A green stink bug GRK gene, its dsRNA and its synthesis method and application

Abstract

The present invention discloses a green stink bug G protein coupled receptor kinase, the amino acid sequence of which is shown in SEQ ID NO: 2. The present invention also discloses a gene encoding the green stink bug G protein coupled receptor kinase, a method for obtaining the same, and an application thereof. The present invention also discloses a dsRNA of the green stink bug GRK gene and an application thereof. The dsRNA of the GRK gene synthesized by the present invention has a significant lethal effect on green stink bugs, effectively controls the population of green stink bugs, and provides a new approach for pest control. At the same time, by using Escherichia coli to synthesize dsRNA, the product can be synthesized on a large scale in a short time, which overcomes the disadvantage that the kit cannot synthesize dsRNA in large quantities. At the same time, the invention has low cost, a wide range of applications, is simple to operate, and can be reused without restrictions.

Description

Technical Field

[0001] The present invention relates to the technical field of agricultural pest control, and in particular to a green stink bug GRK gene, its dsRNA, and an efficient synthesis method and application of the dsRNA. Background Art

[0002] The green stink bug, Apolyguslucorum (Hemiptera: Miridae), belongs to the Miridae family of the order Hemiptera and is a significant pest of various crops, including cotton, vegetables, and fruit trees. In recent years, due to structural adjustments in my country's agricultural industry, the pest's infestation of various crops has intensified. Coupled with long-term reliance on chemical pesticides for control, the bug has developed increasing resistance, causing significant economic losses to Chinese agriculture. Currently, agricultural control of the green stink bug faces significant challenges, necessitating the development of new, non-toxic control methods that reduce the use of chemical pesticides.

[0003] RNA interference (RNAi) is a phenomenon in which exogenous double-stranded RNA (dsRNA) is used to silence the mRNA of a target gene. In 1998, the first report of silencing endogenous mRNA in the nematode Caenorhabditis elegans by injection of exogenous dsRNA was published, and RNAi quickly became a hot topic of research. Due to its high efficiency and specificity, RNAi has been widely used in insect gene function studies and has demonstrated significant potential for pest control. In studies of Hemiptera insects, injection of dsRNA targeting the cuticular protein gene CP19 has been shown to effectively control aphids.

[0004] G protein-coupled receptors (GPCRs) are a family of seven-transmembrane proteins that play a crucial role in regulating insect metamorphosis by transmitting 20-hydroxyecdysone (20E) signals. G protein-coupled receptor kinases (GRKs) are important membrane proteins that are phosphorylated by 20E. Phosphorylated GRKs bind to β-arrestins, leading to a desensitization reaction. This prevents G protein binding to GRKs, thus affecting normal insect development.

[0005] Therefore, designing dsRNA by obtaining the green stink bug's GRK gene and using RNAi technology to inhibit GRK gene expression, resulting in abnormal development and eventual death, may be a new method for controlling green stink bugs in the future. However, the main method for synthesizing dsRNA currently uses the T7 kit, which is expensive, has low synthesis yields, and cannot be produced on a large scale. Summary of the Invention

[0006] Purpose of the invention: The technical problem to be solved by the present invention is to provide a green stink bug G protein coupled receptor kinase.

[0007] The technical problem that the present invention also aims to solve is to provide a gene encoding the green stink bug G protein coupled receptor kinase and a method for obtaining the gene.

[0008] The technical problem that the present invention also aims to solve is to use Escherichia coli to synthesize the green stink bug GRK gene dsRNA in vivo, which has low cost and high efficiency and can achieve large-scale synthesis of target dsRNA.

[0009] The final technical problem to be solved by the present invention is to provide an application of the dsRNA in preventing and controlling green stink bugs.

[0010] Technical solution: In order to solve the above problems, the technical solution of the present invention is to provide a green stink bug G protein coupled receptor kinase, whose amino acid sequence is shown in SEQ ID NO: 2.

[0011] The nucleotide sequence of the gene encoding the green stink bug G protein coupled receptor kinase is shown in SEQ ID NO: 1.

[0012] The present invention also includes a method for obtaining the gene of the green stink bug G protein coupled receptor kinase, comprising the following steps:

[0013] 1) Design and synthesize upstream primer SEQ ID NO.3 and downstream primer SEQ ID NO.4;

[0014] 2) extracting total RNA from the green stink bug and reverse-transcribing it to obtain a cDNA template;

[0015] 3) Using the upstream and downstream primers synthesized in step 1) and the cDNA template obtained in step 2), the GRK gene sequence of the green stink bug is obtained by PCR reaction.

[0016] The present invention also includes dsRNA of the green stink bug GRK gene, the nucleotide sequence of which is shown in SEQ ID NO.5.

[0017] The present invention also includes a method for efficiently synthesizing dsRNA, comprising the following steps:

[0018] 1) PCR amplification of the target gene fragment: homologous sequences to the L4440 vector were added to both ends of the dsRNA nucleotide sequence of the green stink bug GRK gene, and upstream primers as shown in SEQ ID NO. 6 and downstream primers as shown in SEQ ID NO. 7 were designed and synthesized. PCR amplification was performed using the cDNA sequence of the GRK gene as a template to obtain a PCR product, which was then purified to obtain the target gene fragment;

[0019] 2) Construction of recombinant strain: The target gene fragment purified in step 1) is ligated with the linearized L4440 vector using a homologous recombinase to obtain a recombinant vector and express the recombinant strain;

[0020] 3) Inducing expression: Inducing expression of the recombinant strain obtained in step 2) to obtain bacterial cells;

[0021] 4) dsRNA extraction and purification: Extract total RNA from the bacteria, add RNase A and DNaes I to remove single-stranded RNA and genomic DNA to obtain PCR products; add an equal volume of phenol:chloroform:isoamyl alcohol solution, vortex, centrifuge, and collect the supernatant; add ethanol, mix thoroughly, let stand, centrifuge, and discard the supernatant; wash with ethanol, and collect the precipitate by centrifugation; after drying, dissolve in nuclease-free water to obtain purified dsRNA.

[0022] Wherein, the L4440 vector sequence is shown as SEQ ID NO.10.

[0023] Wherein, the induction culture medium in step 3) is LB liquid culture medium, and the bacterial liquid and the induction culture medium are inoculated at a ratio of 1:50 to 1:100.

[0024] Wherein, the final concentration of RNaseA in step 4) is 1-10 μg / mL, and the final concentration of DNaes I is 0.1-1 μg / μL.

[0025] The efficient synthesis method of dsRNA of the green stink bug GRK gene of the present invention specifically comprises the following steps:

[0026] a. PCR amplification of the target gene fragment: Using CE Design software, homologous sequences to L4440 were added to both ends of the dsRNA nucleotide sequence. An upstream primer (SEQ ID NO. 5) containing an Nhe I restriction site and a downstream primer (SEQ ID NO. 6) containing a Pst I restriction site were designed. ; Using the cDNA sequence of the GRK gene as a template, PCR amplification was performed to obtain the PCR product, which was then analyzed by 1% agarose gel electrophoresis; gel recovery and purification were performed using a DNA gel recovery kit to obtain the purified PCR product.

[0027] b. Vector linearization: Double-digest the L4440 vector with two restriction endonucleases to obtain a linearized L4440 vector; analyze by 1% agarose gel electrophoresis and purify by gel recovery using a DNA gel recovery kit to obtain the purified product.

[0028] c. Expression vector construction: Use homologous recombinase to connect the purified target gene fragment with the linearized L4440 vector; transform the recombinant ligation product into competent cells E. coli DH5α, spread it on a solid LB plate, and incubate it upright for 10 minutes and then invert it overnight at 37°C incubator for 12-14 hours; pick positive single colonies for bacterial liquid PCR detection and agarose gel electrophoresis analysis; sequence and analyze single colonies containing the target gene fragment to detect the accuracy of the recombinant vector sequence; inoculate the correctly identified single colony into LB liquid culture medium and incubate it at 37°C overnight for 24 hours; use a plasmid DNA extraction kit to extract the L4440 recombinant plasmid and detect it by agarose gel electrophoresis; transform the recombinant plasmid into the expression strain E. coli HT115, spread it on a plate, and incubate it overnight at 37°C incubator for 12-14 hours; pick positive single colonies for PCR detection and agarose gel running verification, and add 50% glycerol in a 1:1 ratio to preserve the strain.

[0029] d. Induce expression: inoculate the E. coli HT115 culture medium containing the expression vector at a ratio of 1:100 into LB liquid medium and culture in a shaker at 37°C and 200 rpm. 600 =0.6, add IPTG with a final concentration of 1 mM, and induce expression at 37°C for 4-5 h. After the culture is completed, remove the supernatant culture medium by centrifugation to obtain the induced bacterial precipitate, add 0.5 mg / mL lysozyme to the centrifuge tube containing the collected bacteria, and vortex to fully suspend the bacteria.

[0030] e. dsRNA extraction and purification: Total RNA from the bacteria was extracted using the Trizol method; RNase A and DNaes I were added at a final concentration of 1 μg / mL and reacted at 37°C for 30 min to remove single-stranded RNA and genomic DNA to obtain PCR products; an equal volume of phenol:chloroform:isoamyl alcohol (25:24:1) solution was added, the mixture was shaken for more than 100 s, and the supernatant was collected by centrifugation; 3 volumes of 95% ethanol were added to the supernatant, the mixture was thoroughly mixed, allowed to stand, and the supernatant was discarded by centrifugation; the mixture was washed twice with 75% ethanol and the precipitate was collected by centrifugation; after drying, the precipitate was dissolved in nuclease-free water to obtain purified dsRNA; the concentration was determined by agarose gel electrophoresis and spectrophotometry, and the mixture was stored at -80°C.

[0031] Wherein, the LB solid culture medium components described in step c are 10g / L sodium chloride, 10g / L peptone, 5g / L yeast extract, 12g / L agar powder and 10μg / mL ampicillin; the LB liquid culture medium components are 10g / L sodium chloride, 10g / L peptone, 5g / L yeast extract and 100μg / mL ampicillin.

[0032] Wherein, the LB liquid culture medium described in step d comprises 10 g / L sodium chloride, 10 g / L peptone, 5 g / L yeast extract, 100 μg / mL ampicillin and 12.5 μg / mL tetracycline.

[0033] The present invention also includes the use of the dsRNA of the green stink bug GRK gene in preventing and controlling the green stink bug.

[0034] The application is achieved by injecting dsRNA into the body of the green stink bug through a microinjector to inhibit the expression of the green stink bug's GRK gene, thereby affecting the growth and development of the green stink bug.

[0035] Beneficial Effects: Compared to existing technologies, the present invention has the following advantages: the dsRNA synthesized by the present invention against the green stink bug has a significant lethal effect, effectively controlling the green stink bug population and providing a new approach for pest control. Furthermore, the use of Escherichia coli to synthesize dsRNA allows for large-scale synthesis in a short period of time, overcoming the disadvantage of the kit's inability to synthesize large quantities of dsRNA. Furthermore, the invention is low-cost, widely applicable, simple to operate, and reusable without restrictions. BRIEF DESCRIPTION OF THE DRAWINGS

[0036] Figure 1 , using qPCR technology to detect the relative expression levels of GRK gene and internal reference gene β-actin;

[0037] Figure 2 ,After nymphs were injected with dsGRK, the nymphs showed deformities;

[0038] Figure 3 Compared with the control group (injected with ddH2O and dsGFP), the mortality rate of the green stink bug in the treatment group (injected with dsGRK) was significantly increased. DETAILED DESCRIPTION

[0039] The present invention will be further described below with reference to the accompanying drawings.

[0040] Example 1

[0041] The GRK gene sequence of the green stink bug was obtained through the following steps:

[0042] 1. Based on the transcriptome data of Alyssa lucorum, cloning primers were designed using Primer Premier 5.0 software. The primer sequences are as follows:

[0043] Upstream primer SEQ ID NO.3: ATGGCAGATTTGGAGGCTGT

[0044] Downstream primer SEQ ID NO.4: TCAGTTTCCATTGGTCGTTC

[0045] All primers were synthesized by Shanghai Sangon Biotechnology Co., Ltd.

[0046] 2. Use Trizol method to extract total RNA from green stink bug and reverse transcribe to obtain cDNA template:

[0047] Healthy, fourth-instar green stink bug nymphs were selected as samples, with five individuals forming a biological replicate. The samples were quickly frozen in liquid nitrogen. The insects were ground using an electric grinder, and total RNA was extracted using TRIzol Reagent (TIANGEN, Beijing). First-strand cDNA was synthesized using the HiScript III RT SuperMix reverse transcription kit (Vazyme, Nanjing) and used as a template for PCR reactions.

[0048] 3. Obtain the GRK gene sequence of the green stink bug by RCR reaction:

[0049] Using the upstream and downstream primers synthesized in step 1 and the cDNA template obtained in step 2, the GRK gene sequence of the green stink bug was obtained by PCR reaction. The reaction system is as follows:

[0050]

[0051] The PCR reaction conditions were as follows: 94°C for 30 s; 98°C for 10 s, 65°C for 30 s, 72°C for 1 min, 35 cycles; 72°C for 2 min.

[0052] The PCR product was analyzed by 1% agarose gel electrophoresis, excised and recovered, and purified using a DNA gel recovery kit to obtain the purified PCR product. The product was then ligated into a T / A blunt vector (Vazyme, Nanjing), transformed into competent E. coli DH5α cells, and plated on LB solid plates. The plates were incubated upright for 10 minutes and then inverted overnight for 12 to 14 hours in a 37°C incubator. Positive single colonies were picked for bacterial solution PCR detection and agarose gel electrophoresis analysis. The verified bacterial solution was sent to Jie Li (Shanghai) Biotechnology Co., Ltd. for sequencing.

[0053] The nucleotide sequence of the green stink bug GRK gene obtained by sequencing is shown in SEQ ID NO.1.

[0054] 4. Amino acid sequence analysis of the GRK gene of Alyssa lucorum:

[0055] The GRK gene obtained by sequencing was translated using ExPASy online software and predicted to encode 701 amino acids, with a molecular weight of 80.241 kD and an isoelectric point of 6.56. SMART online predictions indicate that the GRK2 protein contains four domains: a G protein signaling regulatory region, a serine / threonine kinase domain, a serine / threonine protein kinase extension, and a PH domain. The amino acid sequence encoding GRK is shown in SED ID No. 2.

[0056] Example 2 Efficient Synthesis of dsRNA of the Green Lycopodidae GRK Gene

[0057] A section of the nucleotide sequence of the green stink bug GRK gene was selected as the preparation of dsRNA, and the nucleotide sequence thereof is shown in SEQ ID NO.5.

[0058] 1. Design of dsRNA primers for the GRK gene of the green stink bug

[0059] Using CEDesign software, homologous sequences to L4440 were added to both ends of the target gene fragment. PCR amplification primers were designed. The upstream primer contained a PstⅠ restriction site, and the downstream primer contained an NheⅠ restriction site. The sequences are as follows:

[0060] Upstream primer GRK-dsRNA-F: SEQ ID NO.6

[0061] tccaccggttccatg gctagc GGTTTGGAGAAGTTTACGGCTG

[0062] Downstream primer GRK-dsRNA-F: SEQ ID NO.7

[0063] cttgatatcgaattc ctgcag ATGAGAAGGAGTCGGGAAGCTC

[0064] Lowercase letters represent homologous sequences to those in the L4440 vector, and the underlined parts represent restriction sites. All primers were synthesized by Shanghai Sangon Biotechnology Co., Ltd.

[0065] 2. PCR amplification of target fragments

[0066] The cDNA sequence of the GRK gene was used as a template for PCR amplification to obtain the PCR product.

[0067] The PCR reaction system is:

[0068]

[0069] The PCR reaction conditions were as follows: 94°C for 30 s; 98°C for 10 s, 65°C for 30 s, 72°C for 1 min, 35 cycles; 72°C for 2 min.

[0070] The PCR product was analyzed by 1% agarose gel electrophoresis, the gel was cut and recovered, and purified using a DNA gel recovery kit to obtain the purified PCR product.

[0071] 3. Linearization of L4440 vector:

[0072] The L4440 vector was double-digested with two restriction endonucleases, PstⅠ and NheⅠ, to obtain the linearized L4440 vector.

[0073] The PCR reaction system is:

[0074]

[0075] The PCR reaction conditions were: reaction at 37°C for 30 min.

[0076] The PCR product was analyzed by 1% agarose gel electrophoresis, excised and recovered, and purified using a DNA gel recovery kit to obtain the purified L4440 linearized vector. The sequence of the L4440 vector is shown in SEQ ID NO.10.

[0077] 4. Expression vector construction:

[0078] The purified target gene fragment was ligated with the linearized L4440 vector using homologous recombinase; the recombinant ligation product was transformed into competent cells E. coli DH5α, spread on LB solid plates, and cultured in a 37°C incubator, first upright for 10 minutes and then inverted overnight for 12-14 hours; positive single colonies were picked for bacterial liquid PCR detection and agarose gel electrophoresis analysis; single colonies containing the target gene fragment were sequenced and analyzed to detect the accuracy of the recombinant vector sequence; the correctly identified single colony was inoculated into LB liquid culture medium and incubated at 37°C overnight for 24 hours; the L4440 recombinant plasmid was extracted using a plasmid DNA extraction kit and detected by agarose gel electrophoresis; the recombinant plasmid was transformed into the expression strain E. coli HT115 (DE3) (WEIDI, Shanghai), spread on plates, and cultured in a 37°C incubator overnight for 12-14 hours; positive single colonies were picked for PCR detection and agarose gel running verification, and 50% glycerol was added in equal proportions to preserve the strain.

[0079] The components of LB solid culture medium are 10 g / L sodium chloride, 10 g / L peptone, 5 g / L yeast extract, 12 g / L agar powder and 10 μg / mL ampicillin; the components of LB liquid culture medium are 10 g / L sodium chloride, 10 g / L peptone, 5 g / L yeast extract and 100 μg / mL ampicillin.

[0080] 5. Induced expression:

[0081] The E. coli HT115 bacterial solution containing the expression vector was inoculated into LB liquid medium at a ratio of 1:100 and cultured in a shaking incubator at 37°C and 200 rpm. 600 =0.6, add IPTG with a final concentration of 1 mM, and induce expression at 37°C for 4-5 h. After the culture is completed, remove the supernatant culture medium by centrifugation to obtain the induced bacterial precipitate, add 0.5 mg / mL lysozyme to the centrifuge tube containing the collected bacteria, and vortex to fully suspend the bacteria.

[0082] The LB liquid culture medium contains 10 g / L sodium chloride, 10 g / L peptone, 5 g / L yeast extract, 100 μg / mL ampicillin, and 12.5 μg / mL tetracycline.

[0083] 6. Extraction and purification of dsRNA:

[0084] Total RNA of the bacteria was extracted using Trizol. RNase A and DNase I were added at a final concentration of 1 μg / mL and 0.1 μg / μL, respectively, and the mixture was reacted at 37°C for 30 min to remove single-stranded RNA and genomic DNA to obtain a PCR product. An equal volume of phenol:chloroform:isoamyl alcohol (25:24:1) solution was added, the mixture was shaken for more than 100 s, and the supernatant was collected by centrifugation. Three volumes of 95% ethanol were added to the supernatant, the mixture was thoroughly mixed, allowed to stand, and the supernatant was discarded by centrifugation. The mixture was washed twice with 75% ethanol, and the precipitate was collected by centrifugation. After drying, the precipitate was dissolved in nuclease-free water to obtain the purified dsGRK, which was detected by agarose gel electrophoresis and the concentration was determined by spectrophotometry, and stored at -80°C.

[0085] Example 3 Lethal effect of dsRNA of the green stink bug GRK gene

[0086] 1. Injection of dsRNA

[0087] Thirty healthy, third-instar green stink bug nymphs of the same age were selected and injected with 500 ng of dsGRK into the basal fossa of the thoracic legs by microinjection. Three biological replicates were set up as the treatment group. The same nymphs were injected with 500 ng of dsGFP and the same nymphs were left untreated, and three biological replicates were set up as the control group.

[0088] 2. Detection of silencing of the GRK gene in the green stink bug

[0089] The relative expression levels of GRK gene and internal reference gene β-actin were detected by qPCR technology. -ΔΔCtSilencing of the green stink bug GRK gene was detected using a 20 μL reaction system: 10 μL SYBR Green Master Mix (YEASEN, Shanghai), 0.4 μL each of upstream and downstream primers (10 pmol / L), 2 μL cDNA template, and 7.2 μL RNase-free H2O. The reaction procedure was as follows: 95°C for 5 min; 40 cycles of 95°C for 10 s, 60°C for 40 s, and 95°C for 15 s to generate a melting curve. Three biological replicates and three technical replicates were performed for each sample. The primer sequences are as follows:

[0090] Upstream primer GRK-qPCR-F: SEQ ID NO.8

[0091] tccaccggttccat ggctagc GGTTTGGAGAAGTTTACGGCTG

[0092] Downstream primer GRK-qPCR-F: SEQ ID NO.9

[0093] cttgatatcgaattc ctgcag ATGAGAAGGAGTCGGGAAGCTC

[0094] Figure 1 The results showed that the expression level of the GRK gene in the treatment group (injection of dsGRK) was significantly reduced compared with the control group (injection of ddH2O, dsGFP). The results showed that the injection of dsRNA of the GRK gene had a significant silencing effect on the gene.

[0095] 3. Effects of dsRNA injection on the growth and development of Alyssa lucoides nymphs

[0096] After the nymphs in the treatment group were injected with dsGRK, they became deformed and could not grow and develop normally. Figure 2 shown. Figure 3 The results showed that the mortality rate of green stink bugs in the treatment group (injected with dsGRK) was significantly increased to over 50% compared with the control group (injected with ddH2O and dsGFP). The results showed that the GRK gene plays an important role in the growth and development of green stink bugs. Sequence Listing <110> Jiangsu Academy of Agricultural Sciences <120> A green stink bug GRK gene, its dsRNA and its synthesis method and application <160> 10 <170> SIPOSequenceListing 1.0 <210> 1 <211> 2106 <212> DNA <213> Small-scale GRK mushroom (Apolygus lucorum) <400> 1 atggcagatt tggaggctgt gctggcggat gtcagctacc ttatggccat ggagaagtca aaatgcactc cagcggccag agccagcag aaaatcgtac ttccggaccc aagtgtcagg agcgtgatgc acaatacct cgaaagaag aacgaagtga atttcgataa aatattcaac caagttctgg gattccttct cttcaaggac tactgcgaga acgtgtccga agaacccgtt cctcaactga aattctacga aggregate aggregate aactcgacaa tccggaggac aggaggagt cggctcgcca aatctacgac aagtttatca tgaaggagct tctcgcccac gcacacga accctcgaga cgccgtcgca catgtacaga aatatctcat gaaaaacgaa gttccagtta atcttttcga gccttacatt caagaaatat tcaatcactt gcgaggagaa ccatttaga aatttttaga aagtgataa tacacgcgtt tttgccaatg gaaaaattta 600. ttcagcgtcc atcggatcat cgggcgcgga gggtttggag aagtttacgg ctgccggaag gccgacactg gcaaaatgta cgccatgaaa 660. tgcctcgata agaagaggat caagatgaag caggggaa cgctggcact caacgaaagg atcatgcttt ctctagtcag tacgggggtg gactgtccgt tcatagtttg tatgacttac 780 gccttccaca cgccagaca gctatgcttc atcctcgatc ttatgaatgg aggagacctt 840 cactatcacc tcagccagca cggagtcttc aatgagatcg aaatgaagtt ttacgccgct gaagtgattc ttgggctgga acacatgcac agcggtaca tcgtgtatcg agacctcaag cctgccaaca tcctcctaga cgagcatgga cacgtcagga tatccgacct tgggctcgcc tgtgatttct ccaagaaga acctcatgcc agcgttggta ctcacggcta catggcgcct gaggtcttga gcaagggcac tgcctacgat tccagcgccg actggttctc ctttgggtgc 1140 atgctctaca agcttctcaa ggggcactcg cctttcaggc aacataaaac cagagacaaa cacgaattg accgaatgac cctcacaatg aatgtcgagc ttcccgactc cttctcatcg 1320. acctcctaga acctcctaga accgcttctc atgagggaca tcgacaagag gctgggctgc tgtggaaaag gctctgacga agtgaagga caccctttct tcgagggtct agattggcag 1440 gctgatgcct ttgatattgg ttcgttcgac gaagagata ccaaagggat taagttgacc 1500 gacgcggacc aggatctcta caagaacttc cctctggtca tttctgagag gtggcagagc 1560 gaagtggcgg aaacagtatt cgaaaccatc aaccaagaag ctgaccgaac ggagcagaaa 1620 cggaaagcta agcagaaaca gcgatttgac tgtgatgaaa aagagtcgga ttgcattctt 1680 cacgggtata ttaagaagct gggtggaccg tttgcgtcag cttggcagac tcgctacgca 1740 aagttgtacc ccaaccgtct cgagctgcac cccgagtccg gctcaaccaa acctgatttg 1800 gttttcatgg atcaggttcga agaagttcct caggatcttg tcactgtgaa gggtgagcag 1860 tgcataaaca tcaaaacccg agatgccaaa atcgtcttaa ccaattccga tgacattggt 1920 ctgaaagagt ggctccagtc cctgcgatcg actcataaaa actccctaga actgctcggt 1980 aacatggcca agaaagcagg taagatctac gggacgacag agggcggagg cggcggtggc 2040 ggagggctga acaagggcgc acccgaacga gtcatcgccg ctccccgaac gaccaatgga 2100 aactga 2106 <210> 2 <211> 701 <212> PRT <213> Green plant bug GRK (Apolygus lucorum) <400> 2 Met Ala Asp Leu Glu Ala Val Leu Ala Asp Val Ser Tyr Leu Met Ala 1 5 10 15 Met Glu Lys Ser Lys Cys Thr Pro Ala Ala Arg Ala Ser Lys Lys Ile 20 25 30 Val Leu Pro Asp Pro Ser Val Arg Ser Val Met His Lys Tyr Leu Glu 35 40 45<00002?1>Lys Lys Asn Glu Val Asn Phe Asp Lys Ile Phe Asn Gln Val Leu Gly 50 55 60 Phe Leu Leu Phe Lys Asp Tyr Cys Glu Asn Val Ser Glu Glu Pro Val 65 70 75 80 [[ID=?2]]Pro Gln Leu Lys Phe Tyr Glu Glu Ile Lys Glu Tyr Glu Lys Leu Asp 85 90 95 Asn Pro Glu Asp Arg Arg Lys Ser Ala Arg Gln Ile Tyr Asp Lys Phe 100 105 110 Ile Met Lys Glu Leu Leu Ala His Ala His Glu Tyr Pro Arg Asp Ala 115 120 125 [ Val Ala His Val Gln Lys Tyr Leu Met Lys Asn Glu Val Pro Val Asn It should be noted that there seems to be an error in the original text where is misspelled as <00002?1> and <32> is misspelled as <?2> in the provided translation task. This has been left as is to maintain consistency with the original text for translation purposes. 130 135 140 Leu Phe Glu Pro Tyr Ile Gln Glu Ile Phe Asn His Leu Arg Gly Glu 145 150 155 160 Pro Phe Arg Lys Phe Leu Glu Ser Asp Lys Tyr Thr Arg Phe Cys Gln 165 170 175 Trp Lys Asn Leu Glu Leu Asn Ile Gln Leu Thr Met Asn Asp Phe Ser 180 185 190 Val His Arg Ile Ile Gly Arg Gly Gly Phe Gly Glu Val Tyr Gly Cys 195 200 205 Arg Lys Ala Asp Thr Gly Lys Met Tyr Ala Met Lys Cys Leu Asp Lys 210 215 220 Lys Arg Ile Lys Met Lys Gln Gly Glu Thr Leu Ala Leu Asn Glu Arg 225 230 235 240 Ile Met Leu Ser Leu Val Ser Thr Gly Val Asp Cys Pro Phe Ile Val 245 250 255 Cys Met Thr Tyr Ala Phe His Thr Pro Asp Lys Leu Cys Phe Ile Leu 260 265 270 Asp Leu Met Asn Gly Gly Asp Leu His Tyr His Leu Ser Gln His Gly 275 280 285 Val Phe Asn Glu Ile Glu Met Lys Phe Tyr Ala Ala Glu Val Ile Leu 290 295 300 Gly Leu Glu His Met His Arg Arg Tyr Ile Val Tyr Arg Asp Leu Lys 305 310 315 320 Pro Ala Asn Ile Leu Leu Asp Glu His Gly His Val Arg Ile Ser Asp 325 330 335 Leu Gly Leu Ala Cys Asp Phe Ser Lys Lys Lys Pro His Ala Ser Val 340 345 350 Gly Thr His Gly Tyr Met Ala Pro Glu Val Leu Ser Lys Gly Thr Ala 355 360 365 Tyr Asp Ser Ser Ala Asp Trp Phe Ser Phe Gly Cys Met Leu Tyr Lys 370 375 380 Leu Leu Lys Gly His Ser Pro Phe Arg Gln His Lys Thr Lys Asp Lys 385 390 395 400 His Glu Ile Asp Arg Met Thr Leu Thr Met Asn Val Glu Leu Pro Asp 405 410 415 Ser Phe Ser Ser Glu Leu Arg Asp Leu Leu Glu Arg Leu Leu Met Arg 420 425 430 Asp Ile Asp Lys Arg Leu Gly Cys Cys Gly Lys Gly Ser Asp Glu Val 435 440 445 Lys Glu His Pro Phe Phe Glu Gly Leu Asp Trp Gln Gln Val Tyr Val 450 455 460 Gln Lys Tyr Pro Pro Pro Leu Ile Pro Pro Arg Gly Glu Val Asn Ala 465 470 475 480 Ala Asp Ala Phe Asp Ile Gly Ser Phe Asp Glu Glu Asp Thr Lys Gly 485 490 495 Ile Lys Leu Thr Asp Ala Asp Gln Asp Leu Tyr Lys Asn Phe Pro Leu 500 505 510 Val Ile Ser Glu Arg Trp Gln Ser Glu Val Ala Glu Thr Val Phe Glu 515 520 525 Thr Ile Asn Gln Glu Ala Asp Arg Thr Glu Gln Lys Arg Lys Ala Lys 530 535 540 Gln Lys Gln Arg Phe Asp Cys Asp Glu Lys Glu Ser Asp Cys Ile Leu 545 550 555 560 His Gly Tyr Ile Lys Lys Leu Gly Gly Pro Phe Ala Ser Ala Trp Gln 565 570 575 Thr Arg Tyr Ala Lys Leu Tyr Pro Asn Arg Leu Glu Leu His Pro Glu 580 585 590 Ser Gly Ser Thr Lys Pro Asp Leu Val Phe Met Asp Gln Val Glu Glu 595 600 605 Val Pro Gln Asp Leu Val Thr Val Lys Gly Glu Gln Cys Ile Asn Ile 610 615 620 Lys Thr Arg Asp Ala Lys Ile Val Leu Thr Asn Ser Asp Asp Ile Gly 625 630 635 640 Leu Lys Glu Trp Leu Gln Ser Leu Arg Ser Thr His Lys Asn Ser Leu 645 650 655 Glu Leu Leu Gly Asn Met Ala Lys Lys Ala Gly Lys Ile Tyr Gly Thr 660 665 670 Thr Glu Gly Gly Gly Gly Gly Gly Gly Gly Leu Asn Lys Gly Ala Pro 675 680 685 Glu Arg Val Ile Ala Ala Pro Arg Thr Thr Asn Gly Asn 690 695 700 <210> 3 <211> 20 <212> DNA <213> Artificial Sequence <400> 3 atggcagatt tggaggctgt 20 <210> 4 <211> 20 <212> DNA <213> Artificial Sequence <400> 4 tcagtttcca ttggtcgttc 20 <210> 5 <211> 657 <212> DNA <213> dsRNA (Artificial Sequence) of the GRK gene of Apolygus lucorum <400> 5 ggtttggaga agtttacggc tgccggaagg ccgacactgg caaaatgtac gccatgaaat 60 gcctcgataa gaagaggatc aagatgaagc agggggaaac gctggcactc aacgaaagga 120 tcatgctttc tctagtcagt acgggggtgg actgtccgtt catagtttgt atgacttacg 180 ccttccacac gccagacaag ctatgcttca tcctcgatct tatgaatgga ggagaccttc 240 actatcacct cagccagcac ggagtcttca atgagatcga aatgaagttt tacgccgctg 300 aagtgattct tgggctggaa cacatgcaca gacggtacat cgtgtatcga gacctcaagc 360 ctgccaacat cctcctagac gagcatggac acgtcaggat atccgacctt gggctcgcct 420 gtgatttctc caagaagaaa cctcatgcca gcgttggtac tcacggctac atggcgcctg 480 aggtcttgag caagggcact gcctacgatt ccagcgccga ctggttctcc tttgggtgca 540 tgctctacaa gcttctcaag gggcactcgc ctttcaggca acataaaacc agagacaaac 600 acgaaattga ccgaatgacc ctcacaatga atgtcgagct tcccgactcc ttctcat 657 <210> 6 <211> 43 <212> DNA <213> Artificial Sequence <400> 6 tccaccggtt ccatggctag cggtttggag aagtttacgg ctg 43 <210> 7 <211> 43 <212> DNA <213> Artificial Sequence <400> 7 cttgatatcg aattcctgca gatgagaagg agtcgggaag ctc 43 <210> 8 <211> 20 <212> DNA <213> Artificial Sequence <400> 8 ggaggtacca ccatgtaccc 20 <210> 9 <211> 20 <212> DNA <213> Artificial Sequence <400> 9 atggagccac cgatccatac 20 <210> 10 <211> 2790 <212> DNA <213> Artificial Sequence <400> 10 gtgctacaga gttcttgaag tggtggccta actacggcta cactagaaga acagtatttg 60 gtatctgcgc tctgctgaag ccagttacct tcggaaaaag agttggtagc tcttgatccg 120 gcaaacaaac caccgctggt agcggtggtt tttttgtttg caagcagcag attacgcgca 180 gaaaaaaagg atctcaagaa gatcctttga tcttttctac ggggtctgac gctcagtgga 240 acgaaaactc acgttaaggg attttggtca tgagattatc aaaaaggatc ttcacctaga 300 tccttttaaa ttaaaaatga agttttaaat caatctaaag tatatatgag taaacttggt 360 ctgacagtta ccaatgctta atcagtgagg cacctatctc agcgatctgt ctatttcgtt 420 catccatagt tgcctgactc cccgtcgtgt agataactac gatacgggag ggcttaccat 480 ctggccccag tgctgcaatg ataccgcgag acccacgctc accggctcca gatttatcag 540 caataaacca gccagccgga agggccgagc gcagaagtgg tcctgcaact ttatccgcct 600 ccatccagtc tattaattgt tgccgggaag ctagagtaag tagttcgcca gttaatagtt 660 tgcgcaacgt tgttgccatt gctacaggca tcgtggtgtc acgctcgtcg tttggtatgg 720 cttcattcag ctccggttcc caacgatcaa ggcgagttac atgatcccccc atgttgtgca 780 aaaaagcggt tagctccttc ggtcctccga tcgttgtcag aagtaagttg gccgcagtgt 840 tatcactcat ggttatggca gcactgcata attctcttac tgtcatgcca tccgtaagat 900 gctttctctgt gactggtgag tactcaacca agtcattctg agaatagtgt atgcggcgac 960 cgagttgctc ttgcccggcg tcaatacggg ataataccgc gccacatagc agaactttaa 1020 aagtgctcat cattggaaa cgttcttcgg ggcgaaact ctcaggatc ttaccgctgt 1080 tgagatccag ttcgatgtaa cccactcgtg cacccactg atcttcagca tctttactt 1140 tcaccagcgt tctgggtga gcaaaacag gaggcaaa tgccgcaaa aagggaataa 1200 gggcgacacg gaatgttga attackcatac tcttcctttt tcaatattat tgaagcattt 1260 atcagggtta ttgtctcatg agcggataca tatttgaatg tattgaaa aaaaacaa 1320 taggggttcc gcgcacattt cccgaaag tgccacctaa attgtaagcg ttaatatttt 1380 gttaaaattc gcgttaaattt ttgttaaat cagctcattt ttaccaat aggccgaaat 1440 cggcaaaatc ccttataaat caaagaata gaccgagata gggttgagtg ttgttccagt 1500 ttggaacaag agtccactat tgaagaacgt ggactccac gtcaaagggc gaaaaaccgt 1560 ctatcagggc gatggcccac tacgtgaacc atcaccctaa tcaagttttt tggggtcgag 1620 gtgccgtaaa gcactaaatc ggaaccctaa aggagcccc cgatttagag cttgacgggg 1680 aaagccggcg aacgtggcga gaaggaagg gagaaagcg aaggagcgg gcgctagggc 1740 gctggcaagt gtagcggtca cgctgcgcgt aaccaccaca cccgccgcgc ttaatgcgcc 1800 gctacagggc gcgtcccatt cgccattcag gctccgcaac tgttgggaag ggcgatcggt 1860 gcgggcctct tcgctattac gccagctggc gaaagggga tgtgctgcaa ggcgattaag 1920 ttgggttaacg ccagggtttt cccagtcacg acgttgtaaa acgacggcca gtgagcgcgc 1980 gtaatacgac tcactatagg gcgaattggg taccgggccc cccctcgagg tcgacggtat 2040 cgataagctt gatatcgaat tcctgcagcc cggggatcc acgcgtcacg tggctagcca 2100 tggaaccggt ggatccacta gttctagagc ggccgccacc gcggtggagc tcgaattcat 2160 cgatgatatc agatctgccg gtctccctat agtgagtcgt attaatttcg ataagccagg 2220 2280 ctcactcaaa ggcggtaata cggttatcca cagaatcagg ggataacgca ggaaagaaca 2340 tgtgagcaaa aggccagcaa aaggccagga accgtaaaaa ggccgcgttg ctggcgtttt 2400 tccataggct ccgcccccct gacgagcatc acaaaaatcg acgctcaagt cagaggtggc 2460 gaaacccgac aggactataa agataccagg cgtttccccc tggaagctcc ctcgtgcgct 2520 ctcctgttcc gaccctgccg cttaccggat acctgtccgc ctttctccct tcgggaagcg 2580 tggcgctttc tcatagctca cgctgtaggt atctcagttc ggtgtaggtc gttcgctcca 2640 agctgggctg tgtgcacgaa ccccccgttc agcccgaccg ctgcgcctta tccggtaact 2700 atcgtcttga gtccaacccg gtaagacacg acttatcgcc actggcagca gccactggta 2760 acaggattag cagagcgagg tatgtaggcg 2790

Claims

1. Use of a dsRNA of the green stink bug GRK gene in controlling green stink bugs, wherein the dsRNA of the green stink bug GRK gene has a nucleotide sequence as shown in SEQ ID NO.

5. The use comprises injecting the dsRNA into the green stink bug via a microinjector to inhibit the expression of the green stink bug GRK gene. The injection dose is 500 ng. The steps of the efficient synthesis method of the dsRNA are as follows: 1) PCR amplification of the target gene fragment: Homologous sequences to the L4440 vector were added to both ends of the dsRNA nucleotide sequence of the green stink bug GRK gene. The upstream primer shown in SEQ ID NO. 6 and the downstream primer shown in SEQ ID NO. 7 were designed and synthesized. PCR amplification was performed using the cDNA sequence of the GRK gene as a template to obtain a PCR product. The PCR product was purified to obtain the target gene fragment; 2) Construction of recombinant strain: The target gene fragment purified in step 1) was ligated with the linearized L4440 vector using a homologous recombinase to obtain a recombinant vector, which was then expressed to obtain a recombinant strain. The sequence of the L4440 vector is shown in SEQ ID NO. 10; 3) Induced expression: The recombinant strain obtained in step 2) is induced to express to obtain bacterial cells; 4) dsRNA Extraction and Purification: Extract total RNA from the bacteria, add RNase A and DNaes I to remove single-stranded RNA and genomic DNA, and obtain PCR products. Add an equal volume of phenol:chloroform:isoamyl alcohol solution, shake, and centrifuge to obtain the supernatant. Add ethanol, mix thoroughly, let stand, centrifuge and discard the supernatant; The precipitate was washed with ethanol and collected by centrifugation; after drying, it was dissolved in nuclease-free water to obtain purified dsRNA.

2. The use according to claim 1, characterized in that Step 3) The induction medium is LB liquid medium, and the bacterial liquid and the induction medium are inoculated at a ratio of 1:50 to 1:

100.

3. The use according to claim 1, characterized in that The final concentration of RNase A in step 4) is 1-10 μg / mL, and the final concentration of DNaesⅠ is 0.1-1 μg / μL.

Images