Genetically engineered strains of Streptococcus zooepidemicus and their applications

Abstract

The present invention proposes a genetically engineered strain of Streptococcus zooepidemicus. The genetically engineered strain carries an exogenous gene expression cassette, and the exogenous gene expression cassette includes a first gene expression cassette and a second gene expression cassette, wherein the first gene expression cassette includes a first promoter and a hasA gene, and the first promoter and the hasA gene are operably connected; the second gene expression cassette includes a second promoter and a hasB gene, and the second promoter and the hasB gene are operably connected. The genetically engineered strain of Streptococcus zooepidemicus according to an embodiment of the present invention carries an exogenous hasA gene expression cassette and an exogenous hasB gene expression cassette, but does not carry an exogenous hasC gene expression cassette, and the hasA gene and the hasB gene in the exogenous gene expression cassette are expressed under two independent promoters, and has a significantly higher HA synthesis yield compared to the existing genetically engineered strains of Streptococcus zooepidemicus.

Description

Technical Field

[0001] The present invention relates to the field of biotechnology, specifically, the present invention relates to a genetically engineered strain of Streptococcus zooepidemicus and an application thereof, and more specifically, the present invention relates to a genetically engineered strain of Streptococcus zooepidemicus, a method for improving the synthesis of hyaluronic acid by Streptococcus zooepidemicus, and a method for producing hyaluronic acid. Background Art

[0002] Hyaluronic acid (HA) is a polysaccharide composed of repeating disaccharide units of glucuronic acid and aminoglucose. It is widely distributed in the dermis and epidermis of cartilage tissue, joint fluid and skin tissue, and plays physiological roles in moisturizing, nutrition, repair and injury prevention. There are two production methods for hyaluronic acid: animal tissue extraction and fermentation. Due to the high preparation cost and complex separation and purification of animal tissue extraction, it has gradually been replaced by fermentation.

[0003] Since the fermentation method is simple, the required raw materials are easily available, and the cost is relatively low, the production of hyaluronic acid by microbial fermentation is one of the most important ways to produce hyaluronic acid. Currently, the microbial strains that can be used to directly produce HA are mainly divided into Class A and Class C in the genus Streptococcus, such as Streptococcus pyogenes and Streptococcus zooepidemicus. As a member of Class C Streptococcus, Streptococcus zooepidemicus is often favored due to its lower pathogenicity and higher HA yield. However, the production of HA by microbial fermentation also reflects many limitations. Affected by the host bacteria, different hosts have different abilities to produce HA, but the shake flask yield is mostly less than 1g / L, and the fermentation tank yield is generally within 7g / L, which not only increases the production cost, but also makes it difficult to meet the growing market demand. With regard to the current host improvement technology, chemical mutagenesis or physical mutagenesis technology is one of the mainstream methods for screening excellent production strains, but the disadvantages of long mutagenesis breeding cycle, large uncertainty of results, and high toxicity are often one of the main factors restricting its development.

[0004] Compared with mutation breeding, the method of using genetic engineering to direct the transformation of the host to obtain high-yield strains has the advantages of being faster, more controllable, and having a shorter cycle. It is one of the most important breeding technologies at present and in the future. Summary of the invention

[0005] The present invention aims to solve one of the technical problems in the related art at least to a certain extent.

[0006] During the research and development process, the inventors of the present application unexpectedly discovered that the hasB gene plays a particularly significant role in the production of hyaluronic acid by Streptococcus zooepidemicus, and the inventors of the present application ingeniously split hasAB into two independently completed expression frames, and mutated the rare start codon GTG of the hasB gene into ATG, thereby enhancing the expression ratio of the hasB gene, and ultimately achieving a shake flask fermentation yield of 2.4-2.8 g / L, which is more than 160% higher than the yield of hyaluronic acid produced by wild-type Streptococcus zooepidemicus of 0.8 g / L-0.9 g / L.

[0007] In the first aspect of the present invention, the present invention proposes a genetically engineered strain of Streptococcus zooepidemicus. According to an embodiment of the present invention, the genetically engineered strain carries an exogenous gene expression cassette, and the exogenous gene expression cassette includes a first gene expression cassette and a second gene expression cassette, wherein the first gene expression cassette includes a first promoter and a hasA gene, and the first promoter and the hasA gene are operably connected; the second gene expression cassette includes a second promoter and a hasB gene, and the second promoter and the hasB gene are operably connected. It should be noted that the "exogenous gene expression cassette" described in the present application refers to a gene expression cassette derived from the outside, rather than a gene expression cassette on the genome of Streptococcus zooepidemicus itself. This gene expression cassette derived from the outside can be obtained by carrying the required gene expression cassette into the body of Streptococcus zooepidemicus through a construct or a vector, and its structure can be the same as or different from the gene expression cassette on the genome of Streptococcus zooepidemicus itself. According to the genetically engineered strain of Streptococcus zooepidemicus according to the embodiment of the present invention, it carries an exogenous hasA gene expression frame and an exogenous hasB gene expression frame, but does not carry an exogenous hasC gene expression frame, and the hasA gene and the hasB gene in the exogenous gene expression frame can be expressed under two independent promoters. Compared with the existing genetically engineered strains of Streptococcus zooepidemicus, it has a significantly higher HA synthesis yield.

[0008] According to an embodiment of the present invention, the genetically engineered strain of Streptococcus zooepidemicus may further include at least one of the following additional technical features:

[0009] According to an embodiment of the present invention, the first gene expression cassette and the second gene expression cassette are arranged on different constructs or the same construct.

[0010] According to an embodiment of the present invention, the construct comprises at least one selected from pSET4, pSET4s, pEU308, and pDL276.

[0011] According to an embodiment of the present invention, the first gene expression frame and the second gene expression frame are arranged on the same construct, and the 3' end of the first gene expression frame is connected to the 5' end of the second gene expression frame or the 3' end of the second gene expression frame is connected to the 5' end of the first gene expression frame.

[0012] According to an embodiment of the present invention, the construct is an episomal pSET4 vector. The episomal pSET4 vector according to an embodiment of the present invention has higher stability.

[0013] According to an embodiment of the present invention, the intensity of the first promoter initiating gene expression is weaker than the intensity of the second promoter initiating gene expression. The inventors found that when the intensity of the first promoter controlling the hasA gene is weaker than the intensity of the second promoter controlling the hasB gene, the HA synthesis yield of the genetically engineered strain of Streptococcus zooepidemicus according to an embodiment of the present invention is higher. For example, the inventors tried to use Pldh to control the hasA gene, PABC to control the hasB gene, the intensity of the PABC promoter is weaker than the Pldh promoter, or Pldh is used to control the hasA gene and the hasB gene at the same time, and the HA yield obtained is lower than that of using PABC to control the hasA gene and Pldh to control the hasA gene.

[0014] According to an embodiment of the present invention, the first promoter and the second promoter are independently selected from PGAPDH (glyceraldehyde-3-phosphate dehydrogenase promoter), PacK (acetate kinase promoter), PABC or Pldh.

[0015] According to an embodiment of the present invention, the first promoter is PABC and the second promoter is Pldh. The inventors found that the hasB gene plays a particularly significant role in the production of hyaluronic acid by Streptococcus zooepidemicus. The hasB gene is expressed by using the same promoter Pldh as lactate dehydrogenase, which significantly reduces the generation of lactic acid during the fermentation process through the promoter competition mechanism, making the fermentation process easier to control.

[0016] According to an embodiment of the present invention, the start codon of the hasB gene is ATG. The inventors found that changing the GTG start codon of the hasB gene to the ATG start codon can further increase the expression ratio of the hasB gene and further improve the HA synthesis yield.

[0017] According to an embodiment of the present invention, the classification name of the zooepidemicus Streptococcus is Streptococcus equisubsp.zooepidemicus HEC-SE01, the preservation number is CCTCC NO:M2020231, and it is deposited in the China Center for Type Culture Collection, the preservation date is June 22, 2020, and the preservation address is Wuhan University, China.

[0018] In the second aspect of the present invention, the present invention proposes a method for improving the synthesis of hyaluronic acid by Streptococcus zooepidemicus. According to an embodiment of the present invention, the method includes causing Streptococcus zooepidemicus to carry an exogenous gene expression frame, the exogenous gene expression frame including a first gene expression frame and a second gene expression frame, wherein the first gene expression frame includes a first promoter and a hasA gene, the first promoter and the hasA gene are operably connected; the second gene expression frame includes a second promoter and a hasB gene, the second promoter and the hasB gene are operably connected. The method according to an embodiment of the present invention can significantly increase the synthesis of hyaluronic acid.

[0019] The method according to the embodiment of the present invention has the same additional technical features as the above-mentioned genetically engineered strain of Streptococcus zooepidemicus, and brings the same technical effects, which will not be repeated here.

[0020] According to a specific embodiment of the present invention, making Streptococcus zooepidemicus carry an exogenous gene expression cassette is achieved by introducing a construct carrying the desired gene expression cassette into Streptococcus zooepidemicus by electroporation.

[0021] In a third aspect of the present invention, the present invention provides a method for producing hyaluronic acid. According to an embodiment of the present invention, the method comprises subjecting the genetically engineered strain described above to fermentation treatment to obtain the hyaluronic acid. The amount of hyaluronic acid obtained by the method according to an embodiment of the present invention is significantly increased.

[0022] Additional aspects and advantages of the present invention will be given in part in the following description and in part will be obvious from the following description, or will be learned through practice of the present invention. BRIEF DESCRIPTION OF THE DRAWINGS

[0023] The above and / or additional aspects and advantages of the present invention will become apparent and easily understood from the description of the embodiments in conjunction with the following drawings, in which:

[0024] Figure 1 is the plasmid map of pSET4-PAT according to Example 3 of the present invention;

[0025] Figure 2 is the plasmid map of pSET4-PASBT according to Example 4 of the present invention;

[0026] Figure 3 is the plasmid map of pSET4-PASBSCT according to Example 5 of the present invention;

[0027] Figure 4 is the plasmid map of pSET4-P1AT-P1BT according to Example 6 of the present invention;

[0028] Figure 5 is the plasmid map of Example 7pSET4-P2AT-P1BT according to the present invention;

[0029] Figure 6 is the plasmid map of pSET4-P2AT-P2BT according to Example 8 of the present invention;

[0030] Figure 7 is the plasmid map of pSET4-P1AT-P2BT according to Example 9 of the present invention;

[0031] Figure 8 It is the agarose gel electrophoresis diagram of the transformant according to Example 9 of the present invention. DETAILED DESCRIPTION

[0032] Embodiments of the present invention are described in detail below, and examples of the embodiments are shown in the accompanying drawings. The embodiments described below with reference to the accompanying drawings are exemplary and intended to be used to explain the present invention, but should not be understood as limiting the present invention.

[0033] In addition, the terms "first" and "second" are used for descriptive purposes only and should not be understood as indicating or implying relative importance or implicitly indicating the number of the indicated technical features. Therefore, the features defined as "first" and "second" may explicitly or implicitly include at least one of the features. In the description of the present invention, the meaning of "plurality" is at least two, such as two, three, etc., unless otherwise clearly and specifically defined.

[0034] According to a specific embodiment of the present invention, the method for transforming Streptococcus zooepidemicus for producing hyaluronic acid proposed by the present invention is as follows:

[0035] 1. Using the Escherichia coli-Streptococcus zooepidemicus shuttle genome editing vector pSET4s as the starting vector, it was mutated into a free pSET4 vector by point mutagenesis technology and used as the backbone vector of the subsequent free overexpression vector;

[0036] 2. Use primers 01F / 01R to clone the PABC+hasA expression cassette (PABC is the has gene cluster promoter of Streptococcus zooepidemicus) from the genome of Streptococcus zooepidemicus. Among them, 01F introduces a Bgl Ⅱ restriction site, and 01R introduces a terminator sequence Ter and an EcoR Ⅰ restriction site. The cloned expression cassette is named PAT (PABC+hasA+Ter), and the PAT expression cassette is inserted between the Bgl Ⅱ and EcoR Ⅰ restriction sites of the pSET4 vector by restriction enzyme ligation, thereby generating the first free expression vector pSET4-PAT;

[0037] 3. Use primers 02F / 02R to clone the Pldh promoter sequence (lactate dehydrogenase promoter) from the genome of Streptococcus zooepidemicus, and use primers 03F / 03R to clone the hasB gene from the genome of Streptococcus zooepidemicus. Among them, the EcoR Ⅰ restriction site was introduced by the 02F primer, the GTG of the hasB gene was mutated to ATG by 03F to enhance the translation efficiency of hasB, and a terminator sequence Ter and sal Ⅰ restriction site were introduced by 03R. Then, the Pldh promoter and the hasB+Ter fragment were connected together by overlap PCR using 02F / 03R to form the Pldh+hasB+Ter expression frame, which was named P2BT. Finally, P2BT was inserted between the EcoR Ⅰ and sal Ⅰ restriction sites of the pSET4-PAT vector by enzyme ligation, thereby generating the second free expression vector pSET4-PAT-P2BT;

[0038] 4. Prepare Streptococcus zooepidemicus into competent cells, introduce the pSET4-PAT-P2BT vector into Streptococcus zooepidemicus by electroporation, screen transformants on BHI solid medium containing spectinomycin at a final concentration of 50 μg / mL, and verify the transformants with YF / YR. The correct transformants are the final strains.

[0039] Compared with the prior art, the zooepidemic streptococcus transformation method of this technical solution has the following advantages:

[0040] 1) Compared with traditional mutagenesis breeding, this method is simple to operate, has a short cycle, and has good expected results. Based on the metabolic flow of the original strain, the HA synthesis pathway is enhanced, which not only maintains the excellent characteristics of the strain but also improves the yield. The shake flask yield reaches 2.4g / L-2.8g / L, the 15L fermentation tank yield reaches 9g / L-11g / L, and the 50L fermentation tank yield reaches 9g / L-10g / L. The shake flask yield of Streptococcus zooepidemicus reported at present is generally 0.1g / L-1.0g / L. The Streptococcus zooepidemicus transformed by the method of the present invention is increased by more than 160% compared with the original strain.

[0041] 2) This technology overexpresses the hasA gene and the hasB gene separately, each gene is started by a separate strong promoter, and the GTG start codon of the hasB gene is creatively changed to the ATG start codon, further increasing the expression ratio of the hasB gene, and ultimately increasing the shake flask yield by more than 160% compared to the starting strain, reaching 2.4-2.8g / L.

[0042] 3) In this technology, the same promoter Pldh as that of lactate dehydrogenase is used to express the hasB gene, and the generation of lactic acid during the fermentation process is significantly reduced through the promoter competition mechanism, making the fermentation process easier to control.

[0043] 4) The constructed strain is stable in fermentation in 15L and 50L fermenters, and the results are highly reproducible. While producing high amounts of hyaluronic acid, the molecular weight can reach 2-2.8 MDa, which is consistent with the molecular weight and distribution width of HA produced by the original strain, and has not decreased. The product molecular weight is concentrated and uniform, and has great production potential.

[0044] The present invention is described below with reference to specific embodiments. It should be noted that these embodiments are merely illustrative and do not limit the present invention in any way.

[0045] The original strain used in the following examples is Streptococcus zooepidemicus with a preservation number of CCTCC NO: M 2020231 (named as Streptococcus equi subsp. zooepidemicus HEC-SE01 in this application).

[0046] Seed culture medium (g / L): glucose 10, peptone 15, yeast extract powder 5, K2HPO4 1.5, MgSO4 0.35, pH 6.5;

[0047] Shake flask fermentation medium (g / L): glucose 30, yeast powder 5.55, peptone 16.67, K2HPO4 1.72, MgSO4 0.36, MSG 3.44, anhydrous sodium dihydrogen phosphate 9.36, disodium hydrogen phosphate dodecahydrate 43.69, pH = 7.5.

[0048] The primer sequences used in the following examples are shown in Table 1.

[0049] Table 1:

[0050]

[0051]

[0052] The nucleotide sequences of the elemental units in the constructs of the following examples are shown below.

[0053] Promoter PABC of the has gene cluster of Streptococcus zooepidemicus

[0054] TCGGAGCTCCTTATAGAATTGCTTTATTACCAATATGAAGTGGCCTGATAAGGGCT GCTTTTTTGATGTCAAAAAAGAGAGCGAAAAGCGGCTGTCCAAAGCGCTTTAGTTTTGGACGGGCCATTTAGCTGCTTGTTATCAGGCACATGCTAGCGATAGCCACAGGTAAAC TCAGGCTATCATTTGTTTTTTGTAGGGGATTGATGACTTGGTGAGCATAGGCAAATCTTAGAAAAAGCTGTATTGACACTAAGATTAATCTATCTTTAATAGAATGGTAAATTAATGA CCTTGTTTGCTTGCTGTGACAGATAGTATATTATGGTTAGCGTTTAAAGGCAAAATACAAAGCGCAAGAAAGGAACAAACCAATCACA(SEQ ID NO:1).

[0055] hasA gene

[0056] ATGAGAACATTAAAAACCTACTAGTTGTGGCCTTTAGTATTTTTTGGGTACT GTTGATTTACGTCAATGTTTATCCTTTTGGTGCTAAAGGAAGCTTGTCAATTTATGGCTTTTTGCTGATAGCTTACCTTATTAGTTTAAAATGTCCTTATCCTTTTTTTACAAGCCATTTAA GGGAAGGGCTGGCAATATAAGGTTGCAGCCCATTATTCCCTTTATAACGAAGATGCTGGAGTCCTAGAGACCTTAAAAAAGTGTTCAGCAGCAAACCTATCCCCTAGCAGAAA TTTATGTTGTTGACGATGGAAGTGCTGAGAGACAGGTATTAAAGCGCATTGGAAGACTATGTGCGTGAAACTGGTGACCTATCAAGCAATGTCATTGTTCATCGGTCAGAGAAAATC AAGGAAAGCGTCATGCACAGGCCTGGGCCTTTGGAAAAGATCAGACGCTGATGTCTTTTGACCGTTGACTCAGAGACTACTTATATCTACCCTGAAGGCTGTAAAAACC TTTAATGACCCAACAGTATATGCTGCTACAGGTCATTTGGAATGTTCGAAAATAGAGAAGT GAATCTTCTAACGCGTTTAACGGATATTCGCTATGATAATGCTTTTGGCGTGGAGCGAG CTGCCCAATCTGTTACGGGTAATATCCTTGTTGCTCAGGACCTCTTAGCATTACAGACGGCAGGTTGTAGTACCTAACATAGATAAATACATCAATCAAACCTTCTTAGGCATTCC TGTAAGCATCGGTGATGATAGGTGCTTGACCAACTATGCAACTGATTTAGGAAAGACCGTTTATCAATCTACTGCTAAATGTTATTACAGATGTTCCTGACAAGATGTCTACTTACTTGAAGCAGCAAAACCGCTGGAACAAGTCCTTCTTTTAGAGTCCATATTATTCTGTTTAAGAAAATCATGAACAATCCTTTTGTAGCCCTATGGACCATACTTGAGGTGTCTATGTTTATGATGCTTGTTTATTCTGTGGTGGATTTCTTTGTAGGCAATGTCAGAGAATTTGATTGGTTA AGGGTTTTAGCCTTTCTGGTGATTATCTTCATTGTTGCTCTTTGTCGTAATATTCACTATATGCTTAAGCACCCGCTGTCCTTCTTGTTATCTCCATTTTATGGGGTGCTGCACTTGTTTG TCCTACAGCCCTTGAAATTATATTCTCTTTTTACTATTAGAAACGCTGACTGGGGAACACGTAAAAAATTATTATAA(SEQ ID NO:2).

[0057] hasB gene

[0058] GTGAAAATTTCTGTAGCAGGCTCAGGATATGTCGGCCTATCCTTGAGTATTTTACT GGCACAACATAATGACGTCACTGTTGTTGACATTATTGATGAAAAGGTGAGATTGATCAATCAAGGCATATCGCCAATCAAGGATGCTGATATTGAGGAGTATTTAAAAAATGCGCC GCTAAATCTCACAGCGACGCTTGATGGCGCAAGCGCTTATAGCAATGCAGACCTTATTATCATTGCTACTCCGACAAATTATGACAGCGAACGCAACTACTTTGACACAAGGCATGT TGAAGAGGTCATCGAGCAGGTCCTAGACCTAAATGCGTCAGCAACCATTATTATCAAA TCAACCATACCACTAGGCTTTATCAAGCATGTTAGGGAAAAATACCAGACAGATCGTATTATTTTTAGCCCAGAATTTTTAAGAGAATCAAAAGCCTTATACGATAACCTTTACCCAA GTCGGATCATTGTTTCTTATGAAAAGGACGACTCACCAAGGGTTATTCAGGCTGCTAAAGCCTTTGCTGGTCTTTTAAAGGAAGGAGCCAAAAGCAAGGATACTCCGGTCTTATTT ATGGGCTCACAGGAGGCTGAGGCGGTCAAGCTATTTGCGAATACCTTTTTGGCCATGCGGGTGTCTTACTTTAATGAATTAGACACCTATTCCGAAAGCAAGGGTCTAGATGCTCA GCGCGTGATTGAAGGAGTCTGTCATGATCAGCGCATTGGTAACCATTACAATAACCCTTCCTTTGGATATGGCGGCTATTGCCTGCCAAAGGACAGCAAGCAGCTGTTGGCAAATTA TAGAGGCATTCCCCAGTCCTTGATGTCAGCGATTGTTGAGTCCAACAAGATACGAAAATCCTATTTAGCTGAACAAATATTAGACAGAGCCTCTAGTCAAAAGCAGGCTGGTGTACCATTAACGATTGGCTTTTACCGCTTGATTATGAAAAGCAACTCTGATAATTTCCGAGAAAGCGCCATTAAAGATATTATTGATATCATCAACGACTATGGGATTAATATTGTCATTTAC GAACCAATGCTTGGTGAGGACATTGGCTACAGGGTTGTCAAGGACTTAGAGCAGTTC AAAAACGAGTCTACAATCATTGTGTCAAATCGCTTTGAGGACGACCTAGGAGATGTCATTGACAAGGTTTACACGAGAGATGTCTTTGGAAGAGACTAG(SEQ ID NO:3).

[0059] hasC gene

[0060] ATGACCAAAGTCAGAAAAGCCATTATTCCTGCTGCAGGTCTAGGAACACGTTTTTT TACCTGCTACCAAAGCTCTTGCCAAAGAGATGTTGCCCATCGTTGATAAACCAACCATCCAGTTTATCGTCGAAGAAGCGCTAAAATCTGGCATCGAGGAAATCCTTGTGGTGACC GGAAAAGCTAAACGCTCTATCGAGGACCATTTTGATTCAAACTTTGAATTAGAATACAACCTCCAAGCTAAGGGGAAAAATGAACTGTTGAAATTAGTGGATGAAACCACTGCCA TTAACCTTCATTTTATCCGTCAAAGCCACCCAAGAGGGCTGGGAGATGCTGTCTTACAAGCCAAAGCCTTTGTGGGCAATGAACCCTTTGTGGTCATGCTTGGAGATGACTTAATG GACATTACAAATGCATCCGCTAAACCTCTCACCAAACAACTCATGGAGGACTATGACAAGACGCATGCATCCACTATCGCTGTGATGAAAGTTCCTCATGAAGATGTGTCTAGCTATGGGGTTATCGCTCCTCAAGGCAAGGCTGTCAAGGGCCTTTACAGTGTAGACACCTTTGTTGAAAAACCACAACCAGAAGATGCGCCTAGTGATTTGGCTATTATTGGTCGTTACCT CCTAACCCCTGAAATTTTTGGTATTTTGGAAAGACAGACCCCTGGAGCAGGTAACGAAGTGCAACTCACAGATGCTATCGATACCCTCAATAAAACTCAGCGTGTCTTTGCACGAG AATTTAAAGGCAATCGTTACGATGTTGGGGATAAATTTGGATTCATGAAAACATCTATC GACTATGCCTTAGAACACCCACAGGTCAAAGAGGACTTGAAAAATTACATTATCAAACTAGGAAAAGCTTTGGAAAAAAGTAAAGTACCAACACATTCAAAGTAA(SEQ ID NO:4)。

[0061] Pldh:

[0062] CTTAAGGAATGCTCCTTTTCTAGTCAATACTCTTTTAATTATACCATAAAATCCTTATTTTTCTGGTTGGAAACGCTATCCGAAAACAATTTTCATAATTTGGTCGAATATCATGA CAAAGACATTACAATGTGTTAAAATAAGATCGTATGAGCAATTTGCTCTAACTAAAATGAAGGAGATGTTTAGAA (SEQ ID NO: 5).

[0063] Example 1: Verification of starting strain shake flask fermentation

[0064] Take the Streptococcus Zooepidemicus strain and inoculate it into the seed culture medium at a rate of one thousandth and culture it until OD 660 =0.5-0.6, transferred to the fermentation medium at a 10% inoculation rate, cultured at 37°C, 220rpm for 48h, and samples were taken to detect HA production and molecular weight. The production was 0.8-0.9g / L and the molecular weight was 2-3MDa.

[0065] Example 2 Construction of pSET4 episomal expression vector

[0066] The pSET4s vector was amplified as a whole using pSET4-F / pSET4-R point mutation primers. The amplified PCR product was digested with DpnⅠ and transformed into Escherichia coli. The transformants were picked and inoculated into LB liquid culture medium containing 50 μg / mL spectinomycin and cultured overnight at 37°C and 220 rpm. The plasmid was extracted and sent for sequencing. The vector with the correct sequencing result was the free pSET4.

[0067] Example 3 Construction process of hasA overexpression strain

[0068] The PABC+hasA expression cassette (PABC is the promoter of the has gene cluster of Streptococcus zooepidemicus) was cloned from the genome of Streptococcus zooepidemicus using primers 01F / 01R. Among them, 01F introduced a Bgl Ⅱ restriction site, and 01R introduced a terminator sequence Ter and an EcoR Ⅰ restriction site. The cloned expression cassette was named PAT (PABC+hasA+Ter, and the PAT expression cassette was inserted between the Bgl Ⅱ and EcoR Ⅰ restriction sites of the pSET4 vector by restriction enzyme ligation, thereby generating the hasA overexpression vector pSET4-PAT. The plasmid map of pSET4-PAT is shown in the figure. Figure 1As shown; Streptococcus zooepidemicus was prepared into competent cells, the pSET4-PAT vector was introduced into Streptococcus zooepidemicus by electroporation, transformants were screened on BHI solid medium containing spectinomycin at a final concentration of 50 μg / mL, and the transformants were verified by YF / YR. The correct transformant was the hasA overexpression strain, and the HA production of shake flask fermentation was 1.1-1.26 g / L.

[0069] Example 4 Construction of hasAB combined overexpression strain

[0070] The hasAB expression cassette (PABC+hasA-RBS-hasB, PABC is the promoter of the has gene cluster of Streptococcus zooepidemicus, and RBS is the ribosome binding site) was cloned from the genome of Streptococcus zooepidemicus using primers 01F / 04R. Among them, 01F introduced a Bgl Ⅱ restriction site, and 04R introduced a terminator sequence Ter and a Sma Ⅰ restriction site. The cloned expression cassette was named PASBT (PABC+hasA+RBS+hasB+Ter), and the PASBT expression cassette was inserted between the Bgl Ⅱ and Sma Ⅰ restriction sites of the pSET4 vector by restriction enzyme ligation, thereby generating the hasAB combined overexpression vector pSET4-PASBT. The plasmid map of pSET4-PASBT is shown in the figure below. Figure 2 As shown; Streptococcus zooepidemicus was prepared into competent cells, the pSET4-PASBT vector was introduced into the Streptococcus zooepidemicus by electroporation, transformants were screened on BHI solid culture medium containing spectinomycin at a final concentration of 50 μg / mL, and the transformants were verified by YF / YR. The correct transformant, i.e., the hasAB combined overexpression strain, had a shake flask yield of 1.4-1.6 g / L.

[0071] Example 5 Construction of hasABC combined overexpression strain

[0072] The hasAB expression cassette (PABC+hasA+RBS+hasB+RBS+hasC, PABC is the has gene cluster promoter of Streptococcus zooepidemicus) was cloned from the genome of Streptococcus zooepidemicus using primers 01F / 05R. Among them, 01F introduced a Bgl Ⅱ restriction site, and 05R introduced a terminator sequence Ter and a Sma Ⅰ restriction site. The cloned expression cassette was named PASBSCT (PABC+hasA+RBS+hasB+RBS+hasC+Ter), and the PASBSCT expression cassette was inserted between the Bgl Ⅱ and Sma Ⅰ restriction sites of the pSET4 vector by restriction enzyme ligation, thereby generating the hasABC combined overexpression vector pSET4-PASBSCT. The plasmid map of pSET4-PASBSCT is shown in the figure. Figure 3As shown; Streptococcus zooepidemicus was prepared into competent cells, the pSET4-PASBSCT vector was introduced into Streptococcus zooepidemicus by electroporation, transformants were screened on BHI solid culture medium containing spectinomycin at a final concentration of 50 μg / mL, and the transformants were verified by YF / YR. The correct transformant, i.e., the hasAB combined overexpression strain, had a shake flask yield of 1.2-1.3 g / L.

[0073] Example 6 Overexpression of hasA and hasB using PABC promoter

[0074] The PABC+hasA expression cassette (PABC is the promoter of the has gene cluster of Streptococcus zooepidemicus) was cloned from the genome of Streptococcus zooepidemicus using primers 01F / 01R. Among them, 01F introduced a Bgl Ⅱ restriction site, and 01R introduced a terminator sequence Ter and an EcoR Ⅰ restriction site. The cloned expression cassette was named P1AT (PABC+hasA+Ter), and the PAT expression cassette was inserted between the Bgl Ⅱ and EcoR Ⅰ restriction sites of the pSET4 vector by restriction enzyme ligation, thereby generating the first free expression vector pSET4-P1AT; the PABC promoter sequence was cloned from the genome of Streptococcus zooepidemicus using primers 06F / 06R, and the hasB gene was cloned from the genome of Streptococcus zooepidemicus using primers 07F / 03R. Among them, the EcoR Ⅰ restriction site was introduced by 07F primer, and the GTG of hasB gene was mutated to ATG to enhance the translation efficiency of hasB. A terminator sequence Ter and sal Ⅰ restriction site were introduced by 03R. Then, the PABC promoter and hasB+Ter fragment were connected together by overlap PCR using 06F / 03R to form the PABC+hasB+Ter expression frame, which was named P1BT. Finally, P1BT was inserted between the EcoR Ⅰ and sal Ⅰ restriction sites of pSET4-P1AT vector by restriction enzyme ligation, thereby generating the second free expression vector pSET4-P1AT-P1BT. The plasmid map of pSET4-P1AT-P1BT is shown in Figure 4.

[0075] Example 7 Overexpression of hasA using the Pldh promoter and overexpression of hasB using the PABC promoter

[0076] The Pldh promoter (marked as P2) was cloned from the genome of Streptococcus zooepidemicus using primers 04F / 07R, the hasA fragment was cloned from the genome of Streptococcus zooepidemicus using primers 08F / 01R, and the Pldh and hasA fragments were fused using primers 04F / 01R. Among them, 04F introduced a Bgl Ⅱ restriction site, and 01R introduced a terminator sequence Ter and an EcoR Ⅰ restriction site. The cloned expression cassette was named P2AT (Pldh+hasA+Ter, abbreviated by the first letters), and the P2AT expression cassette was inserted between the Bgl Ⅱ and EcoR Ⅰ restriction sites of the pSET4 vector by restriction enzyme ligation, thereby generating the first free expression vector pSET4-P2AT; the PABC promoter sequence was cloned from the genome of Streptococcus zooepidemicus using primers 06F / 06R, and the hasB gene was cloned from the genome of Streptococcus zooepidemicus using primers 07F / 03R. Among them, the EcoR Ⅰ restriction site was introduced through the 07F primer, and the GTG of the hasB gene was mutated to ATG to enhance the translation efficiency of hasB. A terminator sequence Ter and a sal Ⅰ restriction site were introduced through 03R. Then, the PABC promoter and the hasB+Ter fragment were connected together through overlap PCR using 06F / 03R to form the PABC+hasB+Ter expression frame, which was named P1BT. Finally, P1BT was inserted between the EcoR Ⅰ and sal Ⅰ restriction sites of the pSET4-P2AT vector by enzyme ligation, thereby generating a second free expression vector pSET4-P2AT-P1BT. The plasmid map of pSET4-P2AT-P1BT is shown in the figure. Figure 5 shown.

[0077] Example 8 Overexpression of hasA and hasB using Pldh

[0078] The Pldh promoter (marked as P2) was cloned from the genome of Streptococcus zooepidemicus using primers 04F / 07R, the hasA fragment was cloned from the genome of Streptococcus zooepidemicus using primers 08F / 01R, and the Pldh and hasA fragments were fused using primers 04F / 01R. Among them, 03F introduced a Bgl Ⅱ restriction site, and 01R introduced a terminator sequence Ter and an EcoR Ⅰ restriction site. The cloned expression cassette was named P2AT (Pldh+hasA+Ter), and the P2AT expression cassette was inserted between the Bgl Ⅱ and EcoR Ⅰ restriction sites of the pSET4 vector by restriction enzyme ligation, thereby generating the first free expression vector pSET4-P2AT; the Pldh promoter sequence (lactate dehydrogenase promoter) was cloned from the genome of Streptococcus zooepidemicus using primers 02F / 02R, and the hasB gene was cloned from the genome of Streptococcus zooepidemicus using primers 03F / 03R. Among them, the EcoR Ⅰ restriction site was introduced through the 02F primer, the GTG of the hasB gene was mutated to ATG through 03F to enhance the translation efficiency of hasB, and a terminator sequence Ter and a sal Ⅰ restriction site were introduced through 03R. Then, the Pldh promoter and the hasB+Ter fragment were connected together through overlap PCR using 02F / 03R to form a Pldh+hasB+Ter expression frame, which was named P2BT. Finally, P2BT was inserted between the EcoR Ⅰ and sal Ⅰ restriction sites of the pSET4-PAT vector by enzyme ligation, thereby generating a second free expression vector pSET4-P2AT-P2BT. The plasmid map of pSET4-P2AT-P2BT is shown in the figure. Figure 6 shown.

[0079] Example 9 Construction of HEC-SE02 strain

[0080] The PABC+hasA expression cassette (PABC is the promoter of the has gene cluster of Streptococcus zooepidemicus) was cloned from the genome of Streptococcus zooepidemicus using primers 01F / 01R. Among them, 01F introduced a Bgl Ⅱ restriction site, and 01R introduced a terminator sequence Ter and an EcoR Ⅰ restriction site. The cloned expression cassette was named P1AT (PABC+hasA+Ter), and the PAT expression cassette was inserted between the Bgl Ⅱ and EcoR Ⅰ restriction sites of the pSET4 vector by restriction enzyme ligation, thereby generating the first free expression vector pSET4-P1AT; the Pldh promoter sequence (lactate dehydrogenase promoter) was cloned from the genome of Streptococcus zooepidemicus using primers 02F / 02R, and the hasB gene was cloned from the genome of Streptococcus zooepidemicus using primers 03F / 03R. Among them, the EcoR Ⅰ restriction site was introduced through the 02F primer, the GTG of the hasB gene was mutated into ATG through 03F to enhance the translation efficiency of hasB, and a terminator sequence Ter and a sal Ⅰ restriction site were introduced through 03R. Then, the Pldh promoter and the hasB+Ter fragment were connected together through overlap PCR using 02F / 03R to form a Pldh+hasB+Ter expression frame, which was named P2BT. Finally, P2BT was inserted between the EcoR Ⅰ and sal Ⅰ restriction sites of the pSET4-P1AT vector by enzyme ligation, thereby generating a second free expression vector pSET4-P1AT-P2BT. The plasmid map of pSET4-P1AT-P2BT is shown in the figure. Figure 7 As shown; Streptococcus zooepidemicus was prepared into competent cells, and the pSET4-P1AT-P2BT vector was introduced into Streptococcus zooepidemicus by electroporation. Transformants were screened on BHI solid medium containing spectinomycin at a final concentration of 50 μg / mL, and the transformants were verified by YF / YR. The agarose gel electrophoresis of the transformants is shown in Figure 8 As shown, the correct transformant is verified to be the final strain.

[0081] Example 10 Final strain shake flask fermentation verification

[0082] The final strain obtained in Example 9 was streaked and activated on a BHI solid medium containing spectinomycin at a final concentration of 50 μg / ml, and cultured at 37°C for 24 h; 5 mL of sterile saline was taken to wash the bacteria, and 1% was inoculated into a seed medium supplemented with spectinomycin at a final concentration of 50 μg / mL, and cultured at 37°C, 220 rpm for 12 h until the OD 660 =0.3-0.6, inoculated into the fermentation medium at 10%, cultured at 37°C, 220rpm for 48h, sampled and diluted 20 times to measure HA production and molecular weight by GPC, the HA production in the shake flask was 2.4-2.8g / L, and the molecular weight was 2-2.8MDa.

[0083] Example 11 Detection of lactic acid content during fermentation of the final strain 15L fermenter

[0084] The final bacterial strain obtained in Example 9 stored in the glycerol tube was inoculated into 1 L of seed culture medium supplemented with 50 μg / mL spectinomycin at a final concentration of 1% and cultured until OD 660 = 0.4, the seed solution was inoculated into a 15L fermentation tank and fermented at 37°C for 48h. During this period, NaOH was added to adjust the pH to 7.0, and the final fermentation liquid sample was taken to test the lactic acid content. It was found that the lactic acid content of the HEC-HAZ strain was 30-35g / L, while the lactic acid content of the starting strain was 42-50g / L, which was significantly lower.

[0085] The comparison of genotypes, HA shake flask yields and molecular weights in the above examples is shown in Table 2.

[0086] Table 2: Comparison of genotypes and HA shake flask yields and molecular weights in various examples

[0087]

[0088] It can be seen from the results in Table 1 that the combined expression of hasAB resulted in a higher HA shake flask yield than overexpression of hasA alone or combined expression of hasABC; the HA shake flask yield was higher when PABC expressed hasA and Pldh expressed hasB than when PABC expressed hasA and hasB separately, Pldh expressed hasA, PABC expressed hasB or Pldh overexpressed hasA and hasB separately.

[0089] In the description of this specification, the description with reference to the terms "one embodiment", "some embodiments", "example", "specific example", or "some examples" etc. means that the specific features, structures, materials or characteristics described in conjunction with the embodiment or example are included in at least one embodiment or example of the present invention. In this specification, the schematic representations of the above terms do not necessarily refer to the same embodiment or example. Moreover, the specific features, structures, materials or characteristics described may be combined in any one or more embodiments or examples in a suitable manner. In addition, those skilled in the art may combine and combine the different embodiments or examples described in this specification and the features of the different embodiments or examples, without contradiction.

[0090] Although the embodiments of the present invention have been shown and described above, it is to be understood that the above embodiments are exemplary and are not to be construed as limitations of the present invention. A person skilled in the art may change, modify, replace and vary the above embodiments within the scope of the present invention. SEQUENCE LISTING <110> Yichang East Sunshine Biochemical Pharmaceutical Co., Ltd. <120> Genetically engineered strains of Streptococcus zooepidemicus and their applications <130> PIDC4200127 <160> twenty three <170> PatentIn version 3.5 <210> 1 <211> 377 <212> DNA <213> Artificial Sequence <220> <223> The promoter of the has gene cluster of Streptococcus zooepidemicus PABC <400> 1 tcggagctcc ttatagaatt gctttattac caatatgaag tggcctgata agggctgctt 60 ttttgatgtc aaaaaagaga gcgaaaagcg gctgtccaaa gcgctttagt tttggacggg 120 ccatttagct gcttgttatc aggcacatgc tagcgatagc cacaggtaaa ctcaggctat 180 catttgtttt ttgtagggga ttgatgactt ggtgagcata ggcaaatctt agaaaaagct 240 gtattgacac taagattaat ctatctttaa tagaatggta aattaatgac cttgtttgct 300 tgctgtgaca gatagtatat tatggttagc gtttaaaggc aaaatacaaa gcgcaagaaa 360 ggaacaaacc aatcaca 377 <210> 2 <211> 1254 <212> DNA <213> Artificial Sequence <220> <223> has the A gene <400> 2 atgagaacat taaaaaacct cataactgtt gtggccttta gtattttttg ggtactgttg 60 atttacgtca atgtttatct ctttggtgct aaaggaagct tgtcaattta tggctttttg 120 ctgatagctt acctattagt taaaatgtcc ttatcctttt tttacaagcc atttaaggga 180 agggctgggc aatataaggt tgcagccatt attccctctt ataacgaaga tgctgagtca 240 ttgctagaga ccttaaaaag tgttcagcag caaacctatc ccctagcaga aatttatgtt 300 gttgacgatg gaagtgctga tgagacaggt attaagcgca ttgaagacta tgtgcgtgaa 360 actggtgacc tatcaagcaa tgtcattgtt catcggtcag agaaaaatca aggaaagcgt 420 catgcacagg cctgggcctt tgaaagatca gacgctgatg tctttttgac cgttgactca 480 gatacttata tctaccctga tgctttggag gagctgttaa aaacctttaa tgacccaaca 540 gtatatgctg ctacaggtca tttgaatgtt cgaaatagag aagtgaatct tctaacgcgt 600 ttaacggata ttcgctatga taatgctttt ggcgtggagc gagctgccca atctgttacg 660 ggtaatatcc ttgtttgctc aggacctctt agcatttaca gacgcgaggt tgtagtacct 720 aacatagata aatacatcaa tcaaaccttc ttaggcattc ctgtaagcat cggtgatgat 780 aggtgcttga ccaactatgc aactgattta ggaaagaccg tttatcaatc tactgctaaa 840 tgtattacag atgttcctga caagatgtct acttacttga agcagcaaaa ccgctggaac 900 aagtccttct ttagagagtc cattatttct gttaagaaaa tcatgaacaa tccttttgta 960 gccctatgga ccatacttga ggtgtctatg tttatgatgc ttgtttattc tgtggtggat 1020 ttctttgtag gcaatgtcag agaatttgat tggttaaggg ttttagcctt tctggtgatt 1080 atcttcattg ttgctctttg tcgtaatatt cactatatgc ttaagcaccc gctgtccttc 1140 ttgttatctc cattttatgg ggtgctgcac ttgtttgtcc tacagccctt gaaattatat 1200 tctcttttta ctattagaaa cgctgactgg ggaacacgta aaaaattatt ataa 1254 <210> 3 <211> 1206 <212> DNA <213> Artificial Sequence <220> <223> hasB gene <400> 3 gtgaaaattt ctgtagcagg ctcaggatat gtcggcctat ccttgagtat tttactggca 60 aacataatg acgtcactgt tgttgacatt attgaatgaaa aggtgagatt gatcaatcaa 120 ggcatatcgc caatcaagga tgctgatatt gaggagtatt taaaaaatgc gccgctaaat 180 ctcacagcga cgcttgatgg cgcaagcgct tatagcaatg cagaccttat tatcattgct 240 300 atcgagcagg tcctagacct aaatgcgtca gcaaccatta ttatcaaatc aaccatacca 360 ctaggcttta tcaagcatgt taggggaaaaa taccagacag atcgtattat ttttagccca 420 gaatttttaa gagaatcaaa agccttatac gataaccttt acccaagtcg gatcattgtt 480 tcttatgaaa aggacgactc accaagggtt attcaggctg ctaaagcctt tgctggtctt 540 ttaaaggaag gagccaaaag caaggatact ccggtcttat ttatgggctc acaggaggct 600 gaggcggtca agctatttgc gaataccttt ttggccatgc gggtgtctta ctttaatgaa 660 ttagacacct attccgaaag caagggtcta gatgctcagc gcgtgattga aggagtctgt 720 catgatcagc gcattggtaa ccattacaat aacccttcct ttggatatgg cggctattgc 780 ctgccaaagg acagcaagca gctgttggca aattatagag gcattcccca gtccttgatg 840 tcagcgattg ttgagtccaa caagatacga aaatcctatt tagctgaaca aatattagac 900 agagcctcta gtcaaaagca ggctggtgta ccattaacga ttggctttta ccgcttgatt 960 atgaaaagca actctgataa tttccgagaa agcgccatta aagatattat tgatatcatc 1020 aacgactatg ggattaatat tgtcatttac gaaccaatgc ttggtgagga cattggctac 1080 agggttgtca aggacttaga gcagttcaaa aacgagtcta caatcattgt gtcaaatcgc 1140 tttgaggacg acctaggaga tgtcattgac aaggtttaca cgagagatgt ctttggaaga 1200 gactag 1206 <210> 4 <211> 915 <212> DNA <213> Artificial Sequence <220> <223> hasC gene <400> 4 atgaccaaag tcagaaaagc cattattcct gctgcaggtc taggaacacg ttttttacct 60 gctaccaaag ctcttgccaa agagatgttg cccatcgttg ataaaccaac catccagttt 120 atcgtcgaag aagcgctaaa atctggcatc gaggaaatcc ttgtggtgac cggaaaagct aaacgctcta tcgaggacca ttttgattca aactttgaat tagatacaa cctccaagct aaggggaaaa atgaactgtt gaattagtg gatgaacca ctgccattaa ccttcatttt atccgtcaaa gccacccaag agggctggga gatgctgtct tacaagccaa agcctttgtg 360 ggcaatgaac cctttgtggt catgcttgga gatgacttaa tggacattac aaatgcatcc gctaaacctc tcaccaaaca actcatggag gactatgaca agacgcatgc atccactatc gctgtgatga aagttcctca tgaagatgtg tctagctatg gggttatcgc tcctcaaggc 540 aaggctgtca agggccttta cagtgtagac acctttgttg aaaaaccaca accagagat gcgcctagtg atttggctat tattggtcgt tacctcctaa cccctgaaat ttttggtatt ttggaagac agacccctgg agcaggtac gaagtgcaac tcacagatgc tatcgatacc ctcaataaaa ctcagcgtgt ctttgcacga gaatttaag gcaatcgtta cgatgttggg gataatttg gattcatga aacatctatc gactatgcct tagaccc acaggtcaaa gaggacttga aaaattacat tatcaaacta ggaaaagctt tggaaaaaag taaagtacca 900 acacattcaa agtaa 915 <210> 5 <211> 192 <212> DNA <213> Artificial Sequence <220> <223> Pldh <400> 5 cttaaggaat gctccttttc tagtcaatac tcttttaatt ataccataaa atccttattt 60 tttctggttg gaaacgctat ccgaaaacaa ttttcataat ttggtcgaat atcatgacaa 120 agacattaca atgtgttaaa ataagatcgt atgagcaatt tgctctaact aaaatgaagg 180 agatgtttag aa 192 <210> 6 <211> 33 <212> DNA <213> Artificial Sequence <220> <223> 01F <400> 6 gaagatcttc ggagctcctt atagaattgc ttt 33 <210> 7 <211> 63 <212> DNA <213> Artificial Sequence <220> <223> 01R <400> 7 ggaattccaa aaaagcccgc tcattaggcg ggctttataa taatttttta cgtgttcccc 60 agt 63 <210> 8 <211> 28 <212> DNA <213> Artificial Sequence <220> <223> 02F <400> 8 ggaattcctt aaggaatgct ccttttct 28 <210> 9 <211> 47 <212> DNA <213> Artificial Sequence <220> <223> 02R <400> 9 gcctgctaca gaaattttca tttctaaaca tctccttcat tttagtt 47 <210> 10 <211> 47 <212> DNA <213> Artificial Sequence <220> <223> 03F <400> 10 aactaaaatg aaggagatgt ttagaaatga aaatttctgt agcaggc 47 <210> 11 <211> 62 <212> DNA <213> Artificial Sequence <220> <223> 03R <400> 11 acgcgtcgac gtcaaaaaag cccgctcatt aggcgggctc tagtctcttc caaagacatc 60 tc 62 <210> 12 <211> 31 <212> DNA <213> Artificial Sequence <220> <223> 04F <400> 12 gaagatcttt aaggaatgct ccttttctag t 31 <210> 13 <211> 61 <212> DNA <213> Artificial Sequence <220> <223> 04R <400> 13 tcccccgggg gaaaaaaagc ccgctcatta ggcgggctct agtctcttcc aaagacatct 60 c 61 <210> 14 <211> 61 <212> DNA <213> Artificial Sequence <220> <223> 05R <400> 14 tcccccgggg gaaaaaaagc ccgctcatta ggcgggctct atttcttgac gtccttgttc 60 a 61 <210> 15 <211> 31 <212> DNA <213> Artificial Sequence <220> <223> 06F <400> 15 ggaattccgg agctccttat agaattgctt t 31 <210> 16 <211> 44 <212> DNA <213> Artificial Sequence <220> <223> 06R <400> 16 gcctgctaca gaaattttca ttgtgattgg tttgttcctt tctt 44 <210> 17 <211> 44 <212> DNA <213> Artificial Sequence <220> <223> 07F <400> 17 aagaaaggaa caaaccaatc acaatgaaaa tttctgtagc aggc 44 <210> 18 <211> 47 <212> DNA <213> Artificial Sequence <220> <223> 07R <400> 18 atgaggtttt ttaatgttct catttctaaa catctccttc attttag 47 <210> 19 <211> 47 <212> DNA <213> Artificial Sequence <220> <223> 08F <400> 19 ctaaaatgaa ggagatgttt agaaatgaga acattaaaaa acctcat 47 <210> 20 <211> 44 <212> DNA <213> Artificial Sequence <220> <223> pSET4-F <400> 20 gatacatgga atagtagtga tgttatacga aatggaaagc acta 44 <210> 21 <211> 44 <212> DNA <213> Artificial Sequence <220> <223> pSET4-R <400> 21 tagtgctttc catttcgtat aacatcacta ctattccatg tatc 44 <210> 22 <211> 21 <212> DNA <213> Artificial Sequence <220> <223> YF <400> 22 tgagaggagg gattattgaa t 21 <210> 23 <211> 17 <212> DNA <213> Artificial Sequence <220> <223> YR <400> 23 gtcatagctg tttcctg 17

Claims

1. A Streptococcus zooepidemicus ( Streptococcus zooepidemicus ), characterized in that Carrying an exogenous gene expression cassette, wherein the exogenous gene expression cassette includes a first gene expression cassette and a second gene expression cassette, Wherein, the first gene expression frame comprises a first promoter and a hasA gene, and the first promoter and the hasA gene are operably connected; The second gene expression frame includes a second promoter and a hasB gene, and the second promoter and the hasB gene are operably connected.

2. The genetically engineered strain according to claim 1, characterized in that: The first gene expression cassette and the second gene expression cassette are arranged on different constructs or on the same construct.

3. The genetically engineered strain according to claim 2, characterized in that The construct comprises at least one selected from pSET4, pSET4s, pEU308, and pDL276.

4. The genetically engineered strain according to claim 2, characterized in that The first gene expression cassette and the second gene expression cassette are arranged on the same construct, and the 3' end of the first gene expression cassette is connected to the 5' end of the second gene expression cassette or the 3' end of the second gene expression cassette is connected to the 5' end of the first gene expression cassette.

5. The genetically engineered strain according to claim 2, characterized in that The construct is an episomal pSET4 vector.

6. The genetically engineered strain according to claim 1, characterized in that The strength of the gene expression driven by the first promoter is weaker than the strength of the gene expression driven by the second promoter.

7. The genetically engineered strain according to claim 1, characterized in that The first promoter and the second promoter are independently selected from PGAPDH, PacK, PABC or Pldh.

8. The genetically engineered strain according to claim 1, characterized in that The first promoter is PABC, and the second promoter is Pldh.

9. The genetically engineered strain according to claim 1, characterized in that: The start codon of the hasB gene is ATG.

10. The genetically engineered strain according to claim 1, characterized in that: The preservation number of the zooepidemic streptococcus is CCTCC NO:M 2020231.

11. A method for improving the synthesis of hyaluronic acid by Streptococcus zooepidemicus, characterized in that: The Streptococcus zooepidemicus carries an exogenous gene expression cassette, wherein the exogenous gene expression cassette includes a first gene expression cassette and a second gene expression cassette, The first gene expression frame includes a first promoter and a hasA gene, and the first promoter and the hasA gene are operably connected; the second gene expression frame includes a second promoter and a hasB gene, and the second promoter and the hasB gene are operably connected.

12. The method according to claim 11, characterized in that The first gene expression cassette and the second gene expression cassette are arranged on different constructs or on the same construct.

13. The method according to claim 12, characterized in that The construct comprises at least one selected from pSET4, pSET4s, pEU308, and pDL276.

14. The method according to claim 12, characterized in that The first gene expression cassette and the second gene expression cassette are arranged on the same construct, and the 3' end of the first gene expression cassette is connected to the 5' end of the second gene expression cassette or the 3' end of the second gene expression cassette is connected to the 5' end of the first gene expression cassette.

15. The method according to claim 12, characterized in that The construct is an episomal pSET4 vector.

16. The method according to claim 11, characterized in that The strength of the gene expression driven by the first promoter is weaker than the strength of the gene expression driven by the second promoter.

17. The method according to claim 11, characterized in that The first promoter and the second promoter are independently selected from PABC or Pldh.

18. The method according to claim 11, characterized in that The first promoter is PABC, and the second promoter is Pldh.

19. The method according to claim 11, characterized in that The start codon of the hasB gene is ATG.

20. The method according to claim 11, characterized in that The method of making Streptococcus zooepidemicus carry an exogenous gene expression cassette is achieved by introducing a construct carrying the desired gene expression cassette into Streptococcus zooepidemicus by electroporation.

21. A method for producing hyaluronic acid, characterized in that: The genetically engineered strain according to any one of claims 1 to 10 is subjected to fermentation treatment to obtain the hyaluronic acid.

Images