figure 1 The structure of RNase H binding to RNA:DNA hybrid substrate (A) and its hydrolysis mechanism (B);

[0057] Figure 2 Schematic diagram of the detection principle;

[0058] Figure 3Figure 3 SDS-PAGE detection of RNase H expression, where M is a protein marker, lane 1 is RH3C (RNase H (E48Q)-3C), and lane 2 is RH3CF (RNase H (E48Q)-3 (Alexa Fluor A532)). A is fluorescence detection on 12% SDS-PAGE before staining, B is fluorescence detection on 12% SDS-PAGE stained with Coomassie Brilliant Blue G250, and C is direct fluorescence detection on the dilution buffer.

[0059] Figure 4 for the detection signal and sensitivity of miRNA let7a;

[0060] Figure 5 The effects and results of probes with different sequences, types, ratios and fixed orientations on the detection signal;

[0061] Figure 6 The effect of RNase H (E48Q) cross-linked conjugates carrying 1, 3, 5, and 7 cysteines that can be covalently cross-linked on the detection signal;

[0062] Figure 7 The effect of RNase H (E48Q) complexes carrying different linker amino acids on the detection signal;

[0063] Figure 8 The effect of the conjugates of AF532 and AF555 covalently cross-linked with RNaseH(E48Q)-3C in different fluorescence bands on the detection signal.

[0064] Figure 9 Schematic diagram of the principle of simultaneous detection of multiple miRNAs in a single tube;

[0065] Figure 10 Specificity for detecting miRNA mismatch bases;

[0066] Figure 11 Results from simultaneous detection of two miRNAs in a single tube reaction;

[0067] Figure 12 Results of simultaneous detection of blood-derived miR-34a in a single-tube reaction;

[0068] Figure 13 Results from simultaneous detection of multiple miRNAs in blood, urine, and saliva in a single-tube reaction;

[0069] Figure 14 Provide a screening and validation process for lung cancer miRNA markers;

[0070] Figure 15 Flowcharts for machine learning and model building;

[0071] Figure 16 The present invention is an application interface of a detection device of a lung cancer diagnosis system. DETAILED DESCRIPTION

[0072] The present invention is further illustrated by way of examples below, but the present invention is not limited to the scope of the examples. Experimental methods in the following examples where specific conditions are not specified were performed according to conventional methods and conditions, or selected according to the product specifications.

[0073] Table 1. Construction and modification of RNase H proteins and their mutants

[0074]

[0075] In the above table, the Arabic numeral subscript after the bracket represents the number of the group or amino acid residue. For example, (Gly)3 represents three consecutive Glys, i.e., the structure of Gly-Gly-Gly.

[0076] Example 1 Construction of 9 E. coli RNase H and plasmids carrying specific molecularly modified mutants

[0077] 1. Construction of plasmid expressing E. coli RNase H

[0078] Extract E. coli K12 genomic DNA. A 50 μL PCR reaction system was prepared, containing 100 ng of E. coli K12 genomic DNA, 5 μL of 10× PCR buffer, 4 μL of 2.5 mM dNTP mixture, 0.5 μL of 100 μM forward and reverse primers, 0.5 μL of pfx50 DNA polymerase (5 U / μL), and sterile deionized water to 50 μL for PCR amplification. PCR reaction conditions were as follows: 94°C for 2 minutes; 30 cycles of 94°C for 30 seconds, 60°C for 40 seconds, and 68°C for 3 minutes; and finally 68°C for 5 minutes.

[0079] The amplified PCR product was treated with a Promega PCR product purification kit. The purified PCR product was reacted with the cloning vector pET33b using restriction enzymes Nco I and Xho I at 37°C for two hours. The target fragment was recovered by electrophoresis using 1% agarose. The pET33b and PCR product, treated with restriction enzymes, were ligated using T4 DNA ligase and transformed into DH5α competent cells. The transformation solution was plated onto kanamycin-containing LB solid medium and incubated inverted at 37°C overnight. The next day, resistant colonies were isolated and cultured in LB liquid medium containing kanamycin. The cells were cultured overnight at 37°C at 200 rpm and sent to a sequencing company for sequencing verification. This resulted in the expression plasmid pET33b-rh, which expresses RNase H with a His purification tag (Protein ID: 1).

[0080] 2. Construction of RNase H (E48Q) mutant with E48Q mutation

[0081] Figure 1 Shown are the structure of RNase H bound to an RNA:DNA hybrid substrate (A) and its hydrolysis mechanism (B). Using primer-directed mutagenesis in the pET33b-rh plasmid vector, 48Glu was converted to 48Gln, creating the E48Q mutant, pET33b-rh (E48Q). The specific experimental steps are as follows.

[0082] PCR amplification: A pair of reverse complementary primers were synthesized to target the mutation site. A 50 μL PCR reaction system was prepared, containing 0.5 μL (approximately 50 ng) of pET33-rh plasmid, 5 μL of 10× buffer, 4 μL of a dNTP mixture (2.5 mmol / L each), 2.0 μL each of 100 μM forward and reverse primers, 0.5 μL of pfx50 DNA polymerase (5 U / μL), and sterile deionized water to a total of 50 μL for PCR amplification. PCR reaction conditions were: 94°C for 30 seconds; 18 cycles of 94°C for 30 seconds, 60°C for 40 seconds, and 68°C for 3 minutes; and finally 68°C for 5 minutes.

[0083] Digest the original template with Dpn I: Add 1 μL of Dpn I to 10 μL of PCR product and incubate at 37°C for 2 hours to digest and remove the original template plasmid.

[0084] Transformation into DH5α competent cells: Follow the instructions for E. coli competent cells, eliminate 3 μL of the PCR product after the original template plasmid is transformed into E. coli DH5α, spread the transformation solution onto kanamycin LB solid medium, incubate at 37°C overnight, pick out resistant monoclonal colonies the next day, culture at 37°C, 200 rpm overnight, and send to a sequencing company for sequencing to obtain pET33b-rh(E48Q).

[0085] 3. Construction of RHv mutants carrying various Cys numbers and linkers from the E48Q mutant (RHv)

[0086] According to the above method 2, combined with the technology previously improved by the present inventors (Wang et al., Molecular and Cellular Probes, 2010, 24: 15–19), starting from the RNase H (E48Q) expression plasmid, expression plasmids were successively constructed with one cysteine ​​added to the N-terminus of the protein corresponding to RNase H (E48Q) and 3, 5, and 7 cysteines added before the C-terminal His-tag. The expressed proteins obtained were RH1CF (Protein ID: 3), RH3CF / RH3CF(GG) (Protein ID: 4), RH5CF (Protein ID: 5), and RH7CF(G) (Protein ID: 6).

[0087] Similarly, starting from the RNase H (E48Q) expression plasmid, expression plasmids carrying different linker types and lengths at the protein C-terminus were constructed, and the protein constructs that could be expressed were RH3C (G) (Protein ID: 7), RH3C (AG) (Protein ID: 8), and RH3C (GGG) (Protein ID: 9) in Table 1.

[0088] Example 2 Expression and Purification of Proteins Carrying Seven Different Conformations (Protein ID 3-9) Derived from RNase H Mutant RHv

[0089] Taking pET33b-rh(E48Q)-3C (Protein ID: 3) as an example, the pET33b-rh(E48Q)-3Cys plasmid was transformed into E. coli Bl21(DE3) for protein expression. The cells were inoculated and cultured until the OD600 reading was ~0.6. The inducer IPTG (Isopropylβ-D-Thiogalactoside) was added to a final concentration of 1.0mM to induce the expression of the target protein. The cells were collected by centrifugation 4 hours after induction. The cells were broken by ultrasonication in PBS, and the supernatant collected by centrifugation was bound to Ni-NTA resin and eluted with imidazole to obtain the target protein RNase H(E48Q)-3Cys (abbreviated as RH3C). The cells were dialyzed against PBS and set aside for use. Figure 3 , wherein A is the fluorescence detection before 12% SDS-PAGE staining, B is the 12% SDS-PAGE Coomassie Brilliant Blue G250 staining, and C is the direct fluorescence detection of the dilution solution).

[0090] Example 3 Fluorescent Labeling and Purification of Seven Proteins with Different Structures (Protein ID 3-9)

[0091] Taking RH3C as an example, the three cysteines introduced into the C-terminus of the RNase H protein through molecular modification were fluorescently labeled, thereby specifically obtaining fluorescently labeled RNase H(E48Q)-(Alexa Fluor A532)3, namely RH3CF.

[0092] RH3C was quantified using the Bradford method. 1 mg / mL RH3C was added to 1 mg / mL Alexa Fluor TM 532C5Maleimide (Cat. No. A10255, Thermo Fisher), react at 30°C in the dark for 1 hour. Centrifuge 3 times in a 10kDa ultrafiltration tube to remove uncrosslinked free Alexa Fluor TM 532C5 Maleimide, the product obtained is mainly RNase H(E48Q)-(Alexa Fluor 532)3 (abbreviated as RH3CF) ( Figure 3 ).

[0093] The same method was used to obtain seven fluorescent-modified conjugates with specific molecular modifications, protein IDs 3-9.

[0094] Example 4 Covalent cross-linking of probes and carboxylated polystyrene microspheres

[0095] Figure 2The following is a schematic diagram of the detection principle of the immobilized DNA probe. The sequences of the synthetic oligonucleotide DNA probes and RNA are shown in Table 2. The 3' end of the probes shown in SEQ ID NO: 1-14 contains an NH2-C6 modification.

[0096] Table 2 Probes used for covalent crosslinking, their modifications, and RNA sequences

[0097]

[0098]

[0099]

[0100] *In the DNA / LNA probes in Table 2, P3 / P indicates that the 3' end of the detection probe is immobilized on a solid support, and P5 indicates that the 5' end of the detection probe is immobilized on a solid support. Lowercase c and t indicate LNA (locked nucleic acid) modification.

[0101] Ten carboxylated polystyrene microspheres (product numbers LC10001-01, LC10001-02, LC10001-03, LC10001-04, LC10001-05, LC10001-06, LC10001-07, LC10001-08, LC10001-09, and LC10001-10, Luminex Corporation) were selected and covalently cross-linked with the probes according to the following method:

[0102] (1) Dissolve the probes in double-distilled water to a concentration of 100 μM.

[0103] (2) Microsphere washing: Take 50 μL of each microsphere (containing 6.0×105 microspheres) and centrifuge at 10,000 g for 5 minutes to precipitate the microspheres. Discard the supernatant. Then add 50 μL of 0.1 M MES, pH 4.5 solution and shake for 15 seconds to suspend the microspheres. Centrifuge at 10,000 g for 5 minutes to precipitate the microspheres. Discard the supernatant. Resuspend the microspheres with 50 μL of 0.1 M MES, pH 4.5.

[0104] (3) Covalent cross-linking of probes and microspheres: Add 2.0 μL of 100 μM probe to the corresponding microsphere suspension in the previous step, mix well, and add 2.5 μL of 10 mg / mL EDC (3-(ethyliminomethylideneamino)-N,N-dimethylpropan-1-amine, hydrochloride, the Chinese name of EDC is usually 1-(3-dimethylaminopropyl)-3-ethylcarbodiimide hydrochloride or 1-ethyl-(3-dimethylaminopropyl)-carbodiimide hydrochloride) solution. Protect from light and react at 37°C for 30 minutes.

[0105] (4) Add another 2.5 μL of 10 mg / mL EDC solution. Protect from light and incubate at 37°C for 30 minutes.

[0106] (5) Centrifuge at 10,000 g for 5 minutes to precipitate the microspheres. Add 1.0 mL of 0.1% SDS to resuspend the microspheres, mix well with a shaker, and centrifuge at 10,000 g for 5 minutes to precipitate the microspheres.

[0107] (6) Discard the supernatant and resuspend the microspheres in 100 μL TE (pH 8.0).

[0108] Example 5 Detection of quantitative curve

[0109] 1. The oligonucleotide DNA probe P3-let7a (SEQ ID: 1) was covalently cross-linked and coated with carboxylated polystyrene microspheres (Cat. No. LC10001-01, Luminex) according to the conditions in Example 4.

[0110] 2. miRNA detection

[0111] (1) Standard: Dissolve the synthetic miRNA let7a (SEQ ID: 14) in TE to a final concentration of 10 μM. Then dilute to 50 nM, 20 nM, 10 nM, 500 pM, 200 pM, 100 pM, 50 pM, and 20 pM, respectively.

[0112] (2) Mixing: Add 2.0 μL of miRNA, 2.0 μL of microsphere mixture, and 1.0 μL of 10 nM RH3CF to 15.0 μL of hybridization solution (500 mM NaCl, 0.05% Tween 20, 1 mM MgCl2, 50 mM Tris-HCl, pH 7.5) and mix thoroughly. Vortex for 5 seconds. Repeat the assay five times for each concentration of miRNA let7a standard.

[0113] (3) Hybridization reaction: Place in a pre-set 42°C water bath for 20 minutes.

[0114] (4) Detection: Add 80 μL of hybridization diluent (100 mM NaCl, 0.05% Tween 20, 20 mM Tris-HCl, pH 7.5), transfer to a 96-well microplate, and place in Luminex-200 for detection.

[0115] (5) Data analysis and fitting: Figure 4 shown.

[0116] The detection sensitivity is 5-10pM miRNA let7a in the reaction system.

[0117] Example 6 Effects of probe combinations of different sequences, types, and fixed orientations

[0118] For the RH3CF prepared by the present invention, a concentration-related fluorescence signal is obtained by recognizing the DNA / RNA hybrid formed by the detection probe fixed on the surface of carboxylated polystyrene microspheres (product number LC10001-01, Luminex) and the target RNA. Therefore, the different types of probes (DNA and locked nucleic acid LNA, etc.) fixed on the solid phase support and the different modifications of their surfaces can affect the nonspecific signal noise, thereby generating different detection signals, and ultimately affecting the minimum detection limit of the detection system. The present invention compares the fixation of different probe directions:

[0119] 1) Immobilization of the 5' and 3' ends of the DNA probe affects the detection signal

[0120] 2) DNA probes with the same sequence fixed at different ratios of 5' and 3' ends

[0121] 3) Probes with the same sequence fixed at the 3' and 5' ends of the target probe

[0122] 4) Probes of different sequences and lengths are fixed at the 3' and 5' ends of the target probe

[0123] 5) DNA and LNA probes with the same sequence fixed at the 3' end

[0124] The probes and their modifications used in this embodiment of the present invention are shown in Table 2.

[0125] In this example, the probes of SEQ ID 1-4 were combined, and 50 μL of carboxylated polystyrene microspheres were added to each of eight reaction tubes according to the ratios and volumes listed in Table 3. Mix thoroughly, then add 2.5 μL of a 10 mg / mL EDC solution. Incubate at 37°C in the dark for 30 minutes. Add another 2.5 μL of a 10 mg / mL EDC solution. Incubate at 37°C in the dark for 30 minutes. Centrifuge at 10,000 g for 5 minutes to precipitate the microspheres. Add 1.0 mL of 0.1% SDS to resuspend the microspheres, mix thoroughly with an oscillator, and centrifuge at 10,000 g for 5 minutes to precipitate the microspheres. Finally, discard the supernatant and resuspend the microspheres in 100 μL of TE (pH 8.0). This yields a detection microsphere probe modified with a mixture of different probe types.

[0126] Table 3 Probe combinations of different sequences, types and fixed orientations

[0127]

[0128]

[0129] Dissolve the synthesized miRNA let7a in TE and dilute it to 10nM. Add 2.0μL of miRNA, 2.0μL of microsphere mixture and 1.0μL of 1μM concentration of RH3CF to 15.0μL of hybridization solution (500mM NaCl, 0.05% Tween 20, 1mM MgCl2, 50mM Tris-HCl, pH7.5) and mix well. Vortex oscillator to mix for 5 seconds. Place in a pre-set 42°C water bath for 20 minutes. Add 80μL of hybridization diluent (100mM NaCl, 0.05% Tween 20, 20mM Tris-HCl, pH7.5), transfer to a 96-well microplate, and place in Luminex-200 for detection. Repeat each combination three times to obtain the results shown below. Figure 5Combinations 1, 5-8 achieved the highest signal-to-noise ratios (S / N). This suggests that immobilizing a certain proportion of non-target probe DNA sequences (e.g., P5-6A, as used in Table 3 above) simultaneously with the target probe sequences on the solid support (e.g., combinations 5 and 7) not only controls and optimizes the density of probes on the solid support but also simultaneously modifies the solid surface to reduce nonspecific adsorption. Optimizing the density of target probes, such as P3-let7a in this example, and modifying the surface with sequences that are non-complementary to the target RNA, can improve the detection signal while reducing the noise generated by nonspecific adsorption, ultimately achieving the goal of raising the detection threshold. The LNA probe did not demonstrate superior detection performance compared to the DNA probe in this example. This may be because the temperature required for complete hybridization increases by 4°C per nucleotide after LNA modification, making the temperature reaction conditions in this example suboptimal for LNA. Conversely, mixing a certain proportion of LNA with DNA can improve the detection performance of LNA probes (e.g., combination 6 compared to combination 8), further demonstrating the need to optimize the optimal conditions for LNA probes.

[0130] This invention confirms and validates for the first time the clear directionality of DNA / RNA recognition based on RNase H molecules. Immobilization of the 3' end of the probe, or maintaining free access to the 5' end of the RNA-recognizing probe, is essential for RNase H binding and recognition in this and other sources. By mixing probes with the same sequence but immobilized in different orientations, the detection signal gradually decreases, achieving a signal-to-noise ratio of 1.2 for probes with 100% immobilized 5' ends, validating the contribution of this invention.

[0131] Example 7 Comparison of the effects of RNase H (E48Q) cross-linked conjugates carrying 1, 3, 5, and 7 site-specific covalently cross-linked cysteines on the detection signal

[0132] The cross-linked conjugates of RNase H (E48Q) carrying 1, 3, 5, and 7 cysteines Cys for site-specific covalent cross-linking are RH1CF, RH3CF, RH5CF, and RH7CF, respectively.

[0133] The synthesized miRNA let7a (SEQ ID NO: 14) was dissolved in TE and diluted to 10 nM. Using the same conditions as in Example 6, the P3-let7a probe microspheres with sequence number 1 (SEQ ID NO: 1) in Table 3 were selected to test the signal generated by the let7a miRNA at a final concentration of 1 nM. Each combination was repeated three times, and the results were as follows: Figure 6The optimal number of Cys residues carried at the end of a specifically engineered molecule is three, which yields the highest detection signal. E. coli RNase H itself carries three Cys amino acids, which are located within the internal / non-surface region of its higher-order structure and are not easily susceptible to site-specific modification and cross-linking. Figure 6 The fluorescence signal generated by a single Cys is shown to be the lowest, while multiple Cys, such as the 5 and 7 Cys in this embodiment, can theoretically produce a stronger fluorescence signal by introducing more fluorescent groups through more Cys. However, for RNase H itself, excessive fluorescent molecule modification can bring about a certain degree of protein denaturation benefits, resulting in a decrease in RNase H binding ability, thereby not improving the detection signal overall. Therefore, the molecular modification of RNase H in the present invention and the optimal balance embodied, 3 Cys, can produce the best results.

[0134] Example 8 Effect of the Length and Type of the Cys Pre-Linker at the Terminal of RNase H (E48Q) on the Detection Signal

[0135] RH3CF(G), RH3C / RH3C(GG), RH3CF(AG) and RH3CF(GGG) prepared in Table 1, respectively, added four different combinations of cysteine ​​linkers (Gly-Cys)3, (Gly-Gly-Cys)3, (Ala-Gly-Cys)3 and ([Gly]3-Cys)3 in front of the C-terminal His-tag of the protein corresponding to RNase H(E48Q), thus obtaining four proteins with Protein IDs 6-9.

[0136] 10 nM miRNA let7a was tested according to the conditions of Example 7, and each combination was repeated three times. The results are as follows Figure 7. The purpose of adding a non-polar linker is to maintain the distance between two adjacent cysteines that can be fluorescently covalently cross-linked, reduce steric hindrance, and improve the effect of covalently cross-linked fluorescent groups. Therefore, 1-3 amino acids were selected as linkers for testing. The test results showed that the combination of 4 different linkers did not show obvious differences. The best effect was achieved by using 3 consecutive Gly as linkers, which was slightly better than the detection signal generated by 2 Gly linkers. From the benefits of 1-3 linkers, 3 Gly connections can produce the best detection signal. Partially replacing Gly with Ala has limited impact on the results. In order to increase the spatial distance and structure between the two cysteines and improve the cross-linking efficiency with the fluorescent group, it is necessary to reduce the steric hindrance effect by connecting with non-polar amino acids. Glycine does not form a three-dimensional chemical structure because its side chain group and lacks a beta carbon atom, so the peptide chain is more flexible, so it can provide more spatial structure and has the least effect on the chemical activity of the adjacent amino acids. Therefore, it becomes the preferred linker amino acid in the technology of the present invention. Among known amino acids, alanine's side chain group is second only to glycine in terms of steric hindrance and hydrophobicity, and is also weakly hydrophobic, creating a weakly hydrophobic environment that is conducive to the insertion of hydrophobic fluorescent groups. Therefore, both are preferred linker amino acids for preparing site-specific molecular modifications and maintaining the biological activity of the target molecule. In this example, linkers of three or four consecutive non-polar amino acids did not significantly affect the resulting signal, demonstrating the need for a reasonable balance between spatial distance, linker amino acid flexibility, and hydrophobicity.

[0137] Example 9 Effect of covalently cross-linked conjugates of AF532 / AF555 and RH3C / RH7C in different fluorescence bands on the detection signal

[0138] Covalent cross-linking: 1 mg / mL of RH3C and RH7C, respectively, with 1 mg / mL Alexa Fluor TM 555C2Maleimide (Cat. No. A20346, Thermo Fisher) was cross-linked and purified according to the conditions in Example 3. AlexaFluor 555-labeled RH3CF555 and RH7CF555 were obtained.

[0139] Signal detection: 10 nM miRNA let7a was tested according to the conditions of Example 7, comparing RH3CF and RH7CF (fluorescently labeled AF532), RH3CF555 and RH7CF555. Each combination was repeated three times, and the results were as follows Figure 8. RH3CF labeled with AF532 has the highest detection signal for the same concentration of miRNA, and the detection signal of RH3CF555 labeled with AF555 is 90% of the former. The results obtained by labeling AF532 and AF555 with RH7C are similar. Therefore, in this embodiment, RH3CF is the preferred combination, and RH3CF555 is second best. This embodiment and Example 7 once again verified that in order to achieve optimal signal conversion and molecular recognition, this specifically modified molecule has a certain degree of optimization of the optimal number of exogenously added cysteine. Excessive fluorescent molecule modification has an impact on the binding and recognition activity of RNase H. The possible reason is that a certain degree of protein denaturation occurs, resulting in a decrease in the binding ability of RNase H, thereby causing an overall decrease in the detection signal.

[0140] Example 10 Detection of transcribed 64-nucleotide RNA 1a ​​(SEQ ID: 9)

[0141] Synthesize 5' end phosphorylated modified DNA RCA-1a (SEQ ID NO: 18). This design is based on the padlock principle of rolling circle amplification (Deng et al., Chem. Sci. 2017, 8 (5), 3668-3675), which can generate 64 oligonucleotide length RNA, the sequence of which is derived from the ORF 1a of Covid-19. First, phosphorylate the linear padlock probe RCA-1a-p in a volume of 20 μL. Add 2 μL of 100 μM linear probe, 2 μL of 10×T4 polynucleotide kinase reaction buffer, 15.5 μL of DEPC-treated H2O and 0.5 μL of T4 polynucleotide kinase (10 U / μL). The ligation reaction consisted of 4 μL of phosphorylated padlock probe (100 nM), 4 μL of 10xT4 DNA ligase reaction buffer, 4 μL of Rp (SEQ ID NO: 17) target DNA solution (1 μM), 27.5 μL of DEPC-treated HO, and 0.5 μL of 5 U / μL T4 DNA ligase. Prior to the addition of T4 DNA ligase, the reaction mixture was heated at 55°C for 5 minutes, annealed at 39°C for 30 minutes, and cooled to room temperature. T4 DNA ligase was then added, and the ligation reaction was carried out at 30°C for 30 minutes. The ligation product was added to an RCA reaction mixture containing 5 μL of 10xphi29 DNA polymerase reaction buffer, 4 μL of dNTPs (10 mM each of dATP, dGTP, dCTP, and dTTP), 0.5 μL of DEPC-treated HO, and 0.5 μL of phi29 DNA polymerase (10 U / μL). The RCA reaction was performed at 37°C for 2 h and terminated by incubation at 65°C for 10 min. A negative control was performed without the addition of phi29 DNA polymerase.

[0142] Signal detection: 2.0 μL of negative control, 0.2, 0.5, and 2.0 μL volumes of ORF1a 64 nucleotides long RNA synthesized by rolling circle reaction were added to P3-1a (SEQ ID NO: 5) cross-linked probe microspheres, 1.0 μL of 1 μM concentration of RH3CF, and 15.0 μL of hybridization solution and mixed. Incubate at 45°C for 20 minutes. Pipette into a 96-well microplate and place in Luminex-200 for detection. The negative control and the signal S / N values ​​read by adding 0.2, 0.5, and 2.0 μL were 1.12, 4.81, 8.22, and 12.10, respectively. According to the standard curve for let7a in Example 4, the corresponding detected synthetic target RNA concentrations were -0.10, 0.26, 0.62, and 1.0 nM, respectively. The signal detected by the negative control is significantly different from that detected by different amounts of 1a RNA. This demonstrates that the technology of the present invention can detect not only miRNAs of 19-25 nucleotides in length, but also RNAs of other lengths. Based on the principles of molecular biology, as long as the probe DNA can hybridize with a specific sequence region of the target RNA to form a double-stranded complementary structure, it can be detected. Therefore, the technology of the present invention is universally applicable to the qualitative detection of RNAs of different lengths.

[0143] Example 11 Specificity of simultaneous detection of multiple miRNAs

[0144] The specificity of simultaneous detection of multiple miRNAs depends on the system's ability to discriminate base changes at one or several sites in RNAs with similar sequences (mismatch discrimination). miRNA let7a and let7b differ by two bases near their 3' ends ( Figure 10 A), the mismatch recognition ability was detected using probes P-let7a (SEQ ID NO: 1) and P-let7b (SEQ ID NO: 2) that are fully complementary to let7a and let7b, respectively.

[0145] 2.0 μL of 10 nM let7a (SEQ ID NO: 14), 2.0 μL of a mixture of P-let7a (SEQ ID NO: 1 cross-linked Luminex microspheres LC10001-01) and P-let7b (SEQ ID NO: 6 cross-linked Luminex microspheres LC10001-02), and 1.0 μL of 10 nM RH3CF were added to 15.0 μL of hybridization solution and mixed. The reaction was carried out at 42°C for 20 minutes, and then 80 μL of hybridization diluent was added. The plate was transferred to a 96-well microplate and the fluorescence signal was detected in a Luminex-200. The results of the five tests were statistically analyzed as follows. Figure 10As shown, the S / N ratio represents the detected fluorescence intensity. The P-let7b probe has two mismatched bases with the let7a sequence, located in the middle of the RNA near the 3' end. The detection signal is about 5-8% of the fully complementary P-let7a ( Figure 10 B). Thus, the multiplex detection system constructed by the present invention can detect similar RNA sequences such as let7a and let7b with high specificity.

[0146] Example 12: Single-tube simultaneous detection of two miRNAs, miR-141 and miR-155

[0147] Synthetic miRNAs m155 (SEQ ID NO: 15) and m141 (SEQ ID NO: 16) were each dissolved in TE to a final concentration of 10 μM and then mixed in a 1:1 ratio to dilute to 10 nM. A 2.0 μL volume of the m141 and m155 mixture, 2.0 μL of a mixed microsphere solution containing P-m141 (SEQ ID NO: 6 cross-linked Luminex microspheres LC10001-03) and P-m155 (SEQ ID NO: 7 cross-linked Luminex microspheres LC10001-03), P-m375 (SEQ ID NO: 8 cross-linked Luminex microspheres LC10001-03) and P-RNU6 (SEQ ID NO: 9 cross-linked Luminex microspheres LC10001-03), and 1.0 μL of 10 nM RH3CF were added to 15.0 μL of hybridization solution and mixed thoroughly. React at 42°C for 20 minutes, add 80 μL of hybridization diluent, transfer to a 96-well microplate, and place in Luminex-200 to detect the fluorescence signal. The results of 5 tests are statistically shown as follows: Figure 11 As shown, miR-141 and miR-155 generate specific signals at their corresponding probes, P-m141 and P-m155. Probes P-m375 and P-RNU6, which are not directly related to the target miRNA sequences, also show signals of 10-15%. This is due to the inevitable degree of cross-talk between multiplex probes, although this does not affect the results of the multiplex assay.

[0148] Example 13 Detection of miRNA miR-34a in blood

[0149] The advantage of PCR-free, single-tube simultaneous detection of multiple miRNAs is that it allows simultaneous detection of multiple target miRNA content information in a single reaction tube, avoiding factors such as PCR inhibitors and CG content in the RT-PCR amplification detection process, which can lead to deviations in ligation or labeling and ultimately false negative test results. The present invention uses the detection of miR-34a in blood as an example for comparison. Foreign research reports have shown that miR-34a levels in blood are low and undetectable, so miR-34a was added as an external reference (Optimization and Standardization of Circulating MicroRNA Detection for Clinical Application The miR-Test Case, Clinical Chemistry, 2016, 62, 743–754). In this example, 5 mL of venous blood was collected, left at room temperature for 2 hours, and centrifuged at 3500 g for 15 minutes to obtain serum. 200 μL of serum was extracted using a miRNA isolation kit (Cat. No. DP-501, Beijing Tiangen Biochemical) according to the manufacturer's instructions to obtain total miRNA. 2.0 μL of total miRNA, 2.0 μL of a mixture of three microspheres containing P-m141 (SEQ ID NO: 6 cross-linked Luminex microspheres LC10001-03), P-m155 (SEQ ID NO: 7 cross-linked Luminex microspheres LC10001-04), P-m375 (SEQ ID NO: 8 cross-linked Luminex microspheres LC10001-04) and P-m34a (SEQ ID NO: 10 cross-linked Luminex microspheres LC10001-07), and 1.0 μL of 10 nM concentration of RH3CF were added to 15.0 μL of hybridization solution and mixed evenly. The reaction was carried out at 42°C for 20 minutes, 80 μL of hybridization diluent was added, the plate was transferred to a 96-well microplate, and the fluorescence signal was detected in Luminex-200. The detection was repeated 5 times, and the results were as follows. Figure 12 As shown in Figure 2, miR-34a showed the highest concentration in this assay, approximately 10 nM, far exceeding miR-141 and miR-155, two other commonly used biomarker assays. This demonstrates that in multiplex biomarker detection, particularly for miRNAs, a single-tube assay without PCR amplification is more accurate for both qualitative and quantitative detection of multiple miRNAs. This example also demonstrates the technical contribution of the present invention.

[0150] Example 14 Single-tube simultaneous detection of multiple miRNAs in blood, urine, and saliva

[0151] Venous blood, saliva and urine were collected from the same healthy person. Serum miRNAs were isolated according to the steps in Example 4. 1 mL of PBS buffer was added to the saliva and blown evenly. 0.5 mL was added to an equal volume of Trizol and then shaken to mix. After the urine was centrifuged at 3500 g for 5 minutes, 0.5 mL was added to an equal volume of Trizol and then shaken to mix. Centrifuge at 12000 g for 1 minute, add 0.2 mL of chloroform to the supernatant and shake to mix, and let it stand for 2 minutes. Centrifuge at 12000 g for 15 minutes, collect the supernatant, add an equal volume of isopropanol, and let it stand at room temperature for 20 minutes. Centrifuge at 12000 g for 5 minutes, discard the supernatant, wash the precipitate twice with pre-cooled 75% ethanol, and add 50 μL of TE to dissolve the RNA.

[0152] 2.0 μL of RNA extracted from serum, saliva and urine, 2.0 μL of P-let7a (SEQ ID NO: 1 cross-linked Luminex microspheres LC10001-01), P-m141 (SEQ ID NO: 6 cross-linked Luminex microspheres LC10001-03), P-m155 (SEQ ID NO: 7 cross-linked Luminex microspheres LC10001-03), P-m375 (SEQ ID NO: 8 cross-linked Luminex microspheres LC10001-05), P-RNU6 (SEQ ID NO: 9 cross-linked Luminex microspheres LC10001-06), P-m16 (SEQ ID NO: 11 cross-linked Luminex microspheres LC10001-08) P-m151 (SEQ ID NO: 12 cross-linked Luminex microspheres LC10001-09), P-m145 (SEQ ID NO: 13 cross-linked Luminex microspheres LC10001-01), P-m375 (SEQ ID NO: 14 cross-linked Luminex microspheres LC10001-05), P-RNU6 (SEQ ID NO: 15 cross-linked Luminex microspheres LC10001-06), P-m16 (SEQ ID NO: 16 cross-linked Luminex microspheres LC10001-08), P-m151 (SEQ ID NO: 17 cross-linked Luminex microspheres LC10001-09), P-m145 (SEQ ID NO:13 Cross-linked Luminex Microspheres LC10001-10) A mixture of eight microspheres, 1.0 μL of 10 nM RH3CF, was added to 15.0 μL of hybridization solution and mixed evenly. The mixture was reacted at 42°C for 20 minutes. 80 μL of hybridization diluent was added and the mixture was transferred to a 96-well microplate. The fluorescence signal was detected in a Luminex-200. The detection was repeated 5 times. The results were as follows: Figure 13 As shown in Figure 2, the levels of miR-145 and miR-375 are relatively low, while the levels of miR-16 and let7a are relatively high. Figure 13 A), saliva ( Figure 13 B) and urine ( Figure 13 C) are rich in miRNAs that can be studied as disease-related markers.

[0153] The eight miRNA probes selected in the embodiment of the present invention were used to analyze common miRNAs in miRNA marker research, demonstrating the feasibility of simultaneously detecting multiple miRNAs in a single tube. Compared to the traditional Reverse Transcription PCR, which detects one miRNA at a time in each reaction tube, the PCR-free amplification of the present invention can detect eight miRNAs in one tube. Theoretically, as the number of probe types increases, a single-tube reaction on the Luminex instrument system can detect up to 500 miRNAs. The Luminex xMAP is equipped with 500 types of microspheres and has the function of detecting 500 different indicators at a time. The application of the present invention is also applicable to other instrument systems for multi-indicator detection.

[0154] This example analyzes miRNAs from various bodily fluid sources, enabling direct detection of miRNA in blood, urine, and saliva. This demonstrates that the technology of this invention can enable liquid biopsies from multiple liquid specimen sources. Analysis of miRNA markers in urine is more convenient and accurate for urinary system diseases and has been extensively studied. Detection of miRNA markers in saliva can be applied to the diagnosis and monitoring of diseases such as head and neck cancer.

[0155] Therefore, from Examples 13 and 14, this technology not only demonstrates the detection of multiple miRNA markers in a single tube, which has advantages over traditional RT-PCR in detection throughput and accuracy, but also can conveniently detect and analyze miRNA in blood, saliva and urine, providing a highly feasible solution for liquid biopsy of miRNA markers.

[0156] Example 15 Discovery of miRNA Marker Combinations and Lung Cancer Diagnosis

[0157] 1. Sample collection and sample data collation

[0158] The inventors of this application collected serum samples that met the standards using standard operating procedures (SOPs) and systematically collected complete demographic and clinical data. After sorting out the sample data, the inventors selected serum samples from 62 people for screening and validation of lung cancer miRNA markers. The detection technology utilizes fluorescent cross-linked RNase Hv-(Gly-Gly-Cys-AF 532 )3 (hereinafter referred to as RH3CF) to directly recognize RNA-DNA hybrid chains and convert them into detectable signals without the need for PCR amplification ( Figure 14 ).

[0159] 2. Screening and miRNA Marker Discovery Stage

[0160] Of the 62 serum samples collected during the screening and miRNA biomarker discovery phases, 32 were included in the lung cancer group and 30 in the control group. The lung cancer group was eligible for inclusion if the patient had a confirmed pathological diagnosis of newly diagnosed, untreated lung cancer and had not undergone surgery, chemoradiotherapy, or prior chemoradiotherapy. The 30 normal control group was eligible if the patient had no history of cancer and no significant abnormalities on CT screening. The lung cancer and normal control groups were gender and age matched. Of the 32 lung cancer samples collected during the discovery phase, 21 were adenocarcinomas, 6 were squamous cell carcinomas, 2 were small cell lung cancers, 2 were sarcomatoid carcinomas, and 1 was lymphoepithelioma-like carcinoma. According to the TNM staging system, 5 samples were stage T1, 12 were stage T2, 3 were stage T3, and 12 were stage T4. This covered a range of lung cancer cases from early to late stages. The sample included 20 males and 12 females. The mean age was 60.8 ± 11.0 years, with the oldest being 73 years and the youngest being 36 years.

[0161] The detection technology uses liquid chip single reaction tube to detect multiple miRNAs. Combined with literature research, 70 miRNAs were selected for detection. The specific process is as follows: Figure 14 All miRNA sequences disclosed in the present invention have been stored in the miRBase database (http: / / www.mirbase.org / ).

[0162] 1. Chip Preparation:

[0163] Seventy carboxylated polystyrene microspheres (catalog numbers LC10001-01 to LC10001-70, Luminex) were selected and covalently cross-linked with the probes according to the following method:

[0164] (1) Dissolve the probes in double-distilled water to a concentration of 100 μM.

[0165] (2) Microsphere washing: Take 50 μL (containing 6.0×10 5 Microspheres / mL) were pelleted by centrifugation at 10,000 g for 5 minutes, and the supernatant was discarded. 50 μL of 0.1 M MES, pH 4.5, was added, and the microspheres were suspended by vortexing for 15 seconds. The microspheres were pelleted by centrifugation at 10,000 g for 5 minutes, and the supernatant was discarded. The microspheres were resuspended in 50 μL of 0.1 M MES buffer, pH 4.5.

[0166] (3) Covalent cross-linking of probes and microspheres: Add 2.0 μL of 100 μM probe to the corresponding microsphere suspension from the previous step, mix well, and add 2.5 μL of 10 mg / mL EDC solution. Protect from light and incubate at 37°C for 30 minutes.

[0167] (4) Add another 2.5 μL of 10 mg / mL EDC solution. Protect from light and incubate at 37°C for 30 minutes.

[0168] (5) Centrifuge at 10,000 g for 5 minutes to precipitate the microspheres. Add 1.0 mL of 0.1% SDS to resuspend the microspheres, mix well with a shaker, and centrifuge at 10,000 g for 5 minutes to precipitate the microspheres.

[0169] (6) Discard the supernatant and resuspend the microspheres in 100 μL TE (pH 8.0).

[0170] (7) Mix the coded microspheres coated with different probes to obtain a liquid phase chip.

[0171] 2. Extraction of total serum RNA: Use miRNeasy Mini kit (Qiagen, 217184) to extract total serum RNA;

[0172] 3. Mix: Add 2.0 μL of total RNA from step 2, 2.0 μL of microsphere mixture, and 1.0 μL of 10 nM RH3CF to 15.0 μL of hybridization solution (500 mM NaCl, 0.05% Tween 20, 1 mM MgCl2, 50 mM Tris-HCl, pH 7.5). Vortex for 5 seconds. Repeat five times for each concentration of miRNA let7a standard.

[0173] 4. Liquid chip hybridization reaction: Place in a pre-set 42°C water bath for 20 minutes.

[0174] 5. Detection: Add 80 μL of hybridization diluent (100 mM NaCl, 0.05% Tween 20, 20 mM Tris-HCl, pH 7.5), transfer to a 96-well microplate, and place in Luminex-200 for detection.

[0175] 6. Data processing. According to the results of the chip, each miRNA value read is compared with the standard curve to obtain the concentration of each miRNA in each reaction well, which is the relative expression level of each miRNA in the serum. The miRNA standard curve is obtained by the following experiment: the synthetic miRNA is dissolved in TE solution to a final concentration of 10μM, and then diluted with TE solution to different concentrations of 50nM, 20nM, 10nM, 500pM, 200pM, 100pM, 50pM and 20pM, and then hybridized with the microspheres cross-linked with the probe corresponding to the miRNA. The method for detecting serum-extracted miRNA in this embodiment is adopted, and the serum miRNA is replaced by a serial dilution solution of different concentrations of synthetic miRNA, the fluorescence value is read, and the standard curve is drawn.

[0176] 7. Machine Learning and Data Analysis

[0177] The present invention uses a typical machine learning process to perform data analysis, modeling, and testing, and adopts the following typical process. A typical machine learning process first gives an input data, and the algorithm will obtain an estimated function through a series of processes. This function has the ability to give a new estimate for new data that has not been seen, which is also called building a model (see Figure 15 ).

[0178] Generally speaking, regression isn't used for classification problems because it's a continuous model and is susceptible to noise. However, logistic regression can be used for classification and multi-parameter problems. Logistic regression is essentially linear regression, but it adds a function mapping from features to results. This involves first linearly summing the features and then using the function g(z) to make the prediction. g(z) maps continuous values ​​to 0 and 1.

[0179] The assumption function of logistic regression is as follows, and the assumption function of linear regression is just θ T x.

[0180]

[0181]

[0182] Logistic regression is used to classify 0 / 1 problems, that is, binary classification problems where the predicted result belongs to 0 or 1. Here it is assumed that the binary value satisfies the Bernoulli distribution, that is:

[0183] P(y=1|x;θ)=h θ (x)

[0184] P(y=0|x;θ)=1-h θ (x)

[0185] Therefore, the logistic regression classification algorithm is to establish a regression formula for the data set for classification. The basic form of the regression classifier is to multiply each feature by a regression coefficient, and then add up all the resulting values. In this way, the result of the calculation will be a value of 0-1. Then, values ​​above 0.5 are classified into one category, and values ​​below 0.5 are classified into another category. In the present invention, the numerical value of each miRNA represents each feature. The corresponding coefficient of each miRNA is determined by calculating and modeling the miRNA data of two types of clinical samples (lung cancer group and non-lung cancer group) with known properties. The 20 identified miRNA biomarkers used to train logistic regression derive the following constant coefficient equation (β0, β1, β2, β3, β4, ... βn), and the LC from 0 to 1 is obtained. score Score (continuous). The logistic regression estimation function LC used in the present invention patent to screen and obtain miRNA markers that can effectively distinguish lung cancer and normal controls score as follows:

[0186]

[0187] Among them, y=β0+β1*C1+...βi*Ci...+βn*Cn

[0188] Using the principle of logistic regression, we screened out 20 miRNAs with characteristic expression levels from the initial 70 miRNAs by measuring the expression levels (concentrations) of the corresponding miRNAs in each of the 62 samples tested. The numbers and weighted values ​​of the 20 miRNAs are shown in Table 4 below:

[0189] Table 4 Numbering and weighted assignment of miRNAs

[0190]

[0191]

[0192] For example, when n is 2, the analysis module calculates the sum of the weighted values ​​and the product of the concentrations of miRNAs numbered 1 and 2, namely miR-191 and miR-454, to obtain LC score =0.5409+β1×C1+β2×C2=0.5409+0.3350×C miR-191 –0.4206×C miR-454 The left side of the operator × is the weighted value of each miRNA, and the right side is the concentration of the miRNA (nM).

[0193] When n is 4, the analysis module calculates the sum of the weighted values ​​of the four miRNAs numbered 1 to 4 and the product of their concentrations, and obtains LCscore =0.5409+β1×C1+β2×C2+β3×C3+β4×C4=0.5409+0.3350×C miR-191 –0.4206×C miR-454 –0.2034×C miR-1285 +0.3019×C miR-126 . and so on.

[0194] When analyzing 20 miRNAs, using the following formula, 30 controls and 32 lung cancers can be distinguished (screening stage in Table 5).

[0195] LC score =0.5409–0.1142×C miR-125b +0.3019×C miR-126 –0.2034×C miR-1285 +0.0666×C miR-141 +0.0821×C miR-155 –0.460×C miR-15b +0.1077×C miR-181a-2* +0.3350×C miR-191 +0.1581×C miR-193b +0.2011×C miR-19a +0.0459×C miR-200b –0.1861×C miR-203a -0.0656×C miR-206 +0.2339×C miR-21 –0.0582×C miR-365 –0.2875×C miR-375 –0.1120×C miR-429 –0.4206×C miR-454 +0.2970×C miR-486-5p +0.0706×C miR-574-5p .

[0196] As shown in Table 5, 30 of the 32 lung cancer samples were correctly classified using the formula. A true positive in the table indicates that the miRNA test result and the clinical pathology diagnosis of lung cancer are consistent. A true negative indicates that the test result and the clinical observation are negative. A false positive indicates that the miRNA test result is positive but the clinical observation is negative. A false negative indicates that the test result is negative but the clinical pathology results indicate lung cancer. Figure 16 The application interface of the lung cancer detection device constructed according to the above model is displayed.

[0197] Table 5 Detection performance of 20 miRNA combination markers in the discovery and validation stages

[0198] stage True positive True negative False positive False negative Specificity Sensitivity Total compliance rate filter 30 30 0 2 100.0% 93.8% 96.8% verify 149 69 46 20 60.0% 88.2% 76.8%

[0199] According to the correlation analysis, the combination of miR-126 and miR-454 had the highest correlation.

[0200] Because the initial 70 miRNAs were obtained from literature research, some individual miRNAs have been reported by multiple researchers to be associated with the diagnosis of benign and malignant lung nodules / early lung cancer. However, the detection technology platform for these miRNAs that have been fully studied and reported to be associated with lung cancer diagnosis is based on conventional miRNA ligation and PCR amplification, which has a significant detection system bias (Raabe et al., Nucleic Acids Res. 2014, 42(3):1414-1426). Therefore, only some of the changes in miRNAs are real changes. The present invention, based on previous literature and data analysis, does not require large-scale screening of thousands of miRNAs using clinical samples. Instead, it directly uses PCR-free amplification-free multiple miRNA detection technology to identify markers related to lung cancer diagnosis that are suitable for this detection system and identify statistically significant markers. This is a methodological innovation and progress in the search for disease diagnostic markers.

[0201] 3. Verification Phase

[0202] The validation phase involved a double-blind, controlled trial. Using the microsphere array prepared using the 20 miRNAs identified in the discovery phase (corresponding probe sequences are shown in Table 6), serum separation, detection, and data analysis methods were used to conduct double-blind testing on clinical samples to verify the accuracy of the 20 miRNAs screened for lung cancer. The double-blind testing process involved first determining whether a patient had lung cancer based on serum samples collected, and then comparing the results with clinical case data. A total of 169 patients were included in the lung cancer group and 115 in the control group.

[0203] Table 6 Probe sequences and modifications for lung cancer diagnosis

[0204]

[0205]

[0206] The specific steps to verify the accuracy of 20 miRNAs in lung cancer samples are as follows:

[0207] 1. Extraction of total serum RNA: Total serum RNA was extracted from 169 lung cancer patients and 115 controls.

[0208] 2. Mix: Add 2.0 μL of total RNA obtained in step 1, 2.0 μL of microsphere mixture, and 1.0 μL of 10 nM RH3CF to 15.0 μL of hybridization solution (500 mM NaCl, 0.05% Tween 20, 1 mM MgCl2, 50 mM Tris-HCl, pH 7.5) and mix thoroughly. Vortex for 5 seconds.

[0209] 4. Liquid chip hybridization reaction: Place in a pre-set 42°C water bath for 20 minutes.

[0210] 5. Detection: Add 80 μL of hybridization diluent (100 mM NaCl, 0.05% Tween 20, 20 mM Tris-HCl, pH 7.5), transfer to a 96-well microplate, and place in Luminex-200 for detection.

[0211] 6. Data processing and analysis: Based on the chip results, the concentration of each miRNA read and the PCA reading used as the background are calculated to calculate the concentration of the selected 20 miRNAs (in nM), which represents the relative expression of the 20 miRNAs in the serum. The above lung cancer diagnosis formula is used for calculation, and the calculated result LC score A value ≥0.5 indicates lung cancer, and a value <0.5 indicates healthy individuals. The test results are shown in Table 5 The validation statistical values ​​for miRNAs 1, 2, 4, 6, 8, 10, 12, 14, 16, and 18 were validated using the same method as above.

[0212] A panel of 20 miRNAs (hereafter referred to as 20-miRs) was used to determine lung cancer positivity in 62 samples from the discovery phase and 284 samples from the validation phase (a total of 346 samples across the two phases). The specificity, sensitivity, and overall concordance rates for CEA, NSE, CYF21-1, SCC, CA125, and CA199 for the corresponding 346 samples are shown in Table 7. Positive lung cancer samples were confirmed by postoperative pathology, and 22 of the 145 normal controls were confirmed to be benign by postoperative pathology.

[0213] Table 7 Performance comparison of miRNA markers and conventional markers corresponding to samples in the discovery and validation stages

[0214]

[0215] In Table 7, a true positive indicates that the test result is consistent with the clinical lung cancer result; a true negative indicates that the test result is consistent with the clinical observation of a negative result; a false positive indicates that the test result is positive but the clinical observation is negative; and a false negative indicates that the test result is negative but the clinical pathology results indicate lung cancer. The 284 samples collected during the validation phase included 169 lung cancer patients and 115 controls, with a mean age of 54.3.8 ± 11.8 years (age range, 72 years to 42 years). There were 138 males and 146 females. The lung cancer group was classified as 148 lung adenocarcinomas, 13 squamous cell carcinomas, 2 small cell lung cancers, 3 squamous cell carcinoma in situ, 2 small cell carcinomas, and 3 esophageal cancers.

[0216] Table 8 shows the detection accuracy for each stage of lung cancer according to the TNM staging system. These samples primarily represent early-stage lung cancer. Of the 284 samples used in the validation phase, 22 included samples with benign postoperative pathological findings. This indicates that compared with conventional blood markers such as CEA, the 20-miR combination significantly improves the sensitivity of early-stage lung cancer detection, reaching 84.1%. The overall TTN compliance rate for the 346 samples also reached 80.6%. This approach has significant potential for the timely detection of asymptomatic early-stage lung cancer.

[0217] Table 8 Accuracy of miRNA detection in lung cancer samples of TNM staging in the validation phase

[0218] Staging Positive test (number) Negative test results Accuracy / sensitivity T1 134 17 88.7% T2 8 2 80.0% T3 2 0 100.0% T4 6 1 85.7%

[0219] 4. Effects of different numbers of miRNA marker combinations on result judgment

[0220] The LC formula for judging whether lung cancer is positive based on 20-miR markers obtained by logistic regression score ,According to the weight (coefficient) of each miRNA in the formula, the results were re-analyzed using different numbers of miRNAs and compared with the actual clinical results.

[0221] As shown in Table 9, the single miRNA markers were miR-191 and miR-454, with two miRNAs added at a time. For example, the number of 4-miRNA markers (hereinafter referred to as 4-miRs) was obtained by adding miR-1285 and miR-126 to miR-191 and miR-454, and the number of 6-miRNA markers was obtained by adding miR-181a-2* and miR-203a to the number of 4 miRNAs, and finally, a total of 20 miRNAs. All 284 samples were reanalyzed with different combinations of miRNA markers, and the test results are shown in Table 9 below.

[0222] Table 9 Effects of different numbers of miRNA marker combinations on result judgment in the validation phase

[0223]

[0224]

[0225] As shown in Table 9, the 20-miR combination achieved the best specificity and overall concordance, reaching 69.6% and 77.1%, respectively. The 4-miR combination (miR-191 / 454 / 1285 / 126) achieved the highest sensitivity, reaching 91.1%. Even the overall concordance rate for a single miRNA (miR-454) in diagnosing lung cancer reached 57.4%, surpassing cytokine markers. The sensitivity of single to multiple miRNAs for diagnosing lung cancer ranged from 55.0% to 91.1%, significantly exceeding that of cytokine markers.

[0226] Sensitivity / specificity values ​​are as follows: Data from the domestic Kepao company's lung cancer early diagnosis kit show a sensitivity of 40%-60% and a specificity of 90%; the actual values ​​for the overseas Early CDT-Lung Cancer detection kit are 30%-40% and 80%-90%. The performance of the present invention, using double-blind testing during the performance verification phase, outperformed these two existing products. Therefore, in the diagnosis of early lung cancer using different tumor markers, miRNA markers not only have better sensitivity than cytokine markers, but are also more sensitive than markers that detect methylation in ctDNA derived from blood.

[0227] 5. Revalidation and prediction of test specificity

[0228] Early-stage lung cancer lacks obvious clinical symptoms. Theoretically, it cannot be ruled out that the control group included some patients with early-stage lung cancer and thus did not truly have lung cancer. Although these controls were largely screened with CT imaging and conventional tumor markers such as CEA, the sensitivity of CT and conventional tumor markers for early-stage lung cancer is low, ranging from 0.5% to 26.4% (see Table 7). Therefore, it is difficult to completely rule out that 100% of the 145 non-lung cancer controls enrolled were non-lung cancer. Although 22 of the control group had other lesions confirmed to be benign by postoperative pathology, this proportion only accounted for 22 / 145 (15.2%) of the total controls.

[0229] Therefore, the data calculation and analysis based on this degree of uncertainty will have an impact on the specificity results of the verification stage. To verify this conjecture, based on the fact that in this embodiment, the specificity is high in the screening stage but significantly decreased in the verification stage, whether it is a deviation caused by the difficulty in qualitative identification of normal controls, a population with a low risk of lung cancer was selected for retesting and verification. 42 volunteers aged 17-18 were selected, serum was collected, and the 20-miR detection results were used for analysis and judgment. Of the 42 volunteers in the younger age group, 40 were negative, with a specificity of 95.2%. Although the low-risk group for lung cancer selected this time differed greatly from the 346 screening and verification groups mentioned above in terms of age, and the rationality of the evaluation was insufficient, given that it is difficult to use non-lung cancer controls in the full sense in practice, the 42 test results of the younger age group can be partially used as supporting evidence. SEQUENCE LISTING <110> Shanghai MiRan Biotechnology Co., Ltd. <120> A fluorescent cross-linked RNase H mutant conjugate and its application <130> P20014308C <150> CN202010663579.5 <151> 2020-07-10 <150> CN202011058041.8 <151> 2020-09-30 <160> 37 <170> PatentIn version 3.5 <210> 1 <211> 28 <212> DNA <213> Artificial Sequence <220> <223> P3-let7a <220> <221> misc_feature <222> (28)..(28) <223> 3' NH2-C6 <400> 1 aactatacaacctactacctcatttttt 28 <210> 2 <211> 28 <212> DNA <213> Artificial Sequence <220> <223> P5-let7a <220> <221> misc_feature <222> (28)..(28) <223> 5' NH2-C6 <400> 2 ttttttaact atacaaccta ctacctca 28 <210> 3 <211> 28 <212> DNA <213> Artificial Sequence <220> <223> P3-LNA-let7a <220> <221> misc_feature <222> (28)..(28) <223> 3' NH2-C6 <400> 3 aactatacaa cctactacct catttttt 28 <210> 4 <211> 27 <212> DNA <213> Artificial Sequence <220> <223> P3-1a <220> <221> misc_feature <222> (27)..(27) <223> 3' NH2-C6 <400> 4 ggagtctcca aagccacgta ctttttt 27 <210> 5 <211> 28 <212> DNA <213> Artificial Sequence <220> <223> P-let7b <220> <221> misc_feature <222> (28)..(28) <223> 3' NH2-C6 <400> 5 aaccacacaa cctactacct catttttt 28 <210> 6 <211> 28 <212> DNA <213> Artificial Sequence <220> <223> P-m141 <220> <221> misc_feature <222> (28)..(28) <223> 3' NH2-C6 <400> 6 ccatctttac cagacagtgt tatttttt 28 <210> 7 <211> 29 <212> DNA <213> Artificial Sequence <220> <223> P-m155 <220> <221> misc_feature <222> (29)..(29) <223> 3' NH2-C6 <400> 7 acccctatca cgattagcat taatttttt 29 <210> 8 <211> 28 <212> DNA <213> Artificial Sequence <220> <223> P-m375 <220> <221> misc_feature <222> (28)..(28) <223> 3' NH2-C6 <400> 8 tcacgcgagc cgaacgaaca aatttttt 28 <210> 9 <211> 30 <212> DNA <213> Artificial Sequence <220> <223> P-RNU6 <220> <221> misc_feature <222> (30)..(30) <223> 3' NH2-C6 <400> 9 ccaattttag tatatgtgct gccgtttttt 30 <210> 10 <211> 28 <212> DNA <213> Artificial Sequence <220> <223> P-m34a <220> <221> misc_feature <222> (28)..(28) <223> 3' NH2-C6 <400> 10 acaaccagct aagacactgc catttttt 28 <210> 11 <211> 28 <212> DNA <213> Artificial Sequence <220> <223> P-m16 <220> <221> misc_feature <222> (28)..(28) <223> 3' NH2-C6 <400> 11 cgccaatatt tacgtgctgc tatttttt 28 <210> 12 <211> 27 <212> DNA <213> Artificial Sequence <220> <223> P-m151 <220> <221> misc_feature <222> (27)..(27) <223> 3' NH2-C6 <400> 12 cctcaaggag cttcagtcta gtttttt 27 <210> 13 <211> 29 <212> DNA <213> Artificial Sequence <220> <223> P-m145 <220> <221> misc_feature <222> (29)..(29) <223> 3' NH2-C6 <400> 13 agggattcct gggaaaactg gactttttt 29 <210> 14 <211> 22 <212> RNA <213> Artificial Sequence <220> <223> let-7a <400> 14 ugagguagua gguuguauag uu 22 <210> 15 <211> 23 <212> RNA <213> Artificial Sequence <220> <223> m155 <400> 15 uuaaugcuaa ucgugauagg ggu 23 <210> 16 <211> 22 <212> RNA <213> Artificial Sequence <220> <223> m141 <400> 16 uaacacuguc ugguaaagau gg 22 <210> 17 <211> 25 <212> DNA <213> Artificial Sequence <220> <223> Rp <400> 17 ggaagacaat cttcatctcc ttctg 25 <210> 18 <211> 149 <212> DNA <213> Artificial Sequence <220> <223> RCA-1a <400> 18 aagattgtgt tgggaaggat ggatggatgt ttaagatgtt gaggtgggtg tgataagagg 60 tggtggaggg agtgtggaaa gggaggtagg ttagtttttt tggatggatg gttgtaatag 120 gagtgagtat agggagagag aaggagatg 149 <210> 19 <211> 64 <212> RNA <213> Artificial Sequence <220> <223> 1a <400> 19 guacguggcu uuggagacuc cguggaggag gucuuaucag aggcacguca acaucuuaaa 60 gaug 64 <210> 20 <211> 155 <212> PRT <213> Artificial Sequence <220> <223> E48Q <400> 20 Met Leu Lys Gln Val Glu Ile Phe Thr Asp Gly Ser Cys Leu Gly Asn 1 5 10 15 Pro Gly Pro Gly Gly Tyr Gly Ala Ile Leu Arg Tyr Arg Gly Arg Glu 20 25 30 Lys Thr Phe Ser Ala Gly Tyr Thr Arg Thr Thr Asn Asn Arg Met Gln 35 40 45 Leu Met Ala Ala Ile Val Ala Leu Glu Ala Leu Lys Glu His Cys Glu 50 55 60 Val Ile Leu Ser Thr Asp Ser Gln Tyr Val Arg Gln Gly Ile Thr Gln 65 70 75 80 Trp Ile His Asn Trp Lys Lys Arg Gly Trp Lys Thr Ala Asp Lys Lys 85 90 95 Pro Val Lys Asn Val Asp Leu Trp Gln Arg Leu Asp Ala Ala Leu Gly 100 105 110 Gln His Gln Ile Lys Trp Glu Trp Val Lys Gly His Ala Gly His Pro 115 120 125 Glu Asn Glu Arg Cys Asp Glu Leu Ala Arg Ala Ala Ala Met Asn Pro 130 135 140 Thr Leu Glu Asp Thr Gly Tyr Gln Val Glu Val 145 150 155 <210> 21 <211> 29 <212> DNA <213> Artificial Sequence <220> <223> P-m574-5p <220> <221> misc_feature <222> (29)..(29) <223> 3' NH2-C6 <400> 21 acacactcac acacacacac tcatttttt 29 <210> 22 <211> 28 <212> DNA <213> Artificial Sequence <220> <223> P-m15b <220> <221> misc_feature <222> (28)..(28) <223> 3' NH2-C6 <400> 22 tgtaaaccat gatgtgctgc tatttttt 28 <210> 23 <211> 28 <212> DNA <213> Artificial Sequence <220> <223> P-m125b <220> <221> misc_feature <222> (28)..(28) <223> 3' NH2-C6 <400> 23 tcacaagtta gggtctcagg gatttttt 28 <210> 24 <211> 28 <212> DNA <213> Artificial Sequence <220> <223> P-m193b <220> <221> misc_feature <222> (28)..(28) <223> 3' NH2-C6 <400> 24 agcgggactt tgagggccag tttttttt 28 <210> 25 <211> 28 <212> DNA <213> Artificial Sequence <220> <223> P-m206 <220> <221> misc_feature <222> (28)..(28) <223> 3' NH2-C6 <400> 25 ccacacactt ccttacattc catttttt 28 <210> 26 <211> 28 <212> DNA <213> Artificial Sequence <220> <223> P-m486 <220> <221> misc_feature <222> (28)..(28) <223> 3' NH2-C6 <400> 26 ctcggggcag ctcagtacag gatttttt 28 <210> 27 <211> 28 <212> DNA <213> Artificial Sequence <220> <223> P-m429 <220> <221> misc_feature <222> (28)..(28) <223> 3' NH2-C6 <400> 27 acggttttac cagacagtat tatttttt 28 <210> 28 <211> 28 <212> DNA <213> Artificial Sequence <220> <223> P-m365 <220> <221> misc_feature <222> (28)..(28) <223> 3' NH2-C6 <400> 28 ataaggattt ttaggggcat tatttttt 28 <210> 29 <211> 31 <212> DNA <213> Artificial Sequence <220> <223> P-m203a <220> <221> misc_feature <222> (31)..(31) <223> 3' NH2-C6 <400> 29 aactgttgaa ctgttaagaa ccactttttt t 31 <210> 30 <211> 29 <212> DNA <213> Artificial Sequence <220> <223> P-m454 <220> <221> misc_feature <222> (29)..(29) <223> 3' NH2-C6 <400> 30 accctataag caatattgca ctatttttt 29 <210> 31 <211> 28 <212> DNA <213> Artificial Sequence <220> <223> P-m1285 <220> <221> misc_feature <222> (28)..(28) <223> 3' NH2-C6 <400> 31 aggtctcact ttgttgccca gatttttt 28 <210> 32 <211> 28 <212> DNA <213> Artificial Sequence <220> <223> P-m126 <220> <221> misc_feature <222> (28)..(28) <223> 3' NH2-C6 <400> 32 cgcattatta ctcacggtac gatttttt 28 <210> 33 <211> 28 <212> DNA <213> Artificial Sequence <220> <223> P-m21 <220> <221> misc_feature <222> (28)..(28) <223> 3' NH2-C6 <400> 33 tcaacatcag tctgataagc tatttttt 28 <210> 34 <211> 29 <212> DNA <213> Artificial Sequence <220> <223> P-m19a <220> <221> misc_feature <222> (29)..(29) <223> 3' NH2-C6 <400> 34 tcagttttgc atagatttgc acatttttt 29 <210> 35 <211> 28 <212> DNA <213> Artificial Sequence <220> <223> P-m200b <220> <221> misc_feature <222> (28)..(28) <223> 3' NH2-C6 <400> 35 tcatcattac caggcagtat tatttttt 28 <210> 36 <211> 28 <212> DNA <213> Artificial Sequence <220> <223> P-m181a-2* <220> <221> misc_feature <222> (28)..(28) <223> 3' NH2-C6 <400> 36 ggtacagtca acggtcagtg gttttttt 28 <210> 37 <211> 29 <212> DNA <213> Artificial Sequence <220> <223> P3-m191 <220> <221> misc_feature <222> (29)..(29) <223> 3' NH2-C6 <400> 37 cagctgcttt tgggattccg ttgtttttt 29

Claims

1. A fluorescent cross-linked RNase H mutant conjugate, characterized in that The RNase H mutant conjugates such as RNase Hv-(L x -SH-F) n As shown, RNase Hv is a mutant of RNase H that can bind to RNA or RNA-DNA hybrid chains but cannot cleave RNA; The SH is cysteine; the (L x -SH-F) n Connected to the C-terminus of RNase Hv, n is 3; The L x is Gly, Gly-Gly, Gly-Gly-Gly or Ala-Gly; The F is Alexa Fluor 555 or Alexa Fluor 532; the amino acid sequence of the RNase Hv is shown in SEQ ID NO:

20.

2. A method for preparing the RNase H mutant conjugate according to claim 1, wherein: When the RNase H mutant conjugate is RNase Hv-(L x -SH-F) n When, the method comprises: (a) expressing C-terminal (L x -SH) n RNase Hv was obtained to obtain RNase Hv-(L x -SH) n ; (b) Add excess F to prepare RNase Hv-(L x -SH-F) n .

3. The method according to claim 2, wherein The method comprises: (a) expressing C-terminal (L x -SH) n RNase Hv was obtained to obtain RNase Hv-(L x -SH) n ; (b) Add 2 to 10 times excess F to prepare RNase Hv-(L x -SH-F) n .

4. A kit for RNA detection, characterized in that: The kit comprises the RNaseH mutant conjugate according to claim 1.

5. The kit according to claim 4, wherein The kit also includes a DNA probe.

6. The kit according to claim 5, wherein The 5' end of the DNA probe is a free end, and / or the 3' end is an immobilized end.

7. The kit according to claim 6, wherein The 3' end of the DNA probe has an NH2-C6 modification.

8. The kit according to claim 7, wherein The 3' end of the DNA probe is fixed on a microsphere or a planar medium.

9. The kit according to any one of claims 5 to 8, wherein The nucleotide sequences of the DNA probes are shown in SEQ ID NOs: 1 to 13.

10. A method for RNA detection, characterized in that: It includes the following steps: (1) first hybridizing the DNA probe with the RNA, and then adding the RNase H mutant conjugate as claimed in claim 1; or, (2) Adding DNA probe, RNA and the RNase H mutant conjugate as described in claim 1 simultaneously, and detecting fluorescence.

11. The method according to claim 10, wherein The ratio of the DNA probe to the RNase H mutant conjugate is 2000-100000:

1.

12. The method according to claim 11, wherein The RNA detection is a single-tube detection or a multi-tube detection of multiple RNAs; the single-tube detection means detecting one or more RNAs in one reaction, and the multi-tube detection means detecting only one RNA in each reaction.

13. The method according to claim 12, wherein: The 5' end of the DNA probe is a free end, and / or the 3' end is an immobilized end; and / or the RNA is mRNA, non-coding RNA or miRNA, and the miRNA is mature miRNA or precursor miRNA.

14. The method according to claim 13, wherein The 3' end of the DNA probe has an NH2-C6 modification.

15. The method according to claim 14, wherein The 3' end of the DNA probe is fixed on a microsphere or a planar medium.

16. Use of the RNase H mutant conjugate according to claim 1 or the kit according to any one of claims 4 to 9 in preparing a reagent for analyzing and detecting RNA.

17. The use according to claim 16, characterized in that The RNA is mRNA, non-coding RNA or miRNA, and / or the agent is a diagnostic agent for detecting cancer.

18. The use according to claim 17, characterized in that The miRNA is a mature miRNA or a precursor miRNA.

Citation Information

Patent Citations

  • Multiplex detection of short nucleic acids

    CN111051531B

  • MiRNA combination, kit containing miRNA combination and application of miRNA combination in lung cancer diagnosis

    CN112501295A

  • Combination of fluorescent cross-linked RNase H mutant conjugate and miRNA and use thereof

    JP2023532378A