Plant lipids containing eicosapentaenoic acid, extracted

Abstract

The present invention relates to an extracted plant lipid containing docosahexaenoic acid, and a method for producing the extracted plant lipid.

Description

[0001] This application is a divisional application of a patent application filed on June 18, 2015, with application number 201510342019.9 and invention name “Extracted plant lipids containing docosapentaenoic acid”. Technical Field

[0002] The present invention relates to extracted plant lipids comprising docosapentaenoic acid, and methods for producing the extracted plant lipids. Background Art

[0003] Omega-3 long-chain polyunsaturated fatty acids (LC-PUFAs) are now widely recognized as important compounds for human and animal health. These fatty acids can be obtained from dietary sources or by converting linoleic acid (LA, 18:2ω6) or α-linolenic acid (ALA, 18:3ω3) fatty acids, both of which are considered essential fatty acids in the human diet. Although humans and many other vertebrates are able to convert LA or ALA obtained from plant sources to C22, they do so at very low rates. Furthermore, most modern societies have an unbalanced diet, with at least 90% of the polyunsaturated fatty acids (PUFAs) being ω6 fatty acids, rather than the ω6:ω3 ratio of 4:1 or less that is considered ideal (Trautwein, 2001). The direct dietary sources of LC-PUFAs for humans, such as eicosapentaenoic acid (EPA, 20:5ω3) and docosahexaenoic acid (DHA, 22:6ω3), are largely derived from fish or fish oils. Consequently, health professionals recommend that fish, which contain significant levels of LC-PUFAs, be routinely included in the human diet. Increasingly, fish-derived LC-PUFA oils are being incorporated into, for example, food products and infant formulas. However, due to the decline of global and national fisheries, there is a need for alternative sources of these beneficial health-enhancing oils.

[0004] In contrast to animals, flowering plants lack the ability to synthesize polyunsaturated fatty acids with chain lengths longer than 18 carbons. Specifically, crop and horticultural plants, along with other angiosperms, lack the enzymes required to synthesize longer-chain ω3 fatty acids such as EPA, docosapentaenoic acid (DPA, 22:5ω3), and DHA, derived from ALA. Therefore, an important goal in plant biotechnology is to engineer crop plants that produce large amounts of LC-PUFAs, thereby providing an alternative source of these compounds.

[0005] LC-PUFA biosynthesis pathway

[0006] The biosynthesis of LC-PUFAs in organisms such as microalgae, mosses, and fungi is typically performed as a series of oxygen-dependent desaturation and elongation reactions ( Figure 1) appears. The most common pathway for producing EPA in these organisms involves Δ6-desaturation, Δ6-elongation, and Δ5-desaturation (called the Δ6-desaturation pathway), while a less common pathway uses Δ9-elongation, Δ8-desaturation, and Δ5-desaturation (called the Δ9-desaturation pathway). These sequential desaturation and elongation reactions can be carried out on the ω6 fatty acid substrate LA (e.g. Figure 1 The upper left part (ω6) schematically shown) or ω3 substrate ALA starts until EPA (as shown in FIG. Figure 1 If the initial Δ6-desaturation is performed on the ω6 substrate LA, the LC-PUFA product of the three enzyme series will be the ω6 fatty acid ARA. LC-PUFA synthesizing organisms can use Figure 1 The ω3-desaturase shown in the Δ17-desaturase step of the ω3-desaturase converts ω6 fatty acids to ω3 fatty acids for the conversion of arachidonic acid (ARA, 20:4ω6) to EPA. Some members of the ω3-desaturase family can act on a variety of substrates ranging from LA to ARA. Plant ω3-desaturases often specifically catalyze the Δ15-desaturation of LA to ALA, while fungal and yeast ω3-desaturases can be specific for the Δ17-desaturation of ARA to EPA (Pereira et al., 2004a; Zank et al., 2005). Some reports suggest that non-specific ω3-desaturases may exist that can convert a variety of ω6 substrates into their corresponding ω3 products (Zhang et al., 2008).

[0007] In these organisms, DPA is produced by Δ5-elongation of EPA, followed by Δ4-desaturation to produce DHA ( Figure 1 ), which converts EPA to DHA. In contrast, mammals use the so-called "Sprecher" pathway, which converts DPA to DHA via three separate reactions independent of the Δ4-desaturase enzyme (Sprecher et al., 1995).

[0008] The front-end desaturase that is usually found in plant, moss, microalgae and lower animals such as Caenorhabditis elegans mainly accepts the fatty acid substrate esterified with the sn-2 position of phosphatidylcholine (PC) substrate.Therefore these desaturases are referred to as the front-end desaturase (Domergue etc., 2003) that acyl-PC, lipid are connected.By contrast, higher animal front-end desaturase accepts acyl-CoA substrate usually, and wherein fatty acid substrate is connected to CoA, rather than PC (Domergue etc., 2005).Known some microalgae desaturases and a kind of plant desaturase use the fatty acid substrate (table 2) that is esterified with CoA.

[0009] Each PUFA elongation reaction consists of four steps catalyzed by a multi-component protein complex: First, a condensation reaction causes the addition of a 2C unit from malonyl-CoA to a fatty acid, resulting in the formation of a B-ketoacyl intermediate. This is then reduced by NADPH and then dehydrated to produce an enoyl intermediate. This intermediate is finally reduced a second time to produce the extended fatty acid. It is generally believed that the condensation steps of these four reactions are substrate-specific, while the other steps are not. In practice, this means that as long as a condensing enzyme specific for PUFAs is introduced (commonly referred to as an "elongase"), the native plant elongation machinery will be able to elongate PUFAs, although the native plant elongation machinery may be less efficient in elongating non-native PUFA substrates. In 2007, the identification and characterization of yeast elongation cycle dehydratase was published (Denic and Weissman, 2007).

[0010] PUFA desaturation in plants, mosses and microalgae occurs naturally from fatty acid substrates that are primarily in the acyl-PC pool, while elongation occurs from substrates in the acyl-CoA pool. Transfer of fatty acids from acyl-PC molecules to CoA carriers is performed by phospholipases (PLAs), while transfer of acyl-CoA fatty acids to PC carriers is performed by lysophosphatidylcholine acyltransferases (LPCATs) (Singh et al., 2005).

[0011] Engineering LC-PUFA

[0012] Most LC-PUFA metabolic engineering is performed using the aerobic Δ6-desaturation / elongation pathway. The biosynthesis of gamma-linolenic acid (GLA, 18:3ω6) in tobacco was first reported in 1996 using a Δ6-desaturase from the cyanobacterium Synechocystis (Reddy and Thomas, 1996). More recently, GLA has been produced in crops such as safflower (73% GLA in seed oil; Knauf et al., 2006) and soybean (28% GLA; Sato et al., 2004). The production of LC-PUFAs such as EPA and DHA involves more complex engineering due to the increased number of desaturation and elongation steps involved. The first report of EPA production in terrestrial plants was by Qi et al. (2004), who introduced genes encoding a Δ9-elongase from Isochrysis galbana, a Δ8-desaturase from Euglena gracilis, and a Δ5-desaturase from Mortierella alpina into Arabidopsis, resulting in production of up to 3% EPA. This work was followed by Abbadi et al. (2004), who reported production of up to 0.8% EPA in linseed using genes encoding a Δ6-desaturase and a Δ6-elongase from Physcomitrella patens and a Δ5-desaturase from Phaeodactylum tricornutum.

[0013] The first report of DHA production was in WO 04 / 017467, which describes the production of 3% DHA in soybean embryos, rather than seeds, by introducing genes encoding Saprolegnia diclina Δ6-desaturase, Mortierella alpina Δ6-desaturase, Mortierella alpina Δ5-desaturase, Saprolegnia diclina Δ4-desaturase, Saprolegnia diclina Δ17-desaturase, Mortierella alpina Δ6-elongase, and Pavlova lutheri Δ5-elongase. The maximum EPA level in embryos that also produced DHA was 19.6%, indicating poor efficiency in converting EPA to DHA (WO 2004 / 071467). This finding is similar to that published by Robert et al. (2005), in which the conversion from EPA to DHA was lower, with 3% EPA and 0.5% DHA produced in Arabidopsis using zebrafish Δ5 / 6-desaturase, C. elegans Δ6-elongase, and Pavlovasalina Δ5-elongase and Δ4-desaturase. Furthermore, in 2005, Wu et al. reported the production of 25% ARA, 15% EPA, and 1.5% DHA in Brassica juncea using Pythium irregulare Δ6-desaturase, Thraustochytrid Δ5-desaturase, Physcomitrella patens Δ6-elongase, Calsndula officianalis Δ12-desaturase, Thraustochytrid Δ5-elongase, Phytophthora infestans Δ17-desaturase, Oncorhyncus mykiss LC-PUFA elongase, Thraustochytrid Δ4-desaturase, and Thraustochytrid LPCAT (Wu et al., 2005). A summary of efforts to produce oilseed crops that synthesize ω3 LC-PUFAs is provided in Venegas-Caleron et al. (2010) and Ruiz-Lopez et al. (2012). As indicated by Ruiz-Lopez et al. (2012), the results obtained so far for the production of DHA in transgenic plants do not approach the levels seen in fish oil.

[0014] Therefore, there remains a need for more efficient production of LC-PUFAs in recombinant cells, in particular the production of DPA in seeds of oilseed plants. Summary of the Invention

[0015] Few organisms produce oils with greater than 1-2% DPA, and therefore there are limited options, if any, for producing DPA on a large scale from natural sources.The present inventors have identified methods and plants for producing lipids with high levels of DPA.

[0016] Thus, in a first aspect, the present invention provides a method for producing extracted plant lipids, said method comprising the steps of:

[0017] i) obtaining a plant part whose lipids comprise fatty acids in esterified form comprising oleic acid, palmitic acid, ω6 fatty acids including linoleic acid (LA), ω3 fatty acids including alpha-linolenic acid (ALA) and docosapentaenoic acid (DPA), and optionally one or more of stearidonic acid (SDA), eicosapentaenoic acid (EPA) and eicosatetraenoic acid (ETA), wherein the level of DPA in the total fatty acid content of the extracted lipids is between 7% and 35%, wherein the level of palmitic acid in the total fatty acid content of the extracted lipids is between 2% and 16%, and wherein the level of myristic acid (C14:0) in the total fatty acid content of the extracted lipids is less than 1%; and

[0018] ii) extracting lipids from said plant part;

[0019] wherein the level of DPA in the total fatty acid content of the extracted lipids is between 7% and 35%. In one embodiment, the level of DPA is between 7% and 20%, or between 20.1% and 30%, preferably between 20.1% and 35%, and more preferably between 30% and 35%. In one embodiment, the level of DPA in the total fatty acid content of the extracted lipids is between 8% and 20%, or between 10% and 20%, preferably between 11% and 20%, or between 12% and 20%. The plant part is preferably a seed of Brassica spp. or a seed of Camelina sativa.

[0020] The step of obtaining the plant part or recombinant cell may comprise harvesting the plant part (preferably a seed) from the plant from which it was produced, recovering the recombinant cell from a culture of such cells, or obtaining the plant part or recombinant cell by purchasing it from a producer or supplier or by importing it. The method may comprise the step of determining the fatty acid composition of lipids in a sample of the plant part or recombinant cell or the fatty acid composition of extracted lipids.

[0021] In one embodiment, the extracted lipid, preferably Brassica spp. seed oil or Camelina sativa seed oil, has one or more or all of the following characteristics:

[0022] i) the level of palmitic acid in the total fatty acid content of the extracted plant lipids is between 2% and 15%;

[0023] ii) the level of myristic acid (C14:0) in the total fatty acid content of the extracted plant lipids is about 0.1%;

[0024] iii) the level of oleic acid in the total fatty acid content of the extracted plant lipids is between 1% and 30%;

[0025] iv) the level of linoleic acid (LA) in the total fatty acid content of the extracted plant lipids is between 4% and 20%;

[0026] v) a level of α-linolenic acid (ALA) of between 4% and 40% of the total fatty acid content of the extracted plant lipids;

[0027] vi) a level of gamma-linolenic acid (GLA) between 0.05% and 7% of the total fatty acid content of the extracted plant lipids;

[0028] vii) a level of stearidonic acid (SDA) of between 0.05% and 10% of the total fatty acid content of the extracted plant lipids;

[0029] viii) the level of eicosatetraenoic acid (ETA) in the total fatty acid content of the extracted plant lipids is less than 6%;

[0030] ix) the level of eicosatrienoic acid (ETrA) in the total fatty acid content of the extracted plant lipids is less than 4%;

[0031] x) The extracted plant lipids contain less than 0.1% of ω6-docosapentaenoic acid (22:5 Δ4，7，10，13，16 );

[0032] xi) the level of novel ω6 fatty acids in the total fatty acid content of the extracted plant lipids is less than 10%;

[0033] xii) a ratio of total ω6 fatty acids:total ω3 fatty acids in the fatty acid content of the extracted plant lipids of between 1.0 and 3.0 or between 0.1 and 1;

[0034] xiii) the ratio of neo-ω6 fatty acids: neo-ω3 fatty acids in the fatty acid content of the extracted plant lipids is between 1.0 and 3.0, between 0.02 and 0.1, or between 0.1 and 1;

[0035] xiv) the fatty acid composition of the extracted plant lipids is based on a conversion efficiency of at least 10% of oleic acid to DPA;

[0036] xv) the fatty acid composition of the extracted plant lipids is based on a conversion efficiency of LA to DPA of at least 15%;

[0037] xvi) the fatty acid composition of the extracted plant lipids is based on an ALA to DPA conversion efficiency of at least 17%;

[0038] xvii) the total fatty acids in the extracted plant lipids have less than 1.5% C20:1;

[0039] xviii) the triacylglycerol (TAG) content of the extracted plant lipids is at least 70%;

[0040] xix) the extracted plant lipids contain diacylglycerol (DAG) containing DPA;

[0041] xx) the extracted plant lipids contain less than 10% free (unesterified) fatty acids and / or phospholipids, or are substantially free of them;

[0042] xxi) at least 70% of the DPA esterified in the TAG form is in the sn-1 or sn-3 position of said TAG;

[0043] xxii) the most abundant DPA-containing TAG species in the extracted plant lipids was DPA / 18:3 / 18:3 (TAG 58:11); and

[0044] xxiii) The extracted plant lipids contain tri-DPA TAG (TAG 66:15).

[0045] In one embodiment, the level of eicosapentaenoic acid (EPA) in the total fatty acid content of the extracted plant lipids is between 0.05% and 10%.

[0046] In another embodiment, the level of DHA in the total fatty acid content of the extracted plant lipid is less than 2%, preferably less than 1%, or between 0.1% and 2%, more preferably not detected. The extracted plant lipid is preferably Brassica spp. seed oil or Camelina sativa seed oil.

[0047] In another embodiment, the extracted lipid, preferably Brassica spp. seed oil or Camelina sativa seed oil, has one or more or all of the following characteristics:

[0048] i) the level of palmitic acid in the total fatty acid content of the extracted lipids is between about 2% and 18%, between about 2% and 16%, between about 2% and 15%, or between about 3% and about 10%;

[0049] ii) the level of myristic acid (C14:0) of the total fatty acid content of the extracted lipids is less than 6%, less than 3%, less than 2%, less than 1%, or about 0.1%;

[0050] iii) the level of oleic acid in the total fatty acid content of the extracted lipids is between about 1% and about 30%, between about 3% and about 30%, between about 6% and about 30%, between 1% and about 20%, between about 30% and about 60%, between about 45% and about 60%, about 30%, or between about 15% and about 30%;

[0051] iv) the level of linoleic acid (LA) of the total fatty acid content of the extracted lipids is between about 4% and about 35%, between about 4% and about 20%, between about 4% and 17%, or between about 5% and about 10%;

[0052] v) a level of alpha-linolenic acid (ALA) of between about 4% and about 40%, between about 7% and about 40%, between about 10% and about 35%, between about 20% and about 35%, between about 4% and 16%, or between about 2% and 16% of the total fatty acid content of the extracted lipids;

[0053] vi) a level of gamma-linolenic acid (GLA) of less than 4%, less than about 3%, less than about 2%, less than about 1%, less than about 0.5%, between 0.05% and 7%, between 0.05% and 4%, between 0.05% and about 3%, or between 0.05% and about 2% of the total fatty acid content of the extracted lipids;

[0054] vii) the level of stearidonic acid (SDA) in the total fatty acid content of the extracted lipids is less than about 10%, less than about 8%, less than about 7%, less than about 6%, less than about 4%, less than about 3%, between about 0.05% and about 7%, between about 0.05% and about 6%, between about 0.05% and about 4%, between about 0.05% and about 3%, between about 0.05% and about 10%, or between 0.05% and about 2%;

[0055] viii) the level of eicosatetraenoic acid (ETA) in the total fatty acid content of the extracted lipids is less than 6%, less than about 5%, less than about 4%, less than about 1%, less than about 0.5%, between 0.05% and 6%, between 0.05% and about 5%, between 0.05% and about 4%, between 0.05% and about 3%, or between 0.05% and about 2%;

[0056] ix) the level of eicosatrienoic acid (ETrA) of the total fatty acid content of the extracted lipids is less than 4%, less than about 2%, less than about 1%, between 0.05% and 4%, between 0.05% and 3%, or between 0.05% and about 2%, or between 0.05% and about 1%;

[0057] x) the level of eicosapentaenoic acid (EPA) of the total fatty acid content of the extracted lipids is between 4% and 15%, less than 4%, less than about 3%, less than about 2%, between 0.05% and 10%, between 0.05% and 5%, between 0.05% and about 3%, or between 0.05% and about 2%;

[0058] xi) the level of DPA in the total fatty acid content of the extracted lipids is about 8%, about 9%, about 10%, about 12%, about 14%, about 16%, about 18%, about 20%, about 22%, about 24%, about 26%, about 28%, about 31%, between 7% and 20%, between 20.1% and 29%, between 20.1% and 28%, between 20.1% and about 27%, between 20.1% and about 26%, between 20.1% and about 25%, between 20.1% and about 24%, between 21% and 35%, between 21% and 30%, between 21% and 28%, between 21% and about 26%, or between 21% and about 24%;

[0059] xii) Lipids contain ω6-docosapentaenoic acid (22:5 Δ4，7，10，13，16 );

[0060] xiii) lipids containing less than 0.1% ω6-docosapentaenoic acid (22:5 Δ4，7，10，13，16 );

[0061] xiv) lipids comprising less than 0.1% of one or more or all of SDA, EPA, and ETA in their fatty acid content;

[0062] xv) the level of total saturated fatty acids in the total fatty acid content of the extracted lipids is between about 4% and about 25%, between about 4% and about 20%, between about 6% and about 20%, or between about 6% and about 12%;

[0063] xvi) the level of total monounsaturated fatty acids in the total fatty acid content of the extracted lipids is between about 4% and about 40%, between about 4% and about 35%, between about 8% and about 25%, between 8% and about 22%, between about 15% and about 40%, or between about 15% and about 35%;

[0064] xvii) the level of total polyunsaturated fatty acids in the total fatty acid content of the extracted lipids is between about 20% and about 75%, between 30% and 75%, between about 50% and about 75%, about 60%, about 65%, about 70%, about 75%, or about 60% and about 75%;

[0065] xviii) the level of total ω6 fatty acids in the total fatty acid content of the extracted lipids is between about 35% and about 50%, between about 20% and about 35%, between about 6% and 20%, less than 20%, less than about 16%, less than about 10%, between about 1% and about 16%, between about 2% and about 10%, or between about 4% and about 10%;

[0066] xix) the level of neo-ω6 fatty acids in the total fatty acid content of the extracted lipids is less than about 10%, less than about 8%, less than about 6%, less than 4%, between about 1% and about 20%, between about 1% and about 10%, between 0.5% and about 8%, or between 0.5% and 4%;

[0067] xx) the level of total ω3 fatty acids in the total fatty acid content of the extracted lipids is between 36% and about 65%, between 36% and about 70%, between 40% and about 60%, between about 30% and about 60%, between about 35% and about 60%, between 40% and about 65%, between about 30% and about 65%, between about 35% and about 65%, about 35%, about 40%, about 45%, about 50%, about 55%, about 60%, about 65%, or about 70%;

[0068] xxi) the level of neo-ω3 fatty acids in the total fatty acid content of the extracted lipids is between 21% and about 45%, between 21% and about 35%, between about 23% and about 35%, between about 25% and about 35%, between about 27% and about 35%, about 23%, about 25%, about 27%, about 30%, about 35%, about 40%, or about 45%;

[0069] xxii) a ratio of total ω6 fatty acids:total ω3 fatty acids in the fatty acid content of the extracted lipids of between about 1.0 and about 3.0, between about 0.1 and about 1, between about 0.1 and about 0.5, less than about 0.50, less than about 0.40, less than about 0.30, less than about 0.20, less than about 0.15, about 1.0, about 0.1, about 0.10 to about 0.4, or about 0.2;

[0070] xxiii) a ratio of neo-ω6 fatty acids: neo-ω3 fatty acids in the total fatty acid content of the extracted lipids of between about 1.0 and about 3.0, between about 0.02 and about 0.1, between about 0.1 and about 1, between about 0.1 and about 0.5, less than about 0.50, less than about 0.40, less than about 0.30, less than about 0.20, less than about 0.15, about 0.02, about 0.05, about 0.1, about 0.2, or about 1.0;

[0071] xxiv) the fatty acid composition of the lipids is based on an efficiency of conversion of oleic acid to LA by a Δ12-desaturase of at least about 60%, at least about 70%, at least about 80%, between about 60% and about 98%, between about 70% and about 95%, or between about 75% and about 90%;

[0072] xxv) the fatty acid composition of the lipids is based on an efficiency of conversion of ALA to SDA by a Δ6-desaturase of at least about 30%, at least about 40%, at least about 50%, at least about 60%, at least about 70%, between about 30% and about 70%, between about 35% and about 60%, or between about 50% and about 70%;

[0073] xxvi) the fatty acid composition of the lipids is based on an efficiency of converting SDA to ETA by a Δ6-elongase of at least about 60%, at least about 70%, at least about 75%, between about 60% and about 95%, between about 70% and about 88%, or between about 75% and about 85%;

[0074] xxvii) the fatty acid composition of the lipids is based on an efficiency of conversion of ETA to EPA by a Δ5-desaturase of at least about 60%, at least about 70%, at least about 75%, between about 60% and about 99%, between about 70% and about 99%, or between about 75% and about 98%;

[0075] xxviii) the fatty acid composition of the lipids is based on an efficiency of conversion of EPA to DPA by a delta-5 elongase of at least about 80%, at least about 85%, at least about 90%, between about 50% and about 99%, between about 85% and about 99%, between about 50% and about 95%, or between about 85% and about 95%;

[0076] xxix) the fatty acid composition of the lipids is based on an efficiency of converting oleic acid to DPA of at least about 10%, at least about 15%, at least about 20%, at least about 25%, about 20%, about 25%, about 30%, between about 10% and about 50%, between about 10% and about 30%, between about 10% and about 25%, or between about 20% and about 30%;

[0077] xxx) the fatty acid composition of the lipids is based on an efficiency of converting LA to DPA of at least about 15%, at least about 20%, at least about 22%, at least about 25%, at least about 30%, at least about 40%, about 25%, about 30%, about 35%, about 40%, about 45%, about 50%, between about 15% and about 50%, between about 20% and about 40%, or between about 20% and about 30%;

[0078] xxxi) the fatty acid composition of the lipids is based on an efficiency of converting ALA to DPA of at least about 17%, at least about 22%, at least about 24%, at least about 30%, about 30%, about 35%, about 40%, about 45%, about 50%, about 55%, about 60%, between about 22% and about 70%, between about 17% and about 55%, between about 22% and about 40%, or between about 24% and about 40%;

[0079] xxxii) the total fatty acids in the extracted lipids have less than 1.5% C20:1, less than 1% C20:1, or about 1% C20:1;

[0080] xxxiii) the triacylglycerol (TAG) content of the lipids is at least about 70%, at least about 80%, at least about 90%, at least 95%, between about 70% and about 99%, or between about 90% and about 99%;

[0081] xxxiv) the lipid comprises diacylglycerol (DAG), preferably the DAG comprises DPA;

[0082] xxxv) the lipids comprise less than about 10%, less than about 5%, less than about 1%, or between about 0.001% and about 5%, are free of (non-esterified) fatty acids and / or phospholipids, or are substantially free;

[0083] xxxvi) at least 70%, at least 72%, or at least 80% of the DPA esterified in the TAG form is in the sn-1 or sn-3 position of the TAG;

[0084] xxxvii) the most abundant DPA-containing TAG species in lipids is DPA / 18:3 / 18:3 (TAG 58:11); and

[0085] xxxviii) The lipid comprises tris-DPATAG (TAG 66:15).

[0086] In another embodiment, the extracted lipids are in the form of an oil, preferably Brassica seed oil or Camelina seed oil, wherein at least about 90%, at least about 95%, at least about 98%, or between about 95% and about 98% by weight of the oil is lipid.

[0087] In one embodiment, the level of DPA in the extracted lipid or oil is not increased, or is substantially the same as the level of DPA in the lipid or oil of the plant part before extraction. In other words, after extraction, no procedures are performed to increase the level of DPA in the lipid or oil relative to other fatty acids. As will be apparent, the lipid or oil can be subsequently treated by fractionation or other procedures to alter the fatty acid composition.

[0088] In another embodiment, the extracted lipids additionally comprise one or more sterols, preferably phytosterols.

[0089] In another embodiment, the extracted lipids are in the form of an oil and contain less than about 10 mg sterols / g oil, less than about 7 mg sterols / g oil, between about 1.5 mg and about 10 mg sterols / g oil, or between about 1.5 mg and about 7 mg sterols / g oil.

[0090] Examples of sterols that may be in the extracted lipids include, but are not necessarily limited to, one or more or all of campesterol / 24-methylcholesterol, Δ5-stigmasterol, scutellarin, β-sitosterol / 24-ethylcholesterol, Δ5-avenasterol / isofucansterol, Δ7-stigmasterol / stigmaster-7-en-3β-ol, and Δ7-avenasterol.

[0091] In one embodiment, the plant species is one listed in Table 11, such as Brassica napus, and the level of sterols is approximately the same as the level listed for that particular plant species in Table 11. The plant species can be Brassica napus, Brassica juncea (Indian mustard), or Cannabis sativa (C. sativa) and comprises levels of sterols that are approximately found in extracted oil of wild-type Brassica napus, Brassica juncea, or Cannabis sativa, respectively.

[0092] In one embodiment, the extracted plant lipids comprise one or more or all of campesterol / 24-methylcholesterol, Δ5-stigmasterol, scutellarin, β-sitosterol / 24-ethylcholesterol, Δ5-avenasterol / isofuccasterol, Δ7-stigmasterol / stigmaster-7-en-3β-ol, and Δ7-avenasterol, or have a sterol content substantially the same as wild-type rapeseed oil.

[0093] In one embodiment, the extracted lipids have substantially the same sterol content as wild-type rapeseed oil, mustard oil, or hemp oil.

[0094] In one embodiment, the extracted lipids contain less than about 0.5 mg cholesterol / g oil, less than about 0.25 mg cholesterol / g oil, between about 0 mg and about 0.5 mg cholesterol / g oil, or between about 0 mg and about 0.25 mg cholesterol / g oil, or are essentially free of cholesterol.

[0095] In one embodiment, the plant part is a seed, preferably an oilseed. Examples of such seeds include, but are not limited to, Brassica species, upland cotton, flax, sunflower species, safflower, soybean, maize, Arabidopsis thaliana, bicolor sorghum, sorghum, oats, clover species, oil palm, Nicotiana benthamiana, barley, lupinus angustifolius, Asian cultivated rice, African cultivated rice, camelina or deep-sea two-jointed camellia, preferably Brassica species seeds, camelina seeds or soybean (soybean) seeds, more preferably Brassica napus, Indian mustard or camelina seeds. In one embodiment, the plant part is a seed, preferably an oilseed, such as Brassica species (such as Brassica napus or Indian mustard), upland cotton, flax, sunflower species, safflower, soybean, maize, oil palm, Nicotiana benthamiana, lupinus angustifolius, camelina or deep-sea two-jointed camellia, preferably Brassica napus, Indian mustard or camelina seeds. In one embodiment, the seed is rapeseed, mustard seed, soybean seed, camelina seed or Arabidopsis seed. In an alternative embodiment, the seed is a seed except Arabidopsis seed and / or except camelina seed. In one embodiment, the plant part is a Brassica species seed. In one embodiment, the seed is a seed except soybean seed. In one embodiment, the seed is obtained from a plant grown under standard conditions (for example, as described in Example 1) or from a plant grown under standard conditions in a field or greenhouse. In another embodiment, the seed comprises at least about 18 mg, at least about 22 mg, at least about 26 mg, between about 18 mg and about 100 mg, between about 22 mg and about 70 mg, about 80 mg, between about 30 mg and about 80 mg, or between about 24 mg and about 50 mg of DPA per gram of seed.

[0096] In another embodiment, the total oil content of the plant part comprising the exogenous polynucleotide is at least about 40%, at least about 50%, at least about 60%, at least about 70%, between about 50% and about 80%, or between about 80% and about 100% of the total oil content of the corresponding plant part lacking the exogenous polynucleotide.

[0097] In another embodiment, the method further comprises treating the lipid to increase the level of DPA as a percentage relative to the total fatty acid content. For example, the treatment comprises transesterification. For example, the lipid, such as rapeseed oil, can be treated to convert the fatty acids in the oil into alkyl esters, such as methyl or ethyl esters, which can then be fractionated to enrich the lipid or oil for DPA. In embodiments, the fatty acid composition of the lipid after such treatment comprises at least 40%, at least 50%, at least 60%, at least 70%, at least 80%, or at least 90% DPA.

[0098] In another aspect, the present invention provides an extracted plant lipid, preferably Brassica spp. seed oil or Camelina sativa seed oil, comprising fatty acids in esterified form, the fatty acids comprising oleic acid, palmitic acid, ω6 fatty acids including linoleic acid (LA), ω3 fatty acids including α-linolenic acid (ALA) and docosapentaenoic acid (DPA), and optionally one or more of stearidonic acid (SDA), eicosapentaenoic acid (EPA) and eicosatetraenoic acid (ETA), wherein the level of DPA in the total fatty acid content of the extracted lipid is between 7% and 20% or between 7% and 35%, preferably between 20.1% and 35%, the level of palmitic acid in the total fatty acid content of the extracted lipid is between 2% and 16%, and the level of myristic acid (C14:0) in the total fatty acid content of the extracted lipid is less than 1%. In one embodiment, the level of DPA in the total fatty acid content of the extracted lipids is between 8% and 20%, or between 10% and 20%, preferably between 11% and 20%, or between 12% and 20%. In one embodiment, the level of DHA in the total fatty acid content of the extracted plant lipids is less than 2%, preferably less than 1%, or between 0.1% and 2%, more preferably not detected. In one embodiment, the extracted plant lipids contain less than 0.1% by weight, preferably undetectable, of C21:5ω3 fatty acids.

[0099] In a preferred embodiment, the extracted lipids have one or more of the characteristics defined herein (eg, as defined above).

[0100] In one embodiment, the level of eicosapentaenoic acid (EPA) in the total fatty acid content of the extracted plant lipids is between 0.05% and 10%.

[0101] In one embodiment, the level of docosahexaenoic acid (DHA) in the total fatty acid content of the extracted plant lipids is less than 2%.

[0102] In a preferred embodiment, the lipid or oil, preferably a seed oil, more preferably a Brassica spp. seed oil or Camelina sativa seed oil, has the following characteristics: the level of DPA in the total fatty acid content of the lipid or oil is between 7% and 35% or between 7% and 20%, preferably between 20.1% and 30% or between 20.1% and 35%, preferably between 30% and 35%, the level of palmitic acid is between 2% and 16%, the level of myristic acid is less than 6%, the level of oleic acid is between 1% and 30%, the level of LA is between 4% and 35%, ALA is present, the level of total saturated fatty acids in the total fatty acid content of the extracted lipid is between 4% and 25%, the ratio of total ω6 fatty acids:total ω3 fatty acids in the fatty acid content of the extracted lipid is between 0.05 and 3.0, and the triacylglycerol (TAG) content of the lipid is at least 70%, and optionally, the lipid is substantially free of cholesterol and / or the lipid comprises tri-DPATAG (TAG 66:15). More specifically, the lipid or oil, preferably a seed oil, additionally has one or more or all of the following characteristics: at least 70% of the DPA is esterified at the sn-1 or sn-3 position of the triacylglycerol (TAG), ALA is present at a level between 4% and 40% of the total fatty acid content, GLA is present and / or the level of GLA is less than 4% of the total fatty acid content, the level of SDA is between 0.05% and about 10%, the level of ETA is less than 4%, the level of EPA is between 0.05% and 10%, and the level of total monounsaturated fatty acids is between 4% and 35% of the total fatty acid content of the extracted lipids. The level of total polyunsaturated fatty acids in the total fatty acid content of the extracted lipids is between 20% and 75%, the ratio of neo-ω6 fatty acids to neo-ω3 fatty acids in the fatty acid content of the extracted lipids is between 0.03 and 3.0, preferably less than 0.50, and the fatty acid composition of the lipids is based on at least 60% efficiency in converting oleic acid to LA by a Δ12-desaturase, at least 60% efficiency in converting SDA to ETA acid by a Δ6-elongase, between 50% and 95% efficiency in converting EPA to DPA by a Δ5-elongase, and at least 10% efficiency in converting oleic acid to DPA. Most preferably, at least 81% of the DPA is esterified at the sn-1 or sn-3 position of the triacylglycerol (TAG). In this embodiment, the level of DPA in the total fatty acid content of the extracted plant lipids is preferably less than 2%, more preferably less than 1%, or between 0.1% and 2%, and most preferably not detected.

[0103] In another preferred embodiment, the lipid or oil, preferably a seed oil, more preferably a Brassica spp. seed oil or Camelina sativa seed oil, has the following characteristics: of the total fatty acid content of the lipid or oil, the level of DPA is between 7% and 20% or between 7% and 35%, preferably between 20.1% and 30% or between 20.1% and 35%, preferably between 30% and 35%, the level of palmitic acid is between 2% and 16%, the level of myristic acid is less than 6% and preferably less than 1%, the level of oleic acid is between 1% and 30%, the level of LA is between 4% and 35%, ALA is present, GLA is present, the level of SDA is between 0.05% and 10%, the level of ETA is less than 6%, and the level of EPA is between 0.05% and 10%. In this embodiment, the level of DHA in the total fatty acid content of the extracted plant lipid is preferably less than 2%, more preferably less than 1%, or between 0.1% and 2%, and most preferably not detected.

[0104] In another embodiment, the seeds comprise at least about 18 mg, at least about 22 mg, at least about 26 mg, between about 18 mg and about 100 mg, between about 22 mg and about 70 mg, about 80 mg, between about 30 mg and about 80 mg, or between about 24 mg and about 50 mg of DPA per gram of seed.

[0105] In another embodiment of the above aspect, the plant part such as a seed comprises an exogenous polynucleotide encoding one of the following groups of enzymes;

[0106] i) ω3-desaturase, Δ6-desaturase, Δ5-desaturase, Δ6-elongase and Δ5-elongase;

[0107] ii) Δ15-desaturase, Δ6-desaturase, Δ5-desaturase, Δ6-elongase, and Δ5-elongase;

[0108] iii) Δ12-desaturase, Δ6-desaturase, Δ5-desaturase, Δ6-elongase, and Δ5-elongase;

[0109] iv) a Δ12-desaturase, an ω3-desaturase and / or a Δ15-desaturase, a Δ6-desaturase, a Δ5-desaturase, a Δ6-elongase and a Δ5-elongase;

[0110] v) ω3-desaturase, Δ8-desaturase, Δ5-desaturase, Δ9-elongase, and Δ5-elongase;

[0111] vi) Δ15-desaturase, Δ8-desaturase, Δ5-desaturase, Δ9-elongase, and Δ5-elongase;

[0112] vii) Δ12-desaturase, Δ8-desaturase, Δ5-desaturase, Δ9-elongase, and Δ5-elongase;

[0113] viii) a Δ12-desaturase, an ω3-desaturase and / or a Δ15-desaturase, a Δ8-desaturase, a Δ5-desaturase, a Δ9-elongase and a Δ5-elongase;

[0114] Each polynucleotide is operably linked to one or more promoters capable of directing expression of the polynucleotide in cells of the plant part. Preferably, the plant part, such as a seed, does not have a polynucleotide encoding a Δ4-desaturase or does not have a Δ4-desaturase polypeptide.

[0115] In one embodiment, the Δ12-desaturase also has ω3-desaturase and / or Δ15-desaturase activity, i.e., these activities are conferred by a single polypeptide. Alternatively, the Δ12-desaturase does not have ω3-desaturase activity and does not have Δ15-desaturase activity, i.e., the Δ12-desaturase is a different polypeptide from the polypeptide having ω3-desaturase activity and / or Δ15-desaturase activity.

[0116] In another embodiment of the above aspects, the plant part, such as a seed or a recombinant cell, has one or more or all of the following characteristics:

[0117] i) a Δ12-desaturase that converts oleic acid to linoleic acid with an efficiency of at least 60%, at least 70%, at least 80%, between 60% and 95%, between 70% and 90%, or between 75% and 85% in one or more cells of the plant part or in a recombinant cell;

[0118] ii) an ω3-desaturase that converts ω6 fatty acids into ω3 fatty acids with an efficiency of at least 65%, at least 75%, at least 85%, between 65% and 95%, between 75% and 91%, or between 80% and 91% in one or more cells of the plant part or in a recombinant cell;

[0119] iii) a Δ6-desaturase that converts ALA to SDA in one or more cells of the plant part or in a recombinant cell with an efficiency of at least 20%, at least 30%, at least 40%, at least 50%, at least 60%, at least 70%, between 30% and 70%, between 35% and 60%, or between 50% and 70%;

[0120] iv) a Δ6-desaturase that converts linoleic acid to gamma-linolenic acid in one or more cells of the plant part or in a recombinant cell with an efficiency of less than 5%, less than 2.5%, less than 1%, between 0.1% and 5%, between 0.5% and 2.5%, or between 0.5% and 1%;

[0121] v) a Δ6-elongase that converts SDA to ETA in one or more cells of the plant part or in a recombinant cell with an efficiency of at least 60%, at least 70%, at least 75%, between 60% and 95%, between 70% and 80%, or between 75% and 80%;

[0122] vi) a Δ5-desaturase that converts ETA to EPA with an efficiency of at least 60%, at least 70%, at least 75%, at least 80%, at least 90%, between 60% and 95%, between 70% and 95%, or between 75% and 95% in one or more cells of the plant part or in a recombinant cell;

[0123] vii) a Δ5-elongase that converts EPA to DPA in one or more cells of the plant part or in a recombinant cell with an efficiency of at least 80%, at least 85%, at least 90%, between 50% and 90%, or between 85% and 95%;

[0124] ix) the efficiency of converting oleic acid to DPA in one or more cells of the plant part or in the recombinant cell is at least 10%, at least 15%, at least 20%, at least 25%, 20%, 25%, 30%, between 10% and 50%, between 10% and 30%, between 10% and 25%, or between 20% and 30%;

[0125] x) the efficiency of converting LA to DPA in one or more cells of the plant part or in the recombinant cell is at least 15%, at least 20%, at least 22%, at least 25%, at least 30%, 25%, 30%, 35%, between 15% and 50%, between 20% and 40%, or between 20% and 30%;

[0126] xi) the efficiency of conversion of ALA to DPA in one or more cells of the plant part or in the recombinant cell is at least 17%, at least 22%, at least 24%, at least 30%, 30%, 35%, 40%, between 17% and 55%, between 22% and 35%, or between 24% and 35%;

[0127] xii) the one or more cells of the plant part or the recombinant cell comprises at least 25%, at least 30%, between 25% and 40%, or between 27.5% and 37.5% more ω3 fatty acids than a corresponding cell lacking the exogenous polynucleotide;

[0128] xiii) a Δ6-desaturase that preferentially desaturates α-linolenic acid (ALA) relative to linoleic acid (LA);

[0129] xiv) Δ6-elongase also has Δ9-elongase activity;

[0130] xv) the Δ12-desaturase also has Δ15-desaturase activity;

[0131] xvi) Δ6-desaturase also has Δ8-desaturase activity;

[0132] xvii) the Δ8-desaturase also has Δ6-desaturase activity or does not have Δ6-desaturase activity;

[0133] xviii) the Δ15-desaturase also has ω3-desaturase activity towards GLA;

[0134] xix) ω3-desaturase also has Δ15-desaturase activity towards LA;

[0135] xx) ω3-desaturase desaturates both LA and / or GLA;

[0136] xxi) ω3-desaturases preferentially desaturate GLA relative to LA;

[0137] xxii) one or more or all of the desaturases, preferably the Δ6-desaturase and / or the Δ5-desaturase, have greater activity on acyl-CoA substrates than on corresponding acyl-PC substrates;

[0138] xxiii) the Δ6-desaturase has greater Δ6-desaturase activity towards ALA as a fatty acid substrate than towards LA;

[0139] xxiv) the Δ6-desaturase has greater Δ6-desaturase activity towards ALA-CoA as a fatty acid substrate than towards ALA linked to the sn-2 position of PC as a fatty acid substrate;

[0140] xxv) the Δ6-desaturase has at least 2-fold greater Δ6-desaturase activity, at least 3-fold greater activity, at least 4-fold greater activity, or at least 5-fold greater activity on ALA as a substrate relative to LA;

[0141] xxvi) the Δ6-desaturase has greater activity towards ALA-CoA as a fatty acid substrate than towards ALA linked to the sn-2 position of PC as a fatty acid substrate;

[0142] xxvii) a Δ6-desaturase having at least 5-fold greater Δ6-desaturase activity or at least 10-fold greater activity on ALA-CoA as a fatty acid substrate than on ALA linked to the sn-2 position of PC as a fatty acid substrate;

[0143] xxviii) the desaturase is a front-end desaturase; and

[0144] xxix) The Δ6-desaturase has no detectable Δ5-desaturase activity towards ETA.

[0145] In another embodiment of the above aspects, the plant part, such as a seed or a recombinant cell, has one or more or all of the following characteristics:

[0146] i) a Δ12-desaturase comprising an amino acid sequence as provided in SEQ ID NO: 4, a biologically active fragment thereof, or an amino acid sequence at least 50% identical to SEQ ID NO: 4;

[0147] ii) the ω3-desaturase comprises an amino acid sequence having a sequence as provided in SEQ ID NO: 6, a biologically active fragment thereof, or an amino acid sequence at least 50% identical to SEQ ID NO: 6;

[0148] iii) a Δ6-desaturase comprising an amino acid sequence as provided in SEQ ID NO: 10, a biologically active fragment thereof, or an amino acid sequence at least 50% identical to SEQ ID NO: 10;

[0149] iv) the Δ6-elongase comprises an amino acid sequence having the sequence provided in SEQ ID NO: 19, a biologically active fragment thereof (e.g., SEQ ID NO: 20), or an amino acid sequence at least 50% identical to SEQ ID NO: 19 and / or SEQ ID NO: 20;

[0150] v) a Δ5-desaturase comprising an amino acid sequence as provided in SEQ ID NO: 24, a biologically active fragment thereof, or an amino acid sequence at least 50% identical to SEQ ID NO: 24;

[0151] vi) the Δ5-elongase comprises an amino acid sequence having a sequence as provided in SEQ ID NO: 31, a biologically active fragment thereof, or an amino acid sequence at least 50% identical to SEQ ID NO: 31.

[0152] In one embodiment of the above aspects, the plant part (such as a seed) or recombinant cell further comprises an exogenous polynucleotide encoding a diacylglycerol acyltransferase (DGAT), a monoacylglycerol acyltransferase (MGAT), a glycerol-3-phosphate acyltransferase (GPAT), an acyl-CoA:lysophosphatidylcholine acyltransferase (LPCAT), a phospholipase A2 (PLA2), a phospholipase C (PLC), a phospholipase D (PLD), a CDP-choline diacylglycerol cholinephosphotransferase (CPT), a phosphatidylcholine diacylglycerol acyltransferase (PDAT), a phosphatidylcholine:diacylglycerol cholinephosphotransferase (PDCT), an acyl-CoA synthetase (ACS), or a combination of two or more thereof.

[0153] In another embodiment of the above aspects, the plant part (such as a seed) or recombinant cell further comprises an introduced mutation or exogenous polynucleotide that down-regulates the production and / or activity of an exogenous enzyme selected from the group consisting of FAE1, DGAT, MGAT, GPAT, LPAAT, LPCAT, PLA2, PLC, PLD, CPT, PDAT, a thioesterase such as FATB, or a Δ12-desaturase, or a combination of two or more thereof, in the cells of the plant part.

[0154] In another embodiment, at least one or all of the promoters are seed-specific promoters. In one embodiment, at least one or all of the promoters are obtained from oil biosynthesis or accumulation genes, such as genes encoding oleosin, or from seed storage protein genes, such as genes encoding conlinin.

[0155] In another embodiment, the exogenous polynucleotide is covalently linked in a DNA molecule (preferably a T-DNA molecule) integrated into the genome of the cell of the plant part or the recombinant cell, and preferably wherein the number of such DNA molecules integrated into the genome of the cell of the plant part or the recombinant cell is no more than one, two or three, or is two or three.

[0156] In another embodiment, the plant part comprises at least two different exogenous polynucleotides, each encoding a Δ6-desaturase having the same or a different amino acid sequence.

[0157] In another embodiment, the total oil content of the plant part comprising the exogenous polynucleotide is at least 40%, at least 50%, at least 60%, at least 70%, between 50% and 80%, or between 80% and 100% of the total oil content of the corresponding plant part lacking the exogenous polynucleotide. In another embodiment, the seed comprising the exogenous polynucleotide has a seed weight that is at least 40%, at least 50%, at least 60%, at least 70%, between 50% and 80%, or between 80% and 100% of the weight of the corresponding seed lacking the exogenous polynucleotide.

[0158] In another embodiment of the above aspect, the lipid is in the form of an oil, preferably a seed oil from oilseeds, and wherein at least 90%, at least 95%, at least 98%, or between 95% and 98% by weight of the lipid is triacylglycerol.

[0159] Also provided is a method for producing extracted plant lipids, the method comprising the steps of:

[0160] i) obtaining a plant part, preferably Brassica sp. seeds or Camelina sativa seeds, comprising lipids comprising fatty acids in esterified form, wherein the lipids have a fatty acid profile as defined herein for the extracted lipids. In one embodiment, the fatty acids comprise oleic acid, palmitic acid, ω6 fatty acids including linoleic acid (LA), ω3 fatty acids including α-linolenic acid (ALA) and docosapentaenoic acid (DPA), and one or more of stearidonic acid (SDA), eicosapentaenoic acid (EPA) and eicosatetraenoic acid (ETA), wherein (i) the level of DPA in the total fatty acid content of the extracted lipids is between 7% and 35% or between 7% and 20%, preferably between 20.1% and 30% or between 20.1% and 35%, more preferably between 30% and 35%, (ii) the level of palmitic acid in the total fatty acid content of the extracted lipids is between 2% and 16%, (iii) the level of myristic acid (C14:0) in the total fatty acid content of the extracted lipids is less than 6%, preferably less than 1%, (iv) the level of oleic acid in the total fatty acid content of the extracted lipids is less than 1%. and (ii) at least 70% of the DPA esterified as TAG is at the sn-1 or sn-3 position of the TAG; and

[0161] ii) extracting lipids from said plant parts:

[0162] wherein the level of DPA in the total fatty acid content of the extracted lipids is between 7% and 35%, or between 7% and 20%, preferably between 20.1% and 30%, or between 20.1% and 35%, preferably between 30% and 35%. Preferably, at least 81% or at least 90% of the DPA esterified in the form of TAG is in the sn-1 or sn-3 position of the TAG. Preferably, the level of DHA in the total fatty acid content of the extracted plant lipids is preferably less than 2%, more preferably less than 1% or between 0.1% and 2%, and most preferably is not detected.

[0163] Also provided are lipids produced using the methods of the invention or oils containing the lipids.

[0164] In another aspect, the present invention provides a method for producing polyunsaturated fatty acid methyl or ethyl esters, the method comprising reacting triacylglycerols with methanol or ethanol, respectively, in extracted plant lipids or during an extraction process, wherein the extracted plant lipids comprise fatty acids esterified in the form of TAGs, the fatty acids comprising oleic acid, palmitic acid, ω6 fatty acids including linoleic acid (LA), ω3 fatty acids including α-linolenic acid (ALA), and optionally one or more of stearidonic acid (SDA), eicosapentaenoic acid (EPA), and eicosatetraenoic acid (ETA), wherein the level of DPA in the total fatty acid content of the extracted lipids is between 7% and 35%, or between 7% and 20%, preferably between 20.1% and 30%, or between 20.1% and 35%, preferably between 30% and 35%, thereby producing polyunsaturated fatty acid methyl or ethyl esters.

[0165] In a preferred embodiment, the lipid used in the methods of the above aspects has one or more of the characteristics defined herein in the context of the extracted lipid or oil.

[0166] In another aspect, the present invention provides an oilseed plant comprising:

[0167] a) lipids in its seeds, said lipids comprising fatty acids in esterified form; and

[0168] b) an exogenous polynucleotide encoding one of the following groups of enzymes;

[0169] i) a Δ12-desaturase, a fungal ω3-desaturase and / or a fungal Δ15-desaturase, a Δ6-desaturase, a Δ5-desaturase, a Δ6-elongase and a Δ5-elongase, or

[0170] ii) a Δ12-desaturase, a fungal ω3-desaturase and / or a fungal Δ15-desaturase, a Δ8-desaturase, a Δ5-desaturase, a Δ9-elongase and a Δ5-elongase,

[0171] Each polynucleotide is operably linked to one or more seed-specific promoters capable of directing expression of the polynucleotide in developing seeds of a plant, wherein the fatty acids comprise oleic acid, palmitic acid, ω6 fatty acids containing linoleic acid (LA) and gamma-linolenic acid (GLA), ω3 fatty acids containing alpha-linolenic acid (ALA), stearidonic acid (SDA) and docosapentaenoic acid (DPA), and optionally eicosapentaenoic acid (EPA) and / or eicosatetraenoic acid (ETA), and wherein the level of DPA in the total fatty acid content of the lipid is between 7% and 20%, or between 7% and 35%, between 20.1% and 30%, or between 20.1% and 35%, preferably between 30% and 35%.

[0172] Examples of oilseed plants include, but are not limited to, Brassica species, upland cotton, flax, sunflower species, safflower, soybean, maize, Arabidopsis thaliana, sorghum, oats, clover species, oil palm, Nicotiana benthamiana, barley, lupinus angustifolia, Asian cultivated rice, African cultivated rice, camelina or deep-sea camelina. In one embodiment, the plant is a Brassica species plant, camelina plant or soybean (soybean) plant. In one embodiment, the oilseed plant is rapeseed, Indian mustard, soybean, camelina or Arabidopsis plant. In an alternative embodiment, the oilseed plant is except Arabidopsis thaliana and / or except camelina. In one embodiment, the oilseed plant is a plant except soybean (soybean). In one embodiment, the oilseed plant is in a field or grown in a field or grown in a greenhouse under standard conditions, for example as described in Example 1.

[0173] In one embodiment, one or more of the desaturases is capable of utilizing an acyl-CoA substrate. In a preferred embodiment, one or more of the Δ6-desaturase, Δ5-desaturase, and Δ8-desaturase (if present) is capable of utilizing an acyl-CoA substrate, preferably i) the Δ6-desaturase and Δ5-desaturase or ii) each of the Δ5-desaturase and Δ8-desaturase is capable of utilizing an acyl-CoA substrate. In one embodiment, the Δ12-desaturase and / or the ω3-desaturase is capable of utilizing an acyl-CoA substrate. The acyl-CoA substrate is preferably ALA-CoA, ETA-CoA, DPA-CoA, ETrA-CoA, LA-CoA, GLA-CoA, or ARA-CoA.

[0174] In one embodiment, mature, harvested seeds of a plant, preferably a Brassica napus, Brassica juncea, or Camelina plant, have a DPA content of at least about 28 mg per gram of seed, preferably at least about 32 mg per gram of seed, at least about 36 mg per gram of seed, at least about 40 mg per gram of seed, more preferably at least about 44 mg per gram of seed, at least about 48 mg per gram of seed, about 80 mg per gram of seed, or between about 30 mg and about 80 mg per gram of seed.

[0175] In another aspect, the present invention provides a Brassica napus, B. juncea, or Camelina sativa plant capable of producing seeds comprising DPA, wherein mature, harvested seeds of the plant have a DPA content of at least about 28 mg per gram of seed, preferably at least about 32 mg per gram of seed, at least about 36 mg per gram of seed, at least about 40 mg per gram of seed, more preferably at least about 44 mg per gram of seed, at least about 48 mg per gram of seed, about 80 mg per gram of seed, or between about 30 mg and about 80 mg per gram of seed.

[0176] In another aspect, the present invention provides a plant cell of the plant of the present invention comprising an exogenous polynucleotide.

[0177] Also provided are plant parts (preferably seeds) or recombinant cells having one or more of the following characteristics:

[0178] i) from the plants of the present invention;

[0179] ii) comprises a lipid as defined herein; or

[0180] iii) can be used in the method of the present invention.

[0181] In one embodiment, the harvested Brassica napus, B. juncea or Camelina sativa seeds comprising DPA have a moisture content of between 4% and 15% by weight, preferably between 4% and 8% by weight, more preferably between 4% and 6% by weight, wherein the seeds have a DPA content of at least about 28 mg per gram of seed, preferably at least about 32 mg per gram of seed, at least about 36 mg per gram of seed, at least about 40 mg per gram of seed, more preferably at least about 44 mg per gram of seed or at least about 48 mg per gram of seed, about 80 mg per gram of seed or between about 30 mg and about 80 mg per gram of seed.

[0182] In one embodiment, the cell of the invention, the oilseed plant of the invention, the Brassica napus, B. juncea or Camelina plant of the invention, the plant part of the invention or the seed of the invention can be used to produce an extracted lipid comprising one or more or all of the characteristics defined herein.

[0183] In yet another aspect, the present invention provides a method of producing a plant useful for producing the extracted plant lipids of the present invention, the method comprising

[0184] a) determining the level of DPA in lipids produced by one or more plant parts (such as seeds) or recombinant cells from a plurality of plants or recombinant cells, each plant or recombinant cell comprising one or more exogenous polynucleotides encoding one of the following groups of enzymes;

[0185] i) ω3-desaturase, Δ6-desaturase, Δ5-desaturase, Δ6-elongase and Δ5-elongase;

[0186] ii) Δ15-desaturase, Δ6-desaturase, Δ5-desaturase, Δ6-elongase, and Δ5-elongase;

[0187] iii) Δ12-desaturase, Δ6-desaturase, Δ5-desaturase, Δ6-elongase, and Δ5-elongase;

[0188] iv) a Δ12-desaturase, an ω3-desaturase, or a Δ15-desaturase, a Δ6-desaturase, a Δ5-desaturase, a Δ6-elongase, and a Δ5-elongase;

[0189] v) ω3-desaturase, Δ8-desaturase, Δ5-desaturase, Δ9-elongase, and Δ5-elongase;

[0190] vi) Δ15-desaturase, Δ8-desaturase, Δ5-desaturase, Δ9-elongase, and Δ5-elongase;

[0191] vii) a Δ12-desaturase, a Δ8-desaturase, a Δ5-desaturase, a Δ9-elongase, and a Δ5-elongase; or

[0192] viii) a Δ12-desaturase, an ω3-desaturase, or a Δ15-desaturase, a Δ8-desaturase, a Δ5-desaturase, a Δ9-elongase, and a Δ5-elongase, wherein each polynucleotide is operably linked to one or more promoters capable of directing expression of the polynucleotide in a cell of a plant part; and

[0193] b) identifying plants or recombinant cells from a plurality of plants or recombinant cells that can be used to produce the extracted plant lipids or cellular lipids of the invention in one or more of the plant parts; and

[0194] c) Optionally, producing progeny plants or recombinant cells from the defined plant or recombinant cell or a seed thereof.

[0195] Preferably, the offspring plant is at least the second or third generation removed from the identified plant, and is preferably homozygous for one or more polynucleotides. More preferably, one or more polynucleotides are present in only a single insertion locus of the offspring plant. That is, the present invention provides this method that can be used as a screening method for identifying a plant or its seed from a plurality of transformed candidate plants or seeds, wherein the identified plant or its offspring plant produces the lipid of the present invention, preferably in its seed. If this plant or offspring plant or its seed produces the lipid of the present invention, specifically to have a specified DPA level, the plant or offspring plant or its seed is selected, or if it does not produce the lipid of the present invention, it is not selected.

[0196] In one embodiment, the combination of genetic construct, separation and / or exogenous polynucleotide, carrier, genetic construct or exogenous polynucleotide is stably integrated into the genome of plant or plant part (such as seed).Preferably, the combination of genetic construct, separation and / or exogenous polynucleotide, carrier, genetic construct or exogenous polynucleotide is stably integrated into the genome of plant or plant part (such as seed), at the single locus place of genome, and preferably for being isozygous for insertion.More preferably, plant, plant part or seed is characterized in that in addition, it lacks the exogenous polynucleotide except that one or more T-DNA molecules.That is, there is no exogenous carrier sequence to be integrated into the genome except that the T-DNA sequence.

[0197] In one embodiment, prior to step a), the method comprises introducing the one or more exogenous polynucleotides into one or more cells of the plant.

[0198] Also provided are plants produced using the methods of the invention and seeds of such plants.

[0199] In one embodiment, the plants of the present invention are male and female fertile, preferably having male and female fertility levels that are at least 70% or preferably about the same as those of corresponding wild-type plants. In one embodiment, pollen produced by the plants of the present invention or plants produced from the seeds of the present invention are 90%-100% viable, as determined by staining using a viability stain. For example, pollen viability can be assessed as described in Example 1.

[0200] In another aspect, the present invention provides a method of producing a seed, the method comprising:

[0201] a) growing the plants according to the invention or the plants producing the parts according to the invention, preferably in a field as part of a population of at least 1000 or 2000 or 3000 such plants or in an area of ​​at least 1 hectare or 2 hectares or 3 hectares planted at a standard planting density, or in a greenhouse under standard conditions;

[0202] b) harvesting seeds from the plant(s); and

[0203] c) optionally extracting lipids from the seeds, preferably to produce oil with a total DPA yield of at least 60 kg or 70 kg or 80 kg DPA per hectare.

[0204] In one embodiment, the plant, plant cell, plant part or seed or recombinant cell of the invention has one or more of the following characteristics:

[0205] i) the oil is as defined herein; or

[0206] ii) Plant parts or seeds or recombinant cells can be used in the methods of the invention.

[0207] For example, the seeds can be used to produce the plants of the present invention. The plants can be grown in the field or in a greenhouse under standard conditions, for example as described in Example 1.

[0208] In another aspect, the present invention provides a lipid or oil produced by or obtained from a cell of the invention, an oilseed plant of the invention, a Brassica species of the invention, a Brassica napus, a Brassica juncea, a soybean or a Camelina plant, a plant part of the invention, a seed of the invention, or a plant, plant cell, plant part or seed of the invention using a method of the invention. Preferably, the lipid or oil is purified to remove contaminants such as nucleic acids (DNA and / or RNA), proteins and / or carbohydrates or pigments such as chlorophyll. The lipid or oil can also be purified to enrich the proportion of TAGs, for example, by removing free fatty acids (FFA) or phospholipids.

[0209] In one embodiment, the lipid or oil is obtained by extracting oil from oilseeds. Examples of oils from oilseeds include, but are not limited to, rapeseed oil (Brassica rape, Brassica rapa ssp.), mustard oil (Brassica juncea), other Brassica oils, sunflower oil (Helianthus annus), linseed oil (Flax), soybean oil (Soybean), safflower oil (Safflower), corn oil (Zea mays), tobacco oil (Nicotiana tabacum), peanut oil (Arachis hypogaea), palm oil, cottonseed oil (Gossypium hirsutum), coconut oil (Coconut), avocado oil (Persea americana), olive oil (Olea europaea), cashew nut oil (Anacardium occidentale), macadamia nut oil (Macadamia intergrifolia), almond oil (Prunus amygdalus), or arabidopsis seed oil (Arabidopsis thaliana).

[0210] In another aspect, the present invention provides fatty acids produced or obtained using the methods of the present invention by a cell of the present invention, an oilseed plant of the present invention, a Brassica species of the present invention, Brassica napus, Brassica juncea, soybean or Camelina plant, a plant part of the present invention, a seed of the present invention, or a plant, plant cell, plant part or seed of the present invention. Preferably, the fatty acid is DPA. The fatty acid can be in a fatty acid mixture having a fatty acid composition as described herein, or can be enriched so that the fatty acid comprises at least 40% or at least 90% of the fatty acid content of the mixture. In one embodiment, the fatty acid is non-esterified. Alternatively, the fatty acid is esterified with, for example, a methyl, ethyl, propyl or butyl group.

[0211] Seed meal obtained from the seeds of the present invention is also provided. Preferred seed meal includes, but is not necessarily limited to, Brassica species, Brassica napus, Brassica juncea, Camelina sativa, or soybean seed meal. In one embodiment, the seed meal comprises one or more exogenous polynucleotides and / or genetic constructs as defined herein. In a preferred embodiment, the seed meal retains some lipid or oil produced in the seeds from which the seed meal was obtained after extraction of the majority of the lipid or oil, but at a low level (e.g., less than 2% by weight). The seed meal can be used as animal feed or as an ingredient in food production.

[0212] In another aspect, the present invention provides a composition comprising one or more of a lipid or oil of the invention, a fatty acid of the invention, a cell of the invention, an oilseed plant of the invention, a Brassica species of the invention, Brassica napus, Brassica juncea, Glycine max, or Camelina sativa plant of the invention, a plant part of the invention, a seed of the invention, or a seed meal of the invention. In embodiments, the composition comprises a carrier suitable for pharmaceutical, food, or agricultural use, a seed treatment compound, a fertilizer, another food or feed ingredient, or an added protein or vitamin.

[0213] Also provided are feedstocks, cosmetics, or chemicals comprising one or more of the lipids or oils of the invention, the fatty acids of the invention, the cells of the invention, the oilseed plants of the invention, the Brassica species of the invention, the Brassica napus, the Brassica juncea, the soybean, or the Camelina plant of the invention, the plant parts of the invention, the seeds of the invention, the seed meal of the invention, or the compositions of the invention. A preferred feedstock is an infant formula comprising the lipids and oils of the invention.

[0214] In another aspect, the present invention provides a method of producing a feedstock, preferably an infant formula, comprising mixing one or more of the lipid or oil of the invention, the fatty acid of the invention, the cell of the invention, the oilseed plant of the invention, the Brassica species of the invention, Brassica napus, Brassica juncea, soybean or Camelina plant of the invention, the plant part of the invention, the seed of the invention, the seed meal of the invention or the composition of the invention with at least one other food ingredient. The method may comprise the steps of blending, cooking, baking, extruding, emulsifying or otherwise formulating the feed or packaging the feed or analyzing the amount of lipid or oil in the feed.

[0215] In another aspect, the present invention provides a method for treating or preventing a condition that benefits from PUFAs (preferably DPA), the method comprising administering to a subject one or more of a lipid or oil of the invention, a fatty acid of the invention, a cell of the invention, an oilseed plant of the invention, a Brassica species of the invention, Brassica napus, Brassica juncea, soybean, or Camelina plant of the invention, a plant part of the invention, a seed of the invention, a seed meal of the invention, a composition of the invention, or a feed of the invention. In a preferred embodiment, the PUFA is administered in the form of a pharmaceutical composition comprising a PUFA ethyl ester. The subject can be a human or a non-human animal.

[0216] Examples of conditions that may benefit from PUFAs include, but are not limited to, elevated serum triglyceride levels, elevated serum cholesterol levels (e.g., elevated LDL cholesterol levels), cardiac arrhythmias, angioplasty, inflammation, asthma, psoriasis, osteoporosis, kidney stones, AIDS, multiple sclerosis, rheumatoid arthritis, Crohn's disease, schizophrenia, cancer, fetal alcohol syndrome, attention deficit hyperactivity disorder, cystic fibrosis, phenylketonuria, unipolar depression, aggressive hostility, adrenoleukodystrophy, coronary heart disease, hypertension, diabetes, obesity, Alzheimer's disease, chronic obstructive pulmonary disease, ulcerative colitis, restenosis after angioplasty, eczema, hypertension, platelet aggregation, gastrointestinal bleeding, endometriosis, premenstrual syndrome, myalgic encephalomyelitis, chronic fatigue following viral infection, or eye disease.

[0217] Also provided is the use of one or more of the lipid or oil of the invention, the fatty acid of the invention, the cell of the invention, the oilseed plant of the invention, the Brassica species of the invention, the Brassica napus, the Brassica juncea, the Glycine max or the Camelina plant of the invention, the plant part of the invention, the seed of the invention, the seed meal of the invention, the composition of the invention or the feed of the invention in the manufacture of a medicament for treating or preventing a condition that may benefit from a PUFA, preferably DPA.

[0218] The production of the medicament may include mixing the oil of the present invention with a pharmaceutically acceptable carrier for use in treating conditions as described herein. The method may include first purifying the oil and / or transesterifying and / or fractionating the oil to increase the level of DPA. In a specific embodiment, the method includes treating the lipid or oil, such as rapeseed oil, to convert the fatty acids in the oil into alkyl esters, such as methyl esters or ethyl esters. Further processing such as fractionation or distillation may be performed to enrich the lipid or oil for DPA. In a preferred embodiment, the medicament includes DPA ethyl ester. In an even more preferred embodiment, the DPA ethyl ester level in the medicament is between 30% and 50% or at least 80% or at least 90% or about 85% or about 95%. The medicament may additionally include EPA or DHA ethyl ester, such as between 30% and 50% or at least 90% of the total fatty acid content of the medicament. Such medicaments are suitable for administration to human or animal subjects for use in treating medical conditions as described herein.

[0219] In yet another aspect, the present invention provides a method of producing a seed hopper comprising:

[0220] a) mowing, laying down and / or harvesting the above-ground parts of plants comprising the seeds of the present invention;

[0221] b) threshing and / or winnowing the plant parts to separate the seeds from the rest of the plant parts; and

[0222] c) screening and / or sorting the seeds separated in step b), and loading the screened and / or sorted seeds into a hopper, thereby producing a seed hopper.

[0223] In one embodiment, where relevant, the lipids or oils (preferably seed oils) of or suitable for use in the present invention have fat levels similar to those provided in the tables of the Examples section.

[0224] Unless expressly stated otherwise, any embodiment herein should be construed to apply mutatis mutandis to any other embodiment.

[0225] The present invention is not to be limited in scope by the specific embodiments described herein, which are intended for purposes of illustration only. Functionally equivalent products, compositions, and methods are clearly within the scope of the invention as described herein.

[0226] In this specification, reference to an individual step, composition of matter, group of steps, or group of compositions of matter shall be considered to encompass both one and multiple (i.e., one or more) of those steps, compositions of matter, groups of steps, or groups of compositions of matter, unless specifically stated otherwise or the context requires otherwise.

[0227] In the following, the invention is described by means of the following non-limiting examples and with reference to the accompanying drawings. BRIEF DESCRIPTION OF THE DRAWINGS

[0228] Figure 1 .Aerobic DPA biosynthesis pathway.

[0229] Figure 2Map of the T-DNA insertion region between the left and right borders of pJP3416-GA7. RB indicates the right border; LB, the left border; TER, the transcription terminator / polyadenylation region; PRO, the promoter. The coding region is indicated above the arrow, and the promoter and terminator are below the arrow. Micpu-Δ6D, Micromonas pusilla Δ6-desaturase; Pyrco-Δ6E, Pyramimonas cordata Δ6-elongase; Pavsa-Δ5D, Pavlova salina Δ5-desaturase; Picpa-ω3D, Pichia pastoris ω3-desaturase; Pavsa-Δ4D, Pavlova salina Δ4-desaturase; Lackl-Δ12D, budding yeast (Lachancea kluyveri) Δ12-desaturase; Pyrco-Δ5E, Pyramimonas cordata Δ5-elongase. NOS indicates the Agrobacterium tumefaciens nopaline synthase transcription terminator / polyadenylation region; FP1, truncated napin promoter from Brassica napus; FAE1, Arabidopsis thaliana FAE1 promoter; lectin, soybean lectin transcription terminator / polyadenylation region; Cnl1 and Cnl2 indicate the flax conlinin1 or conlinin2 promoter or terminator. MAR indicates the Rb7 matrix binding region from Nicotiana tabacum.

[0230] Figure 3 . A map of the T-DNA insertion region between the left and right borders of pJP3404. Labels are as follows Figure 2 middle.

[0231] Figure 4 . The insertion region between the left and right borders of pJP3367. Labels are as follows Figure 2 middle.

[0232] Figure 5 (A) Basic phytosterol structures with ring and side chain numbering. (B) Chemical structures of some phytosterols.

[0233] Figure 6Map of the T-DNA insertion region between the left and right borders of pJP3662. RB indicates the right border; LB, the left border; TER, the transcription terminator / polyadenylation region; PRO, the promoter. The coding region is indicated above the arrow, with the promoter and terminator below. Micpu-Δ6D, Micromonas pusillus Δ6-desaturase; Pyrco-Δ6E, Pyramimonas cordiformis Δ6-elongase; Pavsa-Δ5D, Pavlova salina Δ5-desaturase; Picpa-ω3D, Pichia pastoris ω3-desaturase; Lackl-Δ12D, the budding yeast Δ12-desaturase; Pyrco-Δ5E, Pyramimonas cordiformis Δ5-elongase. NOS indicates the Agrobacterium tumefaciens nopaline synthase transcription terminator / polyadenylation region; FP1, truncated napin promoter from Brassica napus; FAE1, Arabidopsis thaliana FAE1 promoter; lectin, soybean lectin transcription terminator / polyadenylation region; Cn11 indicates the flax conlinin1 promoter or terminator. MAR indicates the Rb7 matrix binding region from Nicotiana tabacum.

[0234] Description of Sequence Listing

[0235] SEQ ID NO: 1 - pJP3416-GA7 nucleotide sequence.

[0236] SEQ ID NO: 2—pGA7-mod_B nucleotide sequence.

[0237] SEQ ID NO:3—Codon-optimized open reading frame for expression of budding yeast Δ12 desaturase in plants.

[0238] SEQ ID NO:4 - Budding yeast Δ12-desaturase.

[0239] SEQ ID NO:5—Codon-optimized open reading frame for expression of Pichia pastoris ω3 desaturase in plants.

[0240] SEQ ID NO: 6 - Pichia pastoris ω3 desaturase.

[0241] SEQ ID NO:7—Open reading frame encoding Micromonas pusilla Δ6-desaturase.

[0242] SEQ ID NO:8—Codon-optimized open reading frame for expression of the Micromonas pusillus Δ6-desaturase in plants (version 1).

[0243] SEQ ID NO:9—Codon-optimized open reading frame for expression of the Micromonas pusillus Δ6-desaturase in plants (version 2).

[0244] SEQ ID NO: 10—Micromonas pusilla delta-6 desaturase.

[0245] SEQ ID NO: 11—Open reading frame encoding Ostreococcus lucimarinus Δ6-desaturase.

[0246] SEQ ID NO: 12—Codon-optimized open reading frame for expression of a green dinoflagellate Δ6-desaturase in plants.

[0247] SEQ ID NO:13 - Green dinoflagellates Δ6-desaturase.

[0248] SEQ ID NO: 14—Ostreococcus tauri Δ6-desaturase.

[0249] SEQ ID NO: 15—Open reading frame encoding the Pyramimonas cordiformis Δ6-elongase.

[0250] SEQ ID NO: 16—Codon-optimized open reading frame for expression of the Pyramimonas cordiformis Δ6-elongase in plants (truncated at the 3' end and encoding a functional elongase) (version 1).

[0251] SEQ ID NO: 17—Codon-optimized open reading frame for expression of the Pyramimonas cordiformis Δ6-elongase in plants (truncated at the 3' end and encoding a functional elongase) (version 2).

[0252] SEQ ID NO: 18—Codon-optimized open reading frame for expression of the Pyramimonas cordiformis Δ6-elongase in plants (truncated at the 3' end and encoding a functional elongase) (version 3).

[0253] SEQ ID NO: 19—Pyramimonas cordiformis Δ6-elongase.

[0254] SEQ ID NO:20—Truncate Pyramimonas cordiformis Δ6-elongase.

[0255] SEQ ID NO:21—Open reading frame encoding Pavlova salina Δ5-desaturase.

[0256] SEQ ID NO:22—Codon-optimized open reading frame for expression of Pavlova salina Δ5-desaturase in plants (version 1).

[0257] SEQ ID NO:23—Codon-optimized open reading frame for expression of Pavlova salina Δ5-desaturase in plants (version 2).

[0258] SEQ ID NO:24—Pavlova salina Δ5-desaturase.

[0259] SEQ ID NO:25—Open reading frame encoding the Pyramimonas cordiformis Δ5-desaturase.

[0260] SEQ ID NO:26—Pyramimonas cordiformis Δ5-desaturase.

[0261] SEQ ID NO:27—Open reading frame encoding the Pyramimonas cordiformis Δ5-elongase.

[0262] SEQ ID NO:28—Codon-optimized open reading frame for expression of the Pyramimonas cordiformis Δ5-elongase in plants (version 1).

[0263] SEQ ID NO:29—Codon-optimized open reading frame for expression of the Pyramimonas cordiformis Δ5-elongase in plants (version 2).

[0264] SEQ ID NO:30—Codon-optimized open reading frame for expression of the Pyramimonas cordiformis Δ5-elongase in plants (version 3).

[0265] SEQ ID NO:31—Pyramimonas cordiformis Δ5-elongase.

[0266] SEQ ID NO:32—Open reading frame encoding the Isochrysis galbana Δ9-elongase.

[0267] SEQ ID NO:33—Isochrysis galbana Δ9-elongase.

[0268] SEQ ID NO:34—Open reading frame encoding Emiliania huxleyi CCMP1516 Δ9-elongase.

[0269] SEQ ID NO:35—Codon-optimized open reading frame for expression of the Coleoptera huxleyi Δ9-elongase in plants.

[0270] SEQ ID NO:36—Colobus herxovii CCMP1516 Δ9-elongase.

[0271] SEQ ID NO:37—Open reading frame encoding Pavlova pinguis Δ9-elongase.

[0272] SEQ ID NO:38—Pavlova pinguis Δ9-elongase.

[0273] SEQ ID NO:39—Open reading frame encoding Pavlova salina Δ9-elongase.

[0274] SEQ ID NO:40—Pavlova salina Δ9-elongase.

[0275] SEQ ID NO:41—Open reading frame encoding Pavlova salina Δ8-desaturase.

[0276] SEQ ID NO:42—Pavlova salina Δ8-desaturase.

[0277] SEQ ID NOs: 43 to 51 —Oligonucleotide primers / probes. DETAILED DESCRIPTION

[0278] General Techniques and Definitions

[0279] Unless specifically defined otherwise, all technical and scientific terms used herein should be interpreted as having the same meaning as commonly understood by one of ordinary skill in the art (e.g., in cell culture, molecular genetics, fatty acid synthesis, transgenic plants, protein chemistry, and biochemistry).

[0280] Unless otherwise indicated, the recombinant protein, cell culture, and immunological techniques utilized in the present invention are standard procedures well known to those skilled in the art. Such techniques are described and illustrated in the literature in resources such as: J. Perbal, A Practical Guide to Molecular Cloning, John Wiley and Sons (1984); J. Sambrook et al., Molecular Cloning: A Laboratory Manual, Cold Spring Harbour Laboratory Press (1989); T. A. Brown (editor), Essential Molecular Biology: A Practical Approach, Volumes 1 and 2, IRL Press (1991); D. M. Glover and B. D. Hames (editor), DNA Cloning: A Practical Approach, Volumes 1-4, IRL Press (1995 and 1996); F. M. Ausubel et al. (editor), Current Protocols in Molecular Biology, Greene Pub. Associates and Wiley-Interscience (1988, including all updated editions to date); Ed. Harlow and David Lane (editor), Antibodies: A Laboratory Manual, Cold Spring Harbour Laboratory Press (1989); Harbour Laboratory, (1988); and JE Coligan et al. (editor), Current Protocols in Immunology, John Wiley & Sons (including all updated editions to date).

[0281] The term "and / or," such as "X and / or Y," should be understood to mean "X and Y" or "X or Y," and will be used to provide explicit support for both meanings or for either meaning.

[0282] Unless stated to the contrary, the term "about" as used herein means + / - 10%, more preferably + / - 5%, even more preferably + / - 1% of the specified value.

[0283] Throughout this specification, the word "comprise" or variations such as "comprises" or "comprising" will be understood to imply the inclusion of a stated element, integer or step, or group of elements, integers or steps, but not the exclusion of any other element, integer or step, or group of elements, integers or steps.

[0284] Selected definition

[0285] As used herein, the terms "extracted plant lipid" and "isolated plant lipid" refer to a lipid composition that has been extracted from a plant or part thereof (such as a seed), for example, by crushing. The extracted lipid can be a relatively crude composition obtained, for example, by crushing plant seeds, or a more pure composition in which most, if not all, of the water, nucleic acids, proteins, and carbohydrates derived from the plant material have been removed. Examples of purification methods are described below. In one embodiment, the extracted or isolated plant lipid comprises at least about 60%, at least about 70%, at least about 80%, at least about 90%, or at least about 95% (w / w) lipid by weight of the composition. The lipid can be solid or liquid at room temperature, in which case it is considered an oil. In one embodiment, the extracted lipid of the present invention is not blended with another lipid produced from another source, such as DPA (e.g., DPA from fish oil). In one embodiment, after extraction, the ratio of one or more of oleic acid to DPA, palmitic acid to DPA, linoleic acid to DPA, and total ω6 fatty acids: total ω3 fatty acids is not significantly altered (e.g., no more than 10% or 5% change) when compared to the ratio within the intact seed or cell. In another embodiment, the extracted plant lipid is not exposed to procedures such as hydrogenation or fractionation that may alter the ratio of one or more of oleic acid to DPA, palmitic acid to DPA, linoleic acid to DPA, and total ω6 fatty acids: total ω3 fatty acids when compared to the ratio within the intact seed or cell. When the extracted plant lipid of the present invention is included in an oil, the oil may additionally include non-fatty acid molecules such as sterols.

[0286] As used herein, the terms "extracted vegetable oil" and "isolated vegetable oil" refer to a substance or composition that comprises extracted plant lipids or isolated plant lipids and is liquid at room temperature. The oil is obtained from a plant or part thereof (such as a seed). The extracted or isolated oil can be a relatively coarse composition obtained, for example, by crushing plant seeds, or a purer composition in which most, if not all, of the water, nucleic acids, proteins, and carbohydrates derived from the plant material have been removed. The composition may contain other components that are lipids or non-lipids. In one embodiment, the oil composition comprises at least about 60%, at least about 70%, at least about 80%, at least about 90%, or at least about 95% (w / w) extracted plant lipids. In one embodiment, the extracted oil of the present invention is not blended with another oil such as DPA (e.g., DPA from fish oil) produced by another source. In one embodiment, after extraction, the ratio of one or more of oleic acid to DPA, palmitic acid to DPA, linoleic acid to DPA, and total ω6 fatty acids: total ω3 fatty acids is not significantly altered (e.g., no more than a 10% or 5% change) when compared to the ratio within the intact seed or cell. In another embodiment, the extracted vegetable oil is not exposed to procedures such as hydrogenation or fractionation that can alter the ratio of one or more of oleic acid to DPA, palmitic acid to DPA, linoleic acid to DPA, and total ω6 fatty acids: total ω3 fatty acids when compared to the ratio within the intact seed or cell. The extracted vegetable oils of the present invention may contain non-fatty acid molecules such as sterols.

[0287] As used herein, "oil" is a composition that primarily comprises lipids and is liquid at room temperature. For example, the oil of the present invention preferably comprises at least 75%, at least 80%, at least 85%, or at least 90% lipids by weight. Typically, the purified oil comprises at least 90% triacylglycerols (TAGs) by weight of the lipids in the oil. Minor components of the oil, such as diacylglycerols (DAGs), free fatty acids (FFA), phospholipids, and sterols, may be present as described herein.

[0288] As used herein, the term "fatty acid" refers to a saturated or unsaturated carboxylic acid (or organic acid) typically having a long aliphatic tail. Typically, fatty acids have a carbon-carbon chain of at least 8 carbon atoms, more preferably at least 12 carbon atoms. Preferred fatty acids of the present invention have a carbon chain of 18-22 carbon atoms (C18, C20, C22 fatty acids), more preferably 20-22 carbon atoms (C20, C22), and most preferably 22 carbon atoms (C22). Most naturally occurring fatty acids have an even number of carbon atoms because their biosynthesis involves acetate with two carbon atoms. Fatty acids can be in a free state (non-esterified) or in an esterified form such as a triglyceride, diacylglycerol, monoacylglycerol, acyl-CoA (thioester) or other bonded forms. Fatty acids can be esterified to phospholipids, such as phosphatidylcholine, phosphatidylethanolamine, phosphatidylserine, phosphatidylglycerol, phosphatidylinositol, or diphosphatidylglycerol. In one embodiment, the fatty acid is esterified with a methyl or ethyl group, such as a methyl or ethyl ester of a C20 or C22 PUFA. Preferred fatty acids are methyl or ethyl esters of EPA, DPA or DHA or a mixture EPA and DHA or EPA, DPA and DHA or EPA and DPA.

[0289] "Saturated fatty acids" do not contain any double bonds or other functional groups along the chain. The term "saturated" refers to hydrogen, i.e., all carbons (except the carboxylic acid [-COOH] group) contain as many hydrogens as possible. In other words, the Ω (ω) end contains 3 hydrogens (CH3-) and each carbon in the chain contains 2 hydrogens (-CH2-).

[0290] "Unsaturated fatty acids" have a similar form to saturated fatty acids, except that one or more olefin functional groups are present along the chain, wherein each olefin replaces the single bond "-CH2-CH2-" portion of the chain with a double bond "-CH=CH-" portion (i.e., a carbon double-bonded to another carbon). The two adjacent carbon atoms at either end of the chain bound to the double bond are in either a cis or trans configuration, preferably a cis configuration. In one embodiment, the lipids or oils of the present invention have a fatty acid composition that comprises less than 1% fatty acids having carbon-carbon double bonds in a trans configuration (trans fatty acids).

[0291] As used herein, the term "monounsaturated fatty acid" refers to a fatty acid comprising at least 12 carbon atoms in its carbon chain and only one olefin group (carbon-carbon double bond) in the chain. As used herein, the term "polyunsaturated fatty acid" or "PUFA" refers to a fatty acid comprising at least 12 carbon atoms and at least two olefin groups (carbon-carbon double bonds) in its carbon chain.

[0292] As used herein, the terms "long-chain polyunsaturated fatty acids" and "LC-PUFAs" refer to fatty acids comprising at least 20 carbon atoms and at least two carbon-carbon double bonds in their carbon chains and therefore include VLC-PUFAs. As used herein, the terms "very long-chain polyunsaturated fatty acids" and "VLC-PUFAs" refer to fatty acids comprising at least 22 carbon atoms and at least three carbon-carbon double bonds in their carbon chains. Typically, the number of carbon atoms in a fatty acid carbon chain refers to the unbranched carbon chain. If the carbon chain is branched, the number of carbon atoms excludes those carbon atoms in the side groups. In one embodiment, the long-chain polyunsaturated fatty acid is a tω3 fatty acid, i.e., there is a desaturation (carbon-carbon double bond) at the third carbon-carbon bond from the methyl end of the fatty acid. In another embodiment, the long-chain polyunsaturated fatty acid is an ω6 fatty acid, i.e., there is a desaturation (carbon-carbon double bond) at the sixth carbon-carbon bond from the methyl end of the fatty acid. In another embodiment, the long-chain polyunsaturated fatty acid is selected from the group consisting of arachidonic acid (ARA, 20: 4Δ5,8,11,14; ω6), eicosatetraenoic acid (ETA, 20: 4Δ8,11,14,17, ω3), eicosapentaenoic acid (EPA, 20: 5Δ5,8,11,14,17; ω3), docosapentaenoic acid (DPA, 22: 5Δ7,10,13,16,19, ω3), or docosahexaenoic acid (DHA, 22: 6Δ4,7,10,13,16,19, ω3). The LC-PUFA may also be dihomo-γ-linoleic acid (DGLA) or eicosatrienoic acid (ETrA, 20: 3Δ11,14,17, ω3). It will be apparent that the LC-PUFA produced according to the present invention may be a mixture of any or all of the above and may include other LC-PUFAs or derivatives of any of these LC-PUFAs. In a preferred embodiment, the ω3 fatty acid is at least DPA, preferably DPA and DHA or EPA, DPA and DHA. As extracted from plants, DPA is present in the lipid or oil at a level of between 7% and 20% or between 7% and 35%, preferably between 20.1% and 30% or between 20.1% and 35%, preferably between 30% and 35%, of the total fatty acid composition. For example, DPA is present at a level of between 30.1% and 35% of the total fatty acid composition. In one embodiment, the level of DPA is greater than the level of EPA.

[0293] Furthermore, as used herein, the terms "long-chain polyunsaturated fatty acids" (LC-PUFAs) and "very long-chain polyunsaturated fatty acids" (VLC-PUFAs) refer to fatty acids in a free state (non-esterified) or in an esterified form, such as in triglycerides (triacylglycerols), diacylglycerols, monoacylglycerols, acyl-CoA-bound, or other bound forms. In triglycerides, LC-PUFAs or VLC-PUFAs (such as DPA) can be esterified at the sn-1 / 3 or sn-2 positions, or the triglyceride can contain two or three acyl groups selected from LC-PUFA and VLC-PUFA acyl groups. For example, a triglyceride can contain DPA at both the sn-1 and sn-3 positions. Fatty acids can be esterified in the form of phospholipids, such as phosphatidylcholine (PC), phosphatidylethanolamine, phosphatidylserine, phosphatidylglycerol, phosphatidylinositol, or diphosphatidylglycerol. Thus, LC-PUFAs are present as a mixture in cellular lipids or in purified oils or lipids extracted from cells, tissues, or organisms. In a preferred embodiment, the present invention provides an oil comprising at least 75% or at least 85% triacylglycerols, wherein the remainder is present as other forms of lipids (such as those mentioned), wherein at least the triacylglycerols comprise LC-PUFAs. Subsequently, the oil can be further purified or treated, for example by hydrolysis with a strong base to release free fatty acids or by transesterification, fractionation, etc.

[0294] As used herein, "total ω6 fatty acids" or "total ω6 fatty acid content" or the like refers to the total amount of all ω6 fatty acids, both esterified and non-esterified, in an extracted lipid, oil, recombinant cell, plant part, or seed, expressed as a percentage of the total fatty acid content as determined by the context. These ω6 fatty acids include, if present, LA, GLA, DGLA, ARA, EDA, and ω6-DPA, and exclude any ω3 fatty acids and monounsaturated fatty acids. The ω6 fatty acids present in the plants, seeds, lipids, or oils of the present invention are all included in the category of polyunsaturated fatty acids (PUFAs).

[0295] As used herein, "new ω6 fatty acids" or "new ω6 fatty acid content" and the like refer to the total amount of all ω6 fatty acids excluding LA, both esterified and non-esterified, in an extracted lipid, oil, recombinant cell, plant part or seed, as determined by the context, expressed as a percentage of the total fatty acid content. These new ω6 fatty acids are fatty acids produced in the cells, plants, plant parts and seeds of the present invention by expression of a genetic construct (exogenous polynucleotide) introduced into the cell, and include (if present) GLA, DGLA, ARA, EDA and ω6-DPA, but exclude LA and any ω3 fatty acids and monounsaturated fatty acids. Exemplary total ω6 fatty acid content and new ω6 fatty acid content are determined by converting the fatty acids in the sample into FAMEs and analyzing by GC, as described in Example 1.

[0296] As used herein, "total ω3 fatty acids" or "total ω3 fatty acid content" and the like refer to the total amount of all ω3 fatty acids, both esterified and non-esterified, in an extracted lipid, oil, recombinant cell, plant part, or seed, expressed as a percentage of the total fatty acid content, as determined by the context. These ω3 fatty acids include, if present, ALA, SDA, ETrA, ETA, EPA, DPA, and DHA, and exclude any ω6 fatty acids and monounsaturated fatty acids. The ω3 fatty acids present in the plants, seeds, lipids, or oils of the present invention are all included in the category of polyunsaturated fatty acids (PUFAs).

[0297] As used herein, "new ω3 fatty acids" or "new ω3 fatty acid content" and the like refer to the total amount of all ω3 fatty acids, excluding ALA, in an extracted lipid, oil, recombinant cell, plant part or seed, both esterified and non-esterified, expressed as a percentage of the total fatty acid content. These new ω3 fatty acids are ω3 fatty acids produced in the cells, plants, plant parts and seeds of the present invention by expression of a genetic construct (exogenous polynucleotide) introduced into the cell, and include (if present) SDA, ETrA, ETA, EPA, DPA and DHA, but exclude ALA and any ω6 fatty acids and monounsaturated fatty acids. Exemplary total ω3 fatty acid content and new ω3 fatty acid content are determined by converting the fatty acids in the sample into FAMEs and analyzing by GC, as described in Example 1.

[0298] As will be appreciated by those skilled in the art, the term "obtaining plant parts" as a step in the methods of the present invention may include obtaining one or more plant parts for use in the methods. Obtaining plant parts includes, for example, harvesting plant parts from plants using a mechanical harvester or purchasing plant parts from a supplier or receiving plant parts. In another embodiment, obtaining plant parts may be obtaining plants from some other person who has harvested plant parts.

[0299] The desaturase, elongase, and acyltransferase proteins and genes encoding them useful in the present invention are any of those known in the art, or homologs or derivatives thereof. Examples of such genes and the sizes of the encoded proteins are listed in Table 1. The desaturases shown to be involved in LC-PUFA biosynthesis all belong to the group of so-called "front-end" desaturases. Preferred proteins or combinations of proteins are those encoded by the genetic constructs provided herein as SEQ ID NOs: 1 and 2.

[0300] As used herein, the term "front-end desaturase" refers to a member of a class of enzymes that introduce a double bond between the carboxyl group of the acyl chain of a lipid and a pre-existing unsaturated moiety and are structurally characterized by the presence of an N-terminal cytochrome b5 domain together with a typical fatty acid desaturase domain containing three highly conserved histidine boxes (Napier et al., 1997).

[0301] The activity of any elongase or desaturase used in the present invention can be tested by expressing a gene encoding the enzyme in a cell, such as, for example, a plant cell, or preferably, a somatic embryo or a transgenic plant, and determining whether the cell, embryo or plant has an increased ability to produce LC-PUFAs compared to a comparable cell, embryo or plant in which the enzyme is not expressed.

[0302] In one embodiment, one or more of the desaturases and / or elongases used in the present invention can be purified from microalgae, ie, the amino acid sequence is identical to a polypeptide that can be purified from microalgae.

[0303] While certain enzymes are specifically described herein as "bifunctional," the absence of this term does not necessarily imply that a particular enzyme has no activities other than the specifically defined activities.

[0304] Desaturase

[0305] As used herein, the term "desaturase" refers to an enzyme that is capable of introducing a carbon-carbon double bond into the acyl group of a fatty acid substrate, typically in an esterified form (e.g., an acyl-CoA ester). The acyl group can be esterified with a phospholipid, such as phosphatidylcholine (PC), or with an acyl carrier protein (ACP), or in a preferred embodiment, with CoA. Thus, desaturases are generally divided into three groups. In one embodiment, the desaturase is a front-end desaturase.

[0306] As used herein, a "Δ4-desaturase" refers to a protein that performs a desaturase reaction that introduces a carbon-carbon double bond at the fourth carbon-carbon bond from the carboxyl terminus of a fatty acid substrate. A "Δ4-desaturase" is at least capable of converting DPA to DHA. Preferably, a "Δ4-desaturase" is capable of converting DPA-CoA to DHA-CoA, i.e., it is an acyl-CoA desaturase. In one embodiment, a "Δ4-desaturase" is capable of converting DPA esterified at the sn-2 position of PC to DHA-PC. Preferably, the Δ4-desaturase has greater activity towards DPA-CoA than towards DPA-PC. The desaturation step in producing DHA from DPA is catalyzed by Δ4-desaturases in organisms other than mammals, and genes encoding such enzymes have been isolated from the freshwater protist species Euglena and the marine species Chytridium species (Qiu et al., 2001; Meyer et al., 2003). In one embodiment, the Δ4-desaturase comprises amino acids of a Pavlova salina Δ4-desaturase or a Chytridium sp. Δ4-desaturase, a biologically active fragment thereof, or an amino acid sequence that is at least 80% identical to a Pavlova salina Δ4-desaturase.

[0307] Table 1. Cloned genes involved in LC-PUFA biosynthesis

[0308]

[0309]

[0310]

[0311]

[0312]

[0313] *http: / / www.ncbi.nlm.nih.gov / **Function not confirmed / not demonstrated

[0314] As used herein, a "Δ5-desaturase" refers to a protein that performs a desaturase reaction that introduces a carbon-carbon double bond at the fifth carbon-carbon bond from the carboxyl terminus of a fatty acid substrate. In one embodiment, the fatty acid substrate is ETA and the enzyme produces EPA. Preferably, the "Δ5-desaturase" is capable of converting ETA-CoA to EPA-CoA, i.e., it is an acyl-CoA desaturase. In one embodiment, the "Δ5-desaturase" is capable of converting ETA esterified at the sn-2 position of PC. Preferably, the Δ5-desaturase has greater activity towards ETA-CoA than towards ETA-PC. Examples of Δ5-desaturases are listed in Ruiz-Lopez et al. (2012) and Petrie et al. (2010a), as well as in Table 1 herein. In one embodiment, the Δ5-desaturase comprises an amino acid sequence having the sequence provided as SEQ ID NO: 24, a biologically active fragment thereof, or an amino acid sequence at least 80% identical to SEQ ID NO: 24. In another embodiment, the Δ5-desaturase comprises an amino acid sequence having a sequence as provided in SEQ ID NO: 26, a biologically active fragment thereof, or an amino acid sequence at least 53% identical to SEQ ID NO: 26. In another embodiment, the Δ5-desaturase is from a Chytridium species or Corydorassium huxleyi.

[0315] As used herein, a "Δ6-desaturase" refers to a protein that performs a desaturase reaction that introduces a carbon-carbon double bond at the sixth carbon-carbon bond from the carboxyl terminus of a fatty acid substrate. In one embodiment, the fatty acid substrate is ALA and the enzyme produces SDA. Preferably, the "Δ6-desaturase" is capable of converting ALA-CoA to SDA-CoA, i.e., it is an acyl-CoA desaturase. In one embodiment, the "Δ6-desaturase" is capable of converting ALA esterified at the sn-2 position of PC. Preferably, the Δ6-desaturase has greater activity on ALA-CoA than on ALA-PC. The Δ6-desaturase may also have activity as a Δ5-desaturase, referred to as a Δ5 / Δ6 bifunctional desaturase, provided that its Δ6-desaturase activity on ALA is greater than its Δ5-desaturase activity on ETA. Examples of Δ6-desaturases are listed in Ruiz-Lopez et al. (2012) and Petrie et al. (2010a) and in Table 1 herein. Preferred Δ6-desaturases are from Microcystis pusilla, Pythium malus or marine microalgae.

[0316] In one embodiment, the Δ6 desaturase is further characterized by having at least two, preferably all three, of the following, preferably in a plant cell: i) greater Δ6-desaturase activity on α-linolenic acid (ALA, 18:3Δ9, 12, 15, ω3) as a fatty acid substrate than on linoleic acid (LA, 18:2Δ9, 12, ω6); ii) greater Δ6-desaturase activity on ALA-CoA as a fatty acid substrate than on ALA attached to the sn-2 position of PC as a fatty acid substrate; and iii) Δ8-desaturase activity on ETrA. Examples of such Δ6-desaturases are provided in Table 2.

[0317] In one embodiment, the Δ6-desaturase has greater activity on an ω3 substrate than on the corresponding ω6 substrate and has activity on ALA to produce stearidonic acid (SDA, 18:4 Δ6, 9, 12, 15, ω3) with an efficiency of at least 30%, more preferably at least 40%, or most preferably at least 50% (when expressed from an exogenous polynucleotide in a recombinant cell, such as a plant cell), or at least 35% (when expressed in a yeast cell). In one embodiment, the Δ6-desaturase has greater activity on ALA as a fatty acid substrate than on LA, e.g., at least about 2-fold greater Δ6-desaturase activity. In another embodiment, the Δ6-desaturase has greater activity on ALA-CoA as a fatty acid substrate than on ALA attached to the sn-2 position of PC as a fatty acid substrate, e.g., at least about 5-fold greater Δ6-desaturase activity or at least 10-fold greater activity. In another embodiment, the [Delta]6-desaturase has activity on both the fatty acid substrate ALA-CoA and on ALA linked to the sn-2 position of PC.

[0318] Table 2. Desaturases Demonstrated Activity on Acyl-CoA Substrates

[0319]

[0320]

[0321] In one embodiment, the Δ6-desaturase has no detectable Δ5-desaturase activity towards ETA. In another embodiment, the Δ6-desaturase comprises an amino acid sequence having a sequence as provided in SEQ ID NO: 10, SEQ ID NO: 13 or SEQ ID NO: 14, a biologically active fragment thereof, or an amino acid sequence at least 77% identical to SEQ ID NO: 10, SEQ ID NO: 13 or SEQ ID NO: 14. In another embodiment, the Δ6-desaturase comprises an amino acid sequence having a sequence as provided in SEQ ID NO: 13 or SEQ ID NO: 14, a biologically active fragment thereof, or an amino acid sequence at least 67% identical to either or both of SEQ ID NO: 13 or SEQ ID NO: 14. The Δ6-desaturase may also have Δ8-desaturase activity.

[0322] As used herein, a "Δ8-desaturase" refers to a protein that performs a desaturase reaction that introduces a carbon-carbon double bond at the eighth carbon-carbon bond from the carboxyl terminus of a fatty acid substrate. A Δ8-desaturase is at least capable of converting ETrA to ETA. Preferably, a "Δ8-desaturase" is capable of converting ETrA-CoA to ETA-CoA, i.e., it is an acyl-CoA desaturase. In one embodiment, a "Δ8-desaturase" is capable of converting ETrA esterified at the sn-2 position of PC. Preferably, the Δ8-desaturase has greater activity on ETrA-CoA than on ETrA-PC. The Δ8-desaturase may also have activity as a Δ6-desaturase, referred to as a Δ6 / Δ8 bifunctional desaturase, provided that its Δ8-desaturase activity on ETrA is greater than its Δ6-desaturase activity on ALA. Examples of Δ8-desaturases are listed in Table 1. In one embodiment, the Δ8-desaturase comprises an amino acid sequence having a sequence as provided in SEQ ID NO:42, a biologically active fragment thereof, or an amino acid sequence at least 80% identical to SEQ ID NO:42.

[0323] As used herein, "ω3-desaturase" refers to a protein that performs a desaturase reaction that introduces a carbon-carbon double bond at the third carbon-carbon bond from the methyl end of a fatty acid substrate. Thus, an ω3-desaturase can convert LA to ALA and GLA to SDA (all C18 fatty acids) or DGLA to ETA and / or ARA to EPA (C20 fatty acids). Some ω3-desaturases (Group I) have activity only on C18 substrates, such as plant and cyanobacterial ω3-desaturases. Such ω3-desaturases are also Δ15-desaturases. Other ω3-desaturases have activity on C20 substrates but no activity on C18 substrates (Group II) or have some activity on C18 substrates (Group III). Such ω3-desaturases are also Δ17-desaturases. Preferred ω3-desaturases are those of Group III type that convert LA to ALA, GLA to SDA, DGLA to ETA, and ARA to EPA, such as the Pichia pastoris ω3-desaturase (SEQ ID NO: 6). Examples of ω3-desaturases include those described by Pereira et al. (2004a) (Saprolegnia divaricata ω3-desaturase, Group II), Horiguchi et al. (1998), Berberich et al. (1998), and Spychalla et al. (1997) (Caenorhabditis elegans ω3-desaturase, Group III). In a preferred embodiment, the ω3-desaturase is a fungal ω3-desaturase. As used herein, "fungal ω3-desaturase" refers to an ω3-desaturase from a fungal source (including an Oomycete source) or a variant thereof having an amino acid sequence that is at least 95% identical thereto. Genes encoding various ω3-desaturases have been isolated from fungal sources, such as, for example, Phytophthora infestans (Accession No. CAJ30870, WO2005083053), Saprolegnia heteroclada (Accession No. AAR20444, Pereira et al., 2004a and U.S. Patent No. 7211656), Pythium maltodendron (WO2008022963, Group II), Mortierella alpina (Sakuradani et al., 2005; Accession No. BAD91495; WO2006019192), Thalassiosira pseudonana (Armbrust et al., 2004; Accession No. XP_002291057; WO2005012316), and budding yeast (also known as Saccharomyces kluyveri; Oura et al., 2004; Accession No. AB118663). Xue et al. (2012) described ω3-desaturases from the oomycetes Pythium aphanidermatum, Phytophthora sojae, and Psoralea corylifolia that were able to efficiently convert ω6 fatty acid substrates into the corresponding ω3 fatty acids (preferably for C20 substrates), i.e., they had stronger Δ17-desaturase activity than Δ15-desaturase activity.These enzymes lack Δ12-desaturase activity but can use fatty acids in both acyl-CoA and phospholipid fractions as substrates.

[0324] In a more preferred embodiment, the fungal ω3-desaturase is Pichia pastoris (also known as Komagataella pastoris) ω3-desaturase / Δ15-desaturase (Zhang et al., 2008; Accession No. EF116884; SEQ ID NO: 6) or a polypeptide at least 95% identical thereto.

[0325] In one embodiment, the ω3-desaturase is capable of converting at least one of: ARA to EPA, DGLA to ETA, GLA to SDA, both ARA to EPA and DGLA to ETA, both ARA to EPA and GLA to SDA, or all three.

[0326] In one embodiment, the ω3-desaturase has Δ17 desaturase activity on a C20 fatty acid having at least three carbon-carbon double bonds (preferably ARA). In another embodiment, the ω3-desaturase has Δ15 desaturase activity on a C18 fatty acid having three carbon-carbon double bonds (preferably GLA). Preferably, both activities are present.

[0327] As used herein, "Δ12-desaturase" refers to a protein that performs a desaturase reaction that introduces a carbon-carbon double bond at the 12th carbon-carbon bond from the carboxyl terminus of a fatty acid substrate. Δ12-desaturases typically convert oleoyl-phosphatidylcholine or oleoyl-CoA to linoleoyl-phosphatidylcholine (18:1-PC) or linoleoyl-CoA (18:1-CoA), respectively. The subclass that uses PC-linked substrates is referred to as phospholipid-dependent Δ12-desaturases, and the latter subclass is referred to as acyl-CoA-dependent Δ12-desaturases. Plant and fungal Δ12-desaturases generally belong to the former subclass, while animal Δ12-desaturases, such as those encoded by genes cloned from insects as described by Zhou et al. (2008), belong to the latter subclass. Many other Δ12-desaturase sequences can be readily determined by searching sequence databases.

[0328] As used herein, "Δ15-desaturase" refers to a protein that performs a desaturase reaction that introduces a carbon-carbon double bond at the 15th carbon-carbon bond from the carboxyl terminus of a fatty acid substrate. Various genes encoding Δ15-desaturases have been cloned from plant and fungal species. For example, US5952544 describes nucleic acids encoding plant Δ15-desaturases (FAD3). These enzymes contain amino acid motifs characteristic of plant Δ15-desaturases. WO200114538 describes a gene encoding soybean FAD3. Many other Δ15-desaturase sequences can be readily determined by searching sequence databases.

[0329] As used herein, "Δ17-desaturase" refers to a protein that performs a desaturase reaction that introduces a carbon-carbon double bond at the 17th carbon-carbon bond from the carboxyl terminus of a fatty acid substrate. If a Δ17-desaturase acts on a C20 substrate to introduce desaturation at the ω3 bond, it is also considered an ω3-desaturase.

[0330] In a preferred embodiment, the Δ12-desaturase and / or Δ15-desaturase is a fungal Δ12-desaturase or a fungal Δ15-desaturase. As used herein, "fungal Δ12-desaturase" or "fungal Δ15-desaturase" refers to a Δ12-desaturase or Δ15-desaturase from a fungal source (including an Oomycete source), or a variant thereof having an amino acid sequence that is at least 95% identical thereto. Genes encoding various desaturases have been isolated from fungal sources. US Pat. No. 7,211,656 describes a Δ12 desaturase from Saprolegnia diclina. WO2009016202 describes fungal desaturases from Helobdella robusta, Laccaria bicolor, Lottia gigantea, Microcoleuschthonoplastes, Monosiga brevicollis, Mycosphaerella fijiensis, Mycospaerella graminicola, Naegleria gruben, Nectria haematococca, Nematostella vectensis, Phycomyces blakesleeanus, Trichoderma resii, Physcomitrella patens, Postia placenta, Selaginella moellendorffii, and Microdochium nivale. WO2005 / 012316 describes Δ12-desaturases from Thalassiosira pseudonana and other fungi. WO2003 / 099216 describes genes encoding fungal Δ12-desaturases and Δ15-desaturases isolated from Neurospora crassa, Aspergillus nidulans, Botrytis cinerea, and Mortierella alpina. WO2007133425 describes fungal Δ15 desaturases isolated from Saccharomyces kluyveri, Mortierella alpina, Aspergillus nidulans, Neurospora crassa, Fusarium graminearum, Fusarium moniliforme, and Magnaporthe grisea. A preferred Δ12 desaturase is from Phytophthora sojae (Ruiz-Lopez et al., 2012).

[0331] A distinct subclass of fungal Δ12-desaturases and fungal Δ15-desaturases are bifunctional fungal Δ12 / Δ15-desaturases. Genes encoding these have been cloned from Fusarium moniliforme (Accession No. DQ272516, Damude et al., 2006), Acanthamoeba castellanii (Accession No. EF017656, Sayanova et al., 2006), Perkinsus marinus (WO2007042510), Claviceps purpurea (Accession No. EF536898, Meesapyodsuk et al., 2007), and Coprinus cinereus (Accession No. AF269266, Zhang et al., 2007).

[0332] In another embodiment, the ω3-desaturase has at least some activity on an acyl-CoA substrate, preferably greater activity than on the corresponding acyl-PC substrate. As used herein, "corresponding acyl-PC substrate" refers to a fatty acid esterified at the sn-2 position of phosphatidylcholine (PC), wherein the fatty acid is the same fatty acid as in the acyl-CoA substrate. For example, the acyl-CoA substrate may be ARA-CoA and the corresponding acyl-PC substrate may be sn-2ARA-PC. In one embodiment, the activity is at least two-fold greater. Preferably, the ω3-desaturase has at least some activity on both the acyl-CoA substrate and its corresponding acyl-PC substrate and has activity on both C18 and C20 substrates. Examples of such ω3-desaturases are known from the cloned fungal desaturases listed above.

[0333] In another embodiment, the ω3-desaturase comprises an amino acid sequence having a sequence as provided in SEQ ID NO: 6, a biologically active fragment thereof, or an amino acid sequence at least 60% identical to SEQ ID NO: 6, preferably at least 90% or at least 95% identical to SEQ ID NO: 6.

[0334] In another embodiment, the desaturase used in the present invention has greater activity on an acyl-CoA substrate than on a corresponding acyl-PC substrate. In another embodiment, the desaturase used in the present invention has greater activity on an acyl-PC substrate than on a corresponding acyl-CoA substrate, but has some activity on both substrates. As listed above, "corresponding acyl-PC substrate" refers to a fatty acid esterified at the sn-2 position of phosphatidylcholine (PC), wherein the fatty acid is the same fatty acid as in the acyl-CoA substrate. In one embodiment, the greater activity is at least two-fold greater. In one embodiment, the desaturase is a Δ5 or Δ6 desaturase or an ω3 desaturase, examples of which are provided, but not limited to, those listed in Table 2. To test which substrate the desaturase acts on, i.e., an acyl-CoA or acyl-PC substrate, assays can be performed in yeast cells, as described by Domergue et al. (2003) and (2005). The acyl-CoA substrate capacity of a desaturase can also be inferred when the elongase (when expressed together with the desaturase) has an enzymatic conversion efficiency of at least about 90% in a plant cell, wherein the elongase catalyzes the elongation of the desaturase product. On this basis, the Δ5-desaturase and Δ4-desaturase expressed from the GA7 construct (Examples 2 and 3) and variants thereof (Example 5) were able to desaturate their corresponding acyl-CoA substrates, ETA-CoA and DPA-CoA.

[0335] elongase

[0336] Biochemical evidence indicates that fatty acid elongation consists of four steps: condensation, reduction, dehydration, and a second reduction. In the context of the present invention, an "elongase" refers to a polypeptide that catalyzes the condensation step under suitable physiological conditions in the presence of other members of the elongation complex. It has been shown that only heterologous or homologous expression of the condensation component ("elongase") of the elongase protein complex is required for the extension of the corresponding acyl chain. Therefore, the introduced elongase can successfully recover the reduction and dehydration activities from the transgenic host to carry out successful acyl extension. The specificity of the extension reaction with respect to the chain length and degree of desaturation of the fatty acid substrate is believed to reside in the condensation component. This component is also believed to be rate limiting in the extension reaction.

[0337] As used herein, a "Δ5-elongase" is at least capable of converting EPA to DPA. Examples of Δ5-elongases include those disclosed in WO2005 / 103253. In one embodiment, the Δ5-elongase is active on EPA to produce DPA with an efficiency of at least 60%, more preferably at least 65%, more preferably at least 70%, or most preferably at least 80% or 90%. In another embodiment, the Δ5-elongase comprises an amino acid sequence as provided in SEQ ID NO:31, a biologically active fragment thereof, or an amino acid sequence that is at least 47% identical to SEQ ID NO:31. In another embodiment, the Δ6-elongase is from a marine microalga or a green dinoflagellate (US2010 / 088776).

[0338] As used herein, a "Δ6-elongase" is at least capable of converting SDA to ETA. Examples of Δ6-elongases include those listed in Table 1. In one embodiment, the elongase comprises an amino acid sequence having the sequence provided as SEQ ID NO: 19, a biologically active fragment thereof (e.g., a fragment provided as SEQ ID NO: 20), or an amino acid sequence that is at least 55% identical to one or both of SEQ ID NO: 19 or SEQ ID NO: 20. In one embodiment, the Δ6-elongase is from Physcomitrella patens (Zank et al., 2002; Accession No. AF428243) or Thalassiosira pseudonana (Ruiz-Lopez et al., 2012).

[0339] As used herein, a "Δ9-elongase" is at least capable of converting ALA to ETrA. Examples of Δ9-elongases include those listed in Table 1. In one embodiment, the Δ9-elongase comprises amino acids having a sequence as provided in SEQ ID NO:33, a biologically active fragment thereof, or an amino acid sequence at least 80% identical to SEQ ID NO:33. In another embodiment, the Δ9-elongase comprises amino acids having a sequence as provided in SEQ ID NO:36, a biologically active fragment thereof, or an amino acid sequence at least 81% identical to SEQ ID NO:36. In another embodiment, the Δ9-elongase comprises amino acids having a sequence as provided in SEQ ID NO:38, a biologically active fragment thereof, or an amino acid sequence at least 50% identical to SEQ ID NO:38. In another embodiment, the Δ9-elongase comprises amino acids having a sequence as provided in SEQ ID NO:40, a biologically active fragment thereof, or an amino acid sequence at least 50% identical to SEQ ID NO:40. In another embodiment, the Δ9-elongase has greater activity on an ω6 substrate than on the corresponding ω3 substrate, or vice versa.

[0340] As used herein, the term "having greater activity on an ω6 substrate than on the corresponding ω3 substrate" refers to the relative activity of an enzyme on different substrates under the action of an ω3 desaturase. Preferably, the ω6 substrate is LA and the ω3 substrate is ALA.

[0341] An elongase having Δ6-elongase and Δ9-elongase activity is at least capable of (i) converting SDA to ETA and (ii) converting ALA to ETrA and has a Δ6-elongase activity greater than a Δ9-elongase activity. In one embodiment, the elongase has a conversion efficiency of at least 50%, more preferably at least 60%, for SDA to produce ETA and / or a conversion efficiency of at least 6%, or more preferably at least 9%, for ALA to produce ETrA. In another embodiment, the elongase has a Δ6-elongase activity that is at least about 6.5 times greater than a Δ9-elongase activity. In another embodiment, the elongase has no detectable Δ5-elongase activity.

[0342] Other enzymes

[0343] As used herein, the term "1-acyl-glycerol-3-phosphate acyltransferase" (LPAAT), also known as lysophosphatidic acid-acyltransferase or acyl-CoA-lysophosphatidic acid ester-acyltransferase, refers to a protein that acylates sn-1-acyl-glycerol-3-phosphate (sn-1 G-3-P) at the sn-2 position to form phosphatidic acid (PA). Thus, the term "1-acyl-glycerol-3-phosphate acyltransferase activity" refers to the acylation of (sn-1 G-3-P) at the sn-2 position to produce PA (EC 2.3.1.51).

[0344] The transgene introduced into the recombinant cell, transgenic plant, or part thereof can also encode a DGAT. As used herein, the term "diacylglycerol acyltransferase" (EC 2.3.1.20; DGAT) refers to a protein that transfers a fatty acyl group from an acyl-CoA to a diacylglycerol substrate to produce a triacylglycerol. Thus, "diacylglycerol acyltransferase activity" refers to the transfer of an acyl-CoA to a diacylglycerol to produce a triacylglycerol. There are three known types of DGATs, designated DGAT1, DGAT2, and DGAT3. DGAT1 polypeptides typically have 10 transmembrane domains, DGAT2 typically have 2 transmembrane domains, and DGAT3 are typically soluble. Examples of DGAT1 polypeptides include polypeptides encoded by DGAT1 genes from Aspergillus fumigates (Accession No. XP_755172), Arabidopsis thaliana (CAB44774), Ricinus communis (AAR11479), Tung oilseed oil (ABC94472), Vernonia galamensis (ABV21945, ABV21946), Euonymus alatus (AAV31083), Caenorhabditis elegans (AAF82410), Rattus norvegicus (NP_445889), Homo sapiens (NP_036211), and variants and / or mutants thereof. Examples of DGAT2 polypeptides include polypeptides encoded by DGAT2 genes from Arabidopsis thaliana (Accession No. NP_566952), Ricinus communis (AAY16324), Tung oil tree (ABC94474), Mortierella ramanniana (AAK84179), Homo sapiens (Q96PD7, Q58HT5), Bos taurus (Q70VD8), Mus musculus (AAK84175), Micromonas sp. CCMP1545, and variants and / or mutants thereof. Examples of DGAT3 polypeptides include polypeptides encoded by DGAT3 genes from peanut (Arachis hypogaea, Saha et al., 2006), and variants and / or mutants thereof.

[0345] Polypeptides / peptides

[0346] The term "recombinant" in the context of polypeptides refers to a polypeptide when it is produced by a cell or in a cell-free expression system in an altered amount or at an altered rate compared to its native state (if produced naturally). In one embodiment, the cell is a cell that does not naturally produce the polypeptide. However, the cell may be a cell that contains a non-endogenous gene that causes the production of the polypeptide in an altered amount. Recombinant polypeptides of the present invention include polypeptides in cells, tissues, organs or organisms or cell-free expression systems in which the polypeptide is produced, i.e., a polypeptide that has not been purified or separated from other components of the transgenic (recombinant) cell in which it is produced or a polypeptide produced in such a cell or cell-free system that is subsequently purified from at least some other components.

[0347] The terms "polypeptide" and "protein" are often used interchangeably.

[0348] A polypeptide or polypeptide class can be defined by the degree of identity (% identity) of its amino acid sequence to a reference amino acid sequence or by having a greater % identity to one reference amino acid sequence than to another sequence. The % identity of a polypeptide to a reference amino acid sequence is typically determined by performing a GAP analysis (Needleman and Wunsch, 1970; GCG program) using parameters of a gap creation penalty = 5 and a gap extension penalty = 0.3. The query sequence is at least 15 amino acids in length, and the GAP analysis aligns the two sequences over a region of at least 15 amino acids. More preferably, the query sequence is at least 50 amino acids in length, and the GAP analysis aligns the two sequences over a region of at least 50 amino acids. More preferably, the query sequence is at least 100 amino acids in length, and the GAP analysis aligns the two sequences over a region of at least 100 amino acids. Even more preferably, the query sequence is at least 250 amino acids in length, and the GAP analysis aligns the two sequences over a region of at least 250 amino acids. Even more preferably, the GAP analysis aligns the two sequences over their entire length. The polypeptide or class of polypeptides may have the same enzymatic activity as the reference polypeptide or a different activity therefrom or lack the activity of the reference polypeptide. Preferably, the enzymatic activity of the polypeptide is at least 10%, at least 50%, at least 75% or at least 90% of the activity of the reference polypeptide.

[0349] As used herein, a "biologically active" fragment is a portion of a polypeptide as defined herein that retains a defined activity of the full-length reference polypeptide, e.g., desaturase and / or elongase activity or other enzymatic activity. As used herein, biologically active fragments exclude full-length polypeptides. Biologically active fragments can be of any size, as long as they retain the defined activity. Preferably, biologically active fragments retain at least 10%, at least 50%, at least 75%, or at least 90% of the activity of the full-length protein.

[0350] With respect to defined polypeptides or enzymes, it will be appreciated that % identity figures higher than those provided herein will encompass preferred embodiments. Thus, where applicable, in view of the minimum % identity figures, it is preferred that the polypeptide / enzyme comprises an amino acid sequence that is at least 60%, more preferably at least 65%, more preferably at least 70%, more preferably at least 75%, more preferably at least 76%, more preferably at least 80%, more preferably at least 85%, more preferably at least 90%, more preferably at least 91%, more preferably at least 92%, more preferably at least 93%, more preferably at least 94%, more preferably at least 95%, more preferably at least 96%, more preferably at least 97%, more preferably at least 98%, more preferably at least 99%, more preferably at least 99.1%, more preferably at least 99.2%, more preferably at least 99.3%, more preferably at least 99.4%, more preferably at least 99.5%, more preferably at least 99.6%, more preferably at least 99.7%, more preferably at least 99.8% and even more preferably at least 99.9% identical to the relevant designated SEQ ID NO.

[0351] Amino acid sequence variants / mutants of the polypeptides defined herein can be prepared by introducing appropriate nucleotide changes into the nucleic acids defined herein or by in vitro synthesis of the desired polypeptide. Such variants / mutants may comprise, for example, deletions, insertions or substitutions of residues within the amino acid sequence. Combinations of deletions, insertions and substitutions may be made to obtain the final construct, provided that the final peptide product possesses the desired enzymatic activity.

[0352] Mutated (altered) peptides can be prepared using any technique known in the art. For example, the polynucleotides defined herein can be subjected to in vitro mutagenesis or DNA shuffling techniques, as extensively described by Harayama (1998). Products derived from the mutated / altered DNA can be readily screened using the techniques described herein to determine whether they possess, for example, desaturase or elongase activity.

[0353] In designing amino acid sequence mutants, the location of the mutation site and the nature of the mutation will depend on the characteristic or characteristics to be altered. The sites of mutation can be altered individually or sequentially, for example, by (1) first selectively substituting with conservative amino acids and then selectively substituting with more groups (depending on the results achieved), (2) deleting the target residue, or (3) inserting other residues adjacent to the site being located.

[0354] Amino acid sequence deletions generally range from about 1 to 15 residues, more preferably from about 1 to 10 residues and usually from about 1 to 5 contiguous residues.

[0355] Substitution mutants remove at least one amino acid residue in a polypeptide molecule and insert a different residue in its position. The most interesting sites for substitution mutagenesis are included in sites that are non-conservative in naturally occurring desaturases or elongases. These sites preferably replace in a relatively conservative manner to keep enzymatic activity. This type of conservative substitution is shown in Table 3 under the heading "Exemplary Substitutions."

[0356] In a preferred embodiment, the mutant / variant polypeptide has only or no more than one, two, three, or four conservative amino acid changes when compared to a naturally occurring polypeptide. Details of the conservative amino acid changes are provided in Table 3. As will be appreciated by the skilled artisan, such minor changes can reasonably be predicted to not alter the activity of the polypeptide when expressed in a recombinant cell.

[0357] The polypeptide can be produced in a variety of ways, including producing and recovering natural polypeptides or recombinant polypeptides according to methods known in the art. In one embodiment, the recombinant polypeptide is produced by culturing a cell capable of expressing the polypeptide (such as a host cell as defined herein) under conditions effective to produce the polypeptide. More preferred cells for producing the polypeptide are cells in plants, particularly cells in the seeds of plants.

[0358] Table 3. Exemplary substitutions.

[0359]

[0360] polynucleotides

[0361] The present invention also provides the use of polynucleotides that can be, for example, genes, isolated polynucleotides, chimeric genetic constructs such as T-DNA molecules or chimeric DNA. It can be double-stranded or single-stranded DNA or RNA of genomic or synthetic origin, and can be combined with carbohydrates, lipids, proteins or other materials to perform a specific activity defined herein. The term "polynucleotide" can be used interchangeably with the term "nucleic acid molecule" in this article. The term "isolated polynucleotide" means a polynucleotide or a non-naturally occurring polynucleotide that is separated from a polynucleotide sequence associated or connected with it in its natural state (if obtained from a natural source). Preferably, the isolated polynucleotide is at least 60% free of other components associated with it in nature, more preferably at least 75% free of other components and more preferably at least 90% free of other components.

[0362] In one embodiment, the polynucleotide is non-natural. Examples of non-natural polynucleotides include, but are not limited to, those that have mutated (e.g., by using methods described herein) and polynucleotides in which the open reading frame encoding the protein is operably linked to a promoter that is not naturally associated with the polynucleotide (e.g., in constructs described herein).

[0363] As used herein, the term "gene" is understood in its broadest context and includes a deoxyribonucleotide sequence comprising the transcribed region and (if translated) the protein coding region of a structural gene and comprising sequences at least about 2 kb on either end located adjacent to the coding region at both the 5' and 3' ends and involved in gene expression. In this regard, the gene includes control signals naturally associated with a given gene, such as promoters, enhancers, terminators, and / or polyadenylation signals, or heterologous control signals, in which case the gene is referred to as a "chimeric gene." Sequences located 5' to the protein coding region and present on the mRNA are referred to as 5' non-translated sequences. Sequences located 3' to or downstream of the protein coding region and present on the mRNA are referred to as 3' non-translated sequences. The term "gene" encompasses both cDNA and genomic forms of a gene. Genomic forms or clones of a gene include the coding region, which may be interspersed with non-coding sequences referred to as "introns," "intervening regions," or "intervening sequences." Introns are segments of a gene that are transcribed into nuclear RNA (hnRNA). Introns may contain regulatory elements such as enhancers. Introns are removed or "spliced ​​out" from the nuclear or primary transcript; therefore, introns are not present in the messenger RNA (mRNA) transcript. mRNA functions during translation to specify the sequence or order of amino acids in the nascent polypeptide. The term "gene" includes synthetic or fusion molecules encoding all proteins or portions of proteins described herein, as well as complementary nucleotide sequences of any of the above.

[0364] As used herein, "chimeric DNA" or "chimeric genetic construct" refers to any DNA molecule that is not a native DNA molecule in its natural location, also referred to herein as a "DNA construct." Typically, a chimeric DNA or chimeric gene comprises regulatory or transcriptional sequences or protein coding sequences that are not found operably linked together in nature, i.e., that are heterologous to each other. Thus, a chimeric DNA or chimeric gene may comprise regulatory and coding sequences that are derived from different sources or regulatory and coding sequences that are derived from the same source but arranged in a manner different from that found in nature.

[0365] The term "endogenous" is used herein to indicate a substance that is typically present or produced in, for example, an unmodified plant (such as the plant under study) at the same developmental stage. An "endogenous gene" refers to a native gene in a natural location in the genome of an organism. As used herein, a "recombinant nucleic acid molecule," "recombinant polynucleotide," or variations thereof refer to a nucleic acid molecule that has been constructed or modified by recombinant DNA technology. The terms "foreign polynucleotide," "exogenous polynucleotide," or "heterologous polynucleotide," etc., refer to any nucleic acid introduced into the genome of a cell through experimental manipulation. Foreign or exogenous genes can be genes inserted into non-natural organisms, natural genes introduced into a new location within a natural host, or chimeric genes. A "transgene" is a gene that has been introduced into the genome through a transformation procedure. The terms "genetic modification," "transgenic," and variations thereof include introducing genes into cells through transformation or transduction, mutating genes within cells, and altering or adjusting gene regulation in cells or organisms or their progeny that have undergone these manipulations. As used herein, a "genomic region" refers to a location within the genome where a transgene or transgenic group (also referred to herein as a cluster) has been inserted into a cell or its progenitor. Such regions contain only those nucleotides that have been incorporated by human intervention, such as by the methods described herein.

[0366] In the context of polynucleotides, the term "exogenous" refers to a polynucleotide that is present in a cell in an amount that is changed compared to its native state. In one embodiment, the cell is a cell that does not naturally comprise the polynucleotide. However, the cell can be a cell that comprises a non-endogenous polynucleotide that produces the coded polypeptide of the amount that causes the change. Exogenous polynucleotides include polynucleotides that are not separated from other components of a transgenic (recombinant) cell or a cell-free expression system (wherein there are polynucleotides) and polynucleotides that are produced in such cells or cell-free systems and then purified from at least some other components. Exogenous polynucleotides (nucleic acids) can be nucleotides that are present in nature for continuous extension, or comprise nucleotides that are connected to form two or more continuous extensions of a single polynucleotide from different sources (natural occurrence and / or synthesis). Typically, such chimeric polynucleotides comprise at least one open reading frame that is operably connected to a promoter that is suitable for driving an open reading frame to transcribe in the cell of interest that encodes a polypeptide.

[0367] As used herein, the term "different exogenous polynucleotides" or variations thereof means that the nucleotide sequence of each polynucleotide differs by at least one, preferably multiple, nucleotides. The polynucleotides encode RNA that may or may not be translated into protein within the cell. In one embodiment, it is preferred that each polynucleotide encodes a protein with a different activity. In another embodiment, each exogenous polynucleotide is less than 95%, less than 90%, or less than 80% identical to the other exogenous polynucleotides. Preferably, the exogenous polynucleotides encode a functional protein / enzyme. Furthermore, it is preferred that the different exogenous polynucleotides are non-overlapping, in that each polynucleotide is, for example, a different region of an extrachromosomal transfer nucleic acid that does not overlap with another exogenous polynucleotide. At a minimum, each exogenous polynucleotide has transcriptional start and stop sites and a designated promoter. Individual exogenous polynucleotides may or may not contain introns.

[0368] With respect to defined polynucleotides, it will be appreciated that % identity figures higher than those provided above will encompass preferred embodiments. Thus, where applicable, in view of the minimum % identity figures, it is preferred that the polynucleotide comprises a polynucleotide sequence that is at least 60%, more preferably at least 65%, more preferably at least 70%, more preferably at least 75%, more preferably at least 80%, more preferably at least 85%, more preferably at least 90%, more preferably at least 91%, more preferably at least 92%, more preferably at least 93%, more preferably at least 94%, more preferably at least 95%, more preferably at least 96%, more preferably at least 97%, more preferably at least 98%, more preferably at least 99%, more preferably at least 99.1%, more preferably at least 99.2%, more preferably at least 99.3%, more preferably at least 99.4%, more preferably at least 99.5%, more preferably at least 99.6%, more preferably at least 99.7%, more preferably at least 99.8% and even more preferably at least 99.9% identical to the relevant designated SEQ ID NO.

[0369] The polynucleotides of the present invention can selectively hybridize to the polynucleotides encoding the polypeptides of the present invention under stringent conditions. As used herein, stringent conditions are those that: (1) employ a denaturing agent, such as formamide, e.g., 50% (v / v) formamide with 0.1% (w / v) bovine serum albumin, 0.1% polysucrose, 0.1% polyvinylpyrrolidone, pH 6.5 50 mM sodium phosphate buffer and 750 mM NaCl, 75 mM sodium citrate at 42°C during hybridization; or (2) employ a denaturing agent, such as 50% formamide, 5xSSC (0.75 M in 0.2 x SSC and 0.1% SDS) at 42°C during hybridization. NaCl, 0.075 M sodium citrate), 50 mM sodium phosphate (pH 6.8), 0.1% sodium pyrophosphate, 5x Denhardt's solution, sonicated salmon sperm DNA (50 g / ml), 0.1% SDS and 10% dextran sulfate and / or (3) washing at 50°C using low ionic strength and high temperature, such as 0.015 M NaCl / 0.0015 M sodium citrate / 0.1% SDS.

[0370] When compared to a naturally occurring molecule, a polynucleotide may have one or more mutations, which are deletions, insertions or substitutions of nucleotide residues. Polynucleotides having mutations relative to a reference sequence may be naturally occurring (that is, isolated from a natural source) or synthetic (e.g., by subjecting the nucleic acid to site-directed mutagenesis or DNA shuffling, as described above). Thus, it is clear that a polynucleotide may be from a naturally occurring source or be recombinant. Preferred polynucleotides are those having a coding region that is codon-optimized for translation in plant cells, as known in the art.

[0371] recombinant vector

[0372] One embodiment of the present invention includes a recombinant vector containing at least one polynucleotide molecule defined herein, which is inserted into any vector capable of delivering the polynucleotide molecule to a host cell. Recombinant vectors include expression vectors. Recombinant vectors include heterologous polynucleotide sequences, i.e., polynucleotide sequences adjacent to polynucleotide molecules defined herein are not naturally found, preferably derived from species other than the species from which one or more polynucleotide molecules are derived. The vector can be RNA or DNA and is typically a plasmid. Plasmid vectors typically include other nucleic acid sequences for easily selecting, amplifying, and transforming expression cassettes provided in prokaryotic cells, for example, vectors in pUC-sources, vectors in pSK-sources, vectors in pGEM-sources, vectors in pSP-sources, vectors in pBS-sources, or binary vectors preferably containing one or more T-DNA regions. Other nucleic acid sequences include a self-replicating origin of replication, preferably a selective marker gene encoding antibiotic or herbicide resistance, a plurality of unique cloning sites for providing a plurality of sites of nucleic acid sequences or genes encoded in the nucleic acid construct, and sequences that enhance the transformation of prokaryotic and eukaryotic (particularly plant) cells. The recombinant vector may comprise more than one polynucleotide as defined herein, for example, a combination of three, four, five or six polynucleotides as defined herein, preferably a chimeric genetic construct as described herein, each polynucleotide being operably linked to an expression control sequence operable in the cell of interest. Preferably, the expression control sequence comprises or is entirely a heterologous promoter, i.e., heterologous relative to the coding region controlled by them. More than one polynucleotide as defined herein, for example, 3, 4, 5 or 6 polynucleotides, preferably 7 or 8 polynucleotides, each encoding a different polypeptide, are preferably covalently linked together in a single recombinant vector, preferably in a single T-DNA molecule, which can then be introduced into a cell as a single molecule to form a recombinant cell according to the present invention, and preferably integrated into the genome of a recombinant cell of a transgenic plant, for example. The integration into the genome can be integration into the nuclear genome or plastid genome of the transgenic plant. Therefore, the polynucleotides so connected will be inherited together as a single genetic locus in the offspring of the recombinant cell or plant. A recombinant vector or plant may comprise two or more such recombinant vectors, each recombinant vector comprising multiple polynucleotides, for example wherein each recombinant vector comprises 3, 4, 5 or 6 polynucleotides.

[0373] As used herein, "operably linked" refers to the functional relationship between two or more nucleic acid (e.g., DNA) segments. Typically, it refers to the functional relationship between a transcriptional regulatory element (promoter) and a transcribed sequence. For example, if a promoter stimulates or adjusts the transcription of a coding sequence in an appropriate cell, the promoter is operably linked to a coding region, such as a polynucleotide as defined herein. Typically, promoter transcriptional regulatory elements that are operably linked to a transcribed sequence are physically adjacent to the transcribed sequence, i.e., they are cis-acting. However, some transcriptional regulatory elements, such as enhancers, do not need to be physically adjacent to the coding sequence that enhances transcription or be positioned in close proximity thereto.

[0374] When multiple promoters are present, each promoter may independently be the same or different. Preferably, at least 3 and up to a maximum of 6 different promoter sequences are used in the recombinant vector to control the expression of the exogenous polynucleotide.

[0375] Recombinant molecules such as chimeric DNA or genetic constructs may also comprise (a) one or more secretion signals encoding a signal peptide sequence to enable secretion of an expressed polypeptide as defined herein from a cell producing the polypeptide or providing for localization of the expressed polypeptide (e.g., providing for retention of the polypeptide within the endoplasmic reticulum (ER) of the cell or for translocation to plastids) and / or (b) a fusion sequence that causes the nucleic acid molecule to be expressed as a fusion protein. Examples of suitable signal segments include any signal segment capable of directing secretion or localization of a polypeptide as defined herein. Recombinant molecules may also include intervening and / or untranslated sequences surrounding and / or within the nucleic acid sequence of a nucleic acid molecule as defined herein.

[0376] In order to promote the identification of transformants, nucleic acid constructs ideally include selectable or screenable marker genes as external or exogenous polynucleotides, or include selectable or screenable marker genes outside external or exogenous polynucleotides." marker gene" term means giving the cell different phenotypes of expressing marker genes and therefore allowing the cell of such transformation to be distinguished from the cell without the mark. Selectable marker genes give people the property of "selection" based on the resistance to selection agents (for example, herbicides, antimicrobial agents, radiation, heat or other treatments that damage untransformed cells). Screenable marker genes (or reporter genes) give people the property (for example, beta-glucuronidase, luciferase, GFP or other enzymatic activities that are not present in untransformed cells) that can be differentiated by observation or testing, i.e., by "screening". Marker genes and interested nucleotide sequences are not necessarily connected. The actual selection of mark is unimportant, as long as it works (that is, selectivity) with the cell of selection such as plant cell combination.

[0377] Examples of bacterial selectable markers are markers that confer antibiotic resistance such as ampicillin, erythromycin, chloramphenicol or tetracycline resistance, preferably kanamycin resistance. Exemplary selectable markers for selecting plant transformants include, but are not limited to, the hyg gene encoding hygromycin B resistance; the neomycin phosphotransferase (nptII) gene that confers resistance to kanamycin, paromomycin, G418; the glutathione-S-transferase gene from rat liver that confers resistance to glutathione-derived herbicides, for example, as described in EP 256 223; the glutamine synthase gene that confers resistance to glutamine synthase inhibitors such as phosphinothricin when overexpressed, for example, as described in WO 87 / 05327; the acyltransferase gene from Streptomyces viridochromogenes that confers resistance to the selection agent phosphinothricin, for example, as described in EP 256 223. 275957; a gene encoding 5-enolshikimate-3-phosphate synthase (EPSPS) conferring tolerance to N-phosphatidylglycine, for example, as described by Hinchee et al. (1988); a bar gene conferring resistance to bialaphos, for example, as described by WO 91 / 02071; a nitrilase gene such as bxn from Klebsiella ozaenae conferring resistance to bromoxynil (Stalker et al., 1988); a dihydrofolate reductase (DHFR) conferring resistance to methotrexate (Thillet et al., 1988); a mutant acetolactate synthase gene (ALS) conferring resistance to imidazolinones, sulfonylureas or other ALS-inhibiting chemicals (EP 154,204); a mutant anthranilate synthase gene conferring resistance to 5-methyltryptophan; or a dalapon dehalogenase gene conferring resistance to herbicides.

[0378] Preferred screenable markers include, but are not limited to, the uidA gene encoding β-glucuronidase (GUS), for which a variety of chromogenic substrates are known, the green fluorescent protein gene (Niedz et al., 1995), or derivatives thereof; the luciferase (luc) gene (Ow et al., 1986), which allows for bioluminescent detection, and other genes known in the art. As used herein, the term "reporter molecule" means a molecule that provides an analyzable signal by its chemical properties that facilitates the determination of promoter activity by reference to a protein product.

[0379] Preferably, the nucleic acid construct is stably incorporated into the genome of a cell, such as a plant cell. Thus, the nucleic acid may comprise suitable elements that allow the molecule to be incorporated into the genome, preferably the right and left border sequences of a T-DNA molecule, or the construct may be placed in a suitable vector that can be incorporated into the chromosome of the cell.

[0380] Express

[0381] As used herein, an expression vector is a DNA vector capable of transforming a host cell and affecting the expression of one or more specified polynucleotide molecules. The expression vectors of the present invention can direct gene expression in plant cells. Expression vectors suitable for use in the present invention contain regulatory sequences such as transcription control sequences, translation control sequences, origins of replication, and other regulatory sequences that are compatible with recombinant cells and control the expression of the polynucleotide molecules of the present invention. Specifically, polynucleotides or vectors suitable for use in the present invention contain transcription control sequences. Transcription control sequences are sequences that control the initiation, elongation, and termination of transcription. Particularly important transcription control sequences are those that control transcription initiation, such as promoter and enhancer sequences. Suitable transcription control sequences include any transcription control sequence that is functional in at least one of the recombinant cells of the present invention. The choice of regulatory sequence to be used depends on the target organism of interest, such as a plant and / or target organ or tissue. Such regulatory sequences can be obtained from any eukaryotic organism, such as plants or plant viruses, or can be chemically synthesized. A variety of such transcription control sequences are known to those skilled in the art. Particularly preferred transcription control sequences are promoter-active in directing transcription in plants, either constitutively or periodically, and / or are tissue-specific, depending on the plant or part thereof being used.

[0382] A variety of vectors suitable for stable transfection of plant cells or for establishing transgenic plants have been described, for example, in Pouwels et al., Cloning Vectors: A Laboratory Manual, 1985, Supplement 1987; Weissbach and Weissbach, Methods for Plant Molecular Biology, Academic Press, 1989; and Gelvin et al., Plant Molecular Biology Manual, Kluwer Academic Publishers, 1990. Typically, plant expression vectors include one or more cloned plant genes under the transcriptional control of, for example, 5' and 3' regulatory sequences and a dominant selectable marker. Such plant expression vectors may also contain a promoter regulatory region (e.g., a regulatory region that controls inducible or constitutive, environmentally or developmentally regulated, or cell or tissue-specific expression), a transcription initiation site, a ribosome binding site, an RNA processing signal, a transcription termination site, and / or a polyadenylation signal.

[0383] A variety of constitutive promoters active in plant cells have been described. Suitable promoters for constitutive expression in plants include, but are not limited to, the cauliflower mosaic virus (CaMV) 35S promoter, the figwort mosaic virus (FMV) 35S promoter, the sugarcane rhizovirus promoter, the communis yellow mottle virus promoter, the light-inducible promoter from the small subunit of ribulose-1,5-bisphosphate carboxylase, the rice cytoplasmic triosephosphate isomerase promoter, the Arabidopsis thaliana adenine phosphoribosyltransferase promoter, the rice actin 1 gene promoter, the mannopine synthase and octopine synthase promoters, the Adh promoter, the sucrose synthase promoter, the R gene complex promoter, and the chlorophyll α / β binding protein gene promoter.

[0384] For the purpose of expressing in the source tissue of plant such as leaf, seed, root or stem, preferably for the promoter of the present invention there is relatively high expression in these specific tissues. For this purpose, can from a plurality of promoters with tissue-or cell-specific or enhanced expression gene, select. The example of this type of promoter reported in the literature comprises from the chloroplast glutamine synthase GS2 promoter of pea, from the chloroplast fructose-1 of wheat, 6-bisphosphatase promoter, from the nuclear photosynthetic ST-LS1 promoter of potato, from the serine / threonine kinase promoter and glucoamylase (CHS) promoter of Arabidopsis thaliana. Also reported active in photosynthetic activity tissue is ribulose-1,5-bisphosphate carboxylase promoter and Cab promoter.

[0385] A variety of plant gene promoters that are regulated in response to environmental, hormonal, chemical and / or developmental signals can also be used to express genes in plant cells, including promoters regulated by: (1) heat; (2) light (e.g., pea RbcS-3A promoter, corn RbcS promoter); (3) hormones, such as abscisic acid; (4) wounding (e.g., WunI); or (5) chemicals, such as methyl jasmonate, salicylic acid, steroid hormones, alcohols, safeners (WO97 / 06269), or it may also be advantageous to employ (6) organ-specific promoters.

[0386] As used herein, the term "plant seed-specific promoter" or variations thereof refers to a promoter that preferentially directs gene transcription in the developing seeds of a plant, preferably a Brassica species, Camelina, or soybean plant, when compared to other plant tissues. In one embodiment, expression of a seed-specific promoter in the developing seeds of a plant is at least five times stronger than in the leaves and / or stems of the plant, and preferably is stronger in the embryo of the developing seed than in other plant tissues. Preferably, the promoter directs expression of the gene of interest only in the developing seeds, and / or expression of the gene of interest in other parts of the plant (such as leaves) is not detectable by Northern blot analysis and / or RT-PCR. Typically, the promoter drives gene expression during seed growth and development, specifically during the phase of synthesis and accumulation of storage compounds in the seed. Such promoters can drive gene expression in the entire plant storage organ or only a portion thereof, such as the seed coat or one or more cotyledons, preferably in the embryo, in the seeds of dicotyledons or the endosperm or aleurone layer of seeds of monocotyledons.

[0387] Preferred promoters for seed-specific expression include i) promoters from genes encoding enzymes involved in fatty acid biosynthesis and accumulation in seeds (such as fatty acid desaturases and elongases), ii) promoters from genes encoding seed storage proteins, and iii) promoters from genes encoding enzymes involved in carbohydrate biosynthesis and accumulation in seeds. Suitable seed-specific promoters are the rapeseed napin gene promoter (US5,608,152), the Vicia faba USP promoter (Baumlein et al., 1991), the Arabidopsis oleosin promoter (WO98 / 45461), the Phaseolus vulgaris phaseolin promoter (US5,504,200), the Brassica Bce4 promoter (WO91 / 13980), or the legumin LeB4 promoter from Vicia faba (Baumlein et al., 1992), as well as promoters that cause seed-specific expression in monocotyledonous plants such as corn, barley, wheat, rye, rice, etc. Suitable significant promoters are the barley lpt2 or lpt1 gene promoters (WO95 / 15389 and WO95 / 23230) or the promoters described in WO99 / 16890 (promoters from the hordein gene, rice glutelin gene, rice oryzin gene, rice prolamin gene, wheat gliadin gene, wheat gliadin gene, zein gene, oat glutelin gene, sorghum kasirin gene, rye secalin gene). Other promoters include those described by Broun et al. (1998), Potenza et al. (2004), US20070192902 and US20030159173. In one embodiment, the seed-specific promoter is preferentially expressed in a defined seed part, such as the embryo, one or more cotyledons, or the endosperm. Examples of such specific promoters include, but are not limited to, the FP1 promoter (Ellerstrom et al., 1996), the pea legumin promoter (Perrin et al., 2000), the bean lectin promoter (Perrin et al., 2000), the conlinin 1 and conlinin 2 promoters of the gene encoding the flax 2S storage protein (Cheng et al., 2010), the promoter of the FAE1 gene from Arabidopsis thaliana, the BnGLP promoter of the globulin-like protein gene from Brassica napus, and the LPXR promoter of the peroxide reductase gene from flax.

[0388] The 5' untranslated leader sequence can be derived from a promoter of a heterologous gene sequence selected to express the polynucleotide of the present invention, or preferably is heterologous to the coding region of the enzyme being produced and, if desired, can be specifically modified to increase translation of the mRNA. For a review of optimized expression of transgenics, see Koziel et al. (1996). The 5' untranslated region can also be obtained from plant viral RNA (tobacco mosaic virus, tobacco etch virus, maize dwarf mosaic virus, alfalfa mosaic virus, and others), from suitable eukaryotic genes, plant genes (wheat and maize chlorophyll a / b binding protein gene leader sequences), or from synthetic gene sequences. The present invention is not limited to constructs in which the untranslated region is derived from a 5' untranslated sequence accompanying a promoter sequence. The leader sequence can also be derived from an unrelated promoter or coding sequence. Leader sequences suitable for use in the context of the present invention include the maize Hsp70 leader sequence (US Pat. Nos. 5,362,865 and 5,859,347) and the TMV ω element.

[0389] Termination of transcription is realized by the 3 ' non-translated DNA sequence that is operably connected to the polynucleotide of interest in the chimeric vector. The 3 ' non-translated region of the recombinant DNA molecule is included in the polyadenylation signal that works in the plant to cause adenylate nucleotides to be added to the 3 ' end of RNA. The 3 ' non-translated region can be obtained from a plurality of genes expressed in plant cells. Nopaline synthase 3 ' non-translated region, 3 ' untranslated region from the pea small subunit Rubisco gene, 3 ' untranslated region from the soybean 7S seed storage protein gene or the flax conlinin gene are generally used in this respect. The 3 ' non-translated region that transcribes the polyadenylation signal of the plasmid gene that contains Agrobacterium tumor induction (Ti) is also suitable.

[0390] Recombinant DNA technology can be used to increase the expression of transformed polynucleotide molecules by manipulating, for example, the number of copies of polynucleotide molecules within the host cell, the efficiency of transcription of those polynucleotide molecules, the efficiency of translation of the resulting transcripts, and the efficiency of post-translational modifications. Recombinant techniques suitable for increasing the expression of polynucleotide molecules as defined herein include, but are not limited to, integrating the polynucleotide molecules into one or more host cell chromosomes, adding stabilizing sequences to mRNA, replacing or modifying transcriptional control signals (e.g., promoters, operators, enhancers), replacing or modifying translational control signals (e.g., ribosome binding sites, Shine-Dalgarno sequences), modifying polynucleotide molecules to correspond to the codon usage of the host cell, and deleting sequences that destabilize the transcript.

[0391] genetically modified plants

[0392] As used herein, the term "plant" as a noun refers to the whole plant, but when used as an adjective refers to any material present in, obtained from, derived from, or associated with a plant, such as, for example, a plant organ (e.g., leaves, stems, roots, flowers), individual cells (e.g., pollen), seeds, plant cells, etc. The term "plant part" refers to all parts of a plant that contain plant DNA, including vegetative structures such as, for example, leaves or stems, roots, floral organs or structures, pollen, seeds, seed parts (e.g., embryo, endosperm, scutellum or seed coat), plant tissues (such as, for example, vascular tissue), cells thereof, and progeny thereof, so long as the plant part synthesizes the lipids according to the present invention.

[0393] "Transgenic plants", "genetically modified plants" or variations thereof refer to plants that contain a genetic construct ("transgene") that is not found in wild-type plants of the same species, kind or variety. Transgenic plants as defined in the context of the present invention include plants and their progeny that have been genetically modified using recombinant technology to cause the production of a lipid or at least one polypeptide as defined herein in the desired plant or plant organ. Transgenic plant cells and transgenic plant parts have corresponding meanings. "Transgenic" as referred to herein has the standard meaning in the field of biotechnology and includes gene sequences that have been produced or altered by recombinant DNA or RNA technology and introduced into plant cells. Transgenics may include gene sequences derived from plant cells or from cells other than plant cells, which may be of the same species, kind or variety as the plant cell into which the transgene is introduced or of a different species, kind or variety. Typically, transgenes are introduced into cells such as plants by artificial manipulation, for example by transformation, and any method known to those skilled in the art may be used.

[0394] The terms "seed" and "grain" are used interchangeably herein. "Grain" refers to mature grain, such as harvested grain or grain still on the plant but ready for harvest, but may also refer to grain after imbibition or germination, depending on the context. Mature grain or seed typically has a moisture content of less than about 18%-20%, preferably less than 10%. Brassica seeds, such as rapeseed seeds, typically have a moisture content of about 4%-8%, preferably between about 4% and 6% when mature. As used herein, "developing seed" refers to seed prior to maturity, typically found in the reproductive structures of a plant after fertilization or flowering, but may also refer to such seed prior to maturity (separation from the plant).

[0395] As used herein, the term "obtaining a plant part" or "obtaining a seed" refers to any means of obtaining a plant part or seed, including harvesting a plant part or seed from a field or a closed room such as a greenhouse or a growth chamber or by purchasing or receiving from a supplier of plant parts or seeds. Standard growing conditions in a greenhouse include a daytime temperature of 22°C-24°C and a nighttime temperature of 16°C-18°C, using natural light. The seeds may be suitable for planting, i.e., capable of germinating and producing offspring plants, or alternatively may be processed in a manner such that germination is no longer possible, e.g., crushed, polished or ground seeds suitable for food or raw material applications or seeds for extracting the lipids of the present invention.

[0396] As used herein, the term "plant storage organ" refers to a part of a plant that is specialized for storing energy, for example, in the form of proteins, carbohydrates, fatty acids and / or oils. Examples of plant storage organs are seeds, fruits, tuberous roots and tubers. Preferred plant storage organs are seeds.

[0397] As used herein, the term "phenotypically normal" refers to a genetically modified plant or plant organ that has not significantly reduced ability to grow and reproduce when compared to an unmodified plant or plant organ, specifically a storage organ such as a seed, tuber or fruit. In one embodiment, the genetically modified plant or plant organ that has a normal phenotype includes an exogenous polynucleotide encoding a silencing suppressor that is operably linked to a plant storage organ-specific promoter, and has the ability to grow or reproduce essentially identically to an isogenic plant or organ that does not comprise the polynucleotide. Preferably, when grown under the same conditions, biomass, growth rate, germination rate, storage organ size, seed size and / or the number of vigorous seeds produced are not less than 90% of the plant lacking the exogenous polynucleotide. This term does not encompass plant characteristics that may be different from wild-type plants but do not affect the availability of plant commercial purposes, such as, for example, the ballet-like phenotype of seedling leaves.

[0398] Plants provided by the present invention or encompassed for practicing the present invention include monocots and dicots. In preferred embodiments, the plants of the present invention are crop plants (e.g., cereals and beans, corn, wheat, potato, cassava, rice, sorghum, millet, cassava, barley or peas) or other legumes. Plants can be grown to produce edible roots, tubers, leaves, stems, flowers or fruits. Plants can be vegetables or ornamental plants. Plants of the present invention or suitable for use in the present invention may be: corn (Zea mays), rapeseed (Brassica napus, Brassica rapa), mustard (Brassica juncea), flax (Linum usitatissimum), alfalfa (Medicago sativa), rice (Oryza sativa), rye (Secale cerale), sorghum (Sorghum bicolor, Sorghum), sunflower (Helianthus annuus), wheat (Tritium aestivum), soybean (Glycine max), tobacco (Nicotiana tabacum), potato (Solanum tuberosum), peanut (Arachis hypogaea), cotton (Gossypium hirsutum), sweet potato (Lopmoeabatatus), cassava (Manihot esculenta), coffee (Coffee species), coconut (Cocos nucifera), pineapple (Ananas oleraceus). comosus), citrus trees (Citrus spp.), cocoa (Theobromacacao), tea (Camellia senensis), bananas (Musa spp.), avocados (Persea americana), figs (Ficus casica), guavas (Psidium guajava), mangoes (Mangifer indica), olives (Olea europaea), papayas (Caricapapaya), cashews (Anacardium occidentale), macadamia nuts (Macadamia intergrifolia), almonds (Prunus amygdalus), sugar beets (Beta vulgaris), oats, or barley.

[0399] In a preferred embodiment, the plant is an angiosperm.

[0400] In one embodiment, the plant is an oilseed plant, preferably an oilseed crop. As used herein, "oilseed plant" is a plant species for commercially producing oil from the seeds of a plant. The oilseed plant can be rapeseed (such as rapeseed (canola)), corn, sunflower, soybean, sorghum, flax (linseed) or sugar beet. In addition, the oilseed plant can be other Brassica, cotton, peanut, poppy, mustard, castor bean, sesame, sunflower, safflower, Camelina, Capsella or a plant that produces nuts. The plant can produce high levels of oil in its fruit, such as olive, oil palm or coconut. The horticultural plant that the present invention can be used for is lettuce, chicory or vegetable Brassica (including cabbage, broccoli or cauliflower). The present invention can be used for tobacco, gourd, carrot, strawberry, tomato or pepper.

[0401] In another preferred embodiment, the non-transgenic plants used to produce the transgenic plants of the present invention produce oils, particularly in seeds, having i) less than 20%, less than 10% or less than 5% 18:2 fatty acids and / or ii) less than 10% or less than 5% 18:3 fatty acids.

[0402] In a preferred embodiment, the transgenic plant or part thereof is homozygous for each gene (transgene) that has been introduced so that its offspring will not segregate for the desired phenotype. The transgenic plant is heterozygous for one or more introduced transgenes, preferably uniformly heterozygous for the transgenes, such as in F1 offspring grown from hybrid seeds. Such plants can provide advantages well known in the art such as hybrid vigor or can be used for plant breeding or backcrossing.

[0403] In one embodiment, the exogenous polynucleotide encodes a set of polypeptides, wherein the polypeptides are Pythium malutifer Δ6-desaturase, Thraustochytrium Δ5-desaturase or Emiliana huxleyi Δ5-desaturase, Physcomitrella patens Δ6-elongase, Thraustochytrium Δ5-elongase or marine microalgae Δ5-elongase and Phytophthora infestans ω3-desaturase or Pythium malutifer ω3-desaturase.

[0404] In one embodiment, the plant of the present invention or for the present invention is preferably grown as substantially identical at least 1,000, 1,000,000 or 2,000,000 plants in a field or grown in at least 1 hectare or 2 hectares of area. Plant density is different according to plant species, plant species, climate, soil conditions, fertilizer utilization rate and other factors known in the art. For example, rapeseed is usually grown with a planting density of 1.2 to 1.5 million plants per hectare. Plants are gathered in the crops as known in the art, which may include mowing, stacking and / or harvesting plants, followed by threshing and / or winnowing plant material, to separate seeds from the remaining plant parts (usually in the form of husks). Alternatively, seeds can be gathered in the crops from the plants in the field using a single method (i.e., integration).

[0405] Plant transformation

[0406] Transgenic plants can be produced using techniques known in the art, such as those generally described in A. Slater et al., Plant Biotechnology - The Genetic Manipulation of Plants, Oxford University Press (2003) and P. Christou and H. Klee, Handbook of Plant Biotechnology, John Wiley and Sons (2004).

[0407] As used herein, the terms "stable transformation," "stably transformed," and variations thereof refer to the integration of exogenous nucleic acid molecules into the genome of a cell so that they are transferred to progeny cells during cell division without requiring explicit selection for their presence. Stable transformants or their progeny can be selected by in situ hybridization of chromosomal DNA or genetic DNA by any means known in the art, such as Southern blotting. Preferably, plant transformation is performed as described in the Examples herein.

[0408] Agrobacterium-mediated transfer is a widely available system for introducing genes into plant cells, because DNA can be introduced into the cells of whole plant tissues or plant organs or in the explants of tissue culture, for transient expression of DNA or for stable integration of DNA into the plant cell genome. Using Agrobacterium-mediated plant integration vectors to introduce DNA into plant cells is well known in the art (see, for example, US 5177010, US 5104310, US5004863 or US 5159135), including the floral dip method using Agrobacterium or other bacteria that can transfer DNA into plant cells. The DNA region to be transferred is limited by border sequences, and intervening DNA (T-DNA) is usually inserted into the plant genome. In addition, the integration of T-DNA is a relatively accurate process that hardly causes rearrangement. Among the effective plant species mediated by Agrobacterium, it is a method of selection due to the gentleness and limited nature of gene transfer. Preferred Agrobacterium transformation vectors are capable of replicating in both E. coli and Agrobacterium, allowing for convenient manipulations as described in (Klee et al., in: Plant DNA Infectious Agents, Hohn and Schell, eds., Springer-Verlag, New York, pp. 179-203 (1985).

[0409] Acceleration methods that can be used include, for example, microprojectile bombardment. An example of a method for delivering transformed nucleic acid molecules to plant cells is microprojectile bombardment. This method has been reviewed by Yang et al., Particle Bombardment Technology fbr Gene Transfer, Oxford Press, Oxford, England (1994). Non-biological particles (microprojectiles) can be coated with nucleic acids and delivered into cells by a propulsive force. Exemplary particles include those containing tungsten, gold, platinum, etc. In addition to being an effective way to propagate transformed monocotyledons, a particular advantage of microprojectile bombardment is that it does not require the isolation of protoplasts nor the susceptibility to Agrobacterium infection.

[0410] In another alternative embodiment, the plastids may be stably transformed. Methods disclosed for plastid transformation in higher plants include particle gun delivery of DNA containing a selectable marker and targeting the DNA to the plastid genome by homologous recombination (US5,451,513, US5,545,818, US5,877,402, US5,932479 and WO99 / 05265).

[0411] Other methods of cell transformation may also be used and include, but are not limited to, introducing DNA into plants by direct transfer of DNA into pollen, by injecting DNA directly into reproductive organs of the plant, or by injecting DNA directly into cells of immature embryos and then rehydrating the dehydrated embryos.

[0412] The regeneration, development, and growth of plants from individual plant protoplast transformants or from different transformed explants is well known in the art (Weissbach et al., In: Methods for Plant Molecular Biology, Academic Press, San Diego, Calif., (1988). Such regeneration and growth procedures generally include the steps of selecting transformed cells, culturing those individualized cells through the usual stages of embryonic development to the rooted plantlet stage. Transgenic embryos and seeds are similarly regenerated. The resulting transgenic rooted shoots are then planted in an appropriate plant growth medium, such as soil.

[0413] The development or regeneration of plants containing foreign, exogenous genes is well known in the art. Preferably, the regenerated plants are self-pollinated to provide homozygous transgenic plants. In addition, pollen obtained from the regenerated plants is crossed with seed-grown plants of agriculturally important strains. Conversely, pollen from plants of these important strains is used to pollinate the regenerated plants. Transgenic plants of the present invention containing the desired exogenous nucleic acids are grown using methods well known to those skilled in the art.

[0414] In order to verify the existence of transgenic in transgenic cells and plants, methods well known to those skilled in the art can be used to carry out polymerase chain reaction (PCR) amplification or southern blot analysis. The expression product of transgenic can be detected in any of a variety of ways according to the character of the product, and includes western blot and enzyme assay. Once transgenic plants are obtained, they can be grown to produce plant tissue or part with desired phenotype. Plant tissue or plant part can be gathered in the crops and / or seeds can be collected. Seed can be used as the source of the other plant growth for making tissue or part have desired characteristics.

[0415] Transgenic plants formed using Agrobacterium or other transformation methods typically contain a single genetic locus on a chromosome. Such transgenic plants can be referred to as hemizygous for one or more added genes. More preferably, they are homozygous transgenic plants for one or more added genes; that is, transgenic plants containing two added genes, one gene being located at the same locus on each chromosome of a chromosome pair. Homozygous transgenic plants can be obtained by self-pollinating hemizygous transgenic plants, germinating some of the produced seeds, and analyzing the resulting plants for the gene of interest.

[0416] It should also be understood that two different transgenic plants containing two independently separated exogenous genes or loci can also be crossed (mated) to produce offspring containing both sets of genes or loci. Selfing of appropriate F1 offspring can produce plants that are homozygous for both exogenous genes or loci. Backcrossing with the parent plant and outcrossing with non-transgenic plants, such as vegetative propagation, are also contemplated. Descriptions of other breeding methods commonly used for different traits and crops can be found in Fehr, In: Breeding Methods for Cultivar Development, Wilcox J., ed., American Society of Agronomy, Madison Wis. (1987).

[0417] Increased exogenous RNA levels and stable expression

[0418] Silencing suppressors

[0419] In one embodiment, the plant cell, plant or plant part comprises an exogenous polynucleotide encoding a silencing suppressor protein.

[0420] Post-transcriptional gene silencing (PTGS) is a nucleotide sequence-specific defense mechanism that targets both cellular and viral mRNAs for degradation. PTGS occurs in plants or fungi that are stably or transiently transformed with foreign (heterologous) or endogenous DNA and results in the reduced accumulation of RNA molecules that share sequence similarity with the introduced nucleic acid.

[0421] It is widely believed that co-expression of a silencing suppressor with a transgene of interest will increase the level of RNA present in cells transcribed by the transgene. While this has been shown to be true for cells in vitro, significant side effects have been observed in many whole plant co-expression studies. More specifically, as described by Mallory et al. (2002), Chapman et al. (2004), Chen et al. (2004), Dunoyer et al. (2004), Zhang et al. (2006), Lewsey et al. (2007), and Meng et al. (2008), plants expressing silencing suppressors under constitutive promoters are often phenotypically abnormal to a degree that makes them unsuitable for commercial production.

[0422] Recently, it was discovered that by restricting the expression of silencing suppressors to plant seeds or parts thereof, RNA molecule levels can be increased and / or stabilized over several generations (WO2010 / 057246). As used herein, a "silencing suppressor protein" or SSP is any polypeptide that can be expressed in plant cells, which can increase the level of expression products from different transgenes in plant cells, particularly over repeated generations from the initial transformed plant. In one embodiment, the SSP is a viral silencing suppressor or a mutant thereof. A large number of viral silencing suppressors are known in the art and include, but are not limited to, P19, V2, P38, Pe-Po, and RPV-Po.

[0423] As used herein, the terms "stabilizing expression," "stably expressed," "stabilized expression," and variations thereof refer to substantially the same or higher levels of an RNA molecule in subsequent generations (over repeated generations, e.g., at least three, at least five, or at least ten generations) when compared to an isogenic plant lacking an exogenous polynucleotide encoding a silencing suppressor. However, this term or terms do not exclude the possibility that there may be some loss in the level of an RNA molecule within repeated generations when compared to the previous generation, e.g., a loss of not less than 10% per generation.

[0424] The repressor can be selected from any source, for example, plants, viruses, mammals, etc. A list of viruses for which repressors are obtained, as well as the protein (e.g., B2, P14, etc.) or coding region name of the repressor from each specific virus, is available in WO 2010 / 057246. Multiple copies of the repressor can be used. Different repressors can be used together (e.g., in series).

[0425] RNA molecules

[0426] Essentially any RNA molecule that needs to be expressed in plant seeds can be co-expressed with a silencing suppressor. The encoded polypeptide may be involved in the metabolism of oils, starches, carbohydrates, nutrients, etc., and may be responsible for the synthesis of proteins, peptides, fatty acids, lipids, waxes, oils, starches, sugars, carbohydrates, fragrances, odors, toxins, carotenoids, hormones, polymers, flavonoids, storage proteins, phenolic acids, alkaloids, lignin, tannins, cellulose, glycoproteins, glycolipids, etc., preferably the biosynthesis or assembly of TAGs.

[0427] In a specific example, the plant produced has increased levels of an enzyme used to produce oil in a plant such as a Brassica plant, such as rapeseed or sunflower, safflower, flax, cotton, soybean, camelina, or corn.

[0428] Levels of LC-PUFA produced

[0429] The level of LC-PUFA or combination of LC-PUFAs produced in recombinant cells or plant parts such as seeds is important. The level can be expressed as a percentage relative to the total fatty acids, which are a particular LC-PUFA or group of related LC-PUFAs, such as ω3 LC-PUFAs or ω6 LC-PUFAs, or VLC-PUFAs, or other fatty acids that can be determined by methods known in the art. The level can also be expressed as LC-PUFA content, such as, for example, the percentage of LC-PUFA based on the dry weight of the material containing the recombinant cells, such as the percentage of LC-PUFA based on the weight of the seed. It will be appreciated that the LC-PUFA produced in oilseeds is considerably higher in terms of LC-PUFA content than in vegetables or grains not grown for oil production, but both can have similar LC-PUFA compositions and both can be used as a source of LC-PUFAs for human or animal consumption.

[0430] The level of LC-PUFA can be determined by any method known in the art. In a preferred method, total lipids are extracted from cells, tissues or organs and the fatty acids are converted to methyl esters before analysis by gas chromatography (GC). Such techniques are described in Example 1. The peak position in the chromatogram can be used to determine each specific fatty acid and the area under each peak is integrated to determine its amount. As used herein, unless otherwise stated, the percentage of a specific fatty acid in a sample is determined as the area under the peak of the fatty acid, determined as the total area percentage of the fatty acids in the chromatogram. This corresponds substantially to the weight percentage (w / w). The properties of the fatty acids can be confirmed by GC-MS. Total lipids can be separated by techniques known in the art to purify various fractions, such as the TAG fraction. For example, thin layer chromatography (TLC) can be performed on an analytical scale to separate TAG from other lipid fractions such as DAG, acyl-CoA or phospholipids in order to specifically determine the fatty acid composition of TAG.

[0431] In one embodiment, the total amount of ARA, EPA, DPA and DHA in the fatty acids of the extracted lipids is between about 21% and about 40% of the total fatty acids in the cell. In another embodiment, the total fatty acids in the cell have less than 1% C20: 1. In a preferred embodiment, the extractable TAGs in the cell constitute the fatty acids at the levels mentioned herein. Each possible combination of the characteristics defining the lipids as described herein is also contemplated.

[0432] The level of LC-PUFA production in a recombinant cell, plant, or plant part, such as a seed, can also be expressed as the percentage of a particular substrate fatty acid converted to one or more product fatty acids, which is also referred to herein as "conversion efficiency" or "enzyme efficiency." This parameter is based on the fatty acid composition of the lipids extracted from the cell, plant, plant part, or seed, i.e., the amount of LC-PUFA formed (including other LC-PUFAs derived therefrom) as a percentage of the substrate fatty acid or fatty acids (including all other fatty acids derived therefrom). The general formula for percent conversion is: 100 x (total percent of product LC-PUFA and all products derived therefrom) / (total percent of substrate fatty acid and all products derived therefrom). With respect to DPA, for example, this can be expressed as the ratio of the level of DPA (as a percentage of the total fatty acid content of the lipids) to the level of the substrate fatty acid (e.g., OA, LA, ALA, SDA, ETA, or EPA) and all products derived from the substrate, including DPA. The percent conversion or conversion efficiency can be expressed for a single enzymatic step in a pathway, or for part or all of a pathway.

[0433] The specific transformation efficiency was calculated herein according to the following formula:

[0434] 1. OA to DPA = 100 x (% DHA + % DPA) / (total % of OA, LA, GLA, DGLA, ARA, EDA, ALA, SDA, ETrA, ETA, EPA, DPA and DHA).

[0435] 2. LA to DPA = 100 x (% DHA + DPA) / (total % of LA, GLA, DGLA, ARA, EDA, ALA, SDA, ETrA, ETA, EPA, DPA and DHA).

[0436] 3. ALA to DPA = 100 x (% DHA + % DPA) / (total % of ALA, SDA, ETrA, ETA, EPA, DPA and DHA).

[0437] 4. EPA to DPA = 100 x (% DHA + DPA) / (total % of EPA, DPA and DHA).

[0438] 5. DPA to DHA (Δ4-desaturase efficiency) = 100 x (% DHA) / (total % of DPA and DHA).

[0439] 6. Δ12-desaturase efficiency = 100 x (total % of LA, GLA, DGLA, ARA, EDA, ALA, SDA, ETrA, ETA, EPA, DPA, and DHA) / (total % of OA, LA, GLA, DGLA, ARA, EDA, ALA, SDA, ETrA, ETA, EPA, DPA, and DHA).

[0440] 7. ω3-desaturase efficiency = 100 x (total % of ALA, SDA, ETrA, ETA, EPA, DPA, and DHA) / (total % of LA, GLA, DGLA, ARA, EDA, ALA, SDA, ETrA, ETA, EPA, DPA, and DHA).

[0441] 8. OA to ALA = 100 x (total % of ALA, SDA, ETrA, ETA, EPA, DPA and DHA) / (total % of OA, LA, GLA, DGLA, ARA, EDA, ALA, SDA, ETrA, ETA, EPA, DPA and DHA).

[0442] 9. Δ6-desaturase efficiency (for the ω3 substrate ALA) = 100 x (total % of SDA, ETA, EPA, DPA and DHA) / (% of ALA, SDA, ETrA, ETA, EPA, DPA and DHA).

[0443] 10. Δ6-elongase efficiency (for the ω3 substrate SDA) = 100 x (total % of ETA, EPA, DPA and DHA) / (total % of SDA, ETA, EPA, DPA and DHA).

[0444] 11. Δ5-desaturase efficiency (for the ω3 substrate ETA) = 100 x (total % of EPA, DPA and DHA) / (total % of ETA, EPA, DPA and DHA).

[0445] 12. Δ5-elongase efficiency (for the ω3 substrate EPA) = 100 x (total % of DPA and DHA) / (total % of EPA, DPA and DHA).

[0446] The fatty acid composition of the lipids (preferably oilseeds) of the present invention is also characterized by the ratio of ω6 fatty acids: ω3 fatty acids in the total fatty acid content, for total ω6 fatty acids: total ω3 fatty acids or for new ω6 fatty acids: new ω3 fatty acids. The terms total ω6 fatty acids, total ω3 fatty acids, new ω6 fatty acids and new ω3 fatty acids have the meanings as defined herein. The ratio is calculated from the fatty acid composition of lipids extracted from cells, plants, plant parts or seeds in a manner as exemplified herein. It is desirable to have a greater level of ω3 fatty acids in the lipids than ω6 fatty acids, and therefore an ω6: ω3 ratio of less than 1.0 is preferred. A ratio of 0.0 indicates that there is no defined ω6 fatty acid at all; a ratio of 0.03 is achieved as described in Example 5. Such lower ratios can be achieved by combining a Δ6-desaturase with an ω3 substrate preference with an ω3-desaturase (particularly a fungal ω3-desaturase, such as the Pichia pastoris ω3-desaturase exemplified herein).

[0447] The LC-PUFA yield per weight of seed can also be calculated based on the total oil content of the seed and the % DPA in the oil. For example, if the oil content of rapeseed seeds is about 40% (w / w) and about 12% of the total fatty acid content of the oil is DPA, the DPA content of the seed is about 4.8% or about 48 mg per gram of seed. At a DPA content of about 21%, rapeseed seeds or camelina seeds have a DPA content of about 84 mg per gram of seed. The present invention thus provides Brassica napus, Brassica juncea, and Camelina sativa plants and seeds obtained therefrom, which contain at least about 80 mg or at least about 84 mg DPA per gram of seed. The seeds have a moisture content that is typical of harvested mature seeds after drying (4%-15% moisture content). The present invention also provides a method for obtaining oil, comprising obtaining the seeds and extracting oil from the seeds; as well as uses of the oil and a method for obtaining seeds, comprising harvesting seeds from the plants according to the present invention.

[0448] If the seed yield per hectare is known or can be estimated, the amount of DPA produced per hectare can also be calculated. For example, in Australia, rapeseed typically yields approximately 2.5 tons of seed per hectare, which yields approximately 1,000 kg of oil at a 40% oil content. At 20.1% DPA in total oil, this provides approximately 200 kg of DPA per hectare. If the oil content is reduced by 50%, this still provides approximately 100 kg of DPA / ha.

[0449] Evidence to date indicates that some desaturases expressed heterologously in yeast or plants have relatively low activity in combination with some elongases. This can be mitigated by equipping the desaturase with the ability to use acyl-CoA fatty acids as substrates in LC-PUFA synthesis, and this is also considered advantageous in recombinant cells, particularly in plant cells. A particularly advantageous combination for efficient DPA synthesis is a fungal ω3-desaturase, such as Pichia pastoris ω3-desaturase (SEQ ID NO: 6), and a Δ6-desaturase with a preference for ω3 acyl substrates, such as Micromonas pusillus Δ6-desaturase (SEQ ID NO: 7), or variants thereof having at least 95% amino acid sequence identity.

[0450] As used herein, the term "substantially free" means that the composition (e.g., lipid or oil) contains little (e.g., less than about 0.5%, less than about 0.25%, less than about 0.1%, or less than about 0.01%) or no defined component. In one embodiment, "substantially free" means that the component cannot be detected using conventional analytical techniques, for example, a specific fatty acid (e.g., ω6-docosapentaenoic acid) cannot be detected using gas chromatography as set forth in Example 1.

[0451] In one embodiment, the extracted lipid, extracted oil, plant or part thereof such as seeds (of the invention or used in the process / method of the invention), feedstock or composition of the invention does not comprise all-cis-6,9,12,15,18-henicosapentaenoic acid (n-3 HPA).

[0452] Oil production

[0453] The technology that this area is usually practiced can be used for extracting, processing and analyzing the oil produced by the cell of the present invention, plant, seed etc.Usually, plant seeds are cooked, squeezed and extracted to produce crude oil, and then they are degummed, refined, bleached and deodorized.Usually, the technology that is used for crushing seeds is known in the art.For example, oil seeds can be tempered by spraying them with water so that the moisture content is increased to, for example, 8.5% and shelled using a smooth roller with a roller gap setting of 0.23mm to 0.27mm.Depending on the type of seed, water cannot be added before crushing.Applying heat makes the enzyme inactive, promotes further cell rupture, makes the oil droplets merge, and makes the protein particles agglomerate, all of which all contribute to the extraction process.

[0454] In one embodiment, most of the seed oil is released by passing through a screw press. The filter cake discharged from the screw press is then subjected to solvent extraction using a heat tracer column, for example, hexane. Alternatively, the crude oil produced by the squeezing operation can be passed through a settling tank with a grooved line discharge pipe top to remove the solids from which the oil was squeezed during the squeezing operation. The clarified oil can be passed through a plate and frame filter to remove any remaining fine solid particles. If desired, the oil recovered from the extraction process can be combined with the clarified oil to produce a blended crude oil.

[0455] Once the solvent is stripped from the crude oil, the pressed and extracted portions are combined and subjected to normal oil processing procedures. As used herein, the term "purified" when used in conjunction with the lipids or oils of the present invention generally means that the extracted lipids or oils have been subjected to one or more processing steps that increase the purity of the lipid / oil component. For example, the purification step may comprise one or more or all of the group consisting of: degumming, deodorizing, decolorizing, drying and / or fractionating the extracted oil. However, as used herein, the term "purified" does not include other processes that involve transesterification processes or altering the fatty acid composition of the lipids or oils of the present invention in order to increase the DPA content as a percentage of the total fatty acid content. In other words, the fatty acid composition of the purified lipids or oils is substantially identical to that of unpurified lipids or oils.

[0456] Degumming

[0457] Degumming is an early step in oil refining, and its primary purpose is to remove the majority of the phospholipids, which may constitute approximately 1%-2% of the total extracted lipids, from the oil. Approximately 2% water, typically containing phosphoric acid, is added to the crude oil at 70°C to 80°C, resulting in the separation of most of the phospholipids, along with trace metals and pigments. The insoluble material removed is primarily a mixture of phospholipids and triacylglycerols, also known as lecithin. Degumming can be performed by adding concentrated phosphoric acid to the crude seed oil to convert the non-hydratable phospholipids into a hydrated form and chelate any minor metals present. The gums are separated from the seed oil by centrifugation.

[0458] Alkali refining

[0459] Alkali refining is one of the refining processes for processing crude oil, and is sometimes also referred to as neutralization. It is usually after degumming and before bleaching. After degumming, seed oil can be processed by adding sufficient alkaline solution to titrate all fatty acids and phosphoric acid and removing the soap formed thereby. Suitable alkali materials include sodium hydroxide, potassium hydroxide, sodium carbonate, lithium hydroxide, calcium hydroxide, calcium carbonate and ammonium hydroxide. This process is usually carried out at room temperature and removes the free fatty acid fraction. Soap is removed by centrifugation or by being extracted into the solvent for soap, and the neutralized oil is washed with water. If necessary, any excessive alkali in the available suitable acid such as hydrochloric acid or sulfuric acid can be neutralized.

[0460] bleach

[0461] Bleaching is a refining process in which the oil is heated at 90° C. to 120° C. for 10 to 30 minutes in the presence of bleaching earth (0.2% to 2.0%) and in the absence of oxygen by operating with nitrogen or steam or in a vacuum. This step in oil processing is designed to remove unwanted pigments (carotenoids, chlorophyll, gossypol, etc.), and the process also removes oxidation products, trace metals, sulfur compounds, and traces of soap.

[0462] Deodorize

[0463] Deodorization is the treatment of oils and fats at high temperatures (200°C-260°C) and low pressure (0.1-1 mm Hg). This is typically accomplished by introducing steam into the seed oil at a rate of approximately 0.1 ml / min / 100 ml of seed oil. After bubbling for approximately 30 minutes, the seed oil is allowed to cool under vacuum. The seed oil is typically transferred to a glass container and purged with argon before storage under refrigeration. This treatment improves the color of the seed oil and removes most volatile or odorous compounds, including any remaining free fatty acids, monoacylglycerols, and oxidation products.

[0464] frozen

[0465] Congealing is a process sometimes used in the commercial production of oils to separate oils and fats into solid (stearin) and liquid (olein) fractions by crystallization at subambient temperatures. It was originally used with cottonseed oil to produce a solids-free product. It is often used to reduce the saturated fatty acid content of an oil.

[0466] Transesterification

[0467] As used herein, "transesterification" refers to the process of exchanging fatty acids within and between TAGs or transferring fatty acids to another alcohol to form esters. This initially involves releasing fatty acids from TAGs as free fatty acids or it can directly produce fatty acid esters, preferably fatty acid methyl or ethyl esters. In the transesterification reaction of TAGs with alcohols such as methanol or ethanol, the alkyl group of the alcohol forms an ester bond with the acyl group of the TAG (including DPA). When combined with a fractionation process, transesterification can be used to change the fatty acid composition of lipids (Marangoni et al., 1995). Transesterification can be performed using chemical (e.g., strong acid or strong base catalysis) or enzymatic methods, the latter using lipases that can be position-specific (sn-1 / 3 or sn-2 specific) for the fatty acids on the TAGs or have a preference for some fatty acids over others (Speranza et al., 2012). Fatty acid fractionation to increase the concentration of LC-PUFA in oils can be achieved by any method known in the art, such as freeze crystallization, complex formation using urea, molecular distillation, supercritical fluid extraction, countercurrent chromatography, and silver ion complexation. Complex formation using urea is a preferred method for simply and effectively reducing the levels of saturated fatty acids and monounsaturated fatty acids in oils (Gamez et al., 2003). Initially, the TAGs of the oil are hydrolyzed under acid- or base-catalyzed reaction conditions to separate the constituent fatty acids, usually in the form of fatty acid esters, whereby 1 mol of TAG is reacted with at least 3 mol of alcohol (e.g., ethanol for ethyl esters or methanol for methyl esters), wherein an excess of alcohol is used to separate the formed alkyl esters and the further formed glycerol, or by lipase decomposition. These free fatty acids or fatty acid esters, which are generally treated to not change the fatty acid composition, can then be mixed with an ethanolic solution of urea to form a complex. Saturated fatty acids and monounsaturated fatty acids readily complex with urea and crystallize out upon cooling and can subsequently be removed by filtration. The non-urea-complexed fraction is thus rich in LC-PUFAs.

[0468] raw material

[0469] The present invention includes compositions that can be used as feedstocks. For the purposes of the present invention, "feedstock" includes any food or product for human or animal consumption that, when introduced into the body, (a) nourishes or builds tissue or supplies energy; and / or (b) maintains, restores, or supports adequate nutritional status or metabolic function. Feedstocks of the present invention include nutritional compositions for infants and / or children, such as, for example, infant formula and the seed flours of the present invention.

[0470] Raw materials of the present invention include, for example, cells of the present invention, plants of the present invention, plant parts of the present invention, seeds of the present invention, extracts of the present invention, products of the methods of the present invention, products of the fermentation processes of the present invention, or compositions together with one or more suitable carriers. The term "carrier" is used in its broadest sense to encompass any component that may or may not have nutritional value. As will be appreciated by those skilled in the art, the carrier must be suitable for (or used in) the raw material at sufficiently low concentrations so that it does not have a deleterious effect on the organism that consumes the raw material.

[0471] The raw materials of the present invention include oils, fatty acid esters, or fatty acids produced directly or indirectly using methods, cells, or plants disclosed herein. The compositions may be in solid or liquid form. Additionally, the compositions may include edible macronutrients, proteins, carbohydrates, vitamins, and / or minerals in amounts required for a particular use. The amounts of these ingredients will vary depending on whether the composition is intended for a normal individual or for an individual with a specified need, such as an individual suffering from a metabolic disorder.

[0472] Examples of suitable carriers with nutritional value include, but are not limited to, macronutrients such as edible fats, carbohydrates, and proteins. Examples of such edible fats include, but are not limited to, coconut oil, borage oil, fungal oil, blackcurrant oil, soybean oil, and mono- and diglycerides. Examples of such carbohydrates include, but are not limited to, glucose, edible lactose, and hydrolyzed starch. Additionally, examples of proteins that can be used in the nutritional compositions of the present invention include, but are not limited to, soy protein, electrodialyzed whey, electrodialyzed skim milk, milk whey, or hydrolyzates of these proteins.

[0473] With respect to vitamins and minerals, the following may be added to the raw material compositions of the present invention: calcium, phosphorus, potassium, sodium, chloride, magnesium, manganese, iron, copper, zinc, selenium, iodine, and vitamins A, E, D, C, and B complex. Other such vitamins and minerals may also be added.

[0474] The components used in the feedstock compositions of the present invention may be of semi-purified or purified origin. The terms semi-purified or purified refer to materials that have been prepared by purification of natural materials or by de novo synthesis.

[0475] The raw material composition of the present invention can also be added to food, even when dietary supplementation is not required. For example, the composition can be added to any type of food, including but not limited to: margarine, modified butter, cheese, milk, yogurt, chocolate, candy, snacks, salad oil, cooking oil, cooking fat, meat, fish, and beverages.

[0476] In addition, the fatty acids produced according to the present invention or the host cells converted to contain and express the subject genes can also be used as animal food supplements to change the fatty acid composition of animal tissues, eggs or milk to one or more desired fatty acids for human or animal consumption. Examples of such animals include sheep, cattle, horses, poultry (such as chickens), etc.

[0477] Furthermore, the feedstock of the invention may be used in aquaculture to increase fatty acid levels in fish or crustaceans such as, for example, shrimp for human or animal consumption. A preferred fish is salmon.

[0478] Preferred raw materials for the present invention are plants, seeds, and other plant parts, such as leaves and stems, that can be used directly as food or raw materials for humans or other animals. For example, animals can directly consume such plants growing in the field or consume more measured amounts through controlled feeding. The present invention encompasses the use of such plants or plant parts as raw materials for increasing LC-PUFA levels in humans and other animals.

[0479] In one embodiment, the raw material is an infant formula comprising a lipid or oil of the present invention. As used herein, "infant formula" means a non-naturally occurring composition that satisfies at least a portion of the nutritional requirements of an infant. "Infant" means a human subject from birth to an age range no greater than one year old and includes infants of corrected age of 0 to 12 months. The phrase "corrected age" means the infant's chronological age minus the amount of time the infant was born prematurely. Therefore, if the infant is born full term, the corrected age is the infant's age. As used herein, "non-naturally occurring" means that the product is not found in nature but is produced through human intervention. As used herein, the infant formula of the present invention excludes pure human breast milk (Koletzko et al., 1988) and pure milk produced by non-human animals, but the infant formula of the present invention may include components derived from milk, such as milk protein or carbohydrates, such as whey protein or lactose. The infant formula of the present invention excludes naturally occurring meats such as beef, seal meat, whale meat or fish, but the infant formula of the present invention may include components such as protein from these sources. The infant formula of the present invention always contains lipids containing DPA of the present invention at a level preferably between 0.05% and 0.5% based on the total fatty acid content. The DPA may be present as a TAG, as a phospholipid, or as an unesterified fatty acid, or a mixture thereof. The lipids or oils of the present invention can be incorporated into the infant formula using procedures known in the art. For example, one can generally use the procedures described in WO 2008 / 027991, US20150157048, US2015094382, and US20150148316 to produce the infant formula of the present invention, wherein DPA is added in addition to or in place of one or more of the polyunsaturated fatty acids described herein.

[0480] In one example, the infant formula comprises DPA (i.e., ω-3 DPA as described herein), optionally with prebiotics, specifically polydextrose (PDX) and galacto-oligosaccharides (GOS), lactoferrin from non-human sources, and other long-chain polyunsaturated fatty acids (LC-PUFAs). In some embodiments, the nutritional composition further comprises SDA and / or gamma-linolenic acid (GLA). In certain embodiments, the infant formula comprises up to about 7 g / 100 kcal of a fat or lipid source, more preferably from about 3 g / 100 kcal to about 7 g / 100 kcal of a fat or lipid source, wherein the fat or lipid source comprises at least about 0.5 g / 100 kcal and more preferably from about 1.5 g / 100 kcal to about 7 g / 100 kcal; up to about 7 g / 100 kcal of a protein or protein equivalent source, more preferably from about 1 g / 100 kcal to about 7 g / 100 kcal of a protein or protein equivalent source; and at least about 5 g / 100 kcal of carbohydrates, more preferably from about 5 g to about 25 g / 100 kcal of carbohydrates. The infant formula may further comprise one or more or all of the following: 1) at least about 10 mg / 100 kcal lactoferrin, more preferably about 10 mg / 100 kcal to about 200 mg / 100 kcal lactoferrin; 2) about 0.1 g / 100 kcal to about 1 g / 100 kcal of a prebiotic composition comprising PDX and GOS; and 3) at least about 5 mg / 100 kcal of additional LC-PUFAs comprising DHA (i.e., LC-PUFAs other than DPA), more preferably about 5 mg / 100 kcal to about 75 mg / 100 kcal of additional LC-PUFAs comprising DHA.

[0481] In one embodiment, the ratio of DPA:DHA in the total fatty acid content of the infant formula is between 1:3 and 2:1. EPA may also be present but is preferably absent. If present, the ratio of EPA:DPA in the total fatty acid content is preferably less than 1:2, more preferably less than 1:5. ARA may also be absent but is preferably present, preferably at a ratio of ARA:DPA in the total fatty acid content of between 1:3 and 2:1. Most preferably, the levels of each LC-PUFA in the infant formula are approximately the same as those found in human breast milk, which naturally exhibits variation based on maternal age, genetic factors, dietary intake, and nutritional status. See, for example, Koletzko et al. (1988). In a preferred embodiment, the infant formula does not contain detectable levels of henicosapentaenoic acid (HPA, 21:5ω3).

[0482] Infant formula may refer to enteral preparations, oral formulas, formulas for infants, for example, in liquid, powder, gel, paste, solid, concentrate, suspension, or ready-to-use form.

[0483] Prebiotics suitable for use in the present disclosure may include polydextrose, polydextrose powder, lactulose, lactofructooligosaccharides, raffinose, glucose oligosaccharides, inulin, fructooligosaccharides, isomaltooligosaccharides, soybean oligosaccharides, lactofructooligosaccharides, xylooligosaccharides, chitosan oligosaccharides, mannooligosaccharides, arabinose oligosaccharides, sialylated oligosaccharides, fucose oligosaccharides, galacto-oligosaccharides, and gentio-oligosaccharides.

[0484] Lactoferrin may also be included in the nutritional compositions of the present disclosure. Lactoferrin is a single-chain polypeptide of approximately 80 kD containing 1-4 glycans, depending on the species. The 3D structures of lactoferrin from different species are very similar, but not identical. Each lactoferrin protein contains two homologous lobes, termed the N-lobe and the C-lobe, which refer to the N-terminal and C-terminal portions of the molecule, respectively.

[0485] Protein or protein equivalent sources are available in the art, such as skim milk, whey protein, casein, soy protein, hydrolyzed protein, amino acids, etc. Suitable sources of milk protein for use in the present disclosure include, but are not limited to, milk protein powder, milk protein concentrate, milk protein isolate, skim milk solids, skim milk, skim milk powder, whey protein, whey protein isolate, whey protein concentrate, sweet whey, acid whey, casein, acid casein, caseinates (e.g., sodium caseinate, sodium calcium caseinate, calcium caseinate), and any combination thereof.

[0486] Suitable carbohydrate sources can be arbitrarily used in the art, such as lactose, glucose, fructose, corn syrup solids, maltodextrin, sucrose, starch, rice syrup solids, etc. The amount of the carbohydrate component in the nutritional composition is at least about 5g / 100 kcal and can generally vary between about 5g and about 25g / 100 kcal. In some embodiments, the amount of carbohydrate is between about 6g and about 22g / 100 kcal. In other embodiments, the amount of carbohydrate is between about 12g and about 14g / 100 kcal. In some embodiments, corn syrup solids is preferred. In addition, hydrolysis, partial hydrolysis and / or extensive hydrolysis of carbohydrates are desired to be included in the nutritional composition due to their digestibility. Specifically, hydrolyzed carbohydrates are unlikely to contain allergenic epitopes. Non-limiting examples of carbohydrate materials suitable for use herein include starch that is hydrolyzed or complete, natural or chemically modified, derived from corn, cassava, rice or potato, glutinous or non-glutinous form. The limiting examples of carbohydrate that is suitable for comprises the starch of various hydrolysis, and it is characterized by hydrolysis corn starch, maltodextrin, maltose, corn syrup, dextrose, corn syrup solids, glucose and various other glucose polymers and its combination.The limiting examples of other carbohydrate that is suitable for comprises those carbohydrates that are commonly referred to as sucrose, lactose, fructose, high fructose corn syrup, indigestible oligosaccharides such as oligofructose and its combination.

[0487] Preferably, one or more vitamins and / or minerals may be added to the infant formula in an amount sufficient to supply the daily nutritional requirements of the subject.It will be appreciated by those of ordinary skill in the art that vitamin and mineral needs will vary, for example, based on the age of the child. The nutritional composition may optionally include, but is not limited to, one or more of the following vitamins or their derivatives: vitamin B1 (thiamine, thiamine pyrophosphate, TPP, thiamine triphosphate, TTP, thiamine hydrochloride, thiamine nitrate), vitamin B2 (riboflavin, flavin mononucleotide, FMN, flavin adenine dinucleotide, FAD, riboflavin, lutein), vitamin B3 (niacin, niacin, nicotinamide, nicotinamide, nicotinamide adenine dinucleotide, NAD, nicotinic acid mononucleotide, NicMN, pyridine-3-carboxylic acid), tryptophan vitamin B3-precursor, vitamin B6 (pyridoxine, pyridoxal, pyridoxamine, pyridoxine hydrochloride), pantothenic acid (pantothenate, panthenol), folate (folic acid, fblacin, pteroylglutamate), vitamin B12 (cobalamin, methylcobalamin, deoxyadenosylcobalamin, cyanocobalamin,

[0014] Examples of the present invention include, but are not limited to, hydroxycobalamin, adenosylcobalamin), biotin, vitamin C (ascorbic acid), vitamin A (retinol, retinyl acetate, retinyl palmitate, retinyl esters with other long-chain fatty acids, retinal, retinoic acid, retinol esters), vitamin D (calciferol, cholecalciferol, vitamin B6, 1,25-dihydroxyvitamin D), vitamin E (alpha-tocopherol, alpha-tocopheryl acetate, alpha-tocopheryl succinate, alpha-tocopheryl nicotinate, alpha-tocopherol), vitamin K (vitamin K1, phylloquinone, naphthoquinone, vitamin K2, menaquinone-7, vitamin K3, menaquinone-4, menaquinone, menaquinone-8, menaquinone-8H, menaquinone-9, menaquinone-9H, menaquinone-10, menaquinone-11, menaquinone-12, menaquinone-13), choline, inositol, beta-carotene, and any combination thereof. In addition, the nutritional composition may optionally include, but is not limited to, one or more of the following minerals or their derivatives: boron, calcium, calcium acetate, calcium gluconate, calcium chloride, calcium lactate, calcium phosphate, calcium sulfate, chloride, chromium, chromium chloride, chromium picolinate, copper, copper sulfate, copper gluconate, copper sulfate, fluoride, iron, carbonyl iron, ferric iron, ferrous fumarate, ferrous orthophosphate, iron ground, polysaccharide iron, iodide, iodine, magnesium, magnesium carbonate, magnesium hydroxide, magnesium oxide, magnesium stearate, magnesium sulfate, manganese, molybdenum, phosphorus, potassium, potassium phosphate, potassium iodide, potassium chloride, potassium acetate, selenium, sulfur, sodium, docusate sodium, sodium chloride, sodium selenate, sodium molybdate, zinc, zinc oxide, zinc sulfate, and mixtures thereof. Non-limiting derivatives of mineral compounds include salts, alkaline salts, esters, and chelates of any mineral compound. The minerals may be added to the nutritional composition in the form of salts such as calcium phosphate, calcium glycerophosphate, sodium citrate, potassium chloride, potassium phosphate, magnesium phosphate, ferrous sulfate, zinc sulfate, copper sulfate, magnesium sulfate, and sodium selenite.Additional vitamins and minerals may be added as known in the art.

[0488] In one embodiment, the infant formula of the present invention or produced using the present invention does not comprise human or animal breast milk or extracts thereof containing DPA.

[0489] In another embodiment, the level of ω-6 DPA in the total fatty acid content of the infant formula is less than 2%, preferably less than 1%, or between 0.1% and 2%, and more preferably is absent.

[0490] Composition

[0491] The present invention also encompasses compositions, particularly pharmaceutical compositions, comprising one or more of the fatty acids produced using the methods of the present invention and / or the resulting oils, preferably in the form of fatty acid ethyl esters.

[0492] The pharmaceutical composition can comprise one or more of the fatty acid and / or oil and standard, well-known, nontoxic pharmaceutically acceptable carrier, adjuvant or vehicle such as phosphate buffered saline, water, ethanol, polyol, vegetable oil, wetting agent or emulsion (such as water / oil emulsion) combination. The composition can be in liquid or solid form. For example, the composition can be in the form of tablets, capsules, ingestible liquids or powders, injectable or external ointments or creams. Suitable flowability can be maintained, for example, by maintaining the required particle size under dispersed conditions and by using a surfactant. It may also be desirable to include isotonic agents, such as sugar, sodium chloride, etc. In addition to this type of inert diluent, the composition can also include adjuvants, such as wetting agents, emulsifiers and suspending agents, sweeteners, flavorings and aromatics.

[0493] Suspensions, in addition to the active compounds, may contain suspending agents as, for example, ethoxylated isostearyl alcohols, polyoxyethylene sorbitol and sorbitan esters, microcrystalline cellulose, aluminum metahydroxide, bentonite, agar-agar and tragacanth, or mixtures of these substances.

[0494] Solid dosage forms such as tablets and capsules can be prepared using technology well known in the art. For example, the fatty acid produced according to the present invention can be tableted using conventional tablet matrices such as lactose, sucrose and corn starch in combination with a binder (such as gum arabic, corn starch or gelatin), a disintegrant (such as potato starch or alginic acid) and a lubricant (such as stearic acid or magnesium stearate). Capsules can be prepared by incorporating these excipients into gelatin capsules together with an antioxidant and one or more related fatty acids.

[0495] For intravenous administration, the fatty acids or derivatives thereof produced according to the present invention can be incorporated into commercial formulations.

[0496] Typical dosages of a particular fatty acid are 0.1 mg to 20 g, taken one to five times daily (up to 100 g per day), and preferably range from about 10 mg to about 1, 2, 5, or 10 g per day (taken in one or more doses). As is known in the art, a minimum amount of about 300 mg / day of fatty acids, particularly LC-PUFAs, is desirable. However, it will be appreciated that any amount of fatty acid will be beneficial to the subject.

[0497] Possible routes of administration of the pharmaceutical compositions of the present invention include, for example, enteral (e.g., oral and rectal) and parenteral. For example, liquid preparations can be administered orally or rectally. Alternatively, the homogeneous mixture can be completely dispersed in water and mixed with a physiologically acceptable diluent, preservative, buffer, or propellant under aseptic conditions to form a spray or inhalant.

[0498] The dosage of the composition to be administered to a patient can be determined by one of ordinary skill in the art and depends on factors such as patient weight, patient age, patient general health, patient past medical history, patient immune status, and the like.

[0499] Additionally, the composition of the present invention may be used for cosmetic purposes. It may be added to a pre-existing cosmetic composition so as to form a mixture or the fatty acid produced according to the present invention may be used as the sole "active" ingredient in a cosmetic composition.

[0500] Example

[0501] Example 1. Materials and methods

[0502] Gene expression in transient expression systems in plant cells

[0503] Exogenous genetic constructs are expressed in a transient expression system in plant cells, essentially as described by Voinnet et al. (2003) and Wood et al. (2009). A plasmid containing the coding region expressed from a strong constitutive promoter, such as the CaMV 35S promoter, is introduced into Agrobacterium tumefaciens strain AGL1. A chimeric gene 35S:p19 for expressing the p19 viral silencing suppressor is separately introduced into AGL1 as described in WO 2010 / 057246. Recombinant Agrobacterium cells are grown to stationary phase at 28°C in LB broth supplemented with 50 mg / L kanamycin and 50 mg / L rifampicin. Bacteria are then pelleted by centrifugation at 5000 g for 15 min at room temperature and resuspended to an OD600 of 1.0 in infiltration buffer containing 10 mM MES pH 5.7, 10 mM MgCl2, and 100 μM acetosyringone. The cells were then incubated at 28°C with shaking for 3 hours, after which equal volumes of Agrobacterium culture containing 35S:p19 and one or more test chimeric constructs of interest were mixed before infiltration into leaf tissue. Plants were typically grown for an additional five days after infiltration before leaf discs were harvested and freeze-dried for GC analysis of fatty acids.

[0504] Fatty acid methyl esters (FAMEs) of total leaf lipids in freeze-dried samples were generated by incubating the samples in a methanol / HCl / dichloromethane (10 / 1 / 1 v / v) solution at 80°C for 2 hours with a known amount of hexadecanoic acid as an internal standard. The FAMEs were extracted with hexane / DCM, concentrated into a small volume of hexane, and injected into a GC. The amount of individual and total fatty acids present in the lipid fraction was quantified based on the known amount of the internal standard.

[0505] Gas chromatography (GC) analysis of fatty acids

[0506] FAMEs were analyzed by gas chromatography using an Agilent Technologies 7890A GC (Palo Alto, California, USA) equipped with a 30 m SGE-BPX70 column (70% cyanopropyl polyphenylene silicon-siloxane, 0.25 mm inner diameter, 0.25 mm film thickness), an FID, a split / splitless injector, and an Agilent Technologies 7693 series autosampler and injector. Helium was used as the carrier gas. The samples were injected in split mode (50:1 ratio) at an oven temperature of 150°C. After injection, the oven temperature was maintained at 150°C for 1 min and then at 3°C / min. -1 It was raised to 210 °C and again at 50 °C.min -1The temperature was raised to 240° C. and finally held at 240° C. for 1.4 min. Peaks were quantified based on their responses to known amounts of an external standard, GLC-411 (Nucheck), and a C17:0-ME internal standard using Agilent Technologies ChemStation software (Rev B.04.03 (16), Palo Alto, California, USA).

[0507] Liquid chromatography-mass spectrometry (LC-MS) analysis of lipids

[0508] Total lipids were extracted from freeze-dried developing seeds, seeds 12 days after flowering (daf), and mature seeds after adding a known amount of tri-C17:0-TAG as an internal quantitative standard. The extracted lipids were dissolved in 1 mL of 10 mM butylated benzyl alcohol in butanol:methanol (1:1 v / v) per 5 mg of dry material and analyzed using an Agilent 1200 series LC and 6410b electrospray ionization triple quadrupole LC-MS. Lipids were chromatographically separated using an Ascentis Express RP-Amide column (50 mm x 2.1 mm, 2.7 μm, Supelco) running a binary gradient at a flow rate of 0.2 mL / min. The mobile phases were: A. 10 mM ammonium formate in H2O:methanol:tetrahydrofuran (50:20:30 v / v / v); B. 10 mM ammonium formate in H2O:methanol:tetrahydrofuran (5:20:75, v / v / v). The multiple reaction monitoring (MRM) list was based on the following major fatty acids: 16:0, 18:0, 18:1, 18:2, 18:3, 18:4, 20:1, 20:2, 20:3, 20:4, 20:5, 22:4, 22:5, 22:6 using a collision energy of 30 V and a fragmentor voltage of 60 V. Individual MRM TAGs were identified based on the precursor ion of amination and the product ion from the neutral loss of 22:6. TAGs were quantified using a 10 μM tristearin external standard.

[0509] Lipid profiling using LC-MS

[0510] The extracted total lipids were analyzed using an Agilent 1200 series LC coupled to an Agilent 6410B electrospray ionization QQQ-MS (Agilent, Palo Alto, California, USA). A 5 μL injection of each total lipid extract was chromatographed on an Ascentis Express RP-Amide 50 mm x 2.1 mm, 2.7 μm HPLC column (Sigma-Aldrich, Castle Hill, Australia) using a binary gradient at a flow rate of 0.2 mL / min. The mobile phases were: A. 10 mM ammonium formate in H2O: methanol: tetrahydrofuran (50:20:30, v / v / v.); B. 10 mM ammonium formate in H2O: methanol: tetrahydrofuran (5:20:75, v / v / v.). Selected neutral lipids (TAG and DAG) and phospholipids (PL, including PC, PE, PI, PS, PA, PG) were analyzed by multiple reaction monitoring (MRM) using a collision energy of 30 V and a fragmentation energy of 60 V. Neutral lipids targeted the following major fatty acids: 16:0 (palmitic acid), 18:0 (stearic acid), 18:1ω9 (oleic acid, OA), 18:2ω6 (linoleic acid, LA), 18:3ω3 (α-linolenic acid, ALA), 18:4ω3 (stearylonic acid, SDA), 20:1, 20:2, 20:3, 20:4ω3, 20:5ω3, 22:4ω3, 22:5ω3, 22:6ω3, while scanning for C-terminal residues with 0-3, 0-4, 0-5, 4-6 double bonds, respectively. 16 、C 18 、C 20 and C 22 Phospholipids of the substance.

[0511] Individual MRM TAGs were identified based on the aminated precursor ions and the product ions from the neutral loss of 20:1, SDA, EPA, and DHA. 50 μM tristearin and distearin were used as external standards for quantification of TAGs and DAGs. PLs were quantified using 10 μM di-18:0-PC, di-17:0-PA, di-17:0-PE, 17:0-17:1-PG, di-18:1-PI, and di-17:0-PS external standards (Avanti Polar Lipids, Alabaster, Alabama, USA). Selected TAG, DAG, and PL species were further confirmed by Agilent 6520Q-TOF MS / MS.

[0512] Determination of seed fatty acid profile and oil content

[0513] When the seed oil content is to be determined, the seeds are dried in a desiccator for 24 h and approximately 4 mg of seeds are transferred to a 2 ml glass vial with a Teflon-lined screw cap. 0.05 mg of triheptadecanoin dissolved in 0.1 ml of toluene is added to the vial as an internal standard.

[0514] Seed FAMEs were prepared by adding 0.7 ml of 1 N methanolic HCl (Supelco) to a vial containing seed material, vortexing briefly and incubating for 2 h at 80° C. After cooling to room temperature, 0.3 ml of 0.9% NaCl (w / v) and 0.1 ml of hexane were added to the vial and mixed well for 10 min in a Heidolph Vibramax 110. FAMEs were collected into 0.3 ml glass liner tubes and analyzed by GC with a flame ionization detector (FID) as mentioned previously.

[0515] First, the peak area of ​​a single FAME was corrected based on the peak area response of the known amount of the same FAME present in the commercial standard GLC-411 (NU-CHEK PREP, INC., USA). GLC-411 contains 31 fatty acids (by weight %) in equal amounts, ranging from C8:0 to C22:6. In the case of fatty acids not present in the standard, the inventors obtained the peak area response of the most similar FAME. For example, the peak area response of a FAME of 16:1d9 was used for 16:1d7 and the FAME response of C22:6 was used for C22:5. The corrected area is used to calculate the mass of each FAME in the sample by comparison with the internal standard mass. The oil is mainly stored in the form of TAGs and its weight is calculated based on the FAME weight. The total mole number of glycerol is determined by calculating the mole number of each FAME and dividing the total mole number of FAME by three. TAG was calculated as the sum of the glycerol and fatty acyl moieties using the following relationship: % oil by weight = 100 x ((41 x total moles FAME / 3) + (total g FAME - (15 x total mol FAME))) / g seed, where 41 and 15 are the molecular weights of the glycerol moiety and the methyl group, respectively.

[0516] Analysis of sterol content of oil samples

[0517] Use 4mL 5%KOH in 80%MeOH to saponify about 10mg oil and the sample of the aliquot C24:0 monohydric alcohol added as internal standard and heat 2h at 80 ℃ in the glass tube of the screw cap of Teflon lining.After the reaction mixture cools, add 2mL Milli-Q water, and by shaking and vortexing, sterol is extracted into 2mL hexane: dichloromethane (4: 1 v / v). With mixture centrifugation and remove sterol extract and wash with 2mL Milli-Q water. Then, after shaking and centrifugation, remove sterol extract. Use nitrogen stream to evaporate the extract and use 200mL BSTFA and heat 2h at 80 ℃ with sterol silylation.

[0518] For GC / GC-MS analysis of sterols, sterol-OTMSi derivatives were dried on a heating block at 40°C under a stream of nitrogen and then redissolved in chloroform or hexane immediately prior to GC / GC-MS analysis. TM Sterol-OTMS derivatives were analyzed using an Agilent Technologies 6890A GC (Palo Alto, California, USA) with a 1-1 fused silica capillary column (15 m x 0.1 mm i.d., 0.1 μm film thickness), an FID, a split / splitless injector, and an Agilent Technologies 7683B Series autosampler and injector. Helium was used as the carrier gas. Samples were injected in splitless mode at an oven temperature of 120°C. After injection, the oven temperature was raised at 10°C min. -1 Increase to 270℃ and finally at 5℃min -1 The temperature was raised to 300° C. Peaks were quantified using Agilent Technologies ChemStation software (Palo Alto, California, USA). GC results were subject to an error of ±5% for the region of the individual components.

[0519] GC-mass spectrometry (GC-MS) analysis was performed on a Finnigan Thermoquest GCQ GC-MS and a Finnigan Thermo Electron Corporation GC-MS; both systems were equipped with an on-column injector and Thermoquest Xcalibur software (Austin, Texas, USA). Each GC was equipped with a capillary column of similar polarity as described above. Individual components were identified using mass spectral data and by comparing retention time data with those obtained for authentic and laboratory standards. A full program blank analysis was performed concurrently with the sample batch.

[0520] RT-PCR conditions

[0521] Reverse transcription-PCR (RT-PCR) amplification was typically performed using the Superscript III One-Step RT-PCR system (Invitrogen) in a 25 μL volume using 10 pmol forward primer and 30 pmol reverse primer, a final concentration of 2.5 mM MgSO 4 , 400 ng total RNA with buffer, and nucleotide components according to the manufacturer's instructions. Typical temperature profiles were: 1 cycle of 45° C. for 30 minutes for reverse transcription to occur; then 1 cycle of 94° C. for 2 minutes, then 40 cycles of 94° C. for 30 seconds, 52° C. for 30 seconds, 70° C. for 1 minute; then 1 cycle of 72° C. for 2 minutes, after which the reaction mixture was cooled to 5° C.

[0522] Generation of Brassica napus somatic embryos by induction with 35S-LEC2

[0523] The seeds of Brassica napus (cv. Oscar) were sterilized using chlorine gas as described by (Attila Kereszt et al., 2007). The sterilized seeds were germinated in 1 / 2 strength MS medium (Murashige and Skoog, 1962) adjusted to pH 5.8 with 0.8% agar and incubated at 24°C under fluorescent lighting (50 μE / m 2 s) with 18 / 6h (day / night) photoperiod growth for 6-7 days. The cotyledon petiole with 2-4mm petiole length will be aseptically separated from these seedlings and used as explant. The culture of the transformed Agrobacterium tumefaciens strain AGL1 (one contains seed-specific binary vector and the second has the 35S-LEC2 construct) is inoculated from a single colony from a new plate and grown in 10mL LB medium with appropriate antibiotic and grown overnight at 28 ℃ under 150rpm stirring. Bacterial cells are collected by centrifugation at 4000rpm for 5 minutes, then washed and resuspended in 10mL same medium with the MS medium containing 2% sucrose, and grown 4 hours under the situation of appropriate antibiotic for selection after adding acetosyringone to 100 μM. Two hours before adding to plant tissue, spermidine is added, to a final concentration of 1.5mM and with fresh medium the final density of bacteria is adjusted to OD 600nm=0.4. Two bacterial cultures, one carrying the seed-specific construct and the other carrying 35S-AtLEC2, were mixed at a ratio of 1:1 to 1:1.5.

[0524] With 20mL agrobacterium tumefaciens culture, infect the freshly separated Brassica napus leaf petiole 6 minutes.Blot cotyledon petiole with sterile filter paper to remove excessive agrobacterium tumefaciens, and then transfer it to co-cultivation medium (MS medium with 100 μM acetosyringones of 1mg / L TDZ, 0.1mg / L NAA, be supplemented with L-cysteine ​​(50mg / L), ascorbic acid (15mg / L) and MES (250mg / l)).With micropore tape sealing plate and in the dark, at 24 ℃, hatch 48h.Co-cultivation explant is transferred to the culture medium before selecting (containing 1mg / L TDZ, 0.1mg / L NAA, 3mg / L AgNO , 250mg / L cefotaxime and 50mg / L timentin) and at 24 ℃, cultivate 4-5 days with 16h / 8h photoperiod. Then according to the selectable marker gene on the seed-specific carrier, explant is transferred in selection medium (containing 1mg / L TDZ, 0.1mg / L NAA, 3mg / L AgNO , 250mg / L cefotaxime and 50mg / L timentin MS) and at 24 ℃, cultivate 2-3 weeks with 16h / 8h photoperiod.The explant with green embryonic callus is transferred to hormone-free MS medium (with 3mg / L AgNO , 250mg / L cefotaxime, 50mg / L timentin and the MS of selection agent) and cultivate 2-3 weeks in addition.Use GC to analyze the fatty acid composition in the total lipid of the torpedo stage or cotyledon stage embryo separated from the surviving explant on selection medium.

[0525] Determination of transgene copy number by digital PCR

[0526] In order to determine the transgenic copy number in transgenic plants, digital PCR methods were used as follows. This method can also be used to determine whether plants are transgenic for genetic constructs as described herein. From each individual plant, about one square centimeter of leaf tissue was harvested and placed in a collected microtube (Qiagen). The samples were then freeze-dried for 24 to 48 hours. For the destruction of samples to extract DNA, stainless steel ball bearings were added to each dry sample and the tubes were shaken on a Qiagen Tissue grinder. 375 μL extraction buffer (0.1M Tris-HCl pH 8, 0.05M EDTA pH 8, and 1.25% SDS) were added to each tube, the mixture was incubated for 1 hour at 65°C, and then cooled, after which 187 μL 6M ammonium acetate (4°C) was added to each tube while thoroughly mixing. The sample was then centrifuged at 3000 rpm for 30 minutes. The supernatant from each tube was moved into a new microtube containing 220 μL isopropanol each, to precipitate DNA for 5 minutes at room temperature. DNA was collected by centrifugation at 3000 rpm for 30 min, the DNA pellet was washed with 320 μL 70% ethanol and dried, and then resuspended in 225 μL water. Undissolved material was pelleted by centrifugation at 3000 rpm for 20 min, and 150 μL of each supernatant was transferred to a 96-well plate for long-term storage.

[0527] For efficient and quantitative digital PCR (ddPCR), DNA was digested by restriction enzymes prior to the amplification reaction to ensure that multiple copies of the transgene or multiple inserts were physically separated. Therefore, aliquots of the DNA preparation were digested with EcoRI and BamHI together in a 20 μL volume using 10x EcoRI buffer, 5 μL DNA, and approximately 4 units of each enzyme per sample, and incubated overnight at 37°C.

[0528] Primers used in these PCR reactions were designed using Primer3 software to confirm that the primers for the reference and target genes were not expected to interact or that such interactions were not a problem under the conditions used. The reference gene used in the assay was the Brassica napus Hmg (high mobility group) gene, which is present at one gene per Brassica napus genome (Weng et al., 2004). Since Brassica napus is an allotetraploid, it is known that four copies of the Hmg gene exist in Brassica napus, i.e., two alleles for each of the two genes. The reference gene reaction used paired primers and a dual-labeled probe as follows: sense primer, Can11 GCGAAGCACATCGAGTCA (SEQ ID NO: 43); antisense primer, Can12 GGTTGAGGTGGTAGCTGAGG (SEQ ID NO: 44); probe, Hmg-P3 5'-Hex / TCTCTAC / zen / CCGTCTCACATGACGC / 3IABkFQ / -3' (SEQ ID NO: 45). The amplicon size was 73 bp.

[0529] In a target gene amplification reaction for detecting the PPT selectable marker gene region to screen all transgenic plants, the sense primer was Can17, ATACAAGCACGGTGGATGG (SEQ ID NO: 46); the antisense primer was Can18, TGGTCTAACAGGTCTAGGAGGA (SEQ ID NO: 47); and the probe was PPT-P3 5'- / FAM / TGGCAAAGA / zen / GATTTCGAGCTTCCTGC / 3IABkFQ / -3' (SEQ ID NO: 48). The target gene amplification product was 82 bp in size. In some cases, a second target gene assay was performed in parallel with the detection of the partial T-DNA insert. This second assay uses the sense primer Can23 CAAGCACCGTAGTAAGAGAGCA (SEQ ID NO: 49), the antisense primer Can24 CAGACAGCCTGAGGTTAGCA (SEQ ID NO: 50), and the probe D6des-P3 5'- / FAM / TCCCCACTT / zen / CTTAGCGAAAGGAACGA / 3IABkFQ / -3' (SEQ ID NO: 51) to detect a region of the Δ6-desaturase gene. The amplified product of this target gene is 89 bp in size. The reaction typically uses 2 μL of the digested DNA preparation. The reaction composition of each sample was as follows: reference sense primer (10 pM), 1 μL; reference antisense primer (10 pM), 1 μL; reference gene probe (10 pM), 0.5 μL; target gene sense primer (10 pM), 1 μL; target gene antisense primer (10 pM), 1 μL; target gene probe (10 pM), 0.5 μL; ddPCR reagent mixture, 12.5 μL; water 5.5 μL, for a total volume of 25 μL.

[0530] The mixture is then placed in a QX100 droplet generator, which divides each sample into 20,000 nanoliter droplets. This is performed in an 8-well cartridge until all samples are processed and transferred to a 96-well PCR plate. The plate is then heat-sealed using a plate sealer using pierceable foil. The samples are then processed under the following reaction conditions: 95°C for 10 minutes, ramping at 2.5°C / s; then 39 cycles of 94°C for 30 seconds at 2.5°C / s; 61°C for 1 minute, ramping at 2.5°C / s; 98°C for 10 minutes, followed by cooling to 12°C. Following the DNA amplification reaction in the droplets, the plate is placed in a QX100 droplet reader, which analyzes each droplet individually using a two-color detection system (set to detect FAM or Hex). Droplet digital PCR data is viewed as a 1-D plot (where each droplet comes from a sample annotated in a fluorescence density plot) or as a 2-D plot (where fluorescence (FAM) is plotted against fluorescence (Hex) for each droplet). The software measures the number of positive and negative droplets (FAM or Hex) for each fluorophore in each sample. The software then fits the fraction of positive droplets to a Poisson algorithm to determine the concentration of target DNA molecules in copies / μL input. Copy number variation is calculated using the following formula: CNV = (A / B) * Nb, where A = target gene concentration, B = reference gene concentration, and Nb = 4, the number of reference gene copies in the genome.

[0531] Assessment of pollen viability

[0532] Fluorescein diacetate (FDA) was dissolved in acetone at 2 mg / ml to provide a stock solution. FDA dilutions were prepared just before use by adding a few drops of FDA stock solution to 2 ml of sucrose solution (0.5 M) until saturation was achieved (as indicated by the appearance of persistent turbidity).

[0533] Propidium iodide (PI) was dissolved in sterile distilled water at 1 mg / ml to provide a stock solution. Just before use, 100 μl of the stock solution was added to 10 ml of sterile distilled water to prepare a working solution. To check the ratio of viable and non-viable pollen, the PI and FDA stock solutions were mixed in a 2:3 ratio.

[0534] Transgenic and wild-type rapeseed and mustard plants are grown in a greenhouse at 22 ± 2 ℃ of 16h photoperiods every day under standard conditions. Mark and collect the mature buds that are ready to bloom next day at 9-10am in the morning of the next day. Use FDA / PI mixture to dye the pollen from open flowers and use Leica MZFLIII fluorescence microscope to observe. GFP-2 (510nm long pass emission filter) (transmitting red light and green light) with 480 / 40nm excitation filter is used to detect vigorous and inactive pollen. The inactive pollen that is subjected to PI dyeing shows as red under the fluorescence microscope, and vigorous pollen shows as bright green when dyeing with PI and FDA.

[0535] Example 2. Stable expression of transgenic DHA pathway in camelina seeds

[0536] The binary vector pJP3416-GA7 (see Figure 2 and SEQ ID NO: 1) were introduced into Agrobacterium tumefaciens strain AGL1 and cells from the transformed Agrobacterium culture were used to treat flowering Camelina plants using the floral dip method for transformation (Lu and Kang, 2008). After the plants grew and matured, T1 seeds from the treated plants were harvested, sown in soil, and the resulting plants were treated by spraying with the herbicide BASTA to select for plants that were transgenic for or expressed the bar selectable marker gene present on the T-DNA of pJP3416-GA7. After allowing them to self-pollinate, surviving T1 plants that were tolerant to the herbicide were grown to maturity and the resulting T2 seeds were harvested. Five transgenic plants were obtained, of which only three contained the entire T-DNA.

[0537] Lipids were extracted from approximately twenty seed pools from each of the three plants containing the entire T-DNA. Two of the pooled samples contained very low, almost undetectable levels of DHA, but the third pool contained approximately 4.7% DHA. Therefore, lipids were extracted from 10 individual T2 seeds from this plant and analyzed for fatty acid composition by GC. The fatty acid composition data for the individual seeds of this transformed strain are also shown in Table 4. The data compiled from the total seed lipid profile (Table 4) are shown in Table 5.

[0538] Table 4. Fatty acid composition of total seed lipids from transgenic T2 Camelina seeds transformed with the T-DNA of pJP3416-GA7. Fatty acid composition is shown for a pooled seed batch (FD5.46) and for 10 individual seeds arranged from highest to lowest DHA (left to right).

[0539]

[0540]

[0541] Table 5. Data compiled from total seed lipid profiles from transgenic seeds as shown in Table 4. Calculations do not include 'minor fatty acids' in Table 4.

[0542]

[0543]

[0544] DHA is present in six of 10 independent seeds.Four other seeds do not have DHA and are inferred to be invalid segregants that do not have T-DNA based on the hemizygous state of the T-DNA inset in the parental plant.The lipid that extracts from the single seed with the highest level of DHA has 9.0%DHA, and the percentage summation of EPA, DPA and DHA is 11.4%.In this seed, the percentage summation of the new ω 3 fatty acid that produces owing to conversion (SDA, ETrA, ETA, EPA, DPA, DHA) is 19.3%, and the corresponding summation of new ω 6 fatty acid (GLA, EDA, DGLA, ARA and any ω 6 extension product) is 2.2%-only GLA and EDA are detected as new ω 6 fatty acid.

[0545] The ratio of total ω6 FA (including LA) to ω3 FA (including ALA) was found to be 0.44. In seeds with the highest DHA levels, the ratio of new ω6 FA (excluding LA) to new ω3 FA (excluding ALA) was 0.12. The level of total saturated fatty acids was about 17.8% and the level of monounsaturated fatty acids was about 15.5%. The level of total ω6-fatty acids was about 20.4% and the level of ω3-fatty acids was about 46%. The overall conversion efficiency was calculated to be: OA to EPA = 15.6%, OA to DHA = 12.3%, LA to EPA = 17.2%, LA to DHA = 13.6%, ALA to EPA = 24.8%, ALA to DHA = 19.6%.

[0546] Homozygous seeds from this line were obtained in the T4 generation. Event FD5-46-18-110 produced up to 10.3% DHA, with an average of 7.3% DHA observed throughout the T4 generation. A subsequent generation (T5) was established to further test the stability of PUFA production over multiple generations, particularly DHA. The maximum DHA levels observed were found to be stable in the fifth generation, although the aggregated seed DHA content was not stable until the T4 generation due to the presence of multiple transgenic loci. T5 seed batches were also germinated in vitro in MS medium alongside parent Camelina seeds, with no significant differences in germination efficiency or speed observed. Other generations of transgenic lines (T6 and T7) did not show any reduction in seed DHA levels. Transgenic plants were fully male and female fertile, and pollen showed approximately 100% of the viability of wild-type plants. Analysis of the oil content of seeds with varying levels of DHA could not determine a correlation between DHA levels and oil content, contrary to the correlation seen in Arabidopsis.

[0547] In several other transgenic lines, the DHA content of single seeds from independent events exceeded 12%. The transgenic: null gene ratio of these lines was found to be between about 3: 1 and 15: 1. Analysis of representative fatty acid profiles of the top DHA samples from each construct only found 1.2-1.4% GLA, with no other new ω6 PUFAs detected. In contrast, new ω3 PUFA (SDA) ω3 LC-PUFA (ETA, EPA, DPA, DHA) were found to accumulate to 18.5%, with DHA levels accounting for 9.6% of the total fatty acid content. Δ6-desaturation was 32% of the total fatty acid content and EPA was 0.8%. Δ5-elongation efficiency was 93% and Δ6-elongation efficiency was 60%. DHA was detected in the polar seed lipid fraction of the GA7 line.

[0548] Note that the observed segregation ratios (-3:1 to -15:1) indicate that one or at most two transgenic loci are required to produce fish oil-like levels of DHA in Camelina. This has important implications for the ease of breeding transgenic traits and for transgenic stability.

[0549] Homozygous seeds were planted in several greenhouses to produce a total of over 600 individual plants.Oil was extracted from the seeds using a variety of methods including Soxhlet, acetone, and hexane extraction.

[0550] Transgenic camelina seed oil 13C NMR regiospecificity analysis was performed to determine the positional distribution of ω3 LC-PUFAs on TAGs. Events with approximately equal amounts of EPA and DHA were selected to maximize the response to these fatty acids, and the sn-1,3 to sn-2 ratio was found to be 0.75:0.25 for EPA and 0.86:0.14 for DHA, with an unbiased distribution of 0.66:0.33. That is, 75% EPA and 86% DHA are located on the sn-1,3 positions of TAGs. This indicates that both fatty acids prefer to be located on the sn-1,3 positions of camelina TAGs, although the preference for EPA is weaker than that for DHA. The finding that DHA is primarily found on the sn-1,3 positions is similar to results previously reported for Arabidopsis seeds (Petrie et al., 2012).

[0551] Example 3. Modification of T-DNA encoding the DHA pathway in plant seeds

[0552] To increase DHA production in Brassica napus beyond the levels described in WO2013 / 185184, the binary vectors pJP3416-GA7-modA, pJP3416-GA7-modB, pJP3416-GA7-modC, pJP3416-GA7-modD, pJP3416-GA7-modE, and pJP3416-GA7-modF were constructed as described in WO2013 / 185184 and tested in transgenic plants. These binary vectors are variants of the pJP3416-GA7 construct and are designed to further enhance DHA synthesis in plant seeds, specifically by improving the function of the Δ6-desaturase and Δ6-elongase enzymes. SDA has been observed to accumulate in some seeds transformed with the GA7 construct due to the relatively low efficiency of the Δ6 elongase compared to the Δ5 elongase, so, among other modifications, the positions of the two elongase genes were switched in the T-DNA.

[0553] The two elongase coding sequences in pJP3416-GA7 were switched in their T-DNA positions to replace the P. cordata Δ6-elongase cassette by first cloning the new P. cordata Δ6-elongase cassette between the SbfI sites of pJP3416-GA7, thereby generating pJP3416-GA7-modA. This construct was further modified by exchanging the FP1 promoter driving the Micromonas pusillus Δ6-desaturase with the conlinin Cnl2 promoter (pLuCnl2) to generate pJP3416-GA7-modB. This modification was intended to increase Δ6-desaturase expression and, therefore, the efficiency of the enzyme. It is believed that the Cnl2 promoter may produce higher transgene expression in Brassica napus than the truncated promoter.

[0554] Generate eight kinds of transgenic pJP3416-GA7-modB Arabidopsis events and 15 kinds of transgenic pJP3416-GA7-modG Arabidopsis events.In the pJP3416-GA7-modB seeds of collection, observe DHA between 3.4% and 7.2%, and in the T2 pJP3416-GA7-modG seeds of collection, observe DHA between 0.6% and 4.1%.The events of several kinds of highest pJP3416-GA7-modB are sown in the selective culture medium and from the next generation, obtain the seedling that survives.Analyze the DHA content of seed.Because the T1 seed of collection represents the plant of transgenic separation and comprises any all invalid segregants, what is expected is that the homozygous seed from offspring plant has the DHA of increased level, and it is up to 30% of the total fatty acid content in the seed oil.Use other modified constructs to transform Arabidopsis.Although only obtain the strain of a small amount of conversion, do not produce the DHA level that is higher than the modB construct.

[0555] The pJP3416-GA7-modB construct was also used to generate transformed Brassica napus plants of the cultivar Oscar and a series of cultivars (designated NX002, NX003, NX005, NX050, NX052, and NX054). A total of 1,558 transformed plants were obtained, including 77 independent transformed plants (TO) of Oscar and 762 independent plants of the cultivar, including 189 NX005, a line with a high oleic acid content in its seed oil due to a mutation in the FAD2 gene. Other cultivar lines had higher levels of LA and ALA. Transgenic plants displaying more than four T-DNA copies, as determined by digital PCR (Example 1), were discarded; approximately 25% of the TO plants were discarded based on this criterion. Approximately 53% of the TO transgenic plants had one or two T-DNA copies, 12% had approximately three copies, and 24% had four or more copies, as determined by digital PCR. Seeds (T1 seeds) were harvested from approximately 450 transgenic lines after self-pollination, which was achieved by bagging the plants during flowering to avoid outbreeding. T1 seeds were harvested from the remaining transgenic plants at maturity. Approximately 1%-2% of the plant lines were male or female fertile and produced inactive seeds, and these T0 plants were discarded.

[0556] The DHA levels in the seed oils of a collection of seed pools (20 T1 seeds per collection) were tested, and the lines showing the highest levels were selected. Specifically, lines with a DHA level of at least 2% of the total fatty acid content of the T1 seeds of the collection were selected. Approximately 15% of the transgenic lines were selected in this way; the other 85% were discarded. Some of these indicated lines CT132-5 (in cultivar Oscar), CT133-15, -24, -63, -77, -103, -129, and -130 (in NX005). The lines in the NX050 selected included CT136-4, -8, -12, -17, -19, -25, -27, -49, and -51. Twenty seeds from the selected lines (including CT132.5) and 11 seeds from CT133.15 were soaked, and after two days, oil was extracted from half the cotyledons from each individual seed. The other half of the cotyledon with the embryonic axis was retained and cultured on culture medium to maintain the strain for a specific offspring. The fatty acid composition of the oil was determined; data for CT132.5 are shown in Table 6. The DHA levels in 10 of the 20 seeds analyzed ranged from 7% to 20% of the total fatty acid content, as determined by GC analysis. Other seeds had less than 7% DHA and may contain partial (incomplete) copies of the T-DNA from pJP3416-GA7-modB. The transgenic lines appear to contain multiple transgenic inserts that are not genetically connected. Seeds of transgenic line CT133.15 showed DHA levels ranging from 0 to 5%. Seeds without DHA are likely invalid segregants. These data confirm that the modB construct produces good DHA in rapeseed seeds.

[0557] Test the fatty acid composition of 20 or 40 independent seeds (T2 seeds) that obtain from each (from selected conversion strain) in multiple T1 plant after self-pollination individually.Identify the seeds (table 7) that comprise the DHA greater than 20%.Two representative samples CT136-27-18-2 and CT136-27-18-19 have 21.2% and 22.7%DHA respectively.The total ω 3 fatty acid content in these seeds is about 60% as the percentage of total fatty acid content, and ω 6 content is less than 10%.Test the fatty acid composition of 20 or 40 T2 seeds of other several groups from each T1 plant.Identify the seeds that comprise up to 34.3%DHA, for example, in seed C T136-27-47-25 (table 9).The fatty acid composition of the seed oil obtained from CT136-27-47-25 is shown in table 9. The fatty acid profile included 34.3% DHA, along with approximately 1.5% DPA, 0.6% EPA, and 0.5% ETA. The SDA level was approximately 7.5%, ALA was 21.9%, and LA was approximately 6.9%. The neoω6 PUFAs exhibited 1.1% GLA, but no detectable ω6-C20 or -C22 LC-PUFAs. Total saturated fatty acids: 9.6%; monounsaturated fatty acids, 12.5%; total PUFAs, 75.2%; total ω6-PUFAs (including LA), 7.2%; total ω3-PUFAs, 66.9%; total ω6:ω3 fatty acid ratio, 9.3:1; neoω6:neoω3 fatty acids, 37:1. The efficiency of each enzymatic step from oleic acid to DHA is as follows: Δ12-desaturase, 90%; Δ15 / ω3-desaturase, 89%; Δ6-desaturase, 67%; Δ6-elongase, 83%; Δ5-desaturase, 99%; Δ5-elongase, 98%; Δ4-desaturase, 96%. The overall efficiency of oleic acid conversion to DHA is approximately 50%. Therefore, it is clear that seeds that produce DHA in the range of 20.1% to 35% of the total fatty acid content of the seed oil can be identified and selected, including seeds with between 20.1% and 30% DHA or between 30% and 35% DHA in the total fatty acid content.

[0558] Oil content was reduced from about 44% in wild-type seeds in some seeds to about 31%-39% in some DHA-producing seeds, but was similar to wild-type levels in other DHA-producing seeds.

[0559] Different transformed plant lines that produce DHA at a level of at least 10% in T2 seeds are crossed and the F1 progeny are selfed to produce F2 progeny that are homozygous for multiple T-DNA insertions. Seed oil from homozygous seeds is analyzed and up to 30% or 35% of the total fatty acid content in the seed oil is DHA.

[0560] pass13 C NMR regiospecific analysis of TAG in oils obtained from CT136-27-18-2 and CT136-27-18-19 was used to determine the positional distribution of DHA within the glycerol backbone of the TAG molecule. DHA is preferentially attached at the sn-1,3 positions. Greater than 70%, and specifically greater than 90%, of the DHA is located in the sn-1,3 positions.

[0561] The pJP3416-GA7-modB and pJP3416-GA7-modF constructs were also used to generate transformed Camelina plants, as described in Example 2. At least 24 independently transformed plants (T0) were obtained and examined more closely by progeny analysis. Seeds were harvested from these transgenic lines (T1 seeds). The DHA levels in the seed oil of the seed collection were tested, and 6 lines showing the highest DHA levels (between 6% and 9%) were selected. The DHA levels in 20 T1 seeds from each line were analyzed - most seeds showed DHA levels ranging from 6% to 14% of the total fatty acid content, as determined by GC analysis. The fatty acid composition in the oil was determined; the data for several transgenic seeds are shown in Table 8.

[0562] In several other transgenic lines, the DHA content of single seeds from independent events exceeded 12%. The transgenic of these lines was found to have an invalid gene ratio of about 3: 1 (which corresponds to the locus of a single transgenic) or 15: 1 (which corresponds to the locus of two transgenics). Analysis of representative fatty acid profiles of samples from each construct with the highest level of DHA only found 1.2%-1.4% GLA, with no other new ω6 PUFA detected. By contrast, for the modF construct, new ω3 PUFA (SDA) and ω3 LC-PUFA (ETA, EPA, DPA, DHA) accumulated to a total of 25.8%, and for the modG construct accumulated to 21.9%, which was compared to 18.5% of the seeds transformed with GA7. The DHA levels in the oil from these seeds were respectively 9.6%, 12.4%, and 11.5%. Δ6-desaturation was found to be lower in GA7-transformed seeds than in modF- and modG-transformed seeds (32% vs. 47% and 43%), and this resulted in a reduction in ALA in modF and modG seeds relative to GA7. Another notable difference was the accumulation of EPA in modF seeds (3.3% vs. 0.8% in the other two transgenic seeds), which was reflected in the reduction in Δ5-elongation observed in modF seeds (80%) compared to GA7 and modG seeds (93% and 94%). There was a slight increase in Δ6-elongation in these seeds (66% vs. 60% and 61%), although the amount of SDA was actually increased due to the slightly more active Δ6-desaturation. DHA was detected in the polar seed lipid fraction of the GA7 line.

[0563] The fatty acid composition of lipids in T1 seeds of 70 independent transgenic plants of the Brassica napus breeding line NX54, transfected with the modB construct T-DNA, was analyzed. One of these transgenic plants was observed to produce seeds with DPA but no DHA in the seed oil. T1 seeds of this line (CT-137-2) produced approximately 4% DPA, without any detectable DHA in the T1 pooled seeds. The inventors hypothesized that this was caused by inactivation of the Δ4-desaturase gene in this particular inserted T-DNA, which resulted from spontaneous mutation. Approximately 50 T1 seeds from this transgenic line were germinated, and cotyledons emerged from each to analyze the fatty acid composition of the remaining oil. Selected seedlings exhibiting greater than 5% DPA were then grown to maturity, and T2 seeds were harvested. Greater than 7% DPA was observed in these seeds.

[0564] Another transgenic line, designated B0003-514, exhibited approximately 10%-16% DPA in T2 seeds. Seeds containing 15.8% DPA, 0.2%-0.9% DHA, and 0.1%-2.5% EPA were selected. The T2 seed population showed a 1:2:1 segregation of high:medium:no DPA, indicating the presence of a single locus for DPA production in this transgenic line.

[0565] Oil from seeds having about 10% DPA was treated with a mild base to hydrolyze the fatty acids. The hydrolyzed mixture was chromatographed to enrich for DPA, and a fraction containing 72% DPA was obtained based on the weight of the total fatty acid content in the fraction.

[0566] Oil was extracted from LC-PUFA-producing seed samples by a screw press to produce seed meal.

[0567] T4 seeds were produced from the Brassica napus DPA lines and the fatty acid profiles were analyzed. Up to 13% DPA was observed in pooled mature seed samples.

[0568] Table 6. Fatty acid profile of half the cotyledon of germinated T1 transgenic Brassica napus seeds containing the modB construct. Up to 18.1% DHA was observed, with several samples containing greater than 10% DHA.

[0569]

[0570] Table 7. Fatty acid profiles of T2 transgenic Brassica napus seeds containing the modB construct.

[0571]

[0572] ARA (C20:4ω6) was not detected in any sample. The samples also contained about 0.2% or 0.3% C16:1, about 0.1% to 0.3% C16:3, between about 0.7% and 1.0% C20:0, about 0.3% C22:0, and some samples contained trace levels (<0.1%) of C20:1Δ13, C22:3ω3, C24:0, and C24:1

[0573] Table 8. Fatty acid profiles of T1 transgenic Camelina seeds containing modB or modF constructs. The samples also contained approximately 0.1% each of C14:0, C16:1, C20:4n-6, and C22:2n-6 or no detection of these fatty acids.

[0574]

[0575] Table 9. Fatty acid composition of seed oil from Brassica napus T2 seeds transformed with T-DNA from GA7-modB

[0576]

[0577] The seed oil sample also contained 0.1% C14:0; 0.2% C16:1; 0.1% C20:3ω6; no C22:1 and C22:2ω6; 0.1% C24:0 and 0.2% C24:1, 2.6% other fatty acids.

[0578] While the focus of this experiment was to demonstrate DHA and DPA production in oilseed crop species, the differences described above are also interesting from a construct design perspective. First, switching the positions of the Δ6- and Δ5-elongase coding regions in the modF construct resulted in the expected profile shift, with more EPA accumulating due to lower Δ5-elongation. A concomitant increase in Δ6-elongation was observed, but this did not result in lower SDA levels. This was due to an increase in Δ6-desaturation in modF-transformed seeds, which was caused by the addition of an additional Micromonas pusillus Δ6-desaturase expression cassette and by replacing the truncated napin promoter (FP1) with the more active flax conlinin2 promoter. The slightly lower increase in Δ6-desaturation observed with the modG construct was caused by utilizing the Δ5-elongase cassette, which is highly expressed in GA7. Switching the positions of the Δ6-desaturase and Δ5-elongase coding regions resulted in greater Δ6-desaturation. In this case, Δ5-elongase activity was reduced due to the replacement of the FP1 promoter with the Cnl2 promoter.

[0579] These data demonstrate that the modB, modF, and modG constructs produce DHA well in Camelina seeds such as Arabidopsis and rapeseed.

[0580] The inventors believe that, in general, the efficiency of rate-limiting enzyme activity in the DHA pathway is greater in multi-copy T-DNA transformants compared to single-copy T-DNA transformants, or that it can be increased by inserting multiple T-DNA genes encoding enzymes that may be rate-limiting in the pathway. Evidence of the possible importance of multi-copy transformants is seen in Arabidopsis seeds transformed with the GA7 construct, where the highest DHA-producing event had three T-DNAs inserted into the host genome. The multiple genes can be identical or, preferably, encode different variants of the same polypeptide, or be under the control of different promoters with overlapping expression patterns. For example, increased expression can be achieved by expressing multiple Δ6-desaturase coding regions, even when producing the same protein. For example, in pJP3416-GA7-modF and pJP3416-GA7-modC, two versions of the M. pusilla Δ6-desaturase are present and expressed from different promoters. The coding sequences have different codon usage and, therefore, different nucleotide sequences, to reduce potential silencing or co-suppression while still resulting in production of the same protein.

[0581] Example 4. Analysis of TAGs from DHA-producing transgenic Arabidopsis seeds

[0582] The positional distribution of DHA on TAGs from transformed Arabidopsis seeds was determined by NMR. Total lipids were extracted from approximately 200 mg of seeds by first crushing the seeds under hexane, then transferring the crushed seeds to a glass tube containing 10 mL of hexane. The tubes were warmed to approximately 55°C in a water bath and then vortexed and centrifuged. The hexane solution was removed and the procedure was repeated with another 4 x 10 mL. The extracts were combined, concentrated by rotary evaporation, and the TAGs in the extracted lipids were purified from polar lipids by passing them through a short silica gel column using 20 mL of 7% ether in hexane. The positional distribution of acyl groups on the purified TAGs was quantitatively determined as previously described (Petrie et al., 2010a and 2010b).

[0583] The analysis showed that most of the DHA in the total seed oil was located at the sn-1 / 3 position of the TAG, with very little found at the sn-2 position. This is in contrast to TAGs from seeds producing ARA, which showed that 50% of ARA (20:4Δ5,8,11,14) was located at the sn-2 position of transgenic rapeseed oil, while only 33% was expected to be in a random distribution (Petrie et al., 2012).

[0584] Total lipids from transgenic Arabidopsis seeds were also analyzed by triple quadrupole LC-MS to identify the major DHA-containing triacylglycerol (TAG) species. The most abundant DHA-containing TAG species was found to be DHA-18:3-18:3 (TAG 58:12; the nomenclature does not describe the positional distribution), with the second most abundant being DHA-18:3-18:2 (TAG 58:11). Tri-DHA TAG (TAG 66:18) was observed in the total seed oil, albeit at very low but detectable levels. Other major DHA-containing TAG species included DHA-34:3 (TAG 56:9), DHA-36:3 (TAG 58:9), DHA-36:4 (TAG 58:10), DHA-36:7 (TAG 58:13), and DHA-38:4 (TAG 60:10). The identities of the two major DHA-containing TAGs were further confirmed by Q-TOF MS / MS.

[0585] Example 5. Determination of sterol content and composition in oil

[0586] Phytosterols from 12 vegetable oil samples purchased from commercial sources in Australia were characterized as O-trimethylsilyl ether (OTMSi-ether) derivatives by GC and GC-MS analysis as described in Example 1. Sterols were identified by retention data, interpretation of mass spectra, and comparison with literature and laboratory standard mass spectrometric data. Sterols were quantified using a 5β(H)-cholan-24-ol internal standard. The basic phytosterol structure and chemical structure of some of the identified sterols are shown in Figure 5 and Table 10.

[0587] The plant oils analyzed were from: sesame (Sesamum indicum), olive (Olea europaea), sunflower (Helianthus annus), castor (Ricinus communis), rapeseed (Brassica napus), safflower (Carthamus tinctorius), peanut (Arachis aconitifolia), flax (Linum usitatissimum), and soybean (Glycine max). The major phytosterols with decreasing relative abundance in all oil samples were: β-sitosterol (ranging from 28% to 55% of the total sterol content), Δ5-avenasterol (isofuccasterol) (3% to 24%), campesterol (2% to 33%), Δ5-stigmasterol (0.7% to 18%), Δ7-stigmasterol (1% to 18%), and Δ7-avenasterol (0.1% to 5%). Several other minor sterols were identified, including cholesterol, brassicasterol, spongasterol, campestanol, and poriferol. Four C29:2 and two C30:2 sterols were also detected, but further studies are needed to complete the identification of these minor components. In addition, several other unidentified sterols were present in some oils, but due to their extremely low abundance, the mass spectra were not intense enough to identify their structures.

[0588] The sterol content expressed in decreasing amounts as mg / g oil is: rapeseed oil (6.8 mg / g), sesame oil (5.8 mg / g), linseed oil (4.8-5.2 mg / g), sunflower oil (3.7-4.1 mg / g), peanut oil (3.2 mg / g), safflower oil (3.0 mg / g), soybean oil (3.0 mg / g), olive oil (2.4 mg / g), castor oil (1.9 mg / g). The sterol composition % and total sterol content are provided in Table 11.

[0589] Table 10. IUPAC / systematic names of identified sterols.

[0590]

[0591] Table 11. Sterol content and composition of determined vegetable oils.

[0592]

[0593]

[0594] C29:2* and C30:2* represent C29 sterol with two double bonds and C30 sterol with two double bonds, respectively.

[0595] In all seed oil samples, the major phytosterol is typically β-sitosterol (ranging from 30% to 57% of the total sterol content). Other major sterols are present in a wide range of proportions in the oils: campesterol (2% to 17%), Δ5-stigmasterol (0.7% to 18%), Δ5-avenasterol (4% to 23%), and Δ7-stigmasterol (1% to 18%). Oils from different species have different sterol profiles, some of which are quite distinctive. In the case of rapeseed oil, it has the highest proportion of campesterol (33.6%), while samples from other species typically have lower levels, for example, up to 17% in peanut oil. Safflower oil has a relatively high proportion of Δ7-stigmasterol (18%), while this sterol is generally lower in oils from other species, reaching up to 9% in sunflower oil. Because they are unique to each species, sterol profiles can be used to help identify specific vegetable or plant oils and check their authenticity or adulteration with other oils.

[0596] Compare each in two kinds of samples sunflower and safflower, in each case, one is produced by cold pressing seeds and not refining, and the other is not cold pressed and refined.Although observe some differences, the oil of two sources has similar sterol composition and total sterol content, which shows that processing and refining have almost no effect on these two parameters.The sterol content in the described samples changes threefold and ranges from 1.9mg / g to 6.8mg / g.Rapeseed oil has the highest sterol content and castor oil has the lowest sterol content.

[0597] Example 6. Further analysis of transgenic camelina seeds

[0598] Fatty acid composition

[0599] In general, for seeds producing DHA and / or DPA, the inventors observed that the fatty acid composition of the total lipids in the seeds, as determined by direct transmethylation of all lipids in the seeds, was similar to the fatty acid composition of the TAG fraction. This is because more than 90% of the total lipids present in the seeds are in the form of TAGs.

[0600] Sterol composition in seeds

[0601] In order to determine the sterol content and composition in the lipids extracted, a sample of about 10 mg of total lipids from the hexane extract rich in TAGs and the polar lipid-rich CM extract was saponified using 5% KOH in 4 mL 80% MeOH and heated for 2 h in a Teflon-lined screw-capped glass test tube. After the reaction mixture cooled, 2 mL Milli-Q water was added and sterols and alcohols were extracted into 2 mL hexane: dichloromethane (4: 1 v / v) three times by shaking and vortexing. The mixture was centrifuged and each extract in the organic phase was washed with 2 mL Milli-Q water by shaking and centrifuging. After obtaining the top organic layer containing sterols, a nitrogen stream was used to evaporate the solvent and 200 μ L bis(trimethylsilyl)-trifluoroacetamide (BSTFA, Sigma-Aldrich) was used to silylate sterols and alcohols by heating for 2 h at 80 ° C in a sealed GC bottle. By this method, free hydroxyl groups were converted into their trimethylsilyl ethers. Sterol and alcohol-OTMSi derivatives were dried on a heating block (40°C) under a stream of nitrogen and redissolved in dichloromethane (DCM) immediately prior to GC / GC-MS analysis as described above.

[0602] The major sterols in both transgenic and control seeds were 24-ethylcholesterol (sitosterol, 43%-54% of total sterols), 24-methylcholesterol (campesterol, 20%-26%), and lower levels of cholesterol (5%-8%), brassicasterol (2%-7%), isofuccasterol (Δ5-avenasterol, 4%-6%), stigmasterol (0.5%-3%), cholest-7-en-3β-ol (0.2%-0.5%), 24-methylcholestanol (campestanol, 0.4%-1%), and 24-dehydrocholesterol (0.5%-2%) (Table 12). These nine sterols accounted for 86%-95% of the total sterols, with the remaining components being sterols with only partially defined carbon and double bond numbers. The overall sterol profiles were similar between hexane and CM extracts of transgenic and control seeds.

[0603] Fatty alcohol analysis

[0604] As with sterols, fatty alcohols in seeds were derivatized and analyzed. 16 -C 22A series of fatty alcohols, including iso-branched fatty alcohols. Similar spectra were observed for transgenic and control seeds, with some variation in the proportions of the individual components. Chlorophyll-derived phytol was the main fatty alcohol and accounted for 47% and 37% of the total fatty alcohols in the hexane fractions of transgenic and control seeds, respectively. Odd-chain alcohols were present at higher levels in the CM extract (37%-38% of the total fatty alcohol content) than in the hexane extract (16%-23%). Iso-17:0 (16%-38%) was more abundant than 17:0 (0.3%-5.7%). Another odd-chain alcohol present was 19:0 (4.5%-6.5%). Other alcohols detected included iso-16:0, 16:0, iso-18:0, 18:1, and 18:0, with small amounts of iso-20:0, 20:1, 20:0, iso-22:0, 22:1, and 22:0 also present.

[0605] Table 12. Sterol composition of transgenic and control Camelina seeds (% of total sterols)

[0606]

[0607] Abbreviations: UN stands for unknown sterol, the number after C indicates the number of carbon atoms and db indicates the number of double bonds

[0608] Example 7. Production of LC-PUFA in Brassica juncea seeds

[0609] Transgenic mustard plants were generated using the GA7-modB construct for DHA production (Example 3) as described below. Seeds of a long day length sensitive mustard variety were sterilized using chlorine gas as described by Kereszt et al. (2007). Sterilized seeds were germinated in 1 / 2 strength MS medium (Murashige and Skoog, 1962) adjusted to pH 5.8 solidified with 0.8% agar and grown at 24°C under fluorescent lighting (50 μE / m 2s) with a 16 / 8 hour (day / night) photoperiod for 6-7 days. Cotyledonary petioles with 2-4 mm petioles were aseptically isolated from these seedlings and used as explants. Agrobacterium tumefaciens strain AGL1 was transformed with the binary construct GA7. Agrobacterium culture was started and processed for infection as described by Belide et al. (2013). For all transformants, approximately 50 freshly isolated cotyledonary petioles were infected with 10 ml of Agrobacterium tumefaciens culture for 6 minutes. Infected petioles were blotted dry with sterile filter paper to remove excess Agrobacterium tumefaciens and transferred to co-cultivation medium (MS containing 1.5 mg / L BA, 0.01 mg / L NAA and 100 μM acetosyringone, which was also supplemented with L-cysteine ​​(50 mg / L), ascorbic acid (15 mg / L) and MES (250 mg / L). All plates were sealed with microporous tape and incubated in the dark at 24° C. for 48 hours to co-cultivate. Explants were then transferred to pre-selective medium (MS-agar containing 1.5 mg / L BA, 0.01 mg / L NAA, 3 mg / L AgNO , 250 mg / L cefotaxime and 50 mg / L timentin) and cultured at 24° C. with a 16 / 8 h photoperiod for 4-5 days, after which the explants were transferred to selective medium (MS-agar containing 1.5 mg / L BA, 0.01 mg / L NAA, 3 mg / L AgNO , 250 mg / L cefotaxime and 50 mg / L timentin). The explants with green callus were transferred to a new shoot regeneration medium (containing 2.0 mg / L BA, 3 mg / L AgNO , 250 mg / L cefotaxime, 50 mg / L timentin and 5 mg / L PPT MS-agar) and cultivated for another 2 weeks at 24°C with a 16 / 8h photoperiod. The explants with green callus were transferred to a new shoot regeneration medium (containing 2.0 mg / L BA, 3 mg / L AgNO , 250 mg / L cefotaxime, 50 mg / L timentin and 5 mg / L PPT MS-agar) and cultivated for another 2-3 weeks. The small regenerated buds were transferred to a hormone-free MS medium (containing 3 mg / L AgNO , 250 mg / L cefotaxime, 50 mg / L timentin and 5 mg / L PPT MS-agar) and cultivated for another 2-3 weeks.

[0610] The possible transgenic sprouts of at least 1.5 cm in size are separated and transferred to root induction medium (MS-agar containing 0.5 mg / L NAA, 3 mg / L AgNO , 250 mg / L cefotaxime and 50 mg / L timentin) and cultivated for 2-3 weeks. The transgenic sprouts confirmed by PCR and having abundant roots are transferred to the soil of the greenhouse and grown at 22° C. under a photoperiod of 16 / 8 h (day / night). Three transgenic plants confirmed are obtained. The transformed plants are grown in the greenhouse, self-pollination is allowed, and T1 seeds are harvested. The fatty acid composition of the seed oil from a single T1 seed is analyzed; some data are shown in Table 16. Several T1 seeds produce DHA at a level of 10% to about 18% of the total fatty acid content, including JT1-4-A-13, JT1-4-A-5 and JT1-4-B-13 (Table 13). The T1 seeds are germinated and the fatty acid composition in the remaining oil of a cotyledon appearing in each seed is analyzed. Each of the remaining seedlings was maintained and grown to maturity to provide T2 seeds.

[0611] Transgenic plants homozygous for a single T-DNA insertion were identified and selected. Plants of one selected line, designated JT1-4-17, had a single T-DNA insertion and produced DHA with only a low level of DPA, while those of a second selected line, designated JT1-4-34, also had a single T-DNA insertion but produced DPA without DHA. The inventors concluded that the initial transformants contained two separate T-DNAs, one enabling them to produce DHA and the other enabling them to produce DPA without DHA. Indian mustard plants producing DHA in their seeds were crossed with plants producing DPA in their seeds. The F1 progeny included plants heterozygous for both T-DNA insertions. Seeds from these progeny plants were observed to produce approximately 20% DHA and approximately 6% DPA, for a total DHA+DPA content of 26%. The F1 plants were self-pollinated, and progeny homozygous for both T-DNA insertions are expected to produce up to 35% DHA and DPA.

[0612] About 18% DPA was observed in the lipids of the T3 progeny seeds of the pool designated JT1-4-34-11. Similarly, about 17.5% DHA was observed in the lipids of the pooled seeds of the progeny of T3 JT1-4-17-20. The fatty acid compositions of the JT1-4 T1 pooled seeds, T1 individual seeds, T2 pooled seeds, T2 individual seeds, and T3 pooled seeds, T3 individual seeds are shown in Tables 17 and 18. The JT1-4 T3 segregant JT-1-4-34-11 had a pooled T3 seed DPA content of 18%, and individual seeds from this particular segregant had a DPA content of about 26%, each as a percentage of the total fatty acid content.

[0613] The following parameters were calculated for the oil from seeds with 17.9% DPA: total saturated fatty acids, 6.8%; total monounsaturated fatty acids, 36.7%; total polyunsaturated fatty acids, 56.6%; total ω6 fatty acids, 7.1%; new ω6 fatty acids, all 0.4% of which were GLA; total ω3 fatty acids, 46.5%; new ω3 fatty acids, 24.0%; total ω6:total ω3 fatty acid ratio, 6.5; new ω6:new ω3 fatty acid ratio, 60; efficiency of converting oleic acid to LA by Δ12-desaturase, 61%; efficiency of converting ALA to SDA by Δ6-desaturase, 51%; efficiency of converting SDA to ETA acid by Δ6-elongase, 90%; efficiency of converting ETA to EPA by Δ5-desaturase, 87%; efficiency of converting EPA to DPA by Δ5-elongase, 98%.

[0614] To generate more transgenic plants in B. juncea with the modB construct, the transformation was repeated five times and 16 putative transgenic shoots / seedlings were regenerated. T1 seed analysis was performed to determine DPA and DHA content.

[0615] Table 13. Fatty acid composition of seed oil from B. juncea T1 seeds transformed with T-DNA from GA7.

[0616]

[0617] The seed oil samples also contained 0.1% C14:0; 0.1-0.2% C16:3; 0.0-0.1% each of C20:1Δ13, C20:3ω6 and C20:4ω6; 0.3-0.4% C22:0; no C22:1 and C22:2ω6; 0.2% C24:0 and 0.2-0.4% C24:1.

[0618] Table 14. Fatty acid composition of lipids from B. juncea T1 seeds (pool) transfected with T-DNA of GA7-modB. The lipids also contained approximately 0.1% each of 14:0, 16:3, 20:1d13 and 16:2, with no detection of 22:1.

[0619]

[0620] Table 15. Fatty acid composition of seed oil from Brassica juncea T1 (single) seeds transfected with T-DNA of GA7-modB.

[0621]

[0622]

[0623] The seed oil samples also contained 0.1% C14:0; 0.1%-0.2% C16:3; 0.0-0.1% each of C20:1Δ13, C20:3ω6, and C20:4ω6; 0.3%-0.4% C22:0; no C22:1 and C22:2ω6; 0.2% C24:0 and 0.2%-0.4% C24:1.

[0624] Table 16. Fatty acid composition of seed oil from T2 single seeds of Brassica juncea transfected with T-DNA of GA7-modB.

[0625]

[0626]

[0627] Table 17. Fatty acid composition of seed oil from T3 single seeds of Brassica juncea transfected with T-DNA of GA7-modB.

[0628]

[0629]

[0630] To further generate seeds containing DPA and not DHA, a modified genetic construct of the modB construct was formed lacking the Δ4-desaturase gene, as shown below. Two DNA fragments, EPA-DPA fragment 1 and EPA-DPA fragment 2, were synthesized with appropriate restriction sites (Geneart, Germany). The intermediate cloning vector pJP3660 was generated by cloning the AatII-MluI fragment of EPA-DPA fragment 1 into the AscI-AatII sites of vector 11ABHZHC_GA7-frag_d6D_pMS, which was used earlier to construct modB containing the Δ6 desaturase cassette. pJP3661 was then generated by cloning the PmeI-PspOMI fragment of pJP3660 into the PmeI-PspOMI sites of modB. The modified vector pJP3661 was then constructed by cloning the BsiWI-PspOMI fragment of EPA-DPA fragment 2 into the BsiWI-PspOMI sites of pJP3661. Figure 6 This vector contains fatty acid biosynthesis genes encoding enzymes that convert oleic acid into DPA-n3 and the corresponding ω-6 fatty acids.

[0631] The resulting construct was used to transfect B. juncea and B. napus, producing progeny seeds with up to 35% DPA in the total fatty acid content of seed lipids.

[0632] When oil extracted from the seeds of a DHA-producing plant was examined by NMR, at least 95% of the DHA was observed to be present in the sn-1,3 position of the TAG molecule. When oil extracted from the seeds of a DPA-producing plant was examined by NMR, at least 90% of the DPA was observed to be present in the sn-1,3 position of the TAG molecule.

[0633] Example 8. Further analysis of transformed plants and field trials

[0634] The T2 European rape plants of the selection transformed with the T-DNA from the GA7-modB construct are carried out southern blotting hybridization analysis. The DNA extracted from the plant tissue sample with several restriction enzyme digestions that are used for southern blotting hybridization analysis. The radioactive probe corresponding to the T-DNA part is hybridized on the blot washed under stringent conditions, and the blot is exposed to film to detect hybridization bands. Some samples show single hybridization bands of every kind of restriction digestion corresponding to the single T-DNA inset in the plant, while other samples show two bands and other other samples show a plurality of T-DNA bands corresponding to 4 to 6 insets. The multiple hybridization bands observed by southern blotting analysis are well correlated with the T-DNA copy number in the transgenic plant, and the copy number is as determined by the digital PCR method, up to about 3 or 4 copy numbers. When higher than about 5 copy numbers, the digital PCR method is not too reliable.

[0635] The strains of some selections are used as pollen donors when hybridizing a series of approximately 30 kinds of different rapeseed varieties with different genetic backgrounds. Further backcrossing is carried out to confirm whether a plurality of T-DNA insertions are hereditary connections, and allow the unconnected transgenic locus of heredity to gather. Therefore, the strains of the locus that selects to contain single transgenic are used.

[0636] Single primer PCR reactions were performed on transgenic lines using primers adjacent to the left and right borders of the T-DNA, and any lines showing the presence of T-DNA inverted repeats were discarded.

[0637] The transgenic lines of some plants show delayed flowering, and other lines have the seed set that reduces and therefore reduce the seed yield of each plant after growing in greenhouse, and this is consistent with the male or female fertility that reduces.In these plants, check flower part morphology and observe, in some cases, delay pollen to split and release from anther, so that style elongates before splitting, thereby anther is away from column cap.Can recover whole fertility by artificial pollination.In addition, by dyeing with vital stain FDA and PI (embodiment 1), determine the pollen viability that splits, and in some lines, show reduction, and in most of transgenic lines, pollen viability is about 100% as wild type control.As another kind of test that may cause the seed yield that reduces in some plants, the fatty acid content and the composition of the flower bud (comprising anther and column cap / style) of some T3 and T4 plants are tested.In the lipid that is extracted, do not detect DHA, the gene in this instruction genetic construct does not express in flower bud during plant development, and reduces and this is excluded as the reason of seed yield.

[0638] Oil content was measured by NMR and DHA levels were determined in the total fatty acid content of T2 seeds. Transgenic lines with less than 6% DHA were discarded. T-DNA copy numbers were determined in leaf samples from T1, T2, and T3 plants by digital PCR (Example 1).

[0639] The T3 and T4 seed batches selected were sown in fields at two locations in Victoria, Australia, with each 10m row sown at a sowing density of about 10 seeds / m. The selected seed batches included lines from the B003-5-14 source that showed a seed DHA level of about 8%-11% of the set and up to about 19% of the single T2 seed DHA level, wherein the T0 plant T-DNA copy number was 3. The selected seed batches also included lines from the B0050-19 and B0050-27 sources that showed a T2 seed DHA level of more than 20% and 1 or 2 T2 plant T-DNA copy numbers. The seed yield of each plant was determined and compared with the wild-type control grown under the same conditions. Other seed samples were sown in a larger area so that the selected transgenic lines formed a large number. Based on the DHA content in the seeds of the plants grown in the greenhouse, the total DHA content in the seeds of the expected results was at least 24mg / g seed.

[0640] It will be appreciated by those skilled in the art that numerous changes and / or modifications may be made to the invention as shown in the specific embodiments without departing from the spirit or scope of the invention as broadly described. Therefore, the present embodiments are to be considered in all respects as illustrative and not restrictive.

[0641] All publications discussed and / or referenced herein are incorporated in their entirety.

[0642] Any discussion of documents, acts, materials, devices, articles and the like which has been included in this specification is for the purpose of providing a context for the present invention only. It is not to be taken as an admission that any or all of these matters formed part of the prior art base or were common general knowledge in the field relevant to the present invention as it existed before the priority date of each claim of this application.

[0643] References

[0644] Abbadi et al. (2004) Plant Cell 16: 2734-2748.

[0645] Abbott et al. (1998) Science 282: 2012-2018.

[0646] Abdullah et al. (1986) Biotech. 4: 1087.

[0647] Agaba et al. (2004) Marine Biotechnol. (NY) 6: 251-261.

[0648] Alvarez et al. (2000) Theor Appl Genet 100: 319-327.

[0649] Armbrust et al. (2004)Science 306:79-86.

[0650] Baumlein et al. (1991) Mol. Gen. Genet. 225: 459-467.

[0651] Baumlein et al. (1992) Plant J. 2: 233-239.

[0652] Beaudoin et al. (2000) Proc. Natl. Acad. Sci. USA 97: 6421-6426.

[0653] Belide et al. (2013) Plant Cell Tiss Organ Cult. 113: 543-553.

[0654] Berberich. et al. (1998) Plant Mol. Biol. 36: 297-306.

[0655] Broun et al.(1998)Plant J.13:201-210.

[0656] Chadman et al.(2004)Gen.Dev.18:1179-1186.

[0657] Chen et al.(2004)The Plant Cell 16:1302-1313.

[0658] Cheng et al.(1996)Plant Cell Rep.15:653-657.

[0659] Cheng et al.(2010)Transgenic Res 19:221-229.

[0660] Chikwamba et al.(2003)Proc.Natl.Acad.Sci.USA100:11127-11132.

[0661] Cho et al.(1999a)J.Biol.Chem.274:471-477.

[0662] Cho et al.(1999b)J.Biol.Chem.274:37335-37339.

[0663] Clough and Bent(1998)Plant J.16:735-43.

[0664] Damude et al.(2006).Proc Natl Acad Sci USA 103:9446-9451.

[0665] Denic and Weissman(2007)Cell 130:663-677.

[0666] Domergue et al(2002)Eur.J.Biochem.269:4105-4113.

[0667] Domergue et al.(2002)Eur.J.Biochem.269:4105-4113.

[0668] Domergue et al.(2003)J.Biol.Chem.278:35115-35126.

[0669] Domergue et al.(2005)Biochem.Jl 389:483-490.

[0670] Dunoyer et al.(2004)The Plant Cell 16:1235-1250.

[0671] Ellerstrom et al.(1996)Plant Mol.Biol.32:1019-1027.

[0672] Fujimura et al.(1985)Plant Tissue Culture Lett.2:74.

[0673] Gamez et al.(2003)Food Res International 36:721-727.

[0674] Garcia-Maroto et al. (2002) Lipids 37:417-426.

[0675] Girke et al.(1998)Plant J.15:39-48.

[0676] Grant et al.(1995)Plant Cell Rep.15:254-258.

[0677] Hamilton and Baulcombe(1999)Science 286:950-952.

[0678] Hamilton et al.(1997)Gene 200:107-16.

[0679] Harayama(1998).Trends Biotechnol.16:76-82.

[0680] Hastings et al.(2001)Proc.Natl.Acad.Sci.USA98:14304-14309.

[0681] Hinchee et al.(1988)Biotechnology 6:915-922.

[0682] Hoffmann et al.(2008)J Biol.Chem.283:22352-22362.

[0683] Hong et al.(2002a)Lipids 37:863-868.

[0684] Horiguchi et al.(1998)Plant Cell Physiol.39:540-544.

[0685] Horvath et al.(2000)Proc.Natl.Acad.Sci.USA97:1914-1919.

[0686] Huang et al.(1999)Lipids 34:649-659.

[0687] Inagaki et al.(2002)Biosci.Biotechnol.Biochem.66:613-621.

[0688] Johansen and Carrington(2001)Plant Physiol.126-930-938.

[0689] Kajikawa et al.(2004)Plant Mol.Biol.54:335-52.

[0690] Kajikawa et al.(2006)FEBS Lett 580:149-154.

[0691] Kereszt et al.(2007)Nature Protoc 2:948-952.

[0692] Koletzko et al.(1988)Am.J.Clin.Nutr.47:954-959.

[0693] Knutzon et al.(1998)J.Biol Chem.273:29360-6.

[0694] Koziel et al.(1996)Plant Mol.Biol.32:393-405.

[0695] Leonard et al.(2000)Biochem.J.347:719-724.

[0696] Leonard et al.(2000b)Biochem.J.350:765-770.

[0697] Leonard et al. (2002) Lipids 37:733-740.

[0698] Lewsey et al.(2007)Plant J.50:240-252.

[0699] Lo et al.(2003)Genome Res.13:455-466.

[0700] Lu and Kang(2008)Plant Cell Rep.27:273-8.

[0701] Mallory et al.(2002)Nat.Biotech.20:622-625.

[0702] Marangoni et al.(1995)Trends in Food Sci.Technol.6:329-335.

[0703] Meesapyodsuk et al.(2007)J Biol Chem 282:20191-20199.

[0704] Meng et al.(2008)J.Gen.Virol.89:2349-2358.

[0705] Meyer et al.(2003)Biochem.42:9779-9788.

[0706] Meyer et al.(2004)Lipid Res 45:1899-1909.

[0707] Michaelson et al.(1998a)J.Biol.Chem.273:19055-19059.

[0708] Michaelson et al.(1998b)FEBS Lett.439:215-218.

[0709] Murashige and Skoog(1962)Physiologia Plantarum 15:473-497.

[0710] Napier et al.(1998)Biochem.J.330:611-614.

[0711] Needleman and Wunsch(1970)J.Mol.Biol.48:443-453.

[0712] Niedz et al.(1995)Plant Cell Reports 14:403.

[0713] Ow et al.(1986)Science 234:856-859.

[0714] Parker-Barnes et al.(2000)Proc.Natl.Acad.Sci.USA 97:8284-8289.

[0715] Pereira et al.(2004a)Biochem.J.378:665-671.

[0716] Pereira et al.(2004b)Biochem.J.384:357-366.

[0717] Perrin et al.(2000)Mol Breed 6:345-352.

[0718] Petrie et al.(2010a)Metab.Eng.12:233-240.

[0719] Petrie et al.(2010b)Plant Methods 11:6:8.

[0720] Petrie et al.(2012)Transgenic Res.21:139-147.

[0721] Potenza et al.(2004)In Vitro Cell Dev Biol-Plant 40:1-22.

[0722] Prasher et al(1985)Biochem.Biophys.Res.Commun.127:31-36.

[0723] Qi et al.(2002)FEBS Lett.510:159-165.

[0724] Qi et al.(2004)Nat.Biotech.22:739-745.

[0725] Qiu et al.(2001)J.Biol.Chem.276:31561-31566.

[0726] Reddy and Thomas(1996)Nat.Biotech.14:639-642.

[0727] Reddy et al.(1993)Plant Mol.Biol.22:293-300.

[0728] Robert et al.(2005)Func.Plant Biol.32:473-479.

[0729] Robert et al.(2009)Marine Biotech 11:410-418.

[0730] Ruiz-Lopez et al.(2012)Transgenic Res.21:139-147.

[0731] Saha et al.(2006)Plant Physiol.141:1533-1543.

[0732] Saito et al.(2000)Eur.J.Biochem.267:1813-1818.

[0733] Sakuradani et al.(1999)Gene 238:445-453.

[0734] Sato et al.(2004)Crod Sci.44:646-652.

[0735] Sakuradani et al.(2005)Appl.Microbiol.Biotechnol.66:648-654.

[0736] Sayanova et al.(2006)J Biol Chem 281:36533-36541.

[0737] Sayanova et al.(1997)Proc.Natl.Acad.Sci.U.S.A.94:4211-4216.

[0738] Sayanova et al.(2003)FEBS Lett.542:100-104.

[0739] Sayanova et al.(2006)Planta 224:1269-1277.

[0740] Sayanova et al.(2007)Plant Physiol 144:455-467.

[0741] Singh et al.(2005)Curr.Opin.in Plant Biol.8:197-203.

[0742] Speranza et al.(2012)Process Biochemistry(In Press).

[0743] Sperling et al.(2000)Eur.J.Biochem.267:3801-3811.

[0744] Sperling et al.(2001)Arch.Biochm.Biophys.388:293-8.

[0745] Sprecher et al.(1995)J.Lipid Res.36:2471-2477.

[0746] SDychalla et al.(1997)Proc.Natl.Acad.Sci.U.S.A.94:1142-1147.

[0747] Stalker et al.(1998)J.Biol.Chem.263:6310-6314.

[0748] Thillet et al.(1988)J.Biol.Chem 263:12500-12508.

[0749] Tonon et al.(2003)FEBS Lett.553:440-444.

[0750] Toriyama et al.(1986)Theor.Appl.Genet.205:34.

[0751] Trautwein(2001)European J.Lipid Sci.and Tech.103:45-55.

[0752] Tvrdik(2000)J.Cell Biol.149:707-718.

[0753] Venegas-Caleron et al.(2010)Prog.Lipid Res.49:108-119.

[0754] Voinnet et al.(2003)Plant J.33:949-956.

[0755] Wallis and Browse(1999)Arch.Biochem.Biophys.365:307-316.

[0756] Watts and Browse(1999b)Arch.Biochem.Biophys.362:175-182.

[0757] Weiss et al.(2003)Int.J.Med.Microbiol.293:95:106.

[0758] Weng et al.(2004)Plant Molecular Biology Reporter 22:289-300.

[0759] Whitney et al.(2003)Planta 217:983-992.

[0760] Winans(1988)J.Bacteriol.170:4047-54.

[0761] Wood(2009)Plant Biotechnol J.7:914-24.

[0762] Wu et al.(2005)Nat.Biotech.23:1013-1017.

[0763] Yang et al.(2003)Planta 216:597-603.

[0764] Zank et al. (2002) Plant J. 31: 255-268.

[0765] Zank et al.(2005)WO 2005 / 012316

[0766] Zhang et al. (2004) FEBS Lett.556: 81-85.

[0767] Zhang et al. (2006) 20: 3255-3268.

[0768] Zhang et al. (2007a) FEBS Letters 581: 315-319.

[0769] Zhang et al. (2008) Yeast 25: 21-27.

[0770] Zhou et al. (2007) Phytochem. 68: 785-796.

[0771] Zhou et al. (2008) Insect Mol Biol 17: 667-676. Sequence Listing <110> Commonwealth Scientific and Technological Research Organization Food Research and Development Corporation Newshed Pte Ltd <120> Contains extracted plant lipids containing docosapentaenoic acid <130> 516027 <150> AU 2014902471 <151> 2014-06-27 <150> AU 2013905033 <151> 2014-12-18 <150> US 14 / 575,756 <151> 2014-12-18 <160> 51 <170> PatentIn version 3.5 <210> 1 <211> 21527 <212> DNA <213> Artificial sequence <220> <223> pJP3416-GA7. <400> 1 tcctgtggtt ggcatgcaca tacaaatgga cgaacggata aaccttttca cgccctttta 60 aatatccgat tattctaata aacgctcttt tctcttaggt ttaccccgcca atatatcctg 120 tcaaacactg atagtttaaa ctgaaggcgg gaaacgacaa tctgctagtg gatctcccag 180 tcacgacgtt gtaaaacggg cgccccgcgg aaagcttgcg gccgcccgat ctagtaacat 240 agatgacacc gcgcgcgata attatccta gtttgcgcgc tatattttgt tttctatcgc 300 gtattaaatg tataattgcg ggactctaat cataaaaacc catctcataa ataacgtcat 360 gcattacatg ttaattatta cgtgcttaac gtaattcaac agaaattata tgataatcat 420 cgcaagaccg gcaacaggat tcaatcttaa gaaactttat tgccaaatgt ttgaacgatc 480 ggcgcgcctc attagtgagc cttctcagcc tttccgttaa cgtagtagtg ctgtcccacc 540 tttcaaggt tagagaaagt agccttccaa gcaccgtagt aagagagcac cttgtagttg 600 agtccccact tcttagcgaa aggaacgaat cttctgctaa cctcaggctg tctgaattga 660 ggcatatcag ggagaaggtg gtggataacc tgacagttaa ggtatcccat aagccagttc 720 acgtatcctc tagaaggatc gatatcaacg gtgtgatcaa cagcgtagtt aacccaagaa 780 aggtgcttat cagatggaac aacagggagg tgagtatgag aagtagagaa gtgagcgaaa 840 aggtacatgt aagcgatcca gtttccgaaa gtgaaccacc agtaagcaac aggccaagag 900 tatccagtag caagcttgat aacagcggtt ctaacaacat gagaaacgag catccaagaa 960 gcctcttcgt agttcttctt acggagaact tgtctagggt ggagaacgta gatccagaaa 1020 gcttgaacaa gaagtccaga ggtaacagga acgaaagtcc aagcttgaag tctagcccaa 1080 gctctagaga atccttagg tctgttatcc tcaacagcag tgttgaagaa agccacagca 1140 ggagtggtat caagatccat atcgtgtcta acctttgag gggtagcatg gtgcttgtta 1200 tgcatctggt tccacatctc accagaagta gaaagtccga atccacaagt catagcctga 1260 agtctcttgt ccacgtaaac agatccggta agagagttat gtccaccctc atgttgaacc 1320 catccacatc tagctccgaa gaaagcaccg taaacaacag aagcaatgat agggtatcca 1380 gcgtacataa gagcagttcc aagagcgaat gtagcaagaa gctcgagaag tctgtaagcc 1440 acatgggtga tagaaggctt gaagaatcca tctctctcaa gctcagcacg ccatctagcg 1500 aaatcctcaa gcataggagc atcctcagac tcagatctct tgatctcagc aggtctagaa 1560 ggcaaagctc taagcatctt ccaagccttg agagaacgca tgtggaattc tttgaaagcc 1620 tcagtagcat cagcaccagt gttagcaagc atgtagaaga tcacagatcc accagggtgc 1680 ttgaagttag tcacatcgta ctcaacgtcc tcaactctaa cccatctagt ctcgaaagta 1740 gcagcaagct catgaggctc aagagctta agatcaacag gagcagtaga agcatcctta 1800 gcatcaagag cctcagcaga agatttagac ctggtaagtg gagatctagg agaagatctt 1860 ccatcagtct taggagggca catggtatgg taattgtaaa tgtaattgta atgttgtttg 1920 ttgtttgttg ttgttggtaa ttgttgtaaa agatcctcgt gtatgttttt aatcttgttt 1980 gtatcgatga gttttggttt gagtaaagag tgaagcggat gagttaattt ataggctata 2040 aaggagattt gcatggcgat cacgtgtaat aatgcatgca cgcatgtgat tgtatgtgtg 2100 tgctgtga gagaagctct taggtgtttg aagggagtga caagtggcga agaaaaacaa ttctccgcgg ctgcatgcta tgtgtaacgt gtagctaatg ttctggcatg gcatcttatg aacgattctt tttaaaaaca aggtaaaaac ttaacttcat aaattaaaa aaaaaacgt ttactaagtt ggtttaaaag gggatgagac tagtagttg gttggttggt ttccatgtac cagaaggctt accctattag ttgaaagttg aaactttgtt ccctactcaa ttcctagttg 2460. tgtaaatgta tgtatatgta atgtgtata aacgtagtac ttaaatgact aggagtggtt cttgagaccg atgagagatg ggagcagaac taaagatgat gacataatta agaacgaatt tgaaaggctc ttaggtttga atcctattcg agaatgtttt tgtcaaagat agtggcgatt ttgaaccaaa gaaacattt aaaaaatcag tatccggtta cgttcatgca aatagaaagt ggtctaggat ctgattgtaa ttttagactt aaagagtctc ttaagattca atcctggctg tgtacaaaac tacaataat atattttaga ctattggcc ttactaaac ttccactcat tatttactga ggttagaga tagacttgcg grandfather ttcccgaga atactcatga tcccaatt agtcagaggg tatgccaatc agatctaaga acacacattc cctcaaattt 2880 taatgcacat gtaatcatag tttagcacaa ttcaaaaata atgtagtatt aaagacagaa 2940 atttgtagac ttttttttgg cgttaaaaga agactaagtt tatacgtaca ttttatttta 3000 agtggaaaac cgaaattttc catcgaaata tatgaattta gtatatat ttctgcaatg 3060 tactattttg ctattttggc aactttcagt ggactactac tttattacaa tgtgtatgga 3120 tgcatgagtt tgagtataca catgtctaaa tgcatgcttt gtaaaacgta acggaccaca 3180 aaagaggatc catacaaata catctcatag cttcctccat tattttccga cacaaacaga 3240 gcattttaca acaattacca acaacaacaa acaacaaaca acattacaat tacatttaca 3300 attaccatac catggaattc gcccagcctc ttgttgctat ggctcaagag caatacgctg 3360 ctatcgatgc tgttgttgct cctgctatct tctctgctac tgattctatc ggatggggac 3420 ttaagcctat ctcttctgct actaaggact tgcctcttgt tgagtctcct acacctctca 3480 tccttcttt gcttgcttac ttcgctatcg ttggatctgg actcgtttac agaaaggttt 3540 3600. tccctgaac cgtgaagga caagatccat tccttttgaa ggctcttatg cttgctcaca acgtgttcct tatcggactt tctctttaca tgtgcctcaa gcttgtgtac gaggcttacg ttacaagta ctctttctgg ggaaacgctt acaaccctgc tcaaactgag atggctaagg ttatctggat cttctacgtg agcaagatct acgagttcat ggataccttc atcatgctcc 3840. tcaagggaaa tgttaaccag gttagcttcc ttcacgttta ccatcacgga tctatctctg gaatctggtg gatgattact tacgctgctc ctggtggtga tgcttacttc tctgctgctc ttaactcttg ggttcacgtg tgtatgtaca cctactattt tatggctgcc gtgcttccta 3960. aggacgaga aactagaga aagtacctct ggtggggag ataccttact caaatgcaga 4080. tgttccagtt cttcatgaac cttctccagg ctgtttacct tctctactct tcatctcctt accctaagtt tatcgctcag ctcctcgtgg tgtacatggt tactcttctc atgcttttcg 4140 gaaacttcta ctacatgaag caccacgcta gcaagtgatg aggcgcgccg ggccgccgcc atgtgacaga tcgaaggaag aaagtgtaat aagacgactc tcactactcg atcgctagtg attgtcattg tatatataa taatgttatc tttcacaact tatcgtaatg catgtgaaac 4320 tataacacat taatcctact tgtcatatga taacactctc cccatttaaa actcttgtca 4380 attaaagat ataagattct ttaaatgatt aaaaaaata tattataaat tcaatcactc 4440 ctactaataa attattaatt attatttatt gattaaaaaa atacttatac taatttagtc 4500 tgaatagaat aattagattc tagtctcatc cccttttaaa ccaacttagt aaacgttttt 4560 ttttttaatt tttgaagtt aagttttac cttgttttta aaaagaatcg ttcataagat 4620 gccatgccag aacattagct acacgttaca catagcatgc agccgcggag aattgttttt 4680 cttcgccact tgtcactccc ttcaaacacc taagagcttc tctctcacag cacacacata 4740 caatcacatg cgtgcatgca ttattacacg tgatcgccat gcaaatctcc tttatagcct 4800 ataaattaac tcatccgctt cactctttac tcaaaccaaa actcatcgat acaaacaaga 4860 ttaaaaacat acacgaggat cttttacaac attaccaac aacaacaaac aaaacaac 4920 attacaatta catttacaat taccatacca tgcctccaag ggactcttac tcttatgctg 4980 ctcctccttc tgctcaactt cacgaagttg atactcctca agagcacgac aagaaagagc 5040 ttgttatcgg agatagggct tacgatgtta ccaacttcgt taagagacac cctggtggaa 5100 agatcattgc ttaccaagtt ggaactgatg ctaccgatgc ttacaagcag ttccatgtta 5160 gatctgctaa ggctgacaag atgcttaagt ctcttccttc tcgtcctgtt cacaagggat 5220 actctccaag aagggctgat cttatcgctg atttccaaga gttcaccaag caacttgagg 5280 ctgagggaat gttcgagcct tctcttcctc atgttgctta cagacttgct gaggttatcg 5340 ctatgcatgt tgctggtgct gctcttatct ggcatggata cactttcgct ggaatcgcta 5400 tgcttggagt tgttcaggga agatgtggat ggcttatgca tgagggtgga cattactctc 5460 tcactggaaa cattgctttc gacagagcta tccaagttgc ttgttacgga cttggatgtg 5520 gaatgtctgg tgcttggtgg cgtaaccagc ataacaagca ccatgctact cctcaaaagc 5580 ttcagcacga tgttgatctt gatacccttc ctctcgttgc tttccatgag agaatcgctg 5640 ctaaggttaa gtctcctgct atgaaggctt ggctttctat gcaagctaag cttttcgctc 5700 ctgttaccac tcttcttgtt gctcttggat ggcagcttta ccttcatcct agacacatgc 5760 tcaggactaa gcactacgat gagcttgcta tgctcggaat cagatacgga cttgttggat 5820 accttgctgc taactacggt gctggatacg ttctcgct...

Claims

1. Plant lipids extracted from genetically modified Brassica napus or Brassica juncea seeds, comprising fatty acids in esterified form, said fatty acids comprising oleic acid, palmitic acid, ω6 fatty acids including linoleic acid (LA), ω3 fatty acids including α-linolenic acid (ALA) and docosapentaenoic acid (DPA), and one or more of stearidonic acid (SDA), eicosapentaenoic acid (EPA) and eicosatetraenoic acid (ETA), wherein the level of palmitic acid in the total fatty acid content of the extracted lipids is between 2% and 16%, wherein if present, the level of myristic acid (C14:0) in the total fatty acid content of the extracted lipids is less than 1%, and wherein at least 70% of the DPA esterified in the form of triacylglycerol (TAG) is in the sn-1 or sn-3 position of said TAG, wherein said genetically modified Brassica napus or Brassica juncea seeds comprise exogenous polynucleotides encoding Δ12-desaturase, acyl-CoA Δ6-desaturase, acyl-CoA Δ5-desaturase, Δ6-elongase, Δ5-elongase, and ω3-desaturase or Δ15-desaturase or ω3-desaturase and Δ15-desaturase.

2. The lipid of claim 1, wherein the lipid has at least one of the following characteristics: i) the level of palmitic acid in the total fatty acid content of the extracted lipids is between 2% and 15%; ii) the level of myristic acid (C14:0) in the total fatty acid content of the extracted lipids is 0.1%; iii) the level of oleic acid in the total fatty acid content of the extracted lipids is between 1% and 30%; iv) the level of linoleic acid (LA) in the total fatty acid content of the extracted lipids is between 4% and 35%; v) the level of α-linolenic acid (ALA) in the total fatty acid content of the extracted lipids is between 4% and 40%; vi) the level of γ-linolenic acid (GLA) in the total fatty acid content of the extracted lipids is less than 4%; vii) the level of stearidonic acid (SDA) in the total fatty acid content of the extracted lipids is less than 10%; viii) the level of eicosatetraenoic acid (ETA) in the total fatty acid content of the extracted lipids is less than 6%; ix) the level of eicosatrienoic acid (ETrA) in the total fatty acid content of the extracted lipids is less than 4%; x) the level of eicosapentaenoic acid (EPA) in the total fatty acid content of the extracted lipids is between 4% and 15%; xi) the level of DHA in the total fatty acid content of the extracted lipids is less than 2%; xii) The lipid contains less than 0.1% of ω6-docosapentaenoic acid (22:5 Δ4,7,10,13,16 ) in its fatty acid content; xiii) the level of total saturated fatty acids in the total fatty acid content of the extracted lipids is between 4% and 25%; xiv) the level of total monounsaturated fatty acids in the total fatty acid content of the extracted lipids is between 4% and 40%; xv) the level of total polyunsaturated fatty acids in the total fatty acid content of the extracted lipids is between 20% and 75%; xvi) The level of total ω6 fatty acids in the total fatty acid content of the extracted lipids is between 6% and 50%; xvii) The level of total novel ω6 fatty acids in the total fatty acid content of the extracted lipids is less than 10%, wherein the novel ω6 fatty acids are the total amount of ω6 fatty acids in the extracted lipids other than LA; xviii) The level of total ω3 fatty acids in the total fatty acid content of the extracted lipids is between 36% and 65%; xix) The level of total novel ω3 fatty acids in the total fatty acid content of the extracted lipids is between 21% and 45%, wherein the novel ω3 fatty acids are the total amount of ω3 fatty acids in the extracted lipids other than ALA; xx) The ratio of total ω6 fatty acids:total ω3 fatty acids in the fatty acid content of the extracted lipids is between 1.0 and 3.0; xxi) The ratio of total novel ω6 fatty acids:total novel ω3 fatty acids in the extracted lipids is between 1.0 and 3.0; xxii) The total fatty acids in the extracted lipids have less than 1.5% C20:1; xxiii) The TAG content of the lipids is at least 70% (weight / weight); xxiv) The lipids contain diacylglycerol (DAG), wherein the DAG includes DPA; and xxv) The level of DPA in the total fatty acid content of the extracted lipids is between 1% and 16%.

3. The lipid of claim 2, wherein the level of DHA is less than 2% of the total fatty acid content of the extracted lipids.

4. Canola seed oil from genetically modified canola seeds, the seed oil comprising fatty acids in esterified form, the fatty acids comprising oleic acid, palmitic acid, ω6 polyunsaturated fatty acids including linoleic acid (LA), ω3 polyunsaturated fatty acids including α-linolenic acid (ALA), eicosapentaenoic acid (EPA), docosapentaenoic acid (DPA), docosahexaenoic acid (DHA), stearidonic acid (SDA) and eicosatetraenoic acid (ETA), wherein the level of palmitic acid in the total fatty acid content of the seed oil is between 2% and 16%, wherein myristic acid (C14:0) is absent or present at a level less than 1% of the total fatty acid content of the seed oil, wherein the level of EPA in the total fatty acid content of the seed oil is between 4% and 15%, and wherein at least 70% of the DPA esterified in the form of triacylglycerol (TAG) is in the sn-1 or sn-3 position of the TAG, wherein the genetically modified canola seeds comprise exogenous polynucleotides encoding Δ12-desaturase, acyl-CoA Δ6-desaturase, acyl-CoA Δ5-desaturase, Δ6-elongase, Δ5-elongase, and ω3-desaturase or Δ15-desaturase or ω3-desaturase and Δ15-desaturase.

5. Canola seed oil from genetically modified canola seeds, said seed oil comprising fatty acids in esterified form, said fatty acids comprising oleic acid, palmitic acid, ω6 polyunsaturated fatty acids including linoleic acid (LA), ω3 polyunsaturated fatty acids including α-linolenic acid (ALA), eicosapentaenoic acid (EPA), docosapentaenoic acid (DPA), docosahexaenoic acid (DHA), stearidonic acid (SDA), and eicosatetraenoic acid (ETA), wherein the level of palmitic acid in the total fatty acid content of said seed oil is between 2% and 16%, wherein myristic acid (C14:0) is absent or present at a level of less than 1% of the total fatty acid content of said seed oil, wherein the level of DPA in the total fatty acid content of said seed oil is higher than the level of DHA, and wherein at least 70% of the DPA esterified in the form of triacylglycerol (TAG) is at the sn-1 or sn-3 position of said TAG, wherein said genetically modified canola seeds comprise exogenous polynucleotides encoding Δ12-desaturase, acyl-CoA Δ6-desaturase, acyl-CoA Δ5-desaturase, Δ6-elongase, Δ5-elongase, and ω3-desaturase or Δ15-desaturase or ω3-desaturase and Δ15-desaturase.

6. Canola seed oil from genetically modified canola seeds, said seed oil comprising a total fatty acid content, said total fatty acid content comprising fatty acids in esterified form, said fatty acids comprising oleic acid, palmitic acid, ω6 polyunsaturated fatty acids including linoleic acid (LA), ω3 polyunsaturated fatty acids including α-linolenic acid (ALA), eicosapentaenoic acid (EPA), docosapentaenoic acid (DPA), docosahexaenoic acid (DHA), stearidonic acid (SDA), and eicosatetraenoic acid (ETA), wherein the level of palmitic acid in the total fatty acid content of said seed oil is between 2% and 16%, wherein myristic acid (C14:0) is absent or present at a level of less than 1% of the total fatty acid content of said seed oil, wherein at least 70% of the DPA esterified in the form of triacylglycerol (TAG) is at the sn-1 or sn-3 position of said TAG, and wherein ALA, SDA, ETA, EPA, DPA, DHA, and eicosatrienoic acid (ETrA) each exist at a level in said total fatty acid content, each level expressed as a percentage of the total fatty acid content, wherein the sum of the percentages of DPA and DHA divided by the sum of the percentages of ALA, SDA, ETA, EPA, DPA, DHA, and ETrA, expressed as a percentage, is between 15.3% and 60.5%, wherein said genetically modified canola seeds comprise exogenous polynucleotides encoding Δ12-desaturase, acyl-CoA Δ6-desaturase, acyl-CoA Δ5-desaturase, Δ6-elongase, Δ5-elongase, and ω3-desaturase or Δ15-desaturase or ω3-desaturase and Δ15-desaturase.

7. The seed oil according to any one of claims 4 - 6, wherein the level of DHA in the total fatty acid content of the seed oil is less than 2%.

8. The seed oil according to any one of claims 4 - 6, wherein the level of DHA in the total fatty acid content of the seed oil is less than 0.5%.

9. The seed oil according to any one of claims 4 - 6, wherein the level of DHA in the total fatty acid content of the seed oil is between 0.5% and 2.0%.

10. The seed oil according to any one of claims 4 - 6, wherein there is less than 4% of γ - linolenic acid (GLA) in the total fatty acid content of the seed oil.

11. The seed oil according to any one of claims 4 - 6, wherein at least 80% of the DPA esterified in the form of TAG in the seed oil is at the sn - 1 or sn - 3 position of the TAG.

12. The seed oil of claim 11, wherein at least 90% of the DPA esterified in the form of TAG in the seed oil is at the sn - 1 or sn - 3 position of the TAG.

13. The seed oil according to any one of claims 4 - 6, wherein the level of DPA in the total fatty acid content of the seed oil is between 0.05% and 8%.

14. The seed oil according to any one of claims 4 - 6, which has the following characteristics: i) the level of oleic acid in the total fatty acid content of the seed oil is between 1% and 60%, ii) the level of LA in the total fatty acid content of the seed oil is between 4% and 35%, iii) there is less than 4% of γ - linolenic acid (GLA) in the total fatty acid content of the seed oil, and iv) there is between 4% and 25% of total saturated fatty acids in the total fatty acid content of the seed oil.

15. The seed oil according to any one of claims 4 - 6, wherein the sum of the percentages of DPA and DHA divided by the sum of the percentages of ALA, SDA, ETA, EPA, DPA, DHA, and eicosatrienoic acid (ETrA), expressed as a percentage, is between 17% and 55%.

16. The seed oil according to any one of claims 4 - 6, wherein the sum of the percentages of DPA and DHA divided by the sum of the percentages of ALA, SDA, ETA, EPA, DPA, DHA, and eicosatrienoic acid (ETrA), expressed as a percentage, is between 15.3% and 18.7%.

17. A method for producing the extracted plant lipid of claim 1, comprising the following steps: i) Obtain Brassica napus or Brassica juncea seeds containing lipids, said lipids containing fatty acids in esterified form, said fatty acids comprising oleic acid, palmitic acid, ω6 fatty acids including linoleic acid (LA), ω3 fatty acids including α-linolenic acid (ALA) and docosapentaenoic acid (DPA), and one or more of stearidonic acid (SDA), eicosapentaenoic acid (EPA) and eicosatetraenoic acid (ETA), wherein the level of palmitic acid in the total fatty acid content of the lipids is between 2% and 16%, wherein if present, the level of myristic acid (C14:0) in the total fatty acid content of the lipids is less than 1%, wherein at least 70% of the DPA esterified in the form of triacylglycerol (TAG) is in the sn-1 or sn-3 position of the TAG, wherein the seeds contain exogenous polynucleotides encoding Δ12-desaturase, Δ6-desaturase, Δ5-desaturase, Δ6-elongase, Δ5-elongase, and ω3-desaturase or Δ15-desaturase or ω3-desaturase and Δ15-desaturase, and wherein each polynucleotide is operably linked to one or more promoters capable of directing the expression of the polynucleotide in the cells of the seeds, and ii) Extract the lipids from the seeds.

18. The method of claim 17, wherein the extracted lipids have one or more of the characteristics defined in claim 2 or 3.

19. A method for producing the seed oil of any one of claims 4-6, comprising the steps of: i) Obtain Brassica napus seeds comprising a seed oil, said seed oil comprising fatty acids in esterified form, said fatty acids comprising oleic acid, palmitic acid, ω6 fatty acids including linoleic acid (LA), ω3 fatty acids including α-linolenic acid (ALA), docosapentaenoic acid (DPA), docosahexaenoic acid (DHA), stearidonic acid (SDA), eicosapentaenoic acid (EPA) and eicosatetraenoic acid (ETA), wherein the level of palmitic acid in the total fatty acid content of the lipid is between 2% and 16%, wherein if present, the level of myristic acid (C14:0) in the total fatty acid content of the lipid is less than 1%, wherein at least 70% of the DPA esterified in the form of triacylglycerol (TAG) is in the sn-1 or sn-3 position of said TAG, wherein said seeds comprise exogenous polynucleotides encoding Δ12-desaturase, Δ6-desaturase, Δ5-desaturase, Δ6-elongase, Δ5-elongase, and ω3-desaturase or Δ15-desaturase or ω3-desaturase and Δ15-desaturase, wherein each polynucleotide is operably linked to one or more promoters capable of directing the expression of said polynucleotide in the cells of said seeds, and wherein (a) the level of EPA in the total fatty acid content of said seed oil is between 4% and 15%, or (b) wherein the level of DPA in the total fatty acid content of said seed oil is higher than the level of DHA, or (c) wherein ALA, SDA, ETA, EPA, DPA, DHA and eicosatrienoic acid (ETrA) each exist at a level in said total fatty acid content, said levels expressed as a percentage of the total fatty acid content, wherein the sum of the percentages of DPA and DHA divided by the sum of the percentages of ALA, SDA, ETA, EPA, DPA, DHA and ETrA expressed as a percentage is between 15.3% and 60.5%, and ii) Extract the seed oil from said seeds.

20. The method of claim 19, wherein the level of DHA in the total fatty acid content of said seed oil is less than 2%.

21. The method of claim 20, wherein the level of DHA in the total fatty acid content of said seed oil is less than 0.5%.

22. The method of claim 20, wherein the level of DHA in the total fatty acid content of said seed oil is between 0.5% and 2.0%.

23. The method of claim 19, wherein there is a level of less than 4% of γ-linolenic acid (GLA) in the total fatty acid content of said seed oil.

24. The method of claim 19, wherein at least 80% of the DPA esterified in the form of triacylglycerol (TAG) is in the sn-1 or sn-3 position of said TAG.

25. The method of claim 24, wherein at least 90% of the DPA esterified in the form of TAG is in the sn-1 or sn-3 position of said TAG.

26. The method of claim 19, wherein the level of DPA in the total fatty acid content of said seed oil is between 0.05% and 8%.

27. The method of claim 19, wherein said seed oil has the following characteristics: i) The level of oleic acid in the total fatty acid content of the seed oil is between 1% and 60%, ii) The level of LA in the total fatty acid content of the seed oil is between 4% and 35%, iii) There is less than 4% level of gamma-linolenic acid (GLA) in the total fatty acid content of the seed oil, and iv) There is a level of total saturated fatty acids between 4% and 25% in the total fatty acid content of the seed oil.

28. The method of claim 19, wherein the sum of the percentages of DPA and DHA divided by the sum of the percentages of ALA, SDA, ETA, EPA, DPA, DHA, and eicosatrienoic acid (ETrA), expressed as a percentage, is between 17% and 55%.

29. The method of claim 19, wherein the sum of the percentages of DPA and DHA divided by the sum of the percentages of ALA, SDA, ETA, EPA, DPA, DHA, and eicosatrienoic acid (ETrA), expressed as a percentage, is between 15.3% and 18.7%.

30. The method of claim 19, wherein one or more of the following apply: i) Relative to linoleic acid (LA), the Δ6-desaturase preferentially desaturates alpha-linolenic acid (ALA); ii) The Δ6-elongase also has Δ9-elongase activity; iii) The Δ12-desaturase also has Δ15-desaturase activity; iv) The Δ6-desaturase also has Δ8-desaturase activity; v) The Δ15-desaturase also has ω3-desaturase activity towards GLA; vi) The ω3-desaturase also has Δ15-desaturase activity towards LA; vii) The ω3-desaturase desaturates LA and / or GLA; viii) The ω3-desaturase desaturates GLA more than LA; ix) One or more or all of the desaturases have greater activity towards acyl-CoA substrates than towards the corresponding acyl-PC substrates; x) The Δ6-desaturase has greater Δ6-desaturase activity towards ALA than towards LA; xi) The Δ6-desaturase has greater Δ6-desaturase activity towards ALA-CoA than towards ALA linked to the sn-2 position of PC; xii) The Δ6-desaturase has at least 2-fold greater Δ6-desaturase activity towards ALA than towards LA, at least 3-fold greater activity, at least 4-fold greater activity, or at least 5-fold greater activity; xiii) The Δ6-desaturase has at least 5- or 10-fold greater Δ6-desaturase activity towards ALA-CoA than towards ALA linked to the sn-2 position of PC; and xiv) The Δ6-desaturase has no detectable Δ5-desaturase activity towards ETA.

31. The method of claim 19, wherein the exogenous polynucleotide is covalently linked in a T-DNA molecule, the T-DNA molecule is integrated into the genome of the cells of the seed, and the number of such T-DNA molecules integrated into the genome of the cells of the seed is one, two, or three.

32. The method of claim 19, wherein the method further comprises processing the extracted lipid to increase the level of DPA as a percentage of the total fatty acid content, wherein the processing comprises fractionation, distillation, or transesterification such as to produce methyl or ethyl esters of DPA, or a combination of the methods.

33. A method of producing a genetically modified Brassica napus or Brassica juncea plant or seed therefrom, the plant being useful for producing the extracted plant lipid of claim 1 or 2, the method comprising: a) determining the level of DPA in lipids produced from one or more seeds from a plurality of Brassica napus or Brassica juncea plants, each plant in the plurality of plants comprising one or more exogenous polynucleotides encoding a Δ12-desaturase, a Δ6-desaturase, a Δ5-desaturase, a Δ6-elongase, a Δ5-elongase, and an ω3-desaturase or a Δ15-desaturase or an ω3-desaturase and a Δ15-desaturase, wherein each polynucleotide is operably linked to one or more promoters capable of directing the expression of the polynucleotide in the cells of the seed, and b) identifying a genetically modified Brassica napus or Brassica juncea plant from the plurality of plants, which is useful for producing the extracted plant lipid of claim 1 or 2, and c) producing progeny plants or seeds therefrom of the identified plant.

34. A method of producing a seed, the method comprising: a) growing a Brassica napus or Brassica juncea plant comprising (i) one or more exogenous polynucleotides encoding a Δ12-desaturase, a Δ6-desaturase, a Δ5-desaturase, a Δ6-elongase, a Δ5-elongase, and an ω3-desaturase or a Δ15-desaturase or an ω3-desaturase and a Δ15-desaturase, wherein each polynucleotide is operably linked to one or more promoters capable of directing the expression of the polynucleotide in the developing seeds of the plant, and (ii) fatty acids in esterified form in the seed oil of the seeds of the plant, wherein the fatty acids comprise oleic acid, palmitic acid, ω6 fatty acids including linoleic acid (LA), ω3 fatty acids including α-linolenic acid (ALA) and docosahexaenoic acid (DPA), and one or more of stearidonic acid (SDA), eicosapentaenoic acid (EPA), and eicosatetraenoic acid (ETA), wherein the level of palmitic acid in the total fatty acid content of the lipid is between 2% and 16%, wherein if present, the level of myristic acid (C14:0) in the total fatty acid content of the lipid is less than 1%, and wherein at least 70% of the DPA esterified in the form of triacylglycerol (TAG) is in the sn-1 or sn-3 position of the TAG, and b) harvesting seeds from the plant.

35. A method of producing a seed, the method comprising: a) growing Brassica napus plants comprising (i) one or more exogenous polynucleotides encoding a Δ12-desaturase, a Δ6-desaturase, a Δ5-desaturase, a Δ6-elongase, a Δ5-elongase, and an ω3-desaturase or a Δ15-desaturase or an ω3-desaturase and a Δ15-desaturase, wherein each polynucleotide is operably linked to one or more promoters capable of directing the expression of the polynucleotide in the developing seeds of the plant, and (ii) fatty acids in esterified form in the seed oil of the seeds of the plant, wherein the fatty acids comprise oleic acid, palmitic acid, ω6 fatty acids including linoleic acid (LA), ω3 fatty acids including α-linolenic acid (ALA), eicosapentaenoic acid (EPA), docosapentaenoic acid (DPA), docosahexaenoic acid (DHA), stearidonic acid (SDA), and eicosatetraenoic acid (ETA), wherein the level of palmitic acid in the total fatty acid content of the lipid is between 2% and 16%, wherein if present, the level of myristic acid (C14:0) in the total fatty acid content of the lipid is less than 1%, wherein at least 70% of the DPA esterified in the form of triacylglycerol (TAG) is in the sn-1 or sn-3 position of the TAG, and wherein (a) the level of EPA in the total fatty acid content of the seed oil is between 4% and 15%, or (b) wherein the level of DPA in the total fatty acid content of the seed oil is higher than the level of DHA, or (c) wherein ALA, SDA, ETA, EPA, DPA, DHA, and eicosatrienoic acid (ETrA) are each present at a level in the total fatty acid content, each level expressed as a percentage of the total fatty acid content, wherein the sum of the percentages of DPA and DHA divided by the sum of the percentages of ALA, SDA, ETA, EPA, DPA, DHA, and ETrA expressed as a percentage is between 15.3% and 60.5%, and b) harvesting seeds from the plants.

36. A composition comprising the lipid of claim 1 or 2.

37. A composition comprising the seed oil of any one of claims 4-6.

38. A raw material, cosmetic, or chemical agent comprising the lipid of claim 1 or 2.

39. A raw material, cosmetic, or chemical agent comprising the seed oil of any one of claims 4-6.

40. A method for producing a raw material, the method comprising mixing the lipid of claim 1 or 2 with at least one other food ingredient.

41. A method for producing a raw material, the method comprising mixing the seed oil of any one of claims 4-6 with at least one other food ingredient.

Images