Triplex terminators for efficient RNA trans-splicing

Abstract

A nucleic acid trans-splicing molecule is provided that can replace an exon carrying a defect or mutation that causes an ocular disease in a target mammalian ocular gene with an exon having a naturally occurring sequence and free of the defect or mutation. The trans-splicing molecule includes a 3' transcription terminator domain that enhances the efficiency of trans-splicing. The 3' TTD comprises a triple helix domain and a tRNA-like domain.

Description

Background Technology

[0001] Many inherited retinal diseases are caused by mutations in various parts of genes located in the larger eye region, usually multiple mutations. For example, Stargardt disease, also known as Stargardt 1 (STGD1), is an autosomal recessive retinal dystrophy typically characterized by progressive loss of central vision. Similar retinal diseases are caused by defects in other genes in the larger eye region, including CEP290 (7440 nucleotides), whose defects or mutations cause eye diseases such as Leber's congenital amaurosis; and MYO7A (7465 nucleotides), whose defects or mutations cause Usher's disease.

[0002] The presence and location of multiple mutations in these larger eye genes and other genes make mutation repair strategies extremely challenging. Despite the promise of trans-splicing technology, spanning over two decades, a meaningful gene therapy has yet to emerge. This is primarily, but not solely, due to the poor efficiency of the trans-splicing response. Importantly, it should be recognized that trans-splicing is uncommon in higher eukaryotes, including humans. Moreover, instances of endogenous trans-splicing are extremely rare, while cis-splicing clearly dominates. Simply put, trans-splicing appears to be a novel alternative splicing mechanism in humans, utilizing the same cytokines and mechanisms mediating the traditional cis-splicing pathway.

[0003] There is still a need for effective compositions and treatments for treating such conditions. Summary of the Invention

[0004] This article provides RNA trans-splicing molecules (RTMs) that can be used to treat diseases caused by defects in one or more exons of a coding sequence. Methods and compositions utilizing these RTMs are also provided.

[0005] On one hand, the present invention includes a nucleic acid trans-splicing molecule (e.g., RTM) comprising a 3' transcription terminator domain (TTD) comprising a triple helix. In some embodiments, the triple helix comprises at least five consecutive AU Hoogsteen base pairs (e.g., four to 20 consecutive AU Hoogsteen base pairs, four to 18 consecutive AU Hoogsteen base pairs, four to 15 consecutive AU Hoogsteen base pairs, four to 12 consecutive AU Hoogsteen base pairs, four to 11 consecutive AU Hoogsteen base pairs, or four to 10 consecutive AU Hoogsteen base pairs, such as six to eight consecutive AU Hoogsteen base pairs, eight to 10 consecutive AU Hoogsteen base pairs, 10 to 12 consecutive AU Hoogsteen base pairs, 12 to 14 consecutive AU Hoogsteen base pairs, 14 to 16 consecutive AU Hoogsteen base pairs, 16 to 18 consecutive AU Hoogsteen base pairs, or 18 to 20 consecutive AU Hoogsteen base pairs).

[0006] In some embodiments, the triple helix includes an A-rich region having 5-30 nucleic acids (e.g., 5-10, 10-20, or 20-30 nucleic acids). In some embodiments, the A-rich region is located at the 3' end of the TTD (e.g., at or within a poly-A tail).

[0007] In some embodiments, the triple helix comprises a chain of 10 consecutive nucleotides, wherein 9 of the 10 consecutive nucleotides are paired via Husstan base pairing. In some embodiments, the TTD comprises a stem-loop motif.

[0008] In some embodiments, the 3'TTD includes a 5' U-rich motif, a stem-loop motif, a t' U-rich motif, and an A-rich region operatively connected in the 5' to 3' direction.

[0009] In some embodiments, 3'TTD is at least 95% homologous to SEQ ID NO:13, SEQ ID NO:15, SEQ ID NO:17, or SEQ ID NO:23 (e.g., at least 96% homologous to SEQ ID NO:13, SEQ ID NO:15, SEQ ID NO:17, or SEQ ID NO:23; at least 97% homologous to SEQ ID NO:13, SEQ ID NO:15, SEQ ID NO:17, or SEQ ID NO:23; at least 98% homologous to SEQ ID NO:13, SEQ ID NO:15, SEQ ID NO:17, or SEQ ID NO:23; at least 99% homologous to SEQ ID NO:13, SEQ ID NO:15, SEQ ID NO:17, or SEQ ID NO:23; or 100% homologous to SEQ ID NO:13, SEQ ID NO:15, SEQ ID NO:17, or SEQ ID NO:23).

[0010] In some embodiments, the 3'TTD is at least 95% homologous to SEQ ID NO:13 (e.g., at least 96%, at least 97%, at least 98%, or at least 99% homologous), and the triple helix comprises U7-U11 of SEQ ID NO:13 paired with Husstan bases in the A-rich region. In some embodiments, the 3'TTD is PAN ENE+A.

[0011] In some embodiments, the 3'TTD is at least 95% homologous to SEQ ID NO:15 (e.g., at least 96%, at least 97%, at least 98%, or at least 99% homologous), and the triple helix comprises U6-10, C11, and U12-15 of SEQ ID NO:15 paired with Husstan bases in the A-rich region. In some embodiments, the 3'TTD is MALAT1 ENE+A.

[0012] In some embodiments, the 3'TTD is at least 95% homologous to SEQ ID NO:17 (e.g., at least 96%, at least 97%, at least 98%, or at least 99% homologous), and the triple helix comprises U6-10, C11, and U12-15 of SEQ ID NO:17 paired with Husstan bases in the A-rich region. In some embodiments, the 3'TTD is MALAT1 core ENE+A.

[0013] In some embodiments, 3'TTD is at least 95% homologous to SEQ ID NO:23, and wherein the triple helix comprises U8-10, C11, and U12-15 of SEQ ID NO:23 paired with Husstan bases in the A-rich region. In some embodiments, 3'TTD is MENβENE+A.

[0014] On the one hand, a nucleic acid trans-splicing molecule is provided. The RTM includes the following components operatively linked in the 5' to 3' direction:

[0015] (a) A coding sequence domain (CDS) containing one or more functional exons of a selected gene;

[0016] (b) A connector sequence of different lengths and / or compositions, which acts as a structural connection between the coding domain and the binding domain and may contain a motif that serves as a splicing enhancer; or have the ability to fold into a complex secondary structure that minimizes translation of the coding region before trans-splicing events occur; or encode a degradation peptide under conditions of premature RTM maturation.

[0017] (c) Splice body identification motif (splice donor, SD, also known as 5' splice site (5'SS)) configured for initiating splice body-mediated reverse splicing.

[0018] (d) A binding domain (BD) of different length and sequence designed for hybridization with a target intron of the selected gene, wherein the gene has at least one defect or mutation in the 5' exon of the target intron; and

[0019] (e) 3' transcription terminator domain (TTD),

[0020] The nucleic acid trans-splicing molecule is configured to trans-splice the coding domain to an endogenous exon of the selected gene adjacent to the target intron, thereby replacing the endogenous defective or mutated exon with the functional exon and correcting mutations in the selected gene.

[0021] In one embodiment, the binding domain hybridizes with a target intron of a selected gene at the 3' end of the mutation, and the coding domain is contained in one or more exons at the 5' end of the target intron.

[0022] On the other hand, RTM includes the following operative connections in the 5' to 3' direction:

[0023] (a) A binding domain (BD) of different length and sequence designed for hybridization with a target intron of the selected gene, wherein the gene has at least one defect or mutation in the exon at the 3' end of the target intron;

[0024] (b) A connector sequence of different lengths and compositions, which acts as a structural connection between the binding domain and the coding region and contains a motif that serves as a splicing enhancer; or folds into a complex secondary structure that hinders translation of the coding region as a competing event for trans-splicing; or encodes a degradation peptide in the case of premature RTM maturation;

[0025] (c) The 3' spliceosome recognition motif ((spliceosome acceptor, SA), also known as the 3' splice site (3'SS)) is configured to mediate trans-splicing.

[0026] (d) A coding sequence domain (CDS) containing one or more functional exons of the selected gene; and

[0027] (e) 3' transcription terminator domain (TTD),

[0028] The nucleic acid trans-splicing molecule is configured to trans-splice the coding domain to an endogenous exon of the selected gene adjacent to the target intron, thereby replacing the endogenous defective or mutated exon with the functional exon and correcting the mutation in the selected gene. In one embodiment, the binding domain binds to a target intron of the selected gene at the 3' end of the mutation, and the coding domain is contained in one or more exons at the 5' end of the target intron.

[0029] In one embodiment, the 3' transcription terminator domain is a sequence from one or more long non-coding RNA (lncRNA) or other nuclear RNA molecules containing a 3' transcription terminator, the sequence being condensed into a triple helix with a 3' blunt end cap.

[0030] On the other hand, a recombinant adeno-associated virus (rAAV) is provided, wherein the rAAV includes any of the RTMs described herein.

[0031] On the other hand, a method for treating diseases caused by defects or mutations in target genes is provided. The method includes administering a composition comprising recombinant AAV to cells of a subject suffering from the disease, the recombinant AAV comprising nucleic acid trans-splicing molecules as described herein.

[0032] In another aspect, a pharmaceutical formulation is provided comprising a physiologically acceptable carrier and rAAV or RTM as described herein.

[0033] Other aspects and embodiments will be described in the following detailed description. Attached Figure Description

[0034] Figure 1A-1E The map and partial sequence of an RTM luciferase reporter construct targeting intron 26 of human CEP290 are displayed. The construct encodes the 5' half of the luciferase coding sequence (CDS) and distinct transcription terminator sequences: poly(A), a polyadenylation signal from SV40, which generates a 3' terminator after the poly(A) signal is cleaved and a non-templated poly(A) tail is added. Figure 1A ); hhRz, or hammerhead ribonuclease, which self-cleaves to produce the 3' end of RTM ( Figure 1B Comp14, the truncated MALAT1 triple helix terminator structure, produces the 3' end of the RTM after cleavage by ribonuclease P (in two forms, namely...). Figure 1C , 1D ); and hybrids in which the mascRNA domain of Comp14 is replaced by hhRz, which produce the 3' end of RTM after ribonuclease autolysis ( Figure 1E ).

[0035] exist Figure 1A (391. Poly(A)), showing SEQ ID NO:31nt 2081-2600. In Figure 1B (391.hhRz) shows SEQ ID NO:32nt 2081-2447. Figure 1C In (391.Comp14-v1), SEQ ID NO:33nt 2081-2470 is displayed. Figure 1D (391.Comp14-v2 shows SEQ ID NO:34nt 2081-2470. In) Figure 1E (391.Comp14.hhRz) shows SEQ ID NO:35nt 2081-2470.

[0036] Figure 1F The map and sequence of a small gene containing intron 26 from human CEP290 fused to the 3' half of the luciferase CDS are displayed. Figure 1F (pcDNA_FRT.In26 target.3'Luc) shows SEQ ID NO:36nt 6761-7280.

[0037] Figure 2A and 2B As illustrated in Example 1, the measurements... Figures 1A to 1DThe luciferase levels of the construct described in [the text]. RTM was delivered to the expression [the text is incomplete and requires further context]. Figure 1F The cell line shown in the figure contains an intron 26 from human CEP290 that is fused to the 3' half of the luciferase CDS.

[0038] Figures 3A to 3C The image and partial sequence of the RTM construct targeting intron 23 of human ABCA4 are shown. The construct includes one of several terminator sequences for an ABCA4 trans-splicing activity assay: hhz, a hammerhead ribonuclease, which self-cleaves to generate the 3' end of the RTM. Figure 3A C14 or Comp14, a truncated derivative of the MALAT1 triple helix structure, produces the 3' end of the RTM after cleavage by ribonuclease P. Figure 3B ); and wt, i.e., the original MALAT1 triple helix terminator, which produces the 3' end of the RTM after cleavage by ribonuclease P ( Figure 3C ). Figure 3A This shows a portion of the sequence shown in SEQ ID NO:28, where the 5'SS (also known as the SD or splice domain) begins at nt 4311 and the insulator terminates at nt 4591. Figure 3B This shows a portion of the sequence shown in SEQ ID NO:29, where the 5'SS (also known as the SD or splice domain) begins at nt 4311 and the mascRNA terminates at nt 4620. Figure 3C This shows a portion of the sequence shown in SEQ ID NO:30, where the 5'SS (also known as the SD or splice domain) begins at nt 4311 and the mascRNA terminates at nt 4654.

[0039] Figure 4A and 4B This is a Western blot and its quantification, showing the ABCA4 protein produced via RTM-mediated trans-splicing. The RTM tested in Figure 3 includes the binding domains of ABCA4 introns 23 (motifs 27 and 81) and 22 (motifs 117 and 118). NB is a negative control non-binding motif.

[0040] Figure 5AWestern blot analysis of RTMs containing different triple-helix terminators from lncRNAs was presented. These included wild-type sequences from MALAT1 and NEAT1 (MENβ), as well as chimeric forms fused with a triple-helix domain from MALAT1 and a tRNA-like motif (called menRNA) from NEAT1, and chimeric forms fused with a triple-helix domain from NEAT1 and a mascRNA motif from MALAT1. The data indicated that trans-splicing activity was highest when the RTM contained the wild-type MALAT1 terminator.

[0041] Figure 5B The predicted base pairing of triple-helical terminators from three different lncRNAs, including MALAT1, MENβ (NEAT1), and PAN RNA (produced by Kaposi's sarcoma-associated herpesvirus KSHV), is shown. The structural similarity among the different lncRNAs suggests a common evolutionary strategy for protecting the 3' end of lncRNAs after transcription termination. However, X-ray crystallography of the MALAT1 triple-helical domain reveals a triplet with 10 major grooves and 2 minor grooves, most of which possess any known naturally occurring triple-helical structure (Brown, JA et al., 2014). This intricate design may confer a level of structural stability exceeding that of NEAT1 or PAN and could explain why the MALAT1 terminator appears to better support trans-splicing, thereby preventing RTM degradation in the nucleus. Importantly, as shown by in vivo decay assays (Brown, JA, 2014), the blunt-ended triple helix of MALAT1 inhibits rapid nuclear RNA decay.

[0042] Figure 6A This displays highly conserved mascRNA sequences of MALAT1 from several species and their predicted folding conformations. The single-point mutation from G to A, indicated by the red arrow, was inserted into the mascRNA sequence to test the importance of this domain for trans-splicing activity. (See Western blotting). Figure 6B As shown in the diagram, the point mutation eliminates the verified trans-splicing activity of the RTM targeting ABCA4. This is likely because the mutant sequence fails to present the correct conformation required for ribonuclease P recognition and cleavage.

[0043] Figure 7 A vector diagram is shown, comprising the codon-optimized ABCA4 coding sequence and the hammerhead ribonuclease (hhRz). The sequence is shown in SEQ ID NO:28.

[0044] Figure 8A vector diagram is shown, comprising the codon-optimized ABCA4 coding sequence, MALAT1 for codons 1-23, and the truncated MALAT1 Comp14 3'TTD sequence. The sequence is shown in SEQ ID NO:29.

[0045] Figure 9 A vector diagram is shown, comprising the codon-optimized ABCA4 coding sequence, the MALAT1 sequence for codons 1-23, and the wtMALAT1 3'TTD sequence. The sequence is shown in SEQ ID NO:30.

[0046] Figure 10 The map and sequence of the triple-helix region from human MALAT1 lncRNA are shown. The sequence of MALAT1 is shown in SEQ ID NO:7. The triple-helix region begins at SEQ ID NO:7 at position 8287, and the mascRNA terminates at SEQ ID NO:7 at position 8437. Detailed Implementation

[0047] Many experimental trans-splicing studies reported in the literature often fail to reach therapeutically significant endpoints. This does not mean these studies are unimportant, as they all demonstrate the necessary role of RTM-binding domains and splice site signaling. Moreover, while these fundamental elements are indeed important, the complexity of RNA splicing involves a host of additional cis- and trans-acting factors for template recognition, spliceosome assembly, not to mention other non-splicing mechanisms that can directly influence the turnover or localization of RTM molecules. Because trans-splicing is competitively disadvantaged compared to cis-splicing, the technical design of RNA trans-splicing molecules (RTMs) must include features that enhance their advantages. One way to achieve this is by increasing the effective concentration of RTMs in the cell nucleus or by making RTMs more compelling targets for the spliceosome (through cis-acting elements or localization).

[0048] The central focus of this disclosure is the RNA trans-splicing molecule (RTM), designed to specifically target and deliver the gene payload of interest via a trans-splicing reaction. Structurally, the RTM is organized into three core domains: 1) a protein-coding region; 2) a binding domain that hybridizes to introns within the target gene's RNA transcript; and 3) a linker sequence with a splicing signal (5'SS or 3'SS) connecting the coding region to the binding domain. It is important to emphasize that each of these three regions also has a functional role. While modifications to any of these regions could theoretically affect RTM activity, the binding domain has attracted the most attention. In fact, most reports in the literature include some degree of screening to identify the optimal binding sequence. It has been shown that the location and length of the target sequence affect RTM activity. However, there is no evidence that sequence-specific features constitute a shared motif or contribute to the development of binding domain design rules that may be applicable to different gene targets. Therefore, the binding domain has been determined through trial and error.

[0049] It is unclear why some binding domains function better than others. Possible explanations involve RNA folding and how this might affect the availability of a given target sequence for hybridization RTMs. RNA folding can also affect the RTM binding domains themselves; that is, if a binding domain exhibits a complex secondary structure, it will not be usable for hybridization with target introns. Given the identification of the optimal binding domain, RTMs still follow the same rules as other RNAs in the cell nucleus. Moreover, this can affect RTM activity independently of the binding reaction. Mechanistically, RTMs must have a half-life in the cell nucleus long enough to allow the binding reaction to occur. If RTMs are transported out of the cell nucleus or degraded by ubiquitous nuclear ribonucleases, both events significantly reduce the effective RTM concentration, thus decreasing trans-splicing efficiency.

[0050] The biology of long non-coding RNAs (lncRNAs) has recently become a topic of great interest in biomedical research and medicine. This is largely due to the observation that some lncRNAs are upregulated in certain cancers. Moreover, although this relationship does not appear to be causal, understanding the role of these mysterious RNAs can illuminate their possible roles in gene regulation. Like RTMs, lncRNAs are transcribed by RNA polymerase II. Furthermore, they both face the same problem; 3' end processing ensures precise polymerase termination and the functionality of the mature transcript. For RTMs, most literature reports the use of polyadenylation signaling for 3' end processing. However, this method sends the RTM signal to the cytoplasm, effectively reducing the nuclear copy number and allowing RTM expression of truncated proteins with unknown biological consequences. RTM expression of truncated proteins, or sometimes called RTM maturation, is an undesirable outcome / off-target effect with unknown biological consequences. In contrast, many lncRNAs lack polyadenylation signaling and, in fact, rely on non-standard 3' end processing for PolII termination. Some of these exhibit a simple stem-loop structure at the 3' end, which is believed to help stabilize mature transcripts (e.g., histone mRNA). Other lncRNAs, however, employ significantly more complex secondary structures.

[0051] lncRNAs have evolved a blueprint for nuclear localization, which appears to include at least two features: 1) nuclear localization signals and 2) mechanisms for non-standard 3' end processing to evade ribonuclease degradation, thereby increasing their stability. The prototype lncRNA exhibiting these two features is named MALAT1 (metastasis-associated lung adenocarcinoma transcript 1). Interestingly, the 3' end of MALAT1 is highly conserved across species and shows condensation into a triple helix structure after ribonuclease P recognizes and cleaves the tRNA-like structure (Wilutz et al., 2012. Genes and Development. 26:2392-2407). This triple helix is ​​believed to contribute to the stability of the MALAT1 transcript in nucleases.

[0052] As described herein, a 3' triple helix from human MALAT1 was added to a research RTM that targets primary RNA transcripts encoded by the CEP290 luciferase reporter or by the endogenous ABCA4 gene. In all cases, the presence of the 3' triple helix terminator significantly enhanced trans-splicing activity. This was initially demonstrated using a 117 bp truncated form of the 3' triple helix (designated Comp14, as described in Wilutz et al., 2012) and subsequently using the 151 bp native sequence (NCBI REFSEQ: NR_002819).

[0053] On the one hand, the compositions and methods described herein employ gene therapy using adeno-associated virus (AAV) as a means of treating hereditary genetic disorders. More specifically, the methods and compositions described herein employ pre-mRNA trans-splicing as a gene therapy, both in vitro and in vivo, to treat diseases caused by defects in large genes. In one embodiment, these compositions and methods overcome the problem caused by the packaging limitation of nucleic acids packaged into AAV to 4700 nucleotides. When including the sequence required to generate an effective rAAV therapeutic and express an RNA trans-splicing molecule (RTM), the effective size constraint for an RTM containing an eye gene sequence is approximately 4000 nucleotides. These methods and compositions are particularly suitable for treating diseases caused by defects in genes such as ABCA4, CEP290, and MYO7A that exceed the size required for incorporation and expression in AAV.

[0054] Unless otherwise defined, the technical and scientific terms used herein have the same meaning as commonly understood by one of ordinary skill in the art upon reference to the disclosed text, and these terms provide general guidance to those skilled in the art regarding the many terms used in this application. The definitions used herein are provided for clarity only and are not intended to limit the claimed invention.

[0055] When used here, "3' transcription terminator domain" or "3'TTD" designates a long non-coding RNA (lncRNA) located at the 3' end of a trans-splicing molecule. In some cases, the 3'TTD increases trans-splicing efficiency. In some cases, the transcription terminator domain includes an expression and nuclear retention element (ENE), which can form an ENE+A when aligned with an A-rich region (e.g., a poly-A tail).

[0056] As used herein, “long noncoding RNA” or “lncRNA” refers to a non-protein-coding RNA transcript that is longer than 200 nucleotides (e.g., longer than 300 nucleotides, longer than 400 nucleotides, or longer than 500 nucleotides). In some embodiments, lncRNA is 200 to 300 nucleotides, 300 to 400 nucleotides, 400 to 500 nucleotides, or longer than 500 nucleotides.

[0057] As used herein, the term "trans-splicing efficiency" refers to the amount of trans-spliced ​​RNA transcript produced by each trans-splicing molecule applied to a cell. Therefore, trans-splicing efficiency reflects the stability of trans-splicing molecules as well as their nuclear localization and retention.

[0058] As used herein, the terms “triple helix,” “triple helical structure,” and “triplex,” as well as their grammatical derivatives, are used interchangeably and refer to a polynucleotide (e.g., RNA) region characterized by a stacked Grand Groove triplet formed by Husstan base pairing. In some cases, a triple helix comprises multiple (e.g., four or more) consecutive nucleotides paired by Husstan base pairing. In some embodiments, the triple helix comprises four or more consecutive adenosine nucleotides, wherein each of the consecutive adenines is paired with uracil by Husstan base pairing (e.g., a poly-A region aligned with a U-rich motif, such as a U-rich motif in a stacked Grand Groove triplet).

[0059] As used in this article, the term “A-rich region” refers to a continuous nucleic acid chain in which at least 80% of the consecutive nucleic acids are adenine (A).

[0060] As used herein, the term “U-rich motif” refers to a continuous nucleic acid chain in which at least 80% of the continuous nucleic acid is uracil (U).

[0061] A “nucleic acid trans-splicing molecule” or “trans-splicing molecule” has three main elements: (a) a binding domain that confers specificity by tethering the trans-splicing molecule to its target gene (e.g., pre-mRNA); (b) a splicing domain (e.g., a splicing domain having a 3' or 5' splice site); and (c) a coding sequence configured for trans-splicing onto the target gene, which may replace one or more exons in the target gene (e.g., one or more mutated exons). A “pre-mRNA trans-splicing molecule” or “RTM” refers to a nucleic acid trans-splicing molecule that targets pre-mRNA. In some embodiments, a trans-splicing molecule, such as an RTM, may include cDNA, for example, as part of a functional exon to replace or correct mutated exons.

[0062] A nucleic acid is "operably linked" when it has a structural or functional relationship with another nucleic acid sequence. For example, if one nucleic acid sequence and another nucleic acid sequence are positioned relative to each other on the same continuous polynucleotide and have a structural or functional relationship, such as forming a triple helix (e.g., through Hussant base pairing), then the one nucleic acid sequence is operably linked to the other nucleic acid sequence. In some cases, the operably linked nucleic acid sequences are directly linked (i.e., the nucleic acid sequence is directly covalently linked to the other nucleic acid sequence without intercalating nucleotides). In other cases, the operably linked nucleic acid sequences are not directly linked. In cases where the operably linked nucleic acid sequences are not directly linked, these nucleic acid sequences are operably linked (indirectly linked) through adapter sequences. In some cases, the linker sequence can be 1-1,000 bases long (e.g., 1-900, 1-800, 1-700, 1-600, 1-500, 1-400, 1-300, 1-250, 1-200, 1-150, 1-100, 1-90, 1-80, 1-70, 1-60, 1-50, etc.). (1-40, 1-30, 1-20, 1-10, 1-8, 1-6, 1-5, 1-4, or 1-3 base lengths, e.g., 1-10, 10-15, 15-20, 20-30, 30-40, 40-50, 50-100, 100-150, 150-200, or 200-500 base lengths). In some cases, the A-rich region is operatively linked to the 3' end of the U-rich motif via a linker sequence.

[0063] As used herein, the terms "mammal subject" or "subject" include any mammal that requires these treatments or preventative measures, particularly humans. Other mammals requiring such treatments or preventative measures include dogs, cats or other domesticated animals, horses, livestock, laboratory animals, including non-human primates, etc. Subjects may be male or female.

[0064] In one embodiment, the subject develops a condition caused by a gene mutation or is at risk of developing a condition caused by a gene mutation. In one embodiment, the subject develops an eye condition or is at risk of developing an eye condition. In another embodiment, the subject exhibits clinical signs of an eye condition, particularly one related to a defect or mutation in the genes ABCA4, CEP290, or MYO7A.

[0065] The term "ocular condition" includes, but is not limited to, Staggart's disease (autosomal dominant or autosomal recessive), retinitis pigmentosa, rod-cone dystrophy, Leber's congenital amaurosis, Ussell's syndrome, Bardet-Biedl syndrome, Best disease, retinoschisis, untreated retinal detachment, pattern dystrophy, cone-rod dystrophy, achromatopsia, ocular albinism, enhanced S-cone syndrome, diabetic retinopathy, age-related macular degeneration, retinopathy of prematurity, sickle cell retinopathy, congenital stationary night blindness, glaucoma, or retinal vein occlusion. In another embodiment, the subject develops glaucoma, Leber's hereditary optic neuropathy, lysosomal storage disease, or peroxisome disease, or is at risk of developing these diseases.

[0066] Clinical signs of ocular diseases include, but are not limited to, decreased peripheral vision, decreased central (reading) vision, decreased night vision, loss of color perception, decreased visual acuity, decreased light sensitivity, and pigmentary changes. In another embodiment, the subject has been diagnosed with STGD1. In another embodiment, the subject has been diagnosed with juvenile paroxysmal macular degeneration, also known as xanthomas. In another embodiment, the subject has been diagnosed with cone-rod dystrophy. In another embodiment, the subject has been diagnosed with retinitis pigmentosa. In another embodiment, the subject has been diagnosed with age-related macular degeneration (AMD). In another embodiment, the subject has been diagnosed with LCA10. In yet another embodiment, the subject has not yet shown clinical signs of these ocular diseases.

[0067] As used herein, the term “treatment” or “treating” is defined as one or more of the following: reducing the occurrence or progression of an eye disease in a given subject; preventing the disease; reducing the severity of disease symptoms; or delaying its progression; removing disease symptoms; delaying the onset of the disease; or monitoring the progression of the disease or the efficacy of the treatment.

[0068] As used herein, the term "selected cell" refers to any cell or cell type to which RTM is delivered (i.e., the target of interest modified using the compositions and methods provided herein). In some embodiments, the selected cell is a prokaryotic cell. In other embodiments, the selected cell is a eukaryotic cell, non-limiting examples of which include plant cells and tissues, animal cells and tissues, and human cells and tissues. The cell may be derived from an existing cell line, or may be a primary cell, wherein "primary cell," "primary cell line," and "primary culture" are used interchangeably herein to mean cells and cell cultures derived from a subject and permitted to be grown in vitro to achieve a limited number of passages of the culture. Selected cells may be, for example, cancer cells, but are not limited thereto. In some embodiments, the selected cells are manipulated ex vivo and then administered to a subject. In still other embodiments, the selected cells serve as an in vivo target, for example, by delivering rAVV to the subject. In some embodiments, the term "selected cell" refers to ocular cells, which are any cells associated with eye function, such as photoreceptor cells. In some embodiments, the terminology refers to rods, cones, photosensitive ganglion cells, retinal pigment epithelium (RPE) cells, Mueller cells, bipolar cells, horizontal cells, or cells without long processes. Some gene targets are expressed in the eye and other organs. For example, CEP290 is expressed in the renal epithelium and the central nervous system, and MY07A is expressed in cochlear hair cells. Therefore, the selected cells may also include these extraocular cells. In some embodiments, the selected cells are skeletal muscle cells, such as red (slow) skeletal muscle cells, white (fast) skeletal muscle cells, or intermediate skeletal muscle cells. In some embodiments, the selected cells are cardiac muscle cells, such as cardiomyocytes or nodular cardiac muscle cells. In some embodiments, the selected cells are smooth muscle cells. In some embodiments, the selected cells are muscle satellite cells or muscle stem cells.

[0069] As used herein, the term "host cell" may refer to a packaging cell line in which recombinant AAV is produced from a plasmid. Alternatively, the term "host cell" may refer to a target cell from which the transgene is desired to be expressed.

[0070] Codon optimization refers to modifying a nucleic acid sequence to alter individual nucleic acids without causing any changes in the encoded amino acids. This procedure can be performed on any of the sequences described in this specification to enhance expression or stability. Codon optimization can be performed, for example, as described in U.S. Patent Nos. 7,561,972, 7,561,973, and 7,888,112, which are incorporated herein by reference, and transforms the sequence around the translation start site into a shared Kozak sequence. See Kozak et al., Nucleic Acids Res. 15(20):8125-8148, which is incorporated herein by reference. In one embodiment, the coding sequence undergoes codon optimization.

[0071] The term "homology" refers to the degree of identity between two nucleic acid sequences. Homology of homologous sequences is determined by comparing two sequences aligned within the compared sequences under optimal conditions. The sequences compared in this paper may have additions or deletions (e.g., gaps) in the two optimally aligned sequences. Homology of such sequences can be calculated by alignment using, for example, the ClustalW algorithm (Nucleic Acid Research, 22(22):4673 4680(1994). Commercially available sequence analysis software, specifically Vector NTI, GenenyX, BLAST, or analysis tools provided by public databases, can also be used.

[0072] The term "pharmaceutical acceptable" means that something is approved by a federal or state government regulatory agency or listed in the United States Pharmacopeia or other generally recognized pharmacopoeia for use in animals and more specifically in humans.

[0073] The term "carrier" refers to a diluent, adjuvant, excipient, or mediator that is applied together with a synthetic substance. Examples of suitable drug carriers are described in EW Martin's *Remington's Pharmaceutical Sciences*.

[0074] The term “a (species)” means one or more (species), and for example, “a gene” should be understood to mean one or more such genes. Therefore, the terms “a (species) (a / an),” “one (species) or more (species),” and “at least one (species)” are used interchangeably in this document.

[0075] Unless otherwise stated, as used herein, the term “about” means a variation of ±0.1 to 10% relative to a given reference value.

[0076] Regarding the following description, it is anticipated that each of the compositions described herein can be used in another embodiment of the therapeutic method described herein. Furthermore, it is also anticipated that each of the compositions described herein as being usable in the methods is itself an embodiment. Although the various embodiments in the specification are presented using the language of “comprising,” which includes other components or steps, in other instances, the relevant embodiments are also intended to be explained and described using the language of “consisting of…” or “substantially consisting of…”, which does not include any components or steps that would materially alter the embodiments.

[0077] Pre-mRNA trans-splicing methods and molecules

[0078] Pre-mRNA intermediates exist within cells, comprising non-coding nucleic acid sequences, i.e., introns, and nucleic acid sequences encoding amino acids that form the gene product. Introns are scattered among the exons of the gene in the pre-mRNA and are ultimately cleaved from the pre-mRNA molecule when the exons are joined together by a protein complex called the spliceosome. Using spliceosome activity, alternative exons can be introduced by introducing a second nucleic acid. Spliceosome-mediated RNA trans-splicing (SMaRT) is described using an engineered pre-mRNA trans-splicing molecule (RTM) that specifically binds to target pre-mRNA in the cell nucleus and triggers trans-splicing in a process mediated by the spliceosome. This method is described in, for example, Puttaraju M et al., 1999, *Nature Biotechnology*, 17:246-252; Gruber C et al., December 2013, *Molecular Oncology*, 7(6):1056; Avale ME, July 2013, *Human Molecular Genetics*, 22(13):2603-11; Rindt H et al., December 2012, *Cell Mol. Life Sciences*. Sci., 69(24):4191; U.S. Patent Application Publications Nos. 2006 / 0246422 and 20130059901, and U.S. Patents Nos. 6,083,702, 6,013,487, 6,280,978, 7,399,753, and 8,053,232. These documents are incorporated herein by reference.

[0079] The nucleic acid trans-splicing molecules disclosed herein may include any structural or functional features of nucleic acid trans-splicing molecules known in the art, as well as related methods, such as those described in WO 2017 / 087900 and WO 2019 / 2045114, each of which is incorporated herein by reference in its entirety.

[0080] In some embodiments, the RNA trans-splicing molecule (RTM) described herein has five main elements. In one embodiment, the elements comprise elements operatively linked in a 5' to 3' orientation:

[0081] (a) A coding domain (CD) containing one or more functional exons of a selected gene;

[0082] (b) A connector domain (LD) of different lengths and sequences, the LD acting as a structural connection between the coding domain and the binding domain, and may contain a motif that serves as a splicing enhancer; or have the ability to fold into a complex secondary structure that minimizes translation of the coding region before a trans-splicing event occurs; or encode a degradation peptide in the case of premature RTM maturation.

[0083] (c) Splice body identification motif (splicing donor, SD) configured for initiating splice body-mediated reverse splicing;

[0084] (d) A binding domain (BD) of different length and sequence configured for hybridization with a target intron of the selected gene, wherein the gene has at least one defect or mutation in the 5' exon of the target intron; and

[0085] (e) 3' transcription terminator domain (TTD) to increase the efficiency of trans-splicing.

[0086] The nucleic acid trans-splicing molecule is configured to trans-splice the coding domain to an endogenous exon of the selected gene adjacent to the target intron, thereby replacing the endogenous defective or mutated exon with the functional exon and correcting mutations in the selected gene.

[0087] In another embodiment, the element includes components operatively connected in a 5' to 3' orientation:

[0088] (a) is configured to bind the binding domain (BD) of a target intron of a selected gene, wherein the gene has at least one defect or mutation in the exon at the 3' end of the target intron;

[0089] (b) A connector sequence of different lengths and compositions, which acts as a structural connection between the binding domain and the coding region and contains a motif that serves as a splicing enhancer; or folds into a complex secondary structure that hinders translation of the coding region as a competing event for trans-splicing; or encodes a degradation peptide in the case of premature RTM maturation;

[0090] (c) 3' spliceosome recognition motif (splicleroid, SA) configured to mediate trans-splicing;

[0091] (d) A coding domain (CD) containing one or more functional exons of the selected gene; and

[0092] (e) 3' transcription terminator domain (TTD) to increase the efficiency of trans-splicing.

[0093] Encoded Structure Domain Sequence (CDS)

[0094] The coding domain of the RTM described herein includes the portion of the wild-type coding sequence intended to be trans-spliced ​​into the target pre-mRNA. "Wild-type coding sequence" means the sequence that provides the functional protein during translation and assembly. Expression or function need not be at the same level as the wild-type protein. In one embodiment, the wild-type coding sequence is modified, for example, through codon optimization.

[0095] A preRNA trans-splicing molecule (RTM) is configured to trans-splice the coding domain to an endogenous exon of the selected gene adjacent to the target intron, thereby replacing the endogenous defective or mutated exon with the functional exon and correcting mutations in the selected gene. Depending on the configuration of the RTM, the CDS may provide some or all of the exons of the selected gene at the 3' or 5' end of the binding domain. For example, for a 5' trans-splicing response, all or part of the exon at the 5' end of the BD is replaced. For a 3' trans-splicing response, all or part of the exon at the 3' end of the BD is replaced. The design of the RTM allows for the replacement of defective or mutated portions of one or more premRNA exons with a nucleic acid sequence, i.e., one or more exons having a normal sequence without defects or mutations. The "normal" sequence can be a naturally occurring wild-type sequence or a corrected sequence with some other modification that does not cause disease, such as a codon modification.

[0096] In one embodiment, the coding domain is a single exon of the target gene containing a normal wild-type sequence lacking the pathogenic mutation, such as exon 22 of ABCA4. In another embodiment, the coding domain comprises multiple exons containing multiple pathogenic mutations, such as exons 1-22 of ABCA4. Depending on the location of the exon to be corrected, the RTM may contain multiple exons located at the 5' or 3' end of the target gene, or the RTM may be designed to replace exons in the middle of the gene. For use and delivery in rAAV, the entire coding sequence of an eye gene cannot be used as the coding domain of an RTM unless this technique involves smaller eye genes less than 3000 nucleotides in length. As described herein, two RTMs, namely 3' and 5' RTMs, can be used in different rAAV particles to replace the entire large gene.

[0097] The RTMs described herein may contain coding domains encoding one or more exons identified herein and characterized by gene mutations or defects associated with the relevant disease. For example, exon 27 of ABCA4 could serve as the coding domain for an RTM designed to treat Sturgeon's disease. Tables 1 through 3 of this paper identify the target genes and the names of exons containing potentially pathogenic mutations.

[0098] In one embodiment, the coding domain of the 5' RTM is designed to replace an exon in the 5' portion of the target gene. In another embodiment, the coding domain of the 3' RTM is designed to replace an exon in the 3' portion of the gene. In yet another embodiment, the coding domain is one or more exons located within the gene and is situated within a double trans-splicing RTM.

[0099] Therefore, for example, there are three possible types of RTMs that can be used to treat diseases caused by defects in, for example, ABCA4: a 5' trans-splicing RTM including a 5' splice site. After trans-splicing, the 5' RTM becomes the 5' region of the target mRNA; a 3' RTM including a 3' splice site, which is used for trans-splicing and replaces the 3' region of the target mRNA; and a double trans-splicing RTM carrying multiple binding domains as well as 3' and 5' splice sites. After trans-splicing, this RTM replaces an inner exon in the processed target mRNA. In other embodiments, the coding domain may include an exon containing a naturally occurring or artificially introduced stop codon to reduce gene expression; or the RTM may contain other sequences that produce RNAi-like effects.

[0100] For the treatment of Sturge-Weber syndrome, the appropriate coding region for ABCA4 is exons 1-22 or 27-50 in an independent RTM. For the treatment of LCA10, the appropriate coding region for CEP290 is exons 1-26 or 27-54 in an independent RTM. For the treatment of Ussell syndrome, the appropriate coding region for MYO7A is exons 1-18 or 33-49 in an independent RTM.

[0101] Based on the teachings provided herein, those skilled in the art can construct other coding domains to replace all genes in the fragments provided by the 5'RTM and 3'RTM and / or double splicing RTM.

[0102] Connector structural domain (LD)

[0103] In some embodiments, the RTM described herein includes connector structural domains (LDs) of varying lengths and sequences, which act as structural connections between coding structural domains and binding structural domains. In one embodiment, the LD contains one or more motifs that function as splicing enhancers. In another embodiment, the LD provides one or more motifs capable of folding into complex secondary structures designed to minimize translation of the coding region prior to an inverse splicing event.

[0104] In one embodiment, the connector sequence is ccgaatacgacacgtagcaagatct.

[0105] Splice body identification motifs (splice donor (SD) and splice acceptor (SA))

[0106] Depending on the RTM (5' or 3') orientation, the RTM includes a splice identification motif, which is a splice donor (SD), a splice acceptor (SA), or both.

[0107] An intron always has two distinct nucleotides at each end. At the 5' end, the DNA nucleotide is GT [GU in pre-messenger RNA (pre-mRNA)]; at the 3' end, the DNA nucleotide is AG. These nucleotides form part of a splice site. SD is the splice site at the beginning of the intron, i.e., at the 5' left end of the intron, and is sometimes called the 5' splice site or 5'SS. SA is the splice site at the end of the intron, i.e., at the 3' right end of the intron, and is sometimes called the 3' splice site or 3'SS.

[0108]

[0109] In simple terms, the splice domain provides the essential shared motif that is recognized by the spliceosome. The use of BP and PPT follows the shared sequence required for the two phosphoryl transfer reactions involved in performing cis-splicing and, possibly, trans-splicing. In one embodiment, the branching point shared sequence in mammals is YNYURAC (Y = pyrimidine; N = any nucleotide). The underlined A is the branching site. The polypyrimidine region is located between the branching point and the splice site receptor and is crucial for the utilization of different branching points and the recognition of the 3' splice site. The shared sequences for the 5' splice donor site and the 3' splice region used in RNA splicing are well known in the art. Alternatively, modified shared sequences may be used that maintain their ability to function as 5' donor splice sites and 3' splice regions. In simple terms, in one embodiment, the 5' splice site shared sequence is the nucleic acid sequence AG / GURAGU (where / indicates the splice site). In another embodiment, an endogenous splice site corresponding to an exon near the splice site may be employed to maintain any splicing regulatory signals. In one embodiment, the ABCA4 5' RTM uses an endogenous intron 22 5' splice site, the RTM containing a sequence encoding exons 1-22 as a coding region and a binding domain complementary to a region in intron 22. In another embodiment, the ABCA4 3' RTM uses an endogenous intron 26 3' splice site, the RTM encoding exons 27-50 and having a binding domain complementary to intron 26.

[0110] In one embodiment, a suitable 5' splice site with a spacer is: 5'-GTA AGA GAG CTC GTTGCG ATA TTA T-3' SEQ ID NO:1. In another embodiment, a suitable 5' splice site is AGGT.

[0111] In one embodiment, the suitable 3' RTM BP is 5'-TACTAAC-3' (SEQ ID NO:2). In one embodiment, the suitable 3' splice site is: 5'-TAC TAA CTG GTA CCT CTT CTT TTT TTT CTG CAG-3' SEQ ID NO:2 or 5'-CAGGT-3' (SEQ ID NO:4). In one embodiment, the suitable 3' RTM PPT is 5'-TGG TAC CTCTTC TTT TTT TTC TG-3' SEQ ID NO:5.

[0112] Combined structural domain (BD)

[0113] RTMs include binding domains (BDs) of varying lengths and sequences configured to hybridize with target introns of selected genes. In one embodiment, the binding domain is a nucleic acid sequence complementary to the target pre-mRNA sequence to inhibit endogenous target cis-splicing while enhancing trans-splicing between the trans-splicing molecule and the target pre-mRNA, for example, to produce a chimeric molecule having a portion of the endogenous mRNA and a coding domain containing one or more functional exons. In some embodiments, the binding domain is antisense oriented relative to the target intron sequence.

[0114] 5' trans-splicing molecules typically bind to the target intron at the 3' end of the mutation, while 3' trans-splicing molecules typically bind to the target intron at the 5' end of the mutation. In one embodiment, the binding domain comprises a portion of a sequence complementary to the target intron. In one embodiment herein, the binding domain is a nucleic acid sequence complementary to the intron of the closest (i.e., neighboring) corrected exon sequence.

[0115] In another embodiment, the binding domain is targeted to an intron sequence very close to the 3' or 5' splice signal of the target intron. In yet another embodiment, the binding domain sequence may bind to a portion of the target intron and an adjacent exon.

[0116] Therefore, in some cases, binding domains specifically bind to the mutated endogenous target pre-mRNA to anchor the coding domain of the trans-splicing molecule to the pre-mRNA, thereby allowing trans-splicing to occur at the correct location in the target gene. Subsequently, the spliceosome processing mechanism in the cell nucleus can mediate successful trans-splicing of the corrective exon against the pathogenic mutated exon.

[0117] In some embodiments, the trans-splicing molecule is characterized by having a binding domain on the pre-target mRNA that binds to sequences at more than one site. The binding domain may contain multiple nucleotides required to stably bind to the pre-target mRNA to allow trans-splicing with the coding domain. In one embodiment, the binding domain is selected using mFOLD structure analysis targeting accessible loops (Zuker, Nucleic Acid Research, 2003, 31(13):3406-3415).

[0118] The suitable length of the target-binding domain can be 10 to 500 nucleotides. In some embodiments, the length of the binding domain is 20 to 400 nucleotides. In some embodiments, the length of the binding domain is 50 to 300 nucleotides. In some embodiments, the length of the binding domain is 100 to 200 nucleotides. In some embodiments, the binding domain is 10-20 nucleotides long (e.g., 10, 11, 12, 13, 14, 15, 16, 17, 18, 19, or 20 nucleotides long), 20-30 nucleotides long (e.g., 20, 21, 22, 23, 24, 25, 26, 27, 28, 29, or 30 nucleotides long), 30-40 nucleotides long (e.g., 30, 31, 32, 33, 34, 35, 36, 37, 38, 39, or 40 nucleotides long), or 40-50 nucleotides long (e.g., 40, 41, 42, 43, 44, 45, 46, 47, 48, 49, or 50 nucleotides long). (Acid length), 50-60 nucleotides long (e.g., 50, 51, 52, 53, 54, 55, 56, 57, 58, 59 or 60 nucleotides long), 60-70 nucleotides long (e.g., 60, 61, 62, 63, 64, 65, 66, 67, 68, 69 or 70 nucleotides long), 70-80 nucleotides long (e.g., 70, 71, 72, 73, 74, 75, 76, 77, 78, 79 or 80 nucleotides long), 80-90 nucleotides long (e.g., 80, 81, 82, 83, 84, 85, 86, 87, 88, 89 or 90 nucleotides long), 90-100 nucleotides long Nucleotide length (e.g., 90, 91, 92, 93, 94, 95, 96, 97, 98, 99, or 100 nucleotides), 100-110 nucleotides long (e.g., 100, 101, 102, 103, 104, 105, 106, 107, 108, 109, or 110 nucleotides long), 110-120 nucleotides long (e.g., 110, 111, 112, 113, 114, 115, 116, 117, 118, 119, or 120 nucleotides long), 120-130 nucleotides long (e.g., 120, 121, 122, 123, 124, 125, 12...). 6, 127, 128, 129, or 130 nucleotides long; 130-140 nucleotides long (e.g., 130, 131, 132, 133, 134, 135, 136, 137, 138, 139, or 140 nucleotides long); 140-150 nucleotides long (e.g., 140, 141, 142, 143, 144, 145, 146, 147, 148, 149, or 150 nucleotides long); 150-160 nucleotides long (e.g., 150, 151, 152, 153, 154, 155, 156, 157, 158, 159, or 160 nucleotides long).160-170 nucleotides long (e.g., 160, 161, 162, 163, 164, 165, 166, 167, 168, 169, or 170 nucleotides long), 170-180 nucleotides long (e.g., 170, 171, 172, 173, 174, 175, 176, 177, 178, 179, or 180 nucleotides long), 180-190 nucleotides long (e.g., 180, 181, 182, 183, 184, 185, 186, 187, 188, 189, or 190 nucleotides long), 190-200 nucleotides long (e.g., 190, 191, 192...). The length of the binding domain can be 193, 194, 195, 196, 197, 198, 199, or 200 nucleotides, 200-210 nucleotides, 210-220 nucleotides, 220-230 nucleotides, 230-240 nucleotides, 240-250 nucleotides, 250-260 nucleotides, 260-270 nucleotides, 270-280 nucleotides, 280-290 nucleotides, 290-300 nucleotides, 300-350 nucleotides, 350-400 nucleotides, 400-450 nucleotides, or 450-500 nucleotides. In some embodiments, the binding domain is about 150 nucleotides long. In another embodiment, the target binding domain may comprise a nucleic acid sequence with a length of up to 750 nucleotides. In another embodiment, the target-binding domain may include a nucleic acid sequence of up to 1000 nucleotides in length. In another embodiment, the target-binding domain may include a nucleic acid sequence of up to 2000 nucleotides or more in length.

[0119] In some embodiments, increasing the length of the target-binding domain can increase the specificity of the trans-splicing molecule. Other lengths may also be used depending on the lengths of other components in the trans-splicing molecule.

[0120] The binding domain can be 80% to 100% complementary to the target intron in order to stably hybridize with the target intron. For example, in some embodiments, the binding domain has 80%, 81%, 82%, 83%, 84%, 85%, 86%, 87%, 88%, 89%, 90%, 91%, 92%, 93%, 94%, 95%, 96%, 97%, 98%, 99%, or 100% complementarity with the target intron. The degree of complementarity is selected by those skilled in the art based on the requirement to keep the trans-splicing molecule and the nucleic acid construct containing the desired sequence expressed and included in rAAV within a limit of 3,000 or at most 4,000 nucleotide bases. This choice of sequence and hybridization strength depends on the complementarity and length of the nucleic acid.

[0121] In one embodiment, BD targets intron 23, namely motif 81 of ABCA4. In one embodiment, the sequence is: SEQ ID NO:6: TCACTGTTTAATCTGTTAATTCATCTGAGCATTTTGAGGGTG TAGTCGCTTGATTTTATCCTAGAGAGTGTGTGAGTCACACACAGAGAGGAGCAGAA CCTCCAAGGGTCCCTTTGGCTTGTCATCAATTATGTGGCAGCTGTAGGTTCT.

[0122] 3' Transcription Terminator Domain (TTD)

[0123] The RTM described herein contains a 3' transcription terminator domain (TTD), such as a 3' TTD that increases the efficiency of trans-splicing. In one embodiment, the TTD comprises one or more of the following sequences: a sequence involved in forming a triple helix (also referred to herein as a "triple helix" or "triple helical structure"), a ribonuclease P cleavage site, an tRNA-like structure (also referred to herein as an tRNA-like domain, structure, or sequence) that serves as a template for ribonuclease P cleavage, and any side-connection sequences that facilitate the folding of these domains independently or together. Such side-connection sequences may be artificial adapters, adapters derived from another sequence, or side-connection sequences derived from the original lncRNA. In one embodiment, the 3' transcription terminator domain forms a triple helix structure that effectively caps or protects the 3' end from nuclease degradation. As discussed herein, the tRNA-like domain may also include a ribonuclease P cleavage site.

[0124] Long non-coding RNAs (lncRNAs) act as important regulatory mediators in gene expression. Some lncRNAs have been shown to possess a 3' end resulting from the non-standard recognition and cleavage of tRNA-like structures by ribonuclease P. In some cases, highly conserved triple-helix structures have been shown to protect some lncRNAs from 3'-5' endonucleases. As provided herein, the 3' end sequence of certain lncRNAs can be incorporated into the RTM as a terminal domain (TTD), thereby increasing the efficiency of trans-splicing. In one embodiment, the TTD is a sequence from one or more long non-coding RNAs (lncRNAs) or other nuclear RNA molecules containing a 3' transcription terminator, said sequence condensed into a triple-helix 3' cap. In one embodiment, the TTD sequence is derived from human long non-coding RNA MALAT1. In another embodiment, the TTD sequence is derived from human lncRNA MENβ. In one embodiment, the TTD comprises nucleotides 8287-8437 of human MALAT1 (SEQ ID NO:7). In another embodiment, the TTD comprises, in 5' to 3' order: a triplet-forming sequence comprising nucleotides 8287-8379 of SEQ ID NO:7; a ribonuclease P cleavage site comprising nucleotides 8379-8380 of SEQ ID NO:7; and a tRNA-like sequence comprising nucleotides 8380-8437 of SEQ ID NO:7.

[0125] In some embodiments, the 3'TTD comprises a 5' U-rich motif, a stem-loop motif, a 3' U-rich motif, and an A-rich region (e.g., a poly-A tail) in a 5' to 3' orientation (directly or indirectly connected). In some cases, the A-rich region is capable of Husstan base pairing with the 5' U-rich motif. In some embodiments, one or two stem chains are about 8-20 base pairs long (e.g., 9-16, 10-14, or 11-23 base pairs long). In some embodiments, the 5' U-rich motif and the 3' U-rich motif each contain at least five consecutive uracils. In some embodiments, the 5' U-rich motif and the 3' U-rich motif are each 5-15 base pairs long.

[0126] In some embodiments, the 3'TTD comprises, in the 5' to 3' orientation: a 5' U-rich motif comprising five consecutive uracils, a stem-loop motif with a stem chain length of about 16 base pairs, a 3' U-rich motif comprising five consecutive uracils, and an A-rich region comprising at least 18 adenines. In some embodiments, the 3'TTD comprises SEQ ID NO:14. In some embodiments, the 3'TTD comprises SEQ ID NO:13.

[0127] In some embodiments, the 3'TTD comprises, in the 5' to 3' direction: a 5' U-rich motif comprising SEQ ID NO:18, a stem-loop motif with at least one stem chain of about 13 nucleotides in length, a 3' U-rich motif comprising SEQ ID NO:19, and an A-rich region comprising SEQ ID NO:20. In some embodiments, the 3'TTD comprises SEQ ID NO:16. In some embodiments, the 3'TTD comprises SEQ ID NO:15.

[0128] In some embodiments, the 3'TTD includes SEQ ID NO:18, SEQ ID NO:19, and SEQ ID NO:20 in the 5' to 3' direction. In some embodiments, the 3'TTD includes SEQ ID NO:17.

[0129] In some embodiments, the 3'TTD comprises, in the 5' to 3' direction: a 5' U-rich motif comprising SEQ ID NO:23, a stem-loop motif with at least one stem chain of about 13 nucleotides in length, a 3' U-rich motif comprising SEQ ID NO:24, and an A-rich region comprising SEQ ID NO:25. In some embodiments, the 3'TTD comprises SEQ ID NO:24. In some embodiments, the 3'TTD comprises SEQ ID NO:23.

[0130] In some embodiments, the length of the 3'TTD is between 200 and 1000 nucleotides (e.g., its length is 200 to 900, 200 to 800, 200 to 700, 200 to 600, 200 to 500, 200 to 400, or 200 to 300 nucleotides).

[0131] Trichain formation structure

[0132] In one embodiment, the triple helix structure is formed by an A-rich motif (e.g., an A-rich region) and two upstream (e.g., 5') U-rich motifs and a stem-loop structure. As illustrated herein, these sequences are evolutionarily highly conserved in metastasis-associated lung adenocarcinoma transcript 1 (MALAT1), i.e., in certain cancer-associated lncRNAs. Similar highly conserved A-rich and U-rich motifs exist at the 3' end of the MENβ long nuclear noncoding RNA, also known as NEAT1_2, whose 3' end is also processed by ribonuclease P. It has been shown that the formation of these highly conserved A-rich and U-rich motifs is crucial for protecting the 3' end of MALAT1 from 3'-5' exonucleases in the triple helix structure.

[0133] Multiple triple helices can be used to engineer any of the constructs described in this paper. Such triple helices include ENE+A, riboswitch, and telomerase triple helices (see, for example, Brown et al., Nature Structural and Molecular Biology 21, 633-642, 2014, which is incorporated herein by reference). For example, human MALAT1 (Brown et al., *Nature Structural & Molecular Biology*, 7, 633-40, 2014.), KSHV PAN (Mitton-Fry et al., *Science*, 330, 1244-7, 2010), human MENβ (Brown et al., *Proceedings of the National Academy of Sciences of the United States of America*, 109, 19202-7, 2012), *Acanthamoeba polyphaga mimivirus* (Tycowski et al., *Cell Reports*, 2, 26-32, 2012), and *Cotesia congregata* virus have been described. The ENE+A triple helixes of the following viruses: bracovirus (Tycowski et al., Cell Reports, 2, 26-32, 2012), Cotesia sesamiae bracovirus (Tycowski et al., Cell Reports, 2, 26-32, 2012), EHV2 (Tycowski et al., Cell Reports, 2, 26-32, 2012), Plautia stali enterovirus (PSIV) (Tycowski et al., Cell Reports, 2, 26-32, 2012), and Rhesus monkey leptovirus PAN (RRV) (Tycowski et al., Cell Reports, 2, 26-32, 2012). Other exemplary triple helices include riboswitching triple helices, which have been described with respect to the PreQ1-II riboswitches from *Lactobacillales rhamnosus* (Liberman et al., *Nature Chemical Biology*, 9, 353-5, 2013) and the SAM-II riboswitches found in the metagenomics of the Sargasso Sea (Gilbert et al., *Nature Structural & Molecular Biology*, 15, 177-82, 2008).In yet another instance, the telomerase triple helix of humans (Theimer et al., Molecular and Cellular Proteomics, 17, 671-82, 2005) and Kluyveromyces lactis (Cash et al., Proceedings of the National Academy of Sciences, 110, 10970-5, 2013) has been described.

[0134] In one embodiment, the RTM contains a triplet-forming sequence comprising a U-rich motif 1 (e.g., a 5' U-rich motif), a conserved stem-loop, a U-rich motif 2 (e.g., a 3' U-rich motif), and an A-rich region (e.g., as part of a poly-A tail), wherein the A-rich region forms a Watson-Crick stem duplex with the U-rich motif 2, and the U-rich motif 1 aligns with the A-rich region to form a Husstan base pair. (Buske et al., 2012; Beal and Dervan, 1991), which are incorporated herein by reference. In one embodiment, the sequence is derived from human MALAT1. Therefore, in one embodiment, the RTM contains a triplet-forming sequence comprising a U-rich motif 1 (8292-8301 of human MALAT1), a conserved stem-loop (8302-8333 of human MALAT1), a U-rich motif 2 (8334-8343 of human MALAT1), and an A-rich region (8369-8379 of human MALAT1), wherein the A-rich region forms a Watson-Crick stem duplex with the U-rich motif 2, and the U-rich motif 1 aligns with the A-rich region to form a Husstan base pair.

[0135] In another embodiment, the 3' TTD described herein has a novel design obtained through theoretical modeling and / or by extending naturally occurring sequences. In one embodiment, the TTD comprises, in 5' to 3' order: a triplet-forming sequence of varying lengths and compositions, a ribonuclease P cleavage site, and an tRNA-like sequence of varying lengths and compositions. In one embodiment, the triplet formation sequence conforms to one of three known basic “motifs” and is identified by the base composition of the third strand of the triple helix: pyrimidine motif (T, C), purine motif (G, A), and purine-pyrimidine motif (G, T) (Buske FA, Bauer DC, Mattick JS, Bailey TL. 2012. Triplexator: Detecting nucleic acid triple helices in genomic and transcriptomic data., Genome Research 22:1372-1382; Beal PA, Dervan PB. 1991. Second structural motif for recognition of DNA by oligonucleotide-directed triple-helix formation. Science 251:1360-1363, both of which are incorporated herein by reference).

[0136] In another embodiment, the TTD is a truncated form of the human MALAT1 triple helix. In one embodiment, the TTD contains a triplet-forming sequence comprising a deletion of U-rich motif 1 (8292-8301 of human MALAT1), a conserved stem-loop (8302-8310 and 8325-8333 of human MALAT1), a U-rich motif 2 (8334-8343 of human MALAT1), an A-rich region (8369-8379 of human MALAT1), and an intercalation sequence of nucleotides 8345-8364 of human MALAT1 spanning between the U-rich motif 2 and the A-rich region, wherein the A-rich region forms a Watson-Crick stem duplex with the U-rich motif 2, and the U-rich motif 1 aligns with the A-rich region to form a Hustan base pair.

[0137] In one embodiment, the triple helix structure is derived from lncRNA. In another embodiment, the triple helix structure is derived from MALAT1. Because the MALAT1 sequence is evolutionarily highly conserved, it can originate from any species. In one embodiment, the MALAT1 sequence is from a human. In another embodiment, the MALAT1 sequence is from a mouse. In another embodiment, the MALAT1 sequence is from a non-human primate. In another embodiment, the MALAT1 sequence is from a dog. In another embodiment, the MALAT1 sequence is from an elephant. In another embodiment, the MALAT1 sequence is from an opossum. In another embodiment, the MALAT1 sequence is from a fish. Such sequences are known in the art and are available, for example, in GenBank. In one embodiment, the MALAT1 sequence is SEQ ID NO:7.

[0138] In another embodiment, the triple helix sequence is provided as a truncated or modified form of the natural sequence, as long as the sequence retains the ability to fold into the desired triple helix structure.

[0139] In one embodiment, the triple helix structure is derived from MENβ. The MENβ sequence can originate from any species. In one embodiment, the MENβ sequence is from a human. In another embodiment, the MENβ sequence is from a mouse. In another embodiment, the MENβ sequence is from a non-human primate. In another embodiment, the MENβ sequence is from a dog. In another embodiment, the MENβ sequence is from an elephant. In another embodiment, the MENβ sequence is from an opossum. In another embodiment, the MENβ sequence is from a fish. Such sequences are known in the art and are available, for example, in GenBank.

[0140] In another embodiment, the triple helix sequence is provided as a truncated or modified form of the natural sequence, as long as the sequence retains the ability to fold into the desired triple helix structure. In one embodiment, the MENβ sequence is SEQ ID NO:8.

[0141] In some embodiments, the triple helix comprises four to 100 consecutive adenosines paired via Hussant base pairing (e.g., four to 80 consecutive adenosines paired via Hussant base pairing, four to 60 consecutive adenosines paired via Hussant base pairing, four to 50 consecutive adenosines paired via Hussant base pairing, four to 40 consecutive adenosines paired via Hussant base pairing, four to 30 consecutive adenosines paired via Hussant base pairing, four to 20 consecutive adenosines paired via Hussant base pairing, four to 18 consecutive adenosines paired via Hussant base pairing, four to 15 consecutive adenosines paired via Hussant base pairing, four...). Continuous adenosines with up to 12 pairs of Hussant bases, 4 to 11 pairs of Hussant bases, 4 to 10 pairs of Hussant bases, 4 to 9 pairs of Hussant bases, 4 to 8 pairs of Hussant bases, 4 to 7 pairs of Hussant bases, or 4 to 6 pairs of Hussant bases, for example, 5 to 50 pairs of Hussant bases, 5 to 40 pairs of Hussant bases, and 5 to 30 pairs of Hussant bases. Continuous adenosine, five to 20 consecutive adenosines paired via Hussant base pairing, five to 18 consecutive adenosines paired via Hussant base pairing, five to 15 consecutive adenosines paired via Hussant base pairing, five to 12 consecutive adenosines paired via Hussant base pairing, five to 10 consecutive adenosines paired via Hussant base pairing, five to nine consecutive adenosines paired via Hussant base pairing, five to eight consecutive adenosines paired via Hussant base pairing, five to seven consecutive adenosines paired via Hussant base pairing, or five to six consecutive adenosines paired via Hussant base pairing, for example, six to eight consecutive adenosines paired via Hussant base pairing. Paired consecutive adenosines, consecutive adenosines of eight to ten pairs paired via Husstan base pairing, consecutive adenosines of ten to twelve pairs paired via Husstan base pairing, consecutive adenosines of twelve to fourteen pairs paired via Husstan base pairing, consecutive adenosines of fourteen to sixteen pairs paired via Husstan base pairing, consecutive adenosines of sixteen to eighteen pairs paired via Husstan base pairing, consecutive adenosines of eighteen to twenty pairs paired via Husstan base pairing, consecutive adenosines of twenty to thirty pairs paired via Husstan base pairing, consecutive adenosines of thirty to forty pairs paired via Husstan base pairing, or consecutive adenosines of forty to fifty pairs paired via Husstan base pairing.

[0142] In some embodiments, the triple helix comprises a continuous chain of nucleotides, wherein at least 90% of the nucleotides are paired via Husstan base pairing (e.g., at least 90% of the nucleotides are paired via Husstan base pairing, at least 91% of the nucleotides are paired via Husstan base pairing, at least 92% of the nucleotides are paired via Husstan base pairing, at least 93% of the nucleotides are paired via Husstan base pairing, at least 94% of the nucleotides are paired via Husstan base pairing, at least 95% of the nucleotides are paired via Husstan base pairing, at least 96% of the nucleotides are paired via Husstan base pairing, at least 97% of the nucleotides are paired via Husstan base pairing, at least 98% of the nucleotides are paired via Husstan base pairing, at least 99% of the nucleotides are paired via Husstan base pairing, or 100% of the nucleotides are paired via Husstan base pairing).

[0143] Domain 2-tRNA-like structure

[0144] The tRNA-like structures described herein are sequences that form tRNA-like clover secondary structures, enabling them to be recognized by one or more of ribonuclease P, ribonuclease Z, and CCA-adding enzymes.

[0145] The tRNA-like structure of MALAT1 is called mascRNA (MALAT1-associated small cytoplasmic RNA). This sequence is 61 nt long and is shown in SEQ ID NO:9. The tRNA-like structure of mascRNA has been preserved through evolution because four mismatches between mouse and human orthologs maintain a cloverleaf secondary structure. Although structurally similar to tRNA and containing a relatively conserved B box, the 61 nt mascRNA transcript is smaller than most tRNAs (approximately 76 nt) and has a relatively weakly conserved small anticodon loop. Wilusz et al., Cell, 2008 Nov 28; 135(5):919-932, are incorporated herein by reference. The tRNA-like structure of MENβ is called menRNA. Zhang et al., 2017, Cell Reports 19, 1723-1738, are incorporated herein by reference.

[0146] In one embodiment, the tRNA-like structure is derived from lncRNA. In another embodiment, the tRNA-like structure is derived from MALAT1. Because the MALAT1 sequence is evolutionarily highly conserved, it can originate from any species. In one embodiment, the MALAT1 sequence is from a human. In another embodiment, the MALAT1 sequence is from a mouse. In another embodiment, the MALAT1 sequence is from a non-human primate. In another embodiment, the MALAT1 sequence is from a dog. In another embodiment, the MALAT1 sequence is from an elephant. In another embodiment, the MALAT1 sequence is from an opossum. In another embodiment, the MALAT1 sequence is from a fish. Such sequences are known in the art and are available, for example, in GenBank.

[0147] In another embodiment, the tRNA-like sequence is provided as a truncated or modified form of the natural sequence, as long as the sequence retains the ability to fold into the desired tRNA-like structure.

[0148] In one embodiment, the tRNA-like structure is derived from MENβ. The MENβ sequence can be from any species. In one embodiment, the MENβ sequence is from a human. In another embodiment, the MENβ sequence is from a mouse. In another embodiment, the MENβ sequence is from a non-human primate. In another embodiment, the MENβ sequence is from a dog. In another embodiment, the MENβ sequence is from an elephant. In another embodiment, the MENβ sequence is from an opossum. In another embodiment, the MENβ sequence is from a fish. Such sequences are known in the art and are available, for example, in GenBank.

[0149] In another embodiment, the tRNA-like sequence is provided as a truncated or modified form of the natural sequence, as long as the sequence retains the ability to fold into the desired tRNA-like structure.

[0150] The components of a TTD can be derived from the same or different lncRNAs, including lncRNA homologs from different species. For example, the triple-helix domain and tRNA-like domain can be derived from the same long non-coding RNA or different combinations of long non-coding RNA domains from humans or any other species. In one embodiment, the triple-helix domain and tRNA-like domain are derived from MALAT1 or NEAT1 / MENβ.

[0151] target genes

[0152] A target gene is a gene containing one or more defects or mutations that cause eye diseases. In one embodiment described herein, the target gene is a mammalian gene with a defect known to cause disease or condition.

[0153] Wild-type sequences of genes and their encoded proteins and / or genomic and chromosomal sequences are obtained from publicly available databases, and their registry numbers are provided herein. In addition to these publicly available sequences, all subsequently obtained corrected or naturally occurring conserved and non-pathogenic variant sequences found in human or other mammalian populations are included. Furthermore, those with conserved nucleotide substitutions or those causing codon optimization are also included. Homologous sequences in the same or another mammalian organism can also be searched using the sequences provided with the database registry numbers.

[0154] The target eye nucleic acid sequences identified herein and the resulting protein truncated or amino acid fragments are expected to allow for certain minor modifications at the nucleic acid level, including, for example, modifications to silent nucleotide bases, such as codon preferences. In other embodiments, amino acid alterations, such as nucleic acid base modifications to improve the expression of the resulting peptide / protein, are anticipated. Allelic variations resulting from the natural degeneracy of the genetic code are also included as possible modifications to the fragments.

[0155] This also includes analogs or modifications of the protein fragments encoded herein as modifications of selected genes. Typically, these analogs differ from proteins that are specifically identified by only one to four codon changes. Conserved substitutions are those that occur within a series of amino acids that are relevant in terms of side chain and chemical properties.

[0156] The nucleic acid sequence encoding the normal gene can be derived from any mammal that naturally expresses the gene or its homologs. In another embodiment, the gene sequence is derived from the same mammal intended to be treated with the composition. In another embodiment, the gene sequence is derived from a human. In other embodiments, the gene sequence is modified to enhance expression in target cells. Such modifications include codon optimization.

[0157] In one embodiment, the gene is ABCA4, which is indicated in Staggart's disease. The genomic sequence of the DNA of this gene is available at the NCBI reference sequence (135313 bp) NG_009073.1 for chromosome 1. The mRNA and exon positions of the gene are indicated in the NCBI report. The DNA sequence of ABCA4 is provided at NCBI reference sequence: NM_000350.2. The amino acid sequence is provided at NCBI reference sequence: NP000341.2.

[0158] In another embodiment, the gene is CEP290. Leber congenital amaurosis encompasses a group of early-onset childhood retinal dystrophys characterized by vision loss, nystagmus, and severe retinal dysfunction. Patients typically present with severe vision loss and pendulum-like nystagmus at birth. Electroretinography (ERG) responses are often unrecordable. Other clinical findings may include high hyperopia, photophobia, ocular finger signs, keratoconus, cataracts, and variable fundus appearance. LCA10 is caused by a mutation in the CEP290 gene on chromosome 12q21 and can account for up to 21% of LCA cases. Mutations in CEP290 can also cause extraocular findings, including renal and CNS abnormalities, and thus can lead to a variety of syndromes (Senior Loken syndrome, Joubert syndrome, Badit-Beidow syndrome).

[0159] The genomic sequence of the DNA of this gene is available at NCBI reference sequence NC_000012.12 on chromosome 12 from nt.88049013-88142216 (93,204 bp). The mRNA and exons are identified in the NCBI report. The DNA sequence of CEP290 is provided at NCBI reference sequence: NM_025114.3. The amino acid sequence is provided at NCBI reference sequence: NP0789390.3. The mRNA contains 54 exons and 59 introns (caused by substitutional splicing). Many mutations in CEP290 and their locations in the nucleotide sequence are known.

[0160] In another embodiment, the gene is MYO7A. Mutations in this gene are associated with Ussell's syndrome. Ussell's syndrome is a disorder characterized by hearing loss and progressive vision loss. The vision loss is caused by an eye disease called retinitis pigmentosa (RP), which affects the photosensitive layer of the retina. Vision loss occurs as the photosensitive cells of the retina gradually degenerate. Over time, these blind spots enlarge and merge, resulting in tunneling vision. In some cases of Ussell's syndrome, vision is further impaired by clouding of the lens of the eye (cataracts). However, many people with retinitis pigmentosa retain some central vision throughout their lives. Hearing loss is caused by a disease in the cochlear hair cells, which also gradually degenerate. Type I Ussell's syndrome can be caused by mutations in the CDH23, MYO7A, PCDH15, USH1C, or USH1G genes.

[0161] More than 250 mutations in the MYO7A gene have been identified in individuals with Usère's syndrome type 1B. Many of these genetic changes alter single protein building blocks (amino acids) in critical regions of the myosin VIIA protein. Other mutations introduce premature termination signals in the myosin VIIA protein instruction, resulting in an abnormally small form of this protein. Some mutations insert or delete small amounts of DNA into the MYO7A gene, thereby altering the protein. All these changes lead to the production of nonfunctional myosin VIIA protein, which adversely affects the development and function of cells in the inner ear and retina, thus causing Usère's syndrome.

[0162] The genomic sequence of the DNA for this gene is available on chromosome 11 at NCBI reference sequence NC_000011.9 from nt. 77,128,255 to 77,215,240 (86,986 bp). The DNA sequence for MYO7A is available at NCBI reference sequence: NM_000260.3. The amino acid sequence is available at NCBI reference sequence: NP 000251.1. The DNA sequence, amino acid sequence, exon sequence, and intron sequence of MYO7A are available online at https: / / grenada.lumc.nl / LOVD2 / Usher_montpellier / refseq / MYO7A_codingDNA.html, last modified on February 17, 2010. The mRNA contains 49 exons and 61 introns. Many mutations in MYO7A are available in the CCHMC Molecular Genetics Laboratory Mutation Database, LOVD v.2.0.

[0163] RTM target gene coding sequence

[0164] In one embodiment, the coding domain is a single exon of the target gene containing a normal wild-type sequence lacking the pathogenic mutation, such as exon 27 of ABCA4. In another embodiment, the coding domain comprises multiple exons containing multiple pathogenic mutations, such as exons 1-22 of ABCA4. Depending on the location of the exon to be corrected, the RTM may contain multiple exons located at the 5' or 3' end of the target gene, or the RTM may be designed to replace exons in the middle of the gene. For use and delivery in rAAV, the entire coding sequence of the gene cannot be used as the coding domain of the RTM unless this technique involves small genes less than 3000 nucleotides in length. As described herein, two RTMs, namely 3' and 5' RTMs, can be used in different rAAV particles to replace the entire large gene.

[0165] In one embodiment, the coding domain of the 5' RTM is designed to replace an exon in the 5' portion of the target gene. In another embodiment, the coding domain of the 3' RTM is designed to replace an exon in the 3' portion of the gene. In yet another embodiment, the coding domain is one or more exons located within the gene and is situated within a double trans-splicing RTM.

[0166] Therefore, for example, there are three possible types of RTMs that can be used to treat diseases caused by defects in, for example, ABCA4: a 5' trans-splicing RTM including a 5' splice site. After trans-splicing, the 5' RTM becomes the 5' region of the target mRNA; a 3' RTM including a 3' splice site, which is used for trans-splicing and replaces the 3' region of the target mRNA; and a double trans-splicing RTM carrying multiple binding domains as well as 3' and 5' splice sites. After trans-splicing, this RTM replaces an inner exon in the processed target mRNA. In other embodiments, the coding domain may include an exon containing a naturally occurring or artificially introduced stop codon to reduce gene expression; or the RTM may contain other sequences that produce RNAi-like effects.

[0167] For the treatment of Sturge-Weber syndrome, the appropriate coding region for ABCA4 is exons 1-22 or 27-50 in an independent RTM. For the treatment of LCA10, the appropriate coding region for CEP290 is exons 1-26 or 27-54 in an independent RTM. For the treatment of Ussell syndrome, the appropriate coding region for MYO7A is exons 1-18 or 33-49 in an independent RTM.

[0168] Optional components or modifications of RTM

[0169] Optional spacers can be used to separate the splicing domains and target-binding domains in the RTM. The spacer region can be designed to include features such as (i) a stop codon to block translation of any unspliced ​​RTM and / or (ii) a sequence that enhances trans-splicing with the target pre-mRNA. Depending on the length of other components in the RTM and rAAV restrictions, the spacer can be between 3 and 25 nucleotides or more. In one embodiment, a suitable 5' RTM spacer is AGA TCT CGT TGC GATATT AT SEQ ID NO:10. In one embodiment, a suitable 3' spacer is: 5'-GAG AAC ATT ATT ATA GCGTTG CTC GAG-3' SEQ ID NO:11.

[0170] Other optional components of RTM include microintrons, and introns or exons that regulate trans-splicing, enhancers, or silencers (see descriptions in RTM technology publications cited herein, for example).

[0171] In another embodiment, the RTM additionally includes at least one safe sequence incorporated into a spacer, binding domain, or elsewhere in the RTM to prevent nonspecific trans-splicing. This is a region of the RTM that covers the elements of the RTM's 3' and / or 5' splice sites through relatively weak complementarity, thereby preventing nonspecific trans-splicing. The RTM is designed such that after hybridization to one or more binding / targeting portions of the RTM, the 3' and / or 5' splice sites are exposed and become fully active. Such a "safe" sequence includes a complementary extension of the cis sequence (or may be a second independent strand of the nucleic acid) that binds to one or both sides of the RTM branch point, the pyrimidine region, the 3' splice site and / or the 5' splice site (splicing element), or may bind to portions of the splicing element itself. The "safe" binding can be achieved by binding to the RTM target-binding region to disrupt the pre-target mRNA, thereby exposing and activating the RTM splicing element (making it trans-spliced ​​into the pre-target mRNA). In another embodiment, the RTM adds a 3'UTR sequence or a ribonuclease sequence to the 3' or 5' end.

[0172] In one embodiment, the structure of the synthetic RTM may also include a splicing enhancer, such as a sequence called an exon splicing enhancer. Additional features may be added to the RTM molecule, such as polyadenylation signals that alter RNA expression / stability, or 5' splice sequences that enhance splicing, additional binding regions, "safe" self-complementary regions, additional splice sites, or protective groups that regulate molecule stability and prevent degradation. Furthermore, a stop codon may be included in the RTM structure to prevent translation of unspliced ​​RTMs. Other elements, such as 3' hairpin structures, circularized RNA, nucleotide base modifications, or synthetic analogs, may be incorporated into the RTM to promote or facilitate nuclear localization and spliceosome incorporation, as well as intracellular stability.

[0173] The binding of RTM nucleic acid molecules to target pre-mRNA is mediated by complementarity (i.e., based on the base-pairing characteristics of nucleic acids), triple helix formation, or protein-nucleic acid interactions (as described in the literature cited herein). In one embodiment, the RTM nucleic acid molecule consists of DNA, RNA, or a DNA / RNA hybrid molecule, wherein the DNA or RNA is single-stranded or double-stranded. It also contains RNA or DNA, which preferably hybridizes to one of the aforementioned RNA or DNA under stringent conditions, such as hybridization at 60°C in 2.5X SSC buffer and washing several times at 37°C in a lower buffer concentration, such as 0.5X SSC buffer, and encodes a protein exhibiting lipid phosphatase activity and / or associating with the plasma membrane. When RTMs are synthesized in vitro (synthetic RTMs), such RTMs may be modified at the base moiety, sugar moiety, or phosphate backbone, for example, to improve the stability of the molecule, hybridization with target mRNA, translocation in cells, stability against enzyme cleavage in cells, etc. For example, modifying RTMs to reduce overall charge can enhance cellular uptake of the molecule. Furthermore, modifications can be made to reduce sensitivity to nucleases or chemical degradation. Nucleic acid molecules can be synthesized in ways that allow them to conjugate with another molecule, such as peptides, hybridization-triggered cross-linking agents, transporters, or hybridization-triggered cleavage agents.

[0174] Various other well-known modifications to nucleic acid molecules can be introduced as a means of increasing intracellular stability and half-life (see also the description above regarding oligonucleotides). Possible modifications are known in the art (see the references cited herein). Modifications that can be made to the structure of synthesized RTMs include, but are not limited to, backbone modifications, such as those described in the cited RTM technology literature.

[0175] Recombinant AAV molecules

[0176] A variety of known nucleic acid vectors can be used in these methods to design and assemble components of RTMs and recombinant adeno-associated viruses (AAVs) for delivery of RTMs to target cells. Numerous publications known to those skilled in the art discuss the use of various such vectors for gene delivery (see, for example, Ausubel et al., Current Protocols in Molecular Biology, John Wiley & Sons, New York, 1989; Kay, MA et al., 2001, Nature Medicine, 7(1):33-40; and Walther W. and Stein U., 2000, Drugs, 60(2):249-71). In one embodiment described herein, the vector is a recombinant AAV carrying an RTM and driven by a promoter to express the RTM in selected target cells of a diseased subject. Methods for assembling the recombinant vector are well known (see, for example, International Patent Publication No. WO 00 / 15822, published on March 23, 2000, and other references cited herein).

[0177] In some embodiments described herein, one or more RTMs carrying selected gene-binding and coding sequences are delivered to target cells, such as photoreceptor cells, requiring treatment with an adeno-associated virus (AAV) vector. Many naturally occurring serotypes of AAV are available. Numerous natural variants of the AAV capsid allow for the identification and use of AAVs with properties particularly suited to ocular cells. AAV viruses can be engineered using conventional molecular biology techniques, thereby optimizing these particles to achieve cell-specific delivery of the RTM nucleic acid sequence, minimize immunogenicity, adjust stability and particle lifetime, achieve efficient degradation, and achieve accurate delivery to the cell nucleus, among other things.

[0178] The expression of the RTM described in this article can be achieved in selected cells via the delivery of recombinantly engineered AAV or artificial AAV containing a sequence encoding the desired RTM. The use of AAV is a common method for exogenous DNA delivery because it is relatively non-toxic, provides efficient gene transfer, and can be easily optimized for specific purposes. Among the well-characterized AAV serotypes isolated from human or non-human primates (NHPs), human serotype 2 is widely used for efficient gene transfer experiments in various target tissues and animal models. Other AAV serotypes include, but are not limited to, AAV1, AAV3, AAV4, AAV5, AAV6, AAV7, AAV8, and AAV9. Unless otherwise stated, the AAV ITRs and other selected AAV components described herein can be readily selected from any AAV serotype, including but not limited to AAV1, AAV2, AAV3, AAV4, AAV5, AAV6, AAV7, AAV8, AAV9, AAVrh.10, AAV8bp, AAV7m8, or other known and unknown AAV serotypes. These ITRs or other AAV components can be readily isolated from AAV serotypes using techniques available to those skilled in the art. Such AAVs can be isolated from academic, commercial, or public sources (e.g., the American Type Culture Collection, Manassas, VA). Alternatively, AAV sequences can be obtained by synthesis or other suitable means by referring to publicly available sequences, such as those found in the literature or in databases such as GenBank and PubMed. For discussions of various AAV serotypes, see, for example, WO 2005 / 033321 or WO2014 / 124282, which are incorporated herein by reference.

[0179] Desired AAV fragments for assembly into vectors include cap proteins, including vp1, vp2, vp3, and hypervariable regions; rep proteins, including rep 78, rep 68, rep 52, and rep 40; and sequences encoding these proteins. These fragments can be readily used in a variety of vector systems and host cells. Such fragments can be used alone, in combination with other AAV serotype sequences or fragments, or in combination with elements derived from other AAV or non-AAV viral sequences. As used herein, artificial AAV serotypes include, but are not limited to, AAVs having non-naturally occurring capsid proteins. Such artificial capsids can be generated using any suitable technique, using a combination of selected AAV sequences (e.g., fragments of the vp1 capsid protein) and heterologous sequences, which can be obtained from different selected AAV serotypes, discontinuous portions of the same AAV serotype, non-AAV viral sources, or non-viral sources. Artificial AAV serotypes can be, but are not limited to, pseudotyped AAVs, chimeric AAV capsids, recombinant AAV capsids, or “humanized” AAV capsids. Pseudotyped vectors can be used in this invention, wherein the capsid of one AAV is replaced by a heterologous capsid protein. In one embodiment, AAV2 / 5 is a useful pseudotyped vector. In another embodiment, the AAV is AAV2 / 8.

[0180] In one embodiment, a vector used to prepare the compositions and methods described herein contains, at a minimum, a sequence encoding a capsid of a selected AAV serotype, such as an AAV2 capsid or a fragment thereof. In another embodiment, a useful vector contains, at a minimum, a sequence encoding a rep protein of a selected AAV serotype, such as an AAV2 rep protein or a fragment thereof. Optionally, such vectors may contain both AAV cap and rep proteins. In vectors providing AAV rep and cap, the AAV rep and AAV cap sequences may be from a single serotype, such as all AAV2 sources. Alternatively, a vector may be used with a rep sequence from an AAV serotype different from the one providing the cap sequence. In one embodiment, the rep and cap sequences are expressed from independent sources (e.g., independent vectors, or host cells and vectors). In another embodiment, these rep sequences are fused in situ with cap sequences of different AAV serotypes to form a chimeric AAV vector, such as AAV2 / 8 as described in U.S. Patent No. 7,282,199, which is incorporated herein by reference.

[0181] Suitable recombinant adeno-associated virus (AAV) is produced by culturing host cells containing a nucleic acid sequence or fragment thereof encoding an adeno-associated virus (AAV) serotype capsid protein as defined herein; a functional rep gene; a small gene consisting, at a minimum, of an AAV inverted terminal repeat (ITR) sequence and an RTM nucleic acid sequence; and sufficient accessory functions to allow the small gene to be packaged into the AAV capsid protein. The components required for culturing in host cells to package the AAV small gene into the AAV capsid may be provided to the host cells in trans form. Alternatively, any one or more of the required components (e.g., the small gene, rep sequence, cap sequence, and / or accessory functions) may be provided by stable host cells that have been engineered to contain one or more of the required components using methods known to those skilled in the art.

[0182] In one embodiment, the rAAV includes a promoter (or a functional fragment of a promoter). The promoter used in the rAAV is selected from a variety of constitutive or inducible promoters capable of expressing the selected transgene in desired target cells. See, for example, the list of promoters identified in International Patent Publication No. WO2014 / 12482, published August 14, 2014, which is incorporated herein by reference. In one embodiment, the promoter is “cell-specific.” The term “cell-specific” means that a particular promoter selected for the recombinant vector can direct the expression of the selected transgene in a particular cell or eye cell type. In one embodiment, the promoter is specific for the expression of the transgene in photoreceptor cells. In another embodiment, the promoter is specific for expression in rods and / or cones. In another embodiment, the promoter is specific for the expression of the transgene in RPE cells. In another embodiment, the promoter is specific for the expression of the transgene in ganglion cells. In another embodiment, the promoter is specific for the expression of the transgene in Miller cells. In another embodiment, the promoter is specific for the expression of the transgene in bipolar cells. In another embodiment, the transgene is expressed in any of the aforementioned eye cells.

[0183] In another embodiment, the promoter is the original promoter of the target eye gene to be expressed. Useful promoters include, but are not limited to, rod opsin promoter, red-green opsin promoter, blue opsin promoter, cGMP-β-phosphodiesterase promoter, mouse opsin promoter (Beltran et al., 2010, cited above), rhodopsin promoter (Mussolino et al., Gene Ther, July 2011, 18(7):637-45); α subunit of cone transduction protein (Morrissey et al., BMC Developmental Biology, January 2011, 11:3); β-phosphodiesterase (PDE) promoter; retinitis pigmentosa (RP1) promoter (Nicord et al., Journal of Gene Medicine, December 2007, 9(12):1015-23); NXNL2 / NXNL1 promoter (Lambard et al., PLoS...). One), October 2010, 5(10):e13025; RPE65 promoter; Rds / perph2 promoter (Cai et al., Experimental Eye Res., August 2010; 91(2):186-94); and VMD2 promoter (Kachi et al., Human Gene Therapy, 2009(20:31-9)). These references are incorporated herein by reference.

[0184] Other commonly used regulatory sequences contained in small genes or rAAVs are also disclosed in references such as WO2014 / 124282, which are cited and incorporated herein by reference. Those skilled in the art can select these and other expression control sequences without departing from the scope described herein.

[0185] The desired AAV small gene consists, at a minimum, of the RTM and its regulatory sequence described herein, and 5' and 3' AAV inverted terminal repeats (ITRs). In one embodiment, an ITR of AAV serotype 2 is used. In another embodiment, an ITR of AAV serotype 5 or 8 is used. However, ITRs from other suitable serotypes may also be selected. This small gene is packaged into an AAV capsid and delivered to a selected host cell.

[0186] The small gene, rep sequence, cap sequence, and accessory function required for rAAV production can be delivered to the packaging host cell in the form of any genetic element carrying the sequence thereon. Selected genetic elements can be delivered by any suitable method, including those described herein. Methods for constructing any of the embodiments described herein are known to those skilled in nucleic acid manipulation and include genetic engineering, recombinant engineering, and synthetic techniques. See, for example, Sambrook et al., *Molecular Cloning: A Laboratory Manual*, ColdSpring Harbor Press, Cold Spring Harbor, NY. Similarly, methods for producing rAAV viral particles are well known, and the choice of suitable method does not limit the invention. See, for example, K. Fisher et al., 1993, *Journal of Virology*, 70:520-532, and U.S. Patent 5,478,745, etc. These publications are incorporated herein by reference.

[0187] Those skilled in the art can readily select suitable production cell lines. For example, suitable host cells can be selected from any biological organism, including prokaryotic (e.g., bacterial) cells and eukaryotic cells, including insect cells, yeast cells, and mammalian cells. Simply put, an AAV production plasmid carrying a small gene is transfected into selected packaging cells, where the plasmid may exist transiently. Alternatively, a small gene or gene expression cassette with a side-linked ITR is stably integrated into the genome of the host cell via the chromosome or as a free gene. Suitable transfection techniques are known and readily available for delivering recombinant AAV genomes into host cells. Typically, the production plasmid is cultured in host cells expressing cap and / or rep proteins. In the host cell, the small gene, consisting of the RTM of the side-linked AAV ITR, is rescued and packaged into capsid or envelope proteins to form infectious viral particles. Thus, recombinant AAV infectious particles are produced by culturing packaging cells carrying a proviral plasmid in the presence of a viral sequence sufficient to allow the packaging of the gene expression cassette viral genome into the infectious AAV envelope or capsid.

[0188] Drug carriers and drug compositions

[0189] The contamination of the compositions described herein for treating Stagger's disease is preferably assessed using conventional methods, and then formulated into pharmaceutical compositions intended for use with a suitable route of administration. These compositions contain a recombinant viral vector, such as AAV, as detailed above, containing a desired small RTM gene for selected target cells, such as photoreceptor cells. Other compositions containing RTMs, such as in naked DNA or protein form, can be formulated in a similar manner with a suitable carrier. Such formulations involve the use of pharmaceutically and / or physiologically acceptable mediators or carriers, particularly for administration to target cells. In one embodiment, a carrier suitable for administration to ocular cells includes buffered saline, isotonic sodium chloride solution, or other buffers, such as HEPES, to maintain the pH at an appropriate physiological level, and optionally, other pharmaceutical reagents, agents, stabilizers, buffers, carriers, adjuvants, diluents, etc.

[0190] For injection, the carrier is typically a liquid. Exemplary physiologically acceptable carriers include sterile, pyrogen-free water and sterile, pyrogen-free phosphate-buffered saline. Several such known carriers are provided in U.S. Patent No. 7,629,322, which is incorporated herein by reference. In one embodiment, the carrier is an isotonic sodium chloride solution. In another embodiment, the carrier is a balanced salt solution. In one embodiment, the carrier includes a Tween. If the virus is to be stored long-term, it can be frozen in the presence of glycerol or Tween 20.

[0191] In other embodiments, for example, compositions containing the RTM described herein include surfactants. Useful surfactants such as Pluronic F68 (Poloxamer 188), also known as... F68), because these surfactants prevent AAV from adhering to inert surfaces and thus ensure the delivery of the desired dose.

[0192] For example, an exemplary composition designed for treating the ocular diseases described herein comprises a recombinant gland-associated vector and a pharmaceutically acceptable carrier, the recombinant gland-associated vector carrying a nucleic acid sequence encoding a 3' RTM as described herein, the nucleic acid sequence being under the control of a regulatory sequence to express the RTM in ocular cells of a mammalian subject. The carrier is an isotonic sodium chloride solution and includes the surfactant Pluronic F68. In one embodiment, the RTM is the RTM described in the examples. In another embodiment, the RTM contains a binding and coding region of CEP290 or MYO7A.

[0193] In another exemplary embodiment, the composition comprises a recombinant AAV2 / 5 pseudotyped adeno-associated virus carrying a 3' or 5' or RTM for internal gene substitution, i.e., a nucleic acid sequence under the control of a promoter that guides the expression of the RTM in target cells, wherein the composition is formulated together with a carrier and additional components suitable for injection.

[0194] In yet another embodiment, the composition or components used to manufacture or assemble the composition, including carriers, rAAV particles, surfactants and / or components for generating rAAV, as well as laboratory hardware suitable for preparing the composition, may be incorporated into the kit.

[0195] Methods of treating diseases

[0196] Therefore, the compositions described above can be used in methods for treating one or more diseases associated with selected genes. In one embodiment, the disease is an ocular disease (e.g., Staggart's disease, Reber's congenital amaurosis, cone-rod dystrophy, macular degeneration, retinitis pigmentosa, age-related macular degeneration, Senior Locken syndrome). (such as Jupiter syndrome, Ussell syndrome, or other similar syndromes). In one embodiment, treatment includes delaying or improving symptoms associated with the ocular diseases described herein. Such methods involve contacting a target pre-mRNA (e.g., ABCA4, CEP290, MYO7A) with one or more of a 3' RTM, 5' RTM, 3' and 5' RTM, or double trans-splicing RTM as described herein, under certain conditions, such that a portion of the RTM is spliced ​​to the target pre-mRNA to replace all or part of a target gene carrying one or more defects or mutations with a “healthy” or normal or wild-type or corrected mRNA of the target gene, thereby correcting the expression of the gene in the target cells. Alternatively, a pre-miRNA (see the RTM literature cited herein) may be formed, which is designed to reduce the expression of the target mRNA. Thus, the methods and compositions are used to treat ocular diseases / lesions associated with specific mutations and / or gene expression.

[0197] In one embodiment, the contact involves direct application to a diseased subject; in another embodiment, the contact may occur with cultured cells ex vivo and the treated cells re-implanted into the subject. In one embodiment, the method involves administering rAAV particles carrying a 3' RTM. In another embodiment, the method involves administering rAAV particles carrying a 5' RTM. In another embodiment, the method involves administering rAAV particles carrying a double trans-splicing RTM. In yet another embodiment, the method involves administering a mixture of rAAV particles carrying a 3' RTM and rAAV particles carrying a 5' RTM. In yet another embodiment, the method involves administering a mixture of rAAV particles carrying a 3' RTM and rAAV particles carrying a double trans-splicing RTM. In yet another embodiment, the method involves administering a mixture of rAAV particles carrying a 5' RTM and rAAV particles carrying a double trans-splicing RTM. In yet another embodiment, the method involves administering a mixture of rAAV particles carrying a 3' RTM and rAAV particles carrying a 5' RTM and rAAV particles carrying a double trans-splicing RTM.

[0198] These methods involve administering an effective concentration of any of the compositions described herein to a subject in need. In one exemplary embodiment, such a method is provided for preventing, halting, or improving vision loss associated with Stagger's disease in a subject, the method comprising administering an effective concentration of a composition to ocular cells of a mammalian subject in need, the composition comprising recombinant adeno-associated virus (AAV) carrying a 3' RTM as described above and in the examples, under the control of a regulatory sequence that allows the RTM to function and induce trans-splicing of defective target genes in ocular cells, such as photoreceptor cells, of the mammalian subject. In yet another embodiment, the method involves administering two rAAV particles, one carrying a 5' RTM and the other carrying a 3' RTM, as described in the examples, to replace a larger portion of a large gene.

[0199] As used in the methods described herein, "application" means delivering the composition to target-selected cells characterized by a disease caused by a mutation or defect in a target gene. For example, in one embodiment, the method involves delivering the composition to photoreceptor cells or other ocular cells via subretinal injection. In another embodiment, intravitreal injection or injection via a palpebral vein may be used. In yet another embodiment, the method involves delivering the composition by direct injection into a designated organ, such as the liver. In still another embodiment, the method involves delivering the composition by intravenous injection. Other methods of application may be chosen by those skilled in the art based on this disclosure.

[0200] Furthermore, in some embodiments, it is desirable to perform non-invasive retinal imaging and functional studies to identify areas within the preserved photoreceptor that serve as targets for therapy. In these embodiments, clinical diagnostic tests are employed to determine the precise location of one or more subretinal injections. These tests may include electroretinography (ERG), visual field measurements, localization of the surface shape and thickness of retinal layers using confocal scanning laser ophthalmoscopy (cSLO) and optical coherence tomography (OCT), localization of cone density using adaptive optics (AO), functional eye examinations, etc. In light of the imaging and functional studies performed, in some embodiments, one or more injections are performed in the same eye to target different areas of the preserved photoreceptor.

[0201] For use in these methods, as further described below, the volume and viral titer of each injection are determined individually and may be the same as or different from other injections performed on the same subject. In another embodiment, a single, larger volume injection is performed to treat the entire eye. Dosage, administration, and protocol can be determined by the attending physician in accordance with the teachings of this instruction manual.

[0202] In one embodiment, the volume and concentration of the rAAV composition are chosen such that it affects only certain areas of the photoreceptors or other ocular cells. In another embodiment, the volume and / or concentration of the rAAV composition is larger to reach a larger portion of the eye. For application to other organs, the dosage is adjusted in a similar manner.

[0203] The effective concentration of recombinant adeno-associated virus carrying the RTM described herein is approximately 10-1 / mL. 8 With 10 13 The concentration range is between 10 vector genomes (vg / mL). rAAV infection units are measured as described in SKMcLaughlin et al., 1988, *Journal of Virology*, 62:1963. In another embodiment, the concentration range is 10 vg / mL. 9 With 10 13 Between one vector genome (vg / mL). In another embodiment, the effective concentration is approximately 1.5 × 10⁻⁶. 11 vg / mL. In one embodiment, the effective concentration is approximately 1.5 × 10⁻⁶. 10 vg / mL. In another embodiment, the effective concentration is approximately 2.8 × 10⁻⁶. 11 vg / mL. In yet another embodiment, the effective concentration was approximately 1.5 × 10⁻⁶ vg / mL. 12vg / mL. In another embodiment, the effective concentration is approximately 1.5 × 10⁻⁶. 13 vg / mL. The desired effect is to utilize the lowest effective concentration of virus to reduce the risk of undesirable effects such as toxicity and other problems associated with ocular application, such as retinal dysplasia and detachment. Other doses within these ranges or other units may be selected by the attending physician considering the subject being treated, preferably the subject's physical condition, including the subject's age; the composition being administered and the specific condition; the target cells and the degree of disease (if progressive).

[0204] Depending on the size of the area to be treated, the viral titer used, the route of administration, and the desired effect of the method, the delivered composition can be from about 50 μL to about 1 mL, including all figures within that range. In one embodiment, the volume is about 50 μL. In another embodiment, the volume is about 70 μL. In another embodiment, the volume is about 100 μL. In another embodiment, the volume is about 125 μL. In another embodiment, the volume is about 150 μL. In another embodiment, the volume is about 175 μL. In yet another embodiment, the volume is about 200 μL. In another embodiment, the volume is about 250 μL. In another embodiment, the volume is about 300 μL. In another embodiment, the volume is about 450 μL. In another embodiment, the volume is about 500 μL. In another embodiment, the volume is about 600 μL. In another embodiment, the volume is about 750 μL. In another embodiment, the volume is about 850 μL. In another embodiment, the volume is about 1000 μL.

[0205] The following examples are not intended to limit the scope of the embodiments described herein. Those skilled in the art will understand that modifications may be made to the following examples, which are intended to be covered within the spirit and scope of the invention.

[0206] Example 1: Splice Dependency Report Body RTM

[0207] Will Figure 1A-1D The RTM delivery shown is delivered to the expression of a small gene ( Figure 1F The cell line contains an intron 26 from CEP290 fused to the 3' half of the luciferase ORF. An RTM binds (through its binding domain) to the target sequence in intron 26, bringing the 5' splice site (5'SS) in the RTM close to the 3' splice site (3'SS) of the CEP290 small gene. Spliceosome-mediated splicing occurs, producing luciferase expression as a direct measure of trans-splicing activity. Figure 2AThe prior art, which uses two reference RTMs containing either a polyadenylation signal (poly-A) or a hammerhead ribonuclease (hhRz) to constitute transcription termination elements, is used here to establish an activity baseline. Data show that the Comp14 derivative of the MALAT1 transcription terminator enhances trans-splicing compared to a reference RTM containing hhRz for transcription termination. Furthermore, this activity appears to depend on the mascRNA domain and its associated ribonuclease P cleavage. This is confirmed by the loss of activity when the mascRNA domain is replaced by hhRz.

[0208] exist Figure 2B In this study, the experiment was designed to measure luciferase RNA and protein using TaqMan and Western blotting, respectively. Each construct was tested in N=4 replicates, revealing that luciferase protein increased when hhRz was replaced by a Comp14 Malat1 derivative, which is consistent with... Figure 2A The luciferase activity shown was consistent with that observed in the studies. TaqMan analysis of RNA extracted from treated cells showed a similar increase in trans-spliced ​​luciferase RNA when the RTM contained a Comp14 derivative of the Malat1 terminator, depending on two different primer-probe sets (S2 and S4). Since the RTMs used in these studies employed a binding domain targeting intron 26 of the CEP290 gene, RTM trans-splicing activity against endogenous CEP290 transcripts could also be measured. Figure 2B As shown, based on two different TaqMan primer-probe sets (S2 and S3), the Comp14 derivative carrying the Malat1 terminator produced higher levels of chimeric Luc-CEP290 RNA compared to the RTM with the hhRz terminator.

[0209] Example 2: Comparison of 3' terminating subsequences

[0210] The RTM construct was prepared, and several terminator sequences were tested to target ABCA4 expression levels: hhz, i.e., hammerhead ribonuclease, which self-cleaves to generate the 3' end of the RTM ( Figure 3A ); C14 or Comp14, i.e., the truncated MALAT1 triple helix structure (SEQ ID NO:12), which produces the 3' end of RTM after cleavage by ribonuclease P ( Figure 3B ); and wt, i.e., the original MALAT1 triple helix, which produces the 3' end of the RTM after cleavage by ribonuclease P ( Figure 3C ).

[0211] Figure 4A and 4BThis is a Western blot and its quantification, showing the ABCA4 protein produced via RTM-mediated trans-splicing. The RTM tested in Figure 3 includes the binding domains of ABCA4 introns 23 (motifs 27 and 81) and 22 (motifs 117 and 118). NB is a negative control non-binding motif. Figure 4A Data showed that when the hhRz terminator was replaced by a Comp14 derivative, the ABCA4 protein level significantly increased. Figure 4B In comparison, the Comp14 derivative was shown to have an even greater increase in trans-splicing activity when using the wild-type MALAT1 triple-helix terminator, depending on the binding domain, with an increase ranging from 5 to 10 times. Figure 4C The diagram shows the predicted base pairing of the wild-type MALAT1 triple-helix terminator with the Comp14 derivative. When designing the Comp14 derivative, Wilusz et al. indicated that it should have the same base pairing characteristics as the wild-type MALAT1 sequence between the A-rich and U-rich domains, but with truncated stem-loop side domains. However, this assumption overlooks the possible role of the stem-loop side domain in proper base pairing and could explain why the ENE activity of Comp14 is lower than that of the wild-type MALAT1 triple-helix terminator. The observed higher trans-splicing activity level of the wild-type MALAT1 sequence compared to the Comp14 derivative demonstrates important characteristics of the triple-helix terminator structure and ENE function.

[0212] Figure 5A Western blot analysis of RTMs containing different triple-helix terminators from lncRNAs is presented. These include wild-type sequences from MALAT1 and NEAT1 (MENβ), as well as chimeric forms where the triple-helix domain from MALAT1 is fused with a tRNA-like motif from NEAT1 (called menRNA), and chimeric forms where the triple-helix domain from NEAT1 is fused with a mascRNA motif from MALAT1. The data indicate that trans-splicing activity is highest when the RTM contains the wild-type MALAT1 terminator.

[0213] Figure 5BThe predicted base pairing of triple-helical terminators from three different lncRNAs, including MALAT1, MENβ (NEAT1), and PAN RNA (produced by Kaposi's sarcoma-associated herpesvirus KSHV), is shown. The structural similarity among the different lncRNAs suggests a common evolutionary strategy for protecting the 3' end of lncRNAs after transcription termination. However, X-ray crystallography of the MALAT1 triple-helical domain reveals a triplet with 10 major grooves and 2 minor grooves, most of which possess any known naturally occurring triple-helical structure (Brown, JA et al., 2014). This intricate design may confer a level of structural stability exceeding that of NEAT1 or PAN and could explain why the MALAT1 terminator appears to better support trans-splicing, thereby preventing RTM degradation in the nucleus. Importantly, as shown by in vivo decay assays (Brown, JA, 2014), the blunt-ended triple helix of MALAT1 inhibits rapid nuclear RNA decay.

[0214] Figure 6A The highly conserved mascRNA sequences of MALAT1 from several species and their predicted folding conformations are shown. A single-point mutation (G to A, indicated by the red arrow) was inserted into the mascRNA sequence to test the importance of this domain for trans-splicing activity. (See Western blotting). Figure 6B As shown in the diagram, the point mutation eliminates the verified trans-splicing activity of the RTM targeting ABCA4. This is likely because the mutant sequence fails to present the correct conformation required for ribonuclease P recognition and cleavage.

[0215] The following additionally numbered paragraphs further define some embodiments of the invention described herein.

[0216] 1. A nucleic acid trans-splicing molecule comprising a 3' transcription terminator domain (TTD), said TTD comprising a triple helix.

[0217] 2. The nucleic acid trans-splicing molecule according to claim 1, wherein the triple helix comprises at least five consecutive AU-Husstein base pairs.

[0218] 3. The nucleic acid trans-splicing molecule according to claim 1 or 2, wherein the triple helix comprises an A-rich region having 5-30 nucleic acids.

[0219] 4. The nucleic acid trans-splicing molecule according to claim 3, wherein the A-rich region is at the 3' end of the TTD.

[0220] 5. The nucleic acid trans-splicing molecule according to any one of claims 1 to 4, wherein the triple helix comprises a chain having 10 consecutive nucleotides, wherein 9 of the 10 consecutive nucleotides are paired by Husstan base pairing.

[0221] 6. The nucleic acid trans-splicing molecule according to any one of claims 1 to 5, wherein the TTD comprises a stem-loop motif.

[0222] 7. The nucleic acid trans-splicing molecule according to any one of claims 1 to 6, wherein the 3'TTD comprises a 5' U-rich motif, a stem-loop motif, a 3' U-rich motif, and an A-rich region operatively linked in the 5' to 3' direction.

[0223] 8. The nucleic acid trans-splicing molecule according to any one of claims 1 to 4, wherein the 3'TTD is at least 95% homologous to SEQ ID NO:13, SEQ ID NO:15, SEQ ID NO:17 or SEQ ID NO:23.

[0224] 9. The nucleic acid trans-splicing molecule of claim 8, wherein the 3'TTD is at least 95% homologous to SEQ ID NO:13, and wherein the triple helix comprises U7-U11 of SEQ ID NO:13 paired with Husstan bases in the A-rich region.

[0225] 10. The nucleic acid according to claim 9, wherein the 3'TTD is PAN ENE+A.

[0226] 11. The nucleic acid trans-splicing molecule according to any one of claims 1 to 8, wherein the 3'TTD is at least 95% homologous to SEQ ID NO:15, and wherein the triple helix comprises U6-10, C11 and U12-15 of SEQ ID NO:15 paired with Husstan bases in the A-rich region.

[0227] 12. The nucleic acid according to claim 11, wherein the 3'TTD is MALAT1 ENE+A.

[0228] 13. The nucleic acid trans-splicing molecule of claim 8, wherein the 3'TTD is at least 95% homologous to SEQ ID NO:17, and wherein the triple helix comprises U6-10, C11 and U12-15 of SEQ ID NO:17 paired with Husstan bases in the A-rich region.

[0229] 14. The nucleic acid according to claim 13, wherein the 3'TTD is MALAT1 core ENE+A.

[0230] 15. The nucleic acid trans-splicing molecule of claim 8, wherein the 3'TTD is at least 95% homologous to SEQ ID NO:23, and wherein the triple helix comprises U8-10, C11 and U12-15 of SEQ ID NO:23 paired with Husstan bases in the A-rich region.

[0231] 16. The nucleic acid trans-splicing molecule according to claim 15, wherein the 3'TTD is MENβENE+A.

[0232] 17. A nucleic acid trans-splicing molecule comprising: operably linked in a 5' to 3' orientation:

[0233] (a) A sequence of coding domains (CDS) containing one or more functional exons of a selected gene;

[0234] (b) A sequence of connector structural domains (LDS) of different lengths, wherein the LDS serves as a structural connection between the coding structural domain and the binding structural domain.

[0235] (c) Splice body recognition motif (5' splice site) configured for initiation of splice body-mediated trans-splicing;

[0236] (d) A binding domain (BD) of different length and sequence configured for hybridization with a target intron of the selected gene, wherein the gene has at least one defect or mutation in the 5' exon of the target intron; and

[0237] (e) 3' transcription terminator domain (TTD) that increases the efficiency of trans-splicing.

[0238] The nucleic acid trans-splicing molecule is configured to trans-splice the coding domain to an endogenous exon of the selected gene adjacent to the target intron, thereby replacing the endogenous defective or mutated exon with the functional exon and correcting mutations in the selected gene.

[0239] 18. The nucleic acid trans-splicing molecule of claim 17, wherein the binding domain hybridizes with a target intron of the selected gene at the 3' end of the mutation and the coding domain is contained in one or more exons at the 5' end of the target intron.

[0240] 19. A nucleic acid trans-splicing molecule comprising: operably linked in the 5' to 3' direction:

[0241] (a) is configured to bind the binding domain (BD) of a target intron of a selected gene, wherein the gene has at least one defect or mutation in the exon at the 3' end of the target intron;

[0242] (b) A sequence of connectors with different lengths and compositions, the sequence of connectors serving as structural connections between the coding regions of the combined structural domains;

[0243] (c) 3' spliceosome recognition motif (3' splice site) configured to mediate trans-splicing;

[0244] (d) A coding domain sequence (CDS) containing one or more functional exons of the selected gene; and

[0245] (e) 3' transcription terminator domain (TTD) that increases the efficiency of trans-splicing.

[0246] The nucleic acid trans-splicing molecule is configured to trans-splice the coding domain to an endogenous exon of the selected gene adjacent to the target intron, thereby replacing the endogenous defective or mutated exon with the functional exon and correcting mutations in the selected gene.

[0247] 20. The nucleic acid trans-splicing molecule of claim 19, wherein the binding domain binds to a target intron of the selected gene at the 3' end of the mutation and the coding domain is contained in one or more exons at the 5' end of the target intron.

[0248] 21. The nucleic acid trans-splicing molecule according to any one of claims 17 to 20, wherein the 3' transcription terminator domain forms a triple helix structure, the triple helix structure being effectively capped at the 3' end.

[0249] 22. The nucleic acid trans-splicing molecule according to any of the preceding claims, wherein the 3' transcription terminator domain is a sequence from one or more long non-coding RNA (lncRNA) or other nuclear RNA molecules containing a 3' transcription terminator, the sequence being condensed into a triple helix blunt-ended structure.

[0250] 23. The nucleic acid trans-splicing molecule according to any one of claims 17 to 22, wherein the 3' transcription terminator domain is derived from human long non-coding RNA MALAT1.

[0251] 24. The nucleic acid trans-splicing molecule of claim 23, wherein the 3' transcription terminator domain comprises nucleotides 8287-8437 of human MALAT1.

[0252] 25. The nucleic acid trans-splicing molecule of claim 23, wherein the 3' transcription terminator domain comprises, in 5' to 3' order: a triplet-forming sequence comprising nucleotides 8287-8379, a ribonuclease P cleavage site comprising nucleotides 8379-8380, and an tRNA-like sequence comprising nucleotides 8380-8437.

[0253] 26. The nucleic acid trans-splicing molecule of claim 23, wherein the 3' transcription terminator domain contains a triplet-forming sequence comprising a U-rich motif 1 (8292-8301), a conserved stem-loop (8302-8333), a U-rich motif 2 (8334-8343), and an A-rich region (8369-8379), wherein the A-rich region forms a Watson-Crick stem duplex with the U-rich motif 2, and the U-rich motif 1 aligns with the A-rich region to form a Husstan base pair.

[0254] 27. The nucleic acid trans-splicing molecule according to claim 23, wherein the 3' transcription terminator domain is a truncated form of the human MALAT1 triple helix.

[0255] 28. The nucleic acid trans-splicing molecule of claim 27, wherein the 3' transcription terminator domain contains a triplet-forming sequence comprising the deletion of a U-rich motif 1 (8292-8301), a conserved stem-loop (8302-8310 and 8325-8333), a U-rich motif 2 (8334-8343), an A-rich region (8369-8379), and nucleotides 8345-8364 of an intercalation sequence spanning between the U-rich motif 2 and the A-rich region, wherein the A-rich region forms a Watson-Crick stem duplex with the U-rich motif 2, and the U-rich motif 1 is aligned with the A-rich region to form a Husstan base pair.

[0256] 29. The nucleic acid trans-splicing molecule of claim 27, wherein the 3' transcription terminator domain comprises, in order from 5' to 3': a triplet-forming sequence of different lengths and compositions, a ribonuclease P cleavage site, and an tRNA-like sequence of different lengths and compositions.

[0257] 30. The nucleic acid trans-splicing molecule of claim 27, wherein the 3' transcription terminator domain contains a triplet formation sequence that conforms to one of three known basic "motifs" and is identified by the base composition of the third strand in the triple helix as: pyrimidine motif (T, C), purine motif (G, A), and purine-pyrimidine motif (G, T).

[0258] 31. The nucleic acid trans-splicing molecule according to claim 22, wherein the 3' transcription terminator domain comprises a triple helix domain and an tRNA-like domain.

[0259] 32. The nucleic acid trans-splicing molecule of claim 31, wherein the triple helix domain and the tRNA-like domain are derived from the same long non-coding RNA or different combinations of long non-coding RNA domains from humans or any other species.

[0260] 33. The nucleic acid trans-splicing molecule according to claim 31, wherein the triple helix domain and the tRNA-like domain are derived from MALAT1 or NEAT1 / MENβ.

[0261] 34. The nucleic acid trans-splicing molecule according to any of the preceding claims 17, wherein the target mammalian gene is ABCA4, CEP290, or MYO7A.

[0262] 35. The nucleic acid trans-splicing molecule according to any of the preceding claims, wherein the gene is ABCA4 and the defect or mutation is in any of exons 1-23.

[0263] 36. The nucleic acid trans-splicing molecule according to any of the preceding claims, wherein the nucleic acid trans-splicing molecule further comprises one or more adapter sequences.

[0264] 37. The nucleic acid trans-splicing molecule of claim 26, wherein the nucleic acid trans-splicing molecule comprises a junction between the splicing domain and the binding domain.

[0265] 38. The nucleic acid trans-splicing molecule according to claim 36 or 37, wherein the nucleic acid trans-splicing molecule comprises a linker between the binding domain and the 3' end domain.

[0266] 39. A recombinant adeno-associated virus (rAAV) comprising a nucleic acid molecule according to any one of claims 1 to 38.

[0267] 40. The rAAV of claim 39, wherein the AAV preferentially targets photoreceptor cells.

[0268] 41. The rAAV according to claim 39 or 40, wherein the AAV comprises AAV5 capsid protein, AAV8 capsid protein, AAV8(b) capsid protein or AAV9 capsid protein.

[0269] 42. A method for treating a disease caused by a defect or mutation in a target gene, the method comprising: administering a composition comprising recombinant AAV to cells of a subject suffering from the disease, the recombinant AAV comprising a nucleic acid trans-splicing molecule according to any one of claims 1 to 38.

[0270] 43. A method for treating an eye disease caused by a defect or mutation in a target gene, the method comprising: administering a composition comprising recombinant AAV to ocular cells of a subject suffering from an eye disease, said recombinant AAV comprising a nucleic acid trans-splicing molecule according to any one of claims 1 to 38.

[0271] 44. The method of claim 43, wherein the disease is Staggart's disease, Leber's congenital amaurosis (LCA), cone-rod dystrophy, macular degeneration, retinitis pigmentosa, age-related macular degeneration, or Ussell's syndrome.

[0272] 45. The method according to claim 43 or 44, wherein the composition is administered via subretinal injection.

[0273] 46. ​​The method of claim 43, wherein the disease is Staggart's disease, the cell is a photoreceptor cell, the eye gene is ABCA4, and the corrected exon sequence is exon 1-19, exon 1-22, exon 1-23, or exon 1-24.

[0274] 47. A pharmaceutical formulation comprising a physiologically acceptable carrier and rAAV according to any one of claims 39 to 41.

[0275] All publications referenced in this specification are incorporated herein by reference in their entirety. Additionally, U.S. Provisional Patent Application No. 62 / 835,164, filed April 17, 2019, is incorporated herein by reference in its entirety. Similarly, SEQ ID NOs mentioned herein and appearing in the appended sequence list are also incorporated by reference. While the invention has been described with reference to specific embodiments, it should be understood that modifications may be made without departing from the spirit of the invention. Such modifications are intended to be within the scope of the appended claims.

Claims

1. A nucleic acid trans-splicing molecule comprising: operably linked in a 5' to 3' orientation: (a) A sequence of coding domains (CDS) containing one or more functional exons of a selected gene; (b) Splice body identification motif configured for initiating splice body-mediated reverse splicing; (c) A sequence of connector structural domains (LDS) of different lengths, wherein the LDS serves as a structural connection between the coding structural domain and the binding structural domain. (d) A binding domain (BD) of different length and sequence configured for hybridization with a target intron of the selected gene, wherein the gene has at least one defect or mutation in the 5' exon of the target intron; and (e) A 3' transcription terminator domain (TTD), wherein the 3' TTD comprises, operatively linked in the 5' to 3' direction, a triplet-forming sequence, a ribonuclease P cleavage site as shown in nucleotides 8379-8380 of SEQ ID NO:7, and an tRNA-like sequence as shown in nucleotides 8380-8437 of SEQ ID NO:7, wherein the triplet-forming sequence is shown in SEQ ID NO:

15. The nucleic acid trans-splicing molecule is configured to trans-splice the coding domain to an endogenous exon of the selected gene adjacent to the target intron, thereby replacing the endogenous exon with the functional exon and correcting mutations in the selected gene.

2. The nucleic acid trans-splicing molecule of claim 1, wherein the binding domain hybridizes with a target intron of the selected gene at the 3' end of the mutation and the coding domain is contained in one or more exons at the 5' end of the target intron.

3. A nucleic acid trans-splicing molecule comprising: operably linked in the 5' to 3' direction: (a) is configured to bind the binding domain (BD) of a target intron of a selected gene, wherein the gene has at least one defect or mutation in the exon at the 3' end of the target intron; (b) A connector sequence having different lengths and compositions, the connector sequence serving as a structural connection between the binding structural domain and the coding structural domain; (c) Configured to mediate the 3' spliceosome recognition motif for trans-splicing; (d) A coding domain sequence (CDS) containing one or more functional exons of the selected gene; and (e) A 3' transcription terminator domain (TTD), wherein the 3' TTD comprises, operatively linked in the 5' to 3' direction, a triplet-forming sequence, a ribonuclease P cleavage site as shown in nucleotides 8379-8380 of SEQ ID NO:7, and an tRNA-like sequence as shown in nucleotides 8380-8437 of SEQ ID NO:7, wherein the triplet-forming sequence is shown in SEQ ID NO:

15. The nucleic acid trans-splicing molecule is configured to trans-splice the coding domain to an endogenous exon of the selected gene adjacent to the target intron, thereby replacing the endogenous exon with the functional exon and correcting mutations in the selected gene.

4. The nucleic acid trans-splicing molecule of claim 3, wherein the binding domain binds to a target intron of the selected gene at the 5' end of the mutation and the coding domain is contained in one or more exons at the 3' end of the target intron.

5. The nucleic acid trans-splicing molecule according to any one of claims 1 to 4, wherein the 3' TTD forms a triple helix structure, the triple helix structure being effectively capped at the 3' end.

6. The nucleic acid trans-splicing molecule according to any one of claims 1 to 4, wherein the 3' transcription terminator domain is shown in SEQ ID NO:

7.

7. The nucleic acid trans-splicing molecule according to any one of claims 1 to 4, wherein the selected gene is ABCA4, CEP290, or MYO7A.

8. The nucleic acid trans-splicing molecule according to claim 7, wherein the selected gene is ABCA4 and has a defect or mutation in any one of exons 1-22.

9. A recombinant adeno-associated virus (rAAV) comprising a nucleic acid trans-splicing molecule according to any one of claims 1 to 8.

10. The rAAV of claim 9, wherein the AAV preferentially targets photoreceptor cells.

11. The rAAV according to claim 9 or 10, wherein the AAV comprises AAV5 capsid protein, AAV8 capsid protein, AAV8(b) capsid protein or AAV9 capsid protein.

12. A pharmaceutical formulation comprising a physiologically acceptable carrier and rAAV according to any one of claims 9 to 11.

13. Use of a composition comprising rAAV according to any one of claims 9-11 in the preparation of a medicament for treating diseases caused by defects or mutations in a target gene.

14. Use of a composition comprising rAAV according to any one of claims 9-11 in the preparation of a medicament for treating an eye disease caused by a defect or mutation in a target gene.

15. The use according to claim 14, wherein the eye disease is Staggart's disease, Leber's congenital amaurosis (LCA), cone-rod dystrophy, macular degeneration, retinitis pigmentosa, age-related macular degeneration, or Ussell's syndrome.

16. The use according to claim 14 or 15, wherein the drug is administered via subretinal injection.

17. The use according to claim 14 or 15, wherein the disease is Staggart's disease, the target gene is ABCA4 and the corrected exon sequence is exons 1-19.

18. The use according to claim 14 or 15, wherein the disease is Staggart's disease, the target gene is ABCA4 and the corrected exon sequence is exons 1-22.

19. The use according to claim 14 or 15, wherein the disease is Staggart's disease, the target gene is ABCA4 and the corrected exon sequence is exons 1-23.

20. The use according to claim 14 or 15, wherein the disease is Staggart's disease, the target gene is ABCA4 and the corrected exon sequence is exons 1-24.

Images