Two ergothioneine-synthesizing proteins and their applications in ergothioneine synthesis

Abstract

The present invention discloses two ergothioneine-synthesizing proteins and their applications in ergothioneine synthesis. The two ergothioneine-synthesizing proteins disclosed by the present invention are proteins named Tregt1 and Tregt2 respectively. Tregt1 is a protein with an amino acid sequence of Sequence 2; Tregt2 is a protein with an amino acid sequence of Sequence 4. Experiments have proved that Tregt1 and Tregt2 of the present invention can be used to prepare ergothioneine, and the yield can reach 4.5 g / L in 144 hours, which is 3.46 times the highest reported production level at present, and the time is shortened by 72 hours. Tregt1 and Tregt2 of the present invention and their encoding genes have broad application prospects.

Description

Technical Field

[0001] The present invention relates to two ergothioneine-synthesizing proteins in the field of biotechnology and their applications in ergothioneine synthesis. Background Art

[0002] Ergothioneine (2-mercapto-L-histidine trimethyl inner salt, Ergothioneine, ERG) is a rare natural mercaptoimidazole amino acid with extremely strong antioxidant capacity and cell protection function. It plays an important role in scavenging hydroxyl radicals (·OH), hypochlorous acid (HOCl), peroxynitrite (ONOO-), activating antioxidant enzymes, chelating divalent metal ions (such as Cu 2+ ), preventing ultraviolet damage, inhibiting hemoglobin oxidation, anti-inflammatory, anti-aging, inhibiting tumorigenesis and other aspects. The unique and diverse biological functions of ergothioneine endow it with broad application prospects in industries such as medicine, food, health products, and cosmetics.

[0003] Some fungi, bacteria of the class Actinobacteria, and unicellular cyanobacteria can synthesize ergothioneine, while animals and plants cannot synthesize ergothioneine and can only obtain it through diet or from the surrounding environment. Ergothioneine is mainly produced by chemical synthesis and natural extraction. Extracting ergothioneine by fermenting edible mushroom mycelia has a long fermentation period and low yield; while the safety of products obtained by chemical synthesis cannot be guaranteed. People have achieved the biosynthesis of ergothioneine in various systems such as Escherichia coli, Bacillus subtilis, Aspergillus oryzae, Saccharomyces cerevisiae, etc. However, the synthesis efficiency and yield of ergothioneine still lack economic competitiveness and are difficult to be widely applied. Therefore, it is very necessary to find new genes and new methods to further improve the yield of ergothioneine.

[0004] Trichoderma reesei is a food safety strain certified by the US FDA and is widely used in the production of cellulase, but there is no report on the synthesis of ergothioneine. Summary of the Invention

[0005] The primary object of the present invention is to provide the application of a group of Trichoderma reesei genes tregt1 and tregt2 in the synthesis of ergothioneine.

[0006] The present invention first provides a set of proteins that can be used for the production of ergothioneine. The set of proteins consists of proteins named Tregt1 and Tregt2 respectively. Both Tregt1 and Tregt2 are derived from Trichoderma reesei. Tregt1 is one of the following A1), A2), or A3):

[0007] A1) A protein with an amino acid sequence of Sequence 2;

[0008] A2) A protein having the amino acid sequence shown in Sequence 2 of the sequence listing, with one or several amino acid residues substituted and / or deleted and / or added, and having the same function;

[0009] A3) A fusion protein obtained by connecting a tag to the N-terminus and / or C-terminus of A1) or A2);

[0010] The Tregt2 is any of the following C1), C2), or C3):

[0011] C1) A protein having the amino acid sequence of Sequence 4;

[0012] C2) A protein having the amino acid sequence shown in Sequence 4 of the sequence listing, with one or several amino acid residues substituted and / or deleted and / or added, and having the same function;

[0013] C3) A fusion protein obtained by connecting a tag to the N-terminus and / or C-terminus of C1) or C2).

[0014] In order to facilitate the purification of the protein in A1) or C1), a tag shown in the following table can be connected to the amino terminus or carboxyl terminus of the protein composed of the amino acid sequence shown in Sequence 2 or 4 of the sequence listing.

[0015] Table: Sequences of tags

[0016]

[0017] The protein in the above A2) is a protein having 75% or more identity with the amino acid sequence of the protein shown in Sequence 2 and having the same function. The protein in the above C2) is a protein having 75% or more identity with the amino acid sequence of the protein shown in Sequence 4 and having the same function. The 75% or more identity means having 75%, 80%, 85%, 90%, 95%, 96%, 97%, 98%, or 99% identity.

[0018] The proteins in the above A2) and C2) can be artificially synthesized, or their encoding genes can be synthesized first and then biologically expressed.

[0019] The coding gene of the protein in A2) above can be obtained by deleting the codons of one or several amino acid residues in the DNA sequence shown in Sequence 1, and / or performing missense mutations of one or several base pairs, and / or ligating the coding sequences of the tags shown in the above table at its 5′ end and / or 3′ end. Among them, the DNA molecule shown in Sequence 1 encodes the protein shown in Sequence 2. The coding gene of the protein in C2) above can be obtained by deleting the codons of one or several amino acid residues in the DNA sequence shown in Sequence 3, and / or performing missense mutations of one or several base pairs, and / or ligating the coding sequences of the tags shown in the above table at its 5′ end and / or 3′ end. Among them, the DNA molecule shown in Sequence 3 encodes the protein shown in Sequence 4.

[0020] The above-mentioned set of proteins has any of the following uses:

[0021] X1. Producing ergothioneine;

[0022] X2. Preparing a product for producing ergothioneine;

[0023] X3. Preparing an antioxidant or cytoprotective product;

[0024] X4. Preparing a product for scavenging hydroxyl radicals, scavenging hypochlorous acid, scavenging peroxynitrite, activating antioxidant enzymes, chelating divalent metal ions, preventing ultraviolet damage, inhibiting hemoglobin oxidation, anti-inflammatory, anti-aging or inhibiting tumorigenesis.

[0025] The present invention also provides a set of biological materials, which is composed of biological material 1 and biological material 2 respectively named, and the biological material 1 is any one of the following B1) to B5):

[0026] B1) A nucleic acid molecule encoding the Tregt1;

[0027] B2) An expression cassette containing the nucleic acid molecule described in B1);

[0028] B3) A recombinant vector containing the nucleic acid molecule described in B1), or a recombinant vector containing the expression cassette described in B2);

[0029] B4) A recombinant microorganism containing the nucleic acid molecule described in B1), or a recombinant microorganism containing the expression cassette described in B2), or a recombinant microorganism containing the recombinant vector described in B3);

[0030] B5) A cell line containing the nucleic acid molecule described in B1), or a cell line containing the expression cassette described in B2);

[0031] The biological material 2 is any one of the following D1) to D5):

[0032] D1) A nucleic acid molecule encoding the Tregt2;

[0033] D2) An expression cassette containing the nucleic acid molecule described in D1);

[0034] D3) A recombinant vector containing the nucleic acid molecule described in D1), or a recombinant vector containing the expression cassette described in D2);

[0035] D4) A recombinant microorganism containing the nucleic acid molecule described in D1), or a recombinant microorganism containing the expression cassette described in D2), or a recombinant microorganism containing the recombinant vector described in D3);

[0036] D5) A cell line containing the nucleic acid molecule described in D1), or a cell line containing the expression cassette described in D2).

[0037] The present invention also provides a biological material named biological material 3, and the biological material 3 is any one of the following E1) to E4):

[0038] E1) An expression cassette containing the nucleic acid molecule described in B1) and the nucleic acid molecule described in D1);

[0039] E2) A recombinant vector containing the expression cassette described in E1);

[0040] E3) A recombinant microorganism containing the expression cassette described in E1), or a recombinant microorganism containing the recombinant vector described in E2);

[0041] E4) A cell line containing the expression cassette described in E1).

[0042] Among the above biological materials, the nucleic acid molecule described in B1) may be any of the following b11) or b12) or b13) or b14):

[0043] b11) A cDNA molecule or a DNA molecule whose coding sequence is the cDNA molecule or DNA molecule of sequence 1 in the sequence listing;

[0044] b12) The DNA molecule shown in sequence 1 of the sequence listing;

[0045] b13) A cDNA molecule or a DNA molecule that has 75% or more identity with the nucleotide sequence defined by b11) or b12) and encodes the Tregt1;

[0046] b14) A cDNA molecule or a DNA molecule that hybridizes with the nucleotide sequence defined by b11) or b12) or b13) under stringent conditions and encodes the Tregt1;

[0047] The nucleic acid molecule described in D1) may be any of the following d11) or d12) or d13) or d14):

[0048] d11) A cDNA molecule or a DNA molecule whose coding sequence is the cDNA molecule or DNA molecule of sequence 3 in the sequence listing;

[0049] d12) The DNA molecule shown as Sequence 3 in the Sequence Listing;

[0050] d13) A cDNA molecule or DNA molecule that has 75% or more identity with the nucleotide sequence defined by d11) or d12) and encodes the Tregt2;

[0051] d14) A cDNA molecule or DNA molecule that hybridizes with the nucleotide sequence defined by d11) or d12) or d13) under stringent conditions and encodes the Tregt2.

[0052] Wherein, the nucleic acid molecule may be DNA, such as cDNA, genomic DNA or recombinant DNA; the nucleic acid molecule may also be RNA, such as mRNA or hnRNA, etc.

[0053] Those of ordinary skill in the art can easily mutate the nucleotide sequences encoding the Tregt1 and the Tregt2 proteins of the present invention by using known methods, such as methods of directed evolution and point mutation. Those artificially modified nucleotides having 75% or higher identity with the nucleotide sequences of the Tregt1 and the Tregt2 proteins of the present invention, as long as they encode the Tregt1 and the Tregt2 proteins and have the functions of the Tregt1 and the Tregt2 proteins, are all derived from the nucleotide sequences of the present invention and are equivalent to the sequences of the present invention.

[0054] As used herein, the term "identity" refers to the sequence similarity with a natural nucleic acid sequence. "Identity" includes nucleotide sequences having 75% or higher, or 85% or higher, or 90% or higher, or 95% or higher identity with the nucleotide sequence of the protein composed of the amino acid sequences shown in Coding Sequence 2 or 4 of the present invention. Identity can be evaluated by the naked eye or by computer software. Using computer software, the identity between two or more sequences can be expressed as a percentage (%), which can be used to evaluate the identity between related sequences.

[0055] In the above text, the stringent conditions may be as follows: hybridization at 50°C in a mixed solution of 7% sodium dodecyl sulfate (SDS), 0.5 M NaPO4, and 1 mM EDTA, and rinsing at 50°C in 2×SSC, 0.1% SDS; alternatively: hybridization at 50°C in a mixed solution of 7% SDS, 0.5 M NaPO4, and 1 mM EDTA, and rinsing at 50°C in 1×SSC, 0.1% SDS; alternatively: hybridization at 50°C in a mixed solution of 7% SDS, 0.5 M NaPO4, and 1 mM EDTA, and rinsing at 50°C in 0.5×SSC, 0.1% SDS; alternatively: hybridization at 50°C in a mixed solution of 7% SDS, 0.5 M NaPO4, and 1 mM EDTA, and rinsing at 50°C in 0.1×SSC, 0.1% SDS; alternatively: hybridization at 50°C in a mixed solution of 7% SDS, 0.5 M NaPO4, and 1 mM EDTA, and rinsing at 65°C in 0.1×SSC, 0.1% SDS; or: hybridization in a solution of 6×SSC, 0.5% SDS at 65 o Hybridization was carried out at C, and then the membrane was washed once with 2×SSC, 0.1% SDS and once with 1×SSC, 0.1% SDS; alternatively: hybridization and membrane washing were carried out 2 times at 68°C in a solution of 2×SSC, 0.1% SDS for 5 min each time, and then hybridization and membrane washing were carried out 2 times at 68°C in a solution of 0.5×SSC, 0.1% SDS for 15 min each time; alternatively: hybridization and membrane washing were carried out at 65°C in a solution of 0.1×SSPE (or 0.1×SSC), 0.1% SDS.

[0056] The above identity of 75% or more may be an identity of 80%, 85%, 90% or more than 95%.

[0057] As described above, the expression cassette containing the nucleic acid molecule encoding the Tregt1 protein (Tregt1 gene expression cassette) in B2) refers to DNA capable of expressing the Tregt1 protein in a host cell. This DNA may not only include a promoter that initiates transcription of the Tregt1 gene but also a terminator that terminates transcription of the Tregt1 gene. The expression cassette containing the nucleic acid molecule encoding the Tregt2 protein (Tregt2 gene expression cassette) in D2) refers to DNA capable of expressing the Tregt2 protein in a host cell. This DNA may not only include a promoter that initiates transcription of the Tregt2 gene but also a terminator that terminates transcription of the Tregt2 gene. The expression cassette in E1) refers to DNA capable of expressing the Tregt1 and Tregt2 proteins in a host cell. This DNA may not only include promoters that initiate transcription of the Tregt1 gene and the Tregt2 gene but also terminators that terminate transcription of the Tregt1 gene and the Tregt2 gene. Further, the expression cassette may also include enhancer sequences.

[0058] Existing expression vectors can be used to construct recombinant vectors containing the Tregt1 gene and / or the Tregt2 gene expression cassette.

[0059] As described above, the vector can be a plasmid, cosmid, phage or viral vector. Specifically, the plasmid can be the pBAD / HisA plasmid.

[0060] Specifically, the recombinant vector in B3) can be pBAD-tegt1. The pBAD-tegt1 is a recombinant plasmid obtained by inserting the Tregt1 gene between the multiple cloning sites of the pBAD / HisA plasmid. The pBAD-tegt1 contains the Tregt1 gene shown in Sequence 1 in the sequence listing and can express the Tregt1 protein shown in Sequence 2. The expression of the Tregt1 gene is driven by the promoter araBAD.

[0061] Specifically, the recombinant vector in D3) can be pBAD-tegt2. The pBAD-tegt2 is a recombinant plasmid obtained by inserting the Tregt2 gene between the multiple cloning sites of the pBAD / HisA plasmid. The pBAD-tegt2 contains the Tregt2 gene shown in Sequence 3 in the sequence listing and can express the Tregt2 protein shown in Sequence 4. The expression of the Tregt2 gene is driven by the promoter araBAD.

[0062] E2) The recombinant vector may specifically be pBAD-tegt1,2. The pBAD-tegt1,2 is a recombinant plasmid obtained by inserting the Tregt1 gene and the Tregt2 gene linked by the ribosome binding site RBS of T7 into the pBAD / HisA plasmid. The pBAD-tegt1,2 contains the Tregt1 gene and the Tregt2 gene shown in Sequence 1 and Sequence 3 in the sequence listing, and can express the Tregt1 protein shown in Sequence 2 and the Tregt2 protein shown in Sequence 4. The expression of the Tregt1 gene and the Tregt2 gene is driven by the promoter araBAD.

[0063] In the above text, the microorganism may be yeast, bacteria, algae or fungi. Among them, the bacteria may be Escherichia coli, such as Escherichia coli BW25113.

[0064] B4) The recombinant microorganism may be BW-pBAD-tegt1. The BW-pBAD-tegt1 is a recombinant bacterium obtained by introducing the pBAD-tegt1 into Escherichia coli BW25113.

[0065] D4) The recombinant microorganism may be BW-pBAD-tegt2. The BW-pBAD-tegt2 is a recombinant bacterium obtained by introducing the pBAD-tegt2 into Escherichia coli BW25113.

[0066] E3) The recombinant microorganism may be BW-pBAD-tegt1,2. The BW-pBAD-tegt1,2 is a recombinant bacterium obtained by introducing the pBAD-tegt1,2 into Escherichia coli BW25113.

[0067] In the above text, the cell line does not include reproductive materials.

[0068] The kit of biological materials has any of the following uses:

[0069] X1. Producing ergothioneine;

[0070] X2. Preparing a product for producing ergothioneine;

[0071] X3. Preparing an antioxidant or cytoprotective product;

[0072] X4. Preparing a product for scavenging hydroxyl radicals, scavenging hypochlorous acid, scavenging peroxynitrite, activating antioxidant enzymes, chelating divalent metal ions, preventing ultraviolet damage, inhibiting hemoglobin oxidation, anti-inflammatory, anti-aging or inhibiting tumorigenesis.

[0073] Tregt1 or the Tregt2 also belongs to the scope of protection of the present invention.

[0074] The above-mentioned biological material 1 or biological material 2 also falls within the protection scope of the present invention.

[0075] The present invention also provides any one of the following applications of the above-mentioned set of proteins, or the above-mentioned set of biological materials or biological material 3, or the above-mentioned Tregt1 or Tregt2, or the above-mentioned biological material 1 or biological material 2:

[0076] X1. Producing ergothioneine;

[0077] X2. Preparing a product for producing ergothioneine;

[0078] X3. Preparing an antioxidant or cytoprotective product;

[0079] X4. Preparing a product for scavenging hydroxyl radicals, scavenging hypochlorous acid, scavenging peroxynitrite, activating antioxidant enzymes, chelating divalent metal ions, preventing ultraviolet damage, inhibiting hemoglobin oxidation, anti-inflammatory, anti-aging or inhibiting tumorigenesis.

[0080] In the above-mentioned applications, the products described in X3 and X4 may be drugs.

[0081] The present invention also provides a method for producing ergothioneine, the method comprising: culturing a recombinant microorganism expressing the above-mentioned Tregt1 and / or the above-mentioned Tregt2 to express the above-mentioned Tregt1 and / or the above-mentioned Tregt2, and then continuously culturing the recombinant microorganism in a system containing L-histidine, L-methionine and L-cysteine to obtain ergothioneine.

[0082] In the above-mentioned method, the system containing L-histidine, L-methionine and L-cysteine may be transformation solution 1 or transformation solution 2. Transformation solution 1 is composed of a solute and a solvent. The solvent is water, and the solute and its concentration in transformation solution 1 are respectively 5.8 g / L Na2HPO4, 3 g / L KH2PO4, 0.5 g / L NaCl, 1 g / L NH4Cl, 1 g / L L-histidine, 1 g / L L-methionine, 1 g / L L-cysteine, 20 mg / L FeSO4·7H2O, 50 mmol / L glucose;

[0083] Transformation solution 2 is a culture system obtained by feeding a supplementary material into an initial system and containing 500 g of glucose, 40 g of L-cysteine, 40 g of L-methionine and 40 g of L-histidine per liter of the system.

[0084] The initial system contains 10 g of glucose, 8 g of (NH4)2HPO4, 13.3 g of KH2PO4, 1.2 g of MgSO4·7H2O, 1.7 g of citric acid, 10 mL of trace salt solution, NaOH for adjusting pH, and water per liter, with a pH of 7.0;

[0085] The trace salt solution consists of a solvent and solutes. The solvent is 5M hydrochloric acid aqueous solution, and the solutes and their concentrations in the trace salt solution are respectively 10 g / L of FeSO4·7H2O, 2.25 g / L of ZnSO4·7H2O, 1 g / L of CuSO4·5H2O, 0.5 g / L of MnSO4·5H2O, 0.23 g / L of Na2B4O7·10H2O, 2 g / L of CaCl2·2H2O, and (NH4)6Mo7O 24 0.1 g / L.

[0086] In the above method, the recombinant microorganism can be the recombinant microorganism described in B4) or D4). The culture can be carried out under conditions suitable for the growth of the recombinant microorganism, such as 16°C - 30°C. The culture time can be determined according to the growth of the recombinant microorganism or the production of ergothioneine, such as 12 - 144 h. The culture can be first carried out in a culture system containing arabinose (L - arabinose) to induce the expression of the Tregt1 and the Tregt2.

[0087] The present invention also provides a kit, which consists of Y1 and Y2:

[0088] Y1, the kit of proteins, or, the kit of biomaterials or the biomaterial 3, or, the Tregt1 or the Tregt2, or, the biomaterial 1 or the biomaterial 2;

[0089] Y2, the conversion solution.

[0090] The kit has any of the following uses:

[0091] X1, to produce ergothioneine;

[0092] X2, to prepare a product for producing ergothioneine;

[0093] X3, to prepare an antioxidant or cytoprotective product;

[0094] X4, to prepare a product for scavenging hydroxyl radicals, scavenging hypochlorous acid, scavenging peroxynitrite, activating antioxidant enzymes, chelating divalent metal ions, preventing ultraviolet damage, inhibiting hemoglobin oxidation, anti - inflammation, anti - aging, or inhibiting tumorigenesis.

[0095] The following any application of the set of products also falls within the protection scope of the present invention:

[0096] X1. Producing ergothioneine;

[0097] X2. Preparing products for producing ergothioneine;

[0098] X3. Preparing antioxidant or cytoprotective products;

[0099] X4. Preparing products for scavenging hydroxyl radicals, scavenging hypochlorous acid, scavenging peroxynitrite, activating antioxidant enzymes, chelating divalent metal ions, preventing ultraviolet damage, inhibiting hemoglobin oxidation, anti - inflammation, anti - aging or inhibiting tumorigenesis.

[0100] Experimental results show that Tregt1 and Tregt2 of the present invention can be used to produce ergothioneine, and the yield can reach 4.5 g / L in 144 hours, which is 3.46 times the highest production level reported so far (Osawa R, Kamide T, Satoh Y, et al. Heterologous and high production of ergothioneine in Escherichia coli[J]. Journal of Agricultural and Food Chemistry, 2017, 66: 1191 - 1196.), and the time is shortened by 72 hours. Tregt1 and Tregt2 of the present invention and their encoding genes have broad application prospects. Description of the Drawings

[0101] Figure 1 is the vector map. A: Expression vector pBAD - tegt1,2; B: Expression vector pBAD - tegt1; C: Expression vector pBAD - tegt2.

[0102] Figure 2 is for detecting protein expression by SDS - PAEG. Lane M is the protein molecular weight standard; Lane 1: Protein sample of the negative control group (supernatant); Lane 2: Protein sample of the cell lysate of BW - pBAD - tegt1,2 (supernatant); Lane 3: Protein sample of the cell lysate of BW - pBAD - tegt1 (supernatant); Lane 4: Protein sample of the cell lysate of BW - pBAD - tegt2 (supernatant); Lane 5: Protein sample of the negative control group (whole bacteria); Lane 6: Protein sample of the cell lysate of BW - pBAD - tegt1,2 (whole bacteria); Lane 7: Protein sample of the cell lysate of BW - pBAD - tegt1 (whole bacteria); Lane 8: Protein sample of the cell lysate of BW - pBAD - tegt2 (whole bacteria); The arrow pointed by the upper arrow in the figure is the Tregt1 protein, and the arrow pointed by the lower arrow is the Tregt2 protein.

[0103] Figure 3 HPLC detection results for the synthesis of ergothioneine by whole-cell catalysis. A: 20 mg / mL ergothioneine standard; B: Transformation product of negative control whole-cell catalysis; C: Transformation product after whole-cell catalysis of BW-pBAD-tegt1,2; D: Transformation product after whole-cell catalysis of BW-pBAD-tegt1; E: Transformation product after whole-cell catalysis of BW-pBAD-tegt2.

[0104] Figure 4 MS / MS results of the transformation product. A: 10 mg / mL ergothioneine standard; B: Transformation product of whole-cell catalysis of BW-pBAD-tegt1,2.

[0105] Figure 5 High-density fermentation of Escherichia coli strain BW-pBAD-tegt1,2. Specific implementation manners

[0106] The present invention will be further described in detail below in conjunction with specific implementation manners. The provided examples are only for clarifying the present invention and not for limiting the scope of the present invention. The following examples can be used as a guide for those of ordinary skill in the art to make further improvements, and do not limit the present invention in any way.

[0107] The experimental methods in the following examples are all conventional methods unless otherwise specified, and are carried out according to the techniques or conditions described in the literature in this field or according to the product instructions. The materials, reagents, instruments, etc. used in the following examples can be obtained from commercial sources unless otherwise specified. In the following examples, all quantitative tests are set with three repeated experiments, and the results are averaged. In the following examples, unless otherwise specified, the first position of each nucleotide sequence in the sequence listing is the 5'-terminal nucleotide of the corresponding DNA / RNA, and the last position is the 3'-terminal nucleotide of the corresponding DNA / RNA.

[0108] PBS buffer (pH 7.0): Take 380 ml of 0.1 M sodium dihydrogen phosphate solution and add it to 620 ml of 0.1 M disodium hydrogen phosphate solution to prepare 100 mM PBS buffer.

[0109] The conversion solution consists of a solute and a solvent. The solvent is water, and the solute and its concentration in the conversion solution are 5.8 g / L Na2HPO4, 3 g / L KH2PO4, 0.5 g / L NaCl, 1 g / L NH4Cl, 1 g / L L-histidine, 1 g / L L-methionine, 1 g / L L-cysteine, 20 mg / L FeSO4·7H2O, and 50 mmol / L glucose.

[0110] Seed medium (1 L): peptone 16 g, yeast extract 10 g, sodium chloride 5 g, pH 7.0.

[0111] Fermentation medium (1 L): glucose 10 g, (NH4)2HPO4 8 g, KH2PO4 13.3 g, MgSO4·7H2O 1.2 g, citric acid 1.7 g, trace salt solution 10 mL, made up to 1 L with water, adjusted to pH 7.0 with 5 M NaOH.

[0112] The trace salt solution consists of a solvent and solutes. The solvent is 5 M hydrochloric acid aqueous solution, and the solutes and their concentrations in the trace salt solution are FeSO4·7H2O 10 g / L, ZnSO4·7H2O 2.25 g / L, CuSO4·5H2O 1 g / L, MnSO4·5H2O 0.5 g / L, Na2B4O7·10H2O 0.23 g / L, CaCl2·2H2O 2 g / L and (NH4)6Mo7O 24 0.1 g / L.

[0113] Example 1: The ergothioneine synthase proteins Tregt1 and Tregt2 of Trichoderma reesei can synthesize ergothioneine

[0114] 1. Construction of Escherichia coli expression vector

[0115] pBAD-tegt1, 2:

[0116] Extract the RNA of Trichoderma reesei QM9414 (ATCC 26921) and reverse transcribe it into cDNA. Using the obtained cDNA as templates respectively, perform PCR amplification with primers P1 (Tregt1-F, Tregt1-R) and P2 (Tregt2-F, Tregt2-R). The correctly sequenced PCR products are denoted as Tregt1 (2529 bp) and Tregt2 (1438 bp) respectively; Using the pBAD / HisA plasmid (invitrogen, V430-01) as a template, perform PCR amplification with primers pBAD-F and pBAD-R. The correctly sequenced DNA fragment is the linearized vector pBADve (3993 bp). The primer sequences used are as follows:

[0117] Tregt1-F: 5’- ATGGCGCTCAAGTCAGCC-3’;

[0118] Tregt1-R: 5’- GGTATATCTCCTTCTTAAAGTTAAACATCAAACATCTCGCACCAACC-3’;

[0119] Tregt2-F: 5'- TTTAACTTTAAGAAGGAGATATACCATGGCGTCTCTGCCGG-3';

[0120] Tregt2-R: 5'- TCAAATCTTCTGGCCACCC-3';

[0121] pBAD-F: 5'- AAGGGTGGCCAGAAGATTTGAGGCTGTTTTGGCGGATGAG -3';

[0122] pBAD-R: 5'- TCGTGGCTGACTTGAGCGCCATGGTTAATTCCTCCTGTTAGCCC -3'.

[0123] The three - fragment ligation of Tregt1, Tregt2 and pBADve was carried out using a recombinant cloning kit (Clone Express® MultiS One Step Cloning Kit, Novizan (C113 - 02)), and was transformed into competent cells Trans1 - T1 (Phage Chemically Comptent Cell, TransGen Biotech (CD501 - 03)) by the calcium chloride chemical transformation method. Positive clones were picked, plasmids were extracted for sequencing, and the recombinant plasmid with the correct obtained sequence was designated as pBAD - tegt1,2 (its vector map is as shown in A in Figure 1 The structure of pBAD - tegt1,2 is described as follows: pBAD - tegt1,2 is a recombinant plasmid obtained by inserting the Tregt1 gene and the Tregt2 gene into the pBAD / HisA plasmid. Among them, the Tregt1 gene and the Tregt2 gene are connected through the ribosome - binding site RBS of T7, the promoter is araBAD, the selection marker is ampicillin Amp, and the replication origin is pBR322 ori. pBAD - tegt1,2 contains the Trichoderma reesei ergothioneine - synthesizing protein Tregt1 gene and Tregt2 gene. The sequences of the Tregt1 gene and the Tregt2 gene are sequence 1 and sequence 3 in the sequence listing respectively, and can express the Tregt1 protein shown in sequence 2 and the Tregt2 protein shown in sequence 4.

[0124] pBAD - tegt1:

[0125] Using the above recombinant plasmid pBAD-tegt1,2 as a template, PCR amplification was performed using primers P3 (Tregt1-F, Tregt1a-R) and P4 (pBADa-F, pBAD-R). The correctly sequenced PCR products were designated as Tregt1a (2522 bp) and pBADvea (3972 bp), respectively. The primer sequences used are as follows:

[0126] Tregt1-F: 5’- ATGGCGCTCAAGTCAGCC-3’;

[0127] Tregt1a-R: 5’- TCTCATCCGCCAAAACAGCCTCAAACATCTCGCACCAACCTT -3’;

[0128] pBADa-F: 5’- GGCTGTTTTGGCGGATGAGA -3’;

[0129] pBAD-R: 5’- TCGTGGCTGACTTGAGCGCCATGGTTAATTCCTCCTGTTAGCCC -3’.

[0130] Tregt1a and pBADvea were seamlessly spliced using a recombinant cloning kit (Clone Express® MultiS One Step Cloning Kit, Novoprotein (C113-02)) and transformed into competent cells Trans1-T1 (Phage Chemically Comptent Cell, TransGen Biotech (CD501-03)) by the calcium chloride chemical transformation method. Positive clones were picked, plasmids were extracted and sequenced. The correctly sequenced recombinant plasmid was designated as pBAD-tegt1 (its vector map is shown in Figure 1 Figure B). The structure of pBAD-tegt1 is described as follows: The Tregt1 gene was inserted into the multiple cloning site of the pBAD / HisA plasmid. The promoter is araBAD, the selection marker is ampicillin Amp, and the replication origin is pBR322 ori. pBAD-tegt1 contains the Trichoderma reesei ergothioneine synthase protein Tregt1 gene. The sequence of the Tregt1 gene is Sequence 1 in the sequence listing and can express the Tregt1 protein shown in Sequence 2.

[0131] pBAD-tegt2:

[0132] Using plasmid pBAD-tegt1,2 as a template, PCR amplification was carried out using primers P5 (Tregt2b-F, Tregt2-R) and P6 (pBAD-F, pBADb-R). The correctly sequenced PCR products were denoted as Tregt2b (1413bp) and pBADveb (3991bp) respectively. The primer sequences used are as follows:

[0133] Tregt2b-F: 5’- ATGGCGTCTCTGCCGGTT-3’;

[0134] Tregt2-R: 5’- TCAAATCTTCTGGCCACCC -3’;

[0135] pBAD-F: 5’- AAGGGTGGCCAGAAGATTTGAGGCTGTTTTGGCGGATGAG -3’;

[0136] pBADb-R: 5’- CGAACCGGCAGAGACGCCATGGTTAATTCCTCCTGTTAGCCCA -3’.

[0137] Tregt2b and pBADveb were seamlessly spliced using a recombinant cloning kit (Clone Express® MultiS One Step Cloning Kit, Novizan (C113-02)) and transformed into competent cells Trans1-T1 (Phage Chemically Comptent Cell, TransGen Biotech (CD501-03)) by the calcium chloride chemical transformation method. Positive clones were picked, plasmids were extracted and sequenced. The correctly sequenced recombinant plasmid was denoted as pBAD-tegt2 (its vector map is as shown in Figure 1 Figure C). The structure of pBAD-tegt2 is described as follows: The Tregt2 gene was inserted into the multiple cloning site of the pBAD / HisA plasmid. The promoter is araBAD, the selection marker is ampicillin Amp, and the replication origin is pBR322 ori. pBAD-tegt2 contains the Tregt2 gene of the ergothioneine synthesis protein of Trichoderma reesei. The sequence of the Tregt2 gene is Sequence 3 in the sequence listing and can express the Tregt2 protein shown in Sequence 4.

[0138] 2. Obtaining of recombinant Escherichia coli expressing ergothioneine

[0139] The pBAD-tegt1,2, pBAD-tegt1, and pBAD-tegt2 obtained in Step 1 were respectively introduced into Escherichia coli BW25113 (Thermo Cat #OEC5042). The resulting recombinant bacteria were denoted as BW-pBAD-tegt1,2, BW-pBAD-tegt1, and BW-pBAD-tegt2, respectively. The plasmid pBAD / HisA was introduced into Escherichia coli BW25113 to obtain BW-pBAD as a negative control.

[0140] 3. Induction, expression, and detection of proteins

[0141] The BW-pBAD-tegt1,2, BW-pBAD-tegt1, BW-pBAD-tegt2, and BW-pBAD obtained in Step 2 were used as the test strains, and the protein expression and detection were carried out according to the following steps:

[0142] The overnight culture of the test strain was transferred to 5 mL of LB medium containing 100 μg / mL ampicillin at a final concentration at an inoculation amount of 1%, and cultured at 37 °C and 200 rpm for 1.5 h. Then, L-arabinose was added to the system (the mass percentage concentration of L-arabinose in the resulting system was 0.2%). Then, the resulting system was induced to ferment at 16 °C and 160 rpm for 24 h to obtain a fermentation broth.

[0143] The fermentation broth was collected in a centrifuge tube and centrifuged at 13,000 rpm for 2 min. The supernatant was discarded, 1 mL of PBS buffer (pH 7.0) was added to the cell pellet, and the cells were lysed using an ultrasonic disruptor to obtain a cell lysate. 50 μL of the cell lysate was used to prepare a protein sample (whole bacteria), and the remaining cell lysate was centrifuged at 13,000 rpm for 2 min, and the supernatant was used to prepare a protein sample (supernatant). SDS-PAEG was used to detect the protein expression.

[0144] The results were as Figure 2 shown. The ergothioneine synthase proteins Tregt1 (94.6 kDa) and Tregt2 (52.7 kDa) of Trichoderma reesei were both soluble expressed in the strain BW-pBAD-tegt1,2, where the expression level of Tregt1 was relatively high and the expression level of Tregt2 was extremely low; the ergothioneine synthase protein Tregt1 (94.6 kDa) of Trichoderma reesei was soluble expressed in the strain BW-pBAD-tegt1, and the ergothioneine synthase protein Tregt2 (94.6 kDa) of Trichoderma reesei was soluble expressed in the strain BW-pBAD-tegt2.

[0145] 4. Synthesis of ergothioneine by whole-cell catalysis

[0146] Using the BW-pBAD-tegt1, 2, BW-pBAD-tegt1, BW-pBAD-tegt2, and BW-pBAD obtained in step 2 as the test strains respectively, synthesize ergothioneine according to the following steps:

[0147] 4.1 Strain fermentation

[0148] Inoculate the overnight cultured test strain broth at an inoculation amount of 1% into 5 mL of LB medium containing ampicillin with a final concentration of 100 μg / mL, culture at 37°C and 200 rpm for 1.5 h, then add L-arabinose (the mass percentage concentration of L-arabinose in the obtained system is 0.2%), and then induce fermentation of the obtained system at 16°C and 160 rpm for 24 h to obtain the fermentation broth.

[0149] 4.2 Biotransformation

[0150] Collect the fermentation broth obtained in step 4.1, centrifuge at 5000 g for 5 min, discard the supernatant, add the transformation solution (containing 100 μg / mL ampicillin) to the cell precipitate to obtain the cell suspension, the cell concentration in the cell suspension is 3 OD / mL (λ = 600 nm), and transform the obtained cell suspension at 30°C and 200 rpm for 16 h to obtain the transformation product.

[0151] 4.3 Detection of ergothioneine

[0152] Collect the transformation product of step 4.2, centrifuge at 13000 rpm for 3 min, aspirate the supernatant, and prepare it according to a volume ratio of 3:7 (supernatant: acetonitrile), then filter it with a 0.22 μm organic microporous membrane, and the obtained filtrate is the test sample. The standard ergothioneine (Shanghai Aladdin Biochemical Technology Co., Ltd. (L134175-10 mg)) is dissolved in 70% (volume percentage) acetonitrile aqueous solution to 10 mg / L, and then detected by HPLC and tandem mass spectrometry.

[0153] The HPLC detector is Agilent 1260 Infinity LC, the detection column is Agilent ZOBAX-NH2 amino column, the ultraviolet detection wavelength is 254 nm, the mobile phase is 70% (V / V) acetonitrile aqueous solution, the flow rate is 1.0 mL / min, and the injection volume is 10 μL.

[0154] The tandem mass spectrometry uses an LC / MS liquid chromatography / triple quadrupole tandem mass spectrometer (Agilent 1260 / 6460 LC / Triple Quadrupole MS), the mobile phase uses acetonitrile: 4 mmol / L ammonium acetate (85:15), and the detection column is Agilent ZOBAX-NH2 amino column.

[0155] The HPLC detection results are as follows Figure 3 shown. After whole-cell catalysis of strains BW-pBAD-tegt1 and 2, a single strong absorption peak appears at the retention time of 10.191 min ( Figure 3 in C), which is consistent with the position where the standard product of ergothioneine (10.039 min) shows a single absorption peak ( Figure 3 in A), and there is no absorption peak at this position in the negative control ( Figure 3 in B). According to the standard curve, the ergothioneine content is 29.04 mg / L. The secondary mass spectrometry analysis shows that this absorption peak is ergothioneine, indicating that the Trichoderma reesei ergothioneine synthase proteins Tregt1 and Tregt2 expressed by BW-pBAD-tegt1 and 2 can synthesize ergothioneine.

[0156] After whole-cell catalysis of BW-pBAD-tegt1, a single strong absorption peak appears at the retention time of 10.128 min ( Figure 3 in D), which is consistent with the position of the absorption peak of the ergothioneine standard product ( Figure 3 in A), but the peak area is significantly smaller than that of the transformation product obtained by whole-cell catalysis of BW-pBAD-tegt1 and 2. The ergothioneine content is 9.38 mg / L, indicating that BW-pBAD-tegt1 expressing only Tregt1 alone can also synthesize ergothioneine.

[0157] There is no specific chromatographic peak at the position of the absorption peak of the ergothioneine standard product after whole-cell catalysis of BW-pBAD-tegt2 ( Figure 3 in E), indicating that BW-pBAD-tegt2 expressing only Tregt2 alone cannot synthesize ergothioneine.

[0158] The secondary mass spectrometry results of the transformation product are as follows Figure 4 shown.

[0159] 5. Production of ergothioneine by adding the bottom stream of the fermenter

[0160] Using BW-pBAD-tegt1 and 2 obtained in step 2 as the test strains, ergothioneine is synthesized according to the following steps:

[0161] The test strain was inoculated into 100 mL of seed medium at an inoculation amount of 1%, and cultured overnight at 37 °C and 200 rpm to obtain a seed solution; the seed solution was inoculated into 900 mL of fermentation medium containing ampicillin (100 μg / ml) (2 L fermenter), and cultured with stirring at 37 °C until the bacterial concentration reached 30 OD (λ = 600 nm, about 12 h), then L-arabinose was added to the obtained system (the mass percentage concentration of L-arabinose in the obtained system was 0.2%), and then the obtained system was induced to ferment at 30 °C for 12 h, and then the substrate solution (mother liquor with the concentrations of L-methionine, L-cysteine, and L-histidine all being 40 g / L, and the solvent being water) was fed at a flow rate of 4 ml / h / L; during the whole process, a 50 g / 100 mL glucose aqueous solution was fed at a flow rate of 4 mL / h / L, and the dissolved oxygen was maintained at about 20% by adjusting the stirring speed and the ventilation volume, and the pH was maintained at about 7.0 by 2.7 M ammonia water and 1 M phosphoric acid.

[0162] When inoculating the seed solution, it was recorded as 0 h. Samples were taken every 12 h to detect OD600, and then centrifuged to collect the supernatant to detect the content of ergothioneine in the supernatant. The external standard method was used to quantify according to the HPLC peak area with the standard product ergothioneine (Shanghai Aladdin Biochemical Technology Co., Ltd. (L134175-10mg)) as the standard.

[0163] The HPLC detection method was the same as in step 4.

[0164] As Figure 5 As shown in Table 1, during the fermentation of BW-pBAD-tegt1,2, the synthesis amount of ergothioneine increased with the increase of fermentation time within 12 - 144 h. Due to the addition of the inducer at 12 h of fermentation, the strain BW-pBAD-tegt1,2 utilized the L-methionine, L-cysteine, and L-histidine contained in its own cells to synthesize a small amount of ergothioneine and secrete it extracellularly. After 24 h, due to the feeding of the substrate and the continuous growth of the bacteria, the concentration of ergothioneine continued to increase. At 144 h of fermentation, the extracellular ergothioneine concentration reached 4.5 g / L.

[0165] Table 1. Extracellular ergothioneine (ERG) production (mg / L)

[0166]

[0167] The present invention has been described in detail above. For those skilled in the art, without departing from the spirit and scope of the present invention and without unnecessary experiments, the present invention can be implemented within a relatively wide range under equivalent parameters, concentrations and conditions. Although specific embodiments of the present invention are given, it should be understood that the present invention can be further improved. In short, according to the principle of the present invention, this application is intended to cover any modifications, uses or improvements of the present invention, including those that depart from the scope disclosed in this application but are made by conventional techniques known in the art. The application of some basic features can be made according to the scope of the appended claims below. Sequence Listing <110> Institute of Microbiology, Chinese Academy of Sciences <120> Two ergothioneine synthetic proteins and their applications in ergothioneine synthesis <160> 4 <170> PatentIn version 3.5 <210> 1 <211> 2502 <212> DNA <213> Trichoderma reesei <400> 1 atggcgctca agtcagccac gaccacgact accaccacac agagggcgct cgacatcatc 60 gacattcaga atgcgcgaat cgaggtcaac ctcaaggacg agatccttgc ccagatgaat 120 cccgagcagg gcccccgcac gctgcccacg ctgctgctct atgacgagcg cggcctgcag 180 ctgtttgaag aaatcacgta tctggacgaa tactacctga ccaactacga gattgagctc 240 ctgaagaaat cggcagccga aatggccagc cagatccccg agggagcaat tgtggtggag 300 ctgggcagcg gaaacctgcg caaagtctgc ctcctcctgc aggcgtttga agatgccaag 360 aagaagattg actacttcgc gctcgacctg tcccagaagg agctcgagcg cacgctggcc 420 gaggcgcccg tctttgagta cgtgagctgc cggggcctgc gagggacgta tgacgacggg 480 tgcgagtggc tgaagcagga ggcgattctg gctcggccaa agtgcatttt gcacctcggc 540 tccagcattg gcaactttac gcgcgacgag gcggcagagt tcctgaggtc atttgcagag 600 gttctgcagc cctcggatct gatgattgtc ggggttgact catgtcagaa cccggacaag 660 gtgtaccatg catacaatga cagcaagggc gtcacacatc aattcgtcct caacggcctc 720 actcacgcaa acgaggttct cggtcaggaa gccttcaacg tcgaagagtg gcaagtcatt 780 ggcgaatacg tgtacgatgt cgacggcggc cgtcaccagg cctttgtgtc gcctctcgag 840 gtcgcctcgg tcctgggaca catcatcaag ccccacgagc gcatcaagat tgagcagagc 900 ttcaagtact ctgacgtcgg cctcgacaag ctgttcaaga cggccggcct cgtcgaggtt 960 gccaaatgga gccgccaggg cgaatacggc cttcacatgc tcaagagagc caagatgccc 1020 ttccccaggc tccgcgagct ttacgccagc gacaccctgc ccacctgggc cgactgggag 1080 aacctctggg cggcctggga cacggtcacc cgcaagatgc tccccgacgc cgagctcaac 1140 gagaagccca tcaagctgcg caacgcctgc atcttctacc tcggccacat cccggccttc 1200 ctcgacatcc agctcaagaa gacgaccaag gccggcggaa ccgagccgct ctacttccac 1260 accatctttg agcgcggcat cgacccggac gtcgacaacc cggaaaagtg ccacgaccac 1320 tccgaggtcc cggacgagtg gcctcccctt gaggacatcc tgaagtatca ggaccgcgtc 1380 cgcgagagac tccgcaagct gtatgccagc cccgatgagc ttgtcggaga cgttcggcgc 1440 gccgtctgga tcggcttcga gcacgaggcg cttcacctcg agacgctgct gtacatgctg 1500 ctgcagagcg acaagacgct tccgccgccg cacacggtgg tgccggactt ccccaagatg 1560 gcgcagaagg cgtatgccgc gcgggtgccg aatcagtggt ttgatgtccc ggagcagacg 1620 attaccattg gcatggacga tcctgaggat gagcacgaat caaaccggca ctttggatgg 1680 gacaacgaga agcctgccag acaggagact gtgcgtgcct ttcaggccaa ggccaggccc 1740 atcaccaacg aggagtacgc caagtacctc tactcttctc acattgagaa cctcccggcc 1800 tcttggtcgg tcatccctcc caactatcac cacaacacca acgccacgac gcccgggaag 1860 cccatcttga gcgagctccc cgagagcttc ctccacgaca aggcggtgcg gaccgtctac 1920 gggctggtgc ccctgcgcta cgccctcgac tggcctgtct ttgcgtcgta cgacgagctt 1980 gccggctgcg cggcgtggat gggcggcagg atcccgacga tggaggaggc caagagcatc 2040 tacgcgtatg tggagaggca aaaggatatt gccaagcaga gcaagctctc caacaaggtt 2100 ccagccgtca acgggcacct cgtcaatgac ggcgtcgaag agactccccc atccaagccc 2160 tccccggcct ccctcttcgt cgacctcagc acaaccaaca ccggcttcct ccactggcac 2220 cccgtccccg tgacccccaa cggcggctcc ctcgccggcc aggccgagct gggcggcgtc 2280 tgggagtgga cgagctccgt gctgcgtccg caccaggggt tccgcccgat gagcctctac 2340 ccgggctaca cggcggactt cttcgacgac aagcacaacg tcgtgctggg cgggtcctgg 2400 gcgacgcatc cccggattgc gggccggaag agctttgtca attggtatca gaggaattat 2460 ctgtatgcct gggttggggc aaggttggtg cgagatgttt ga 2502 <210> 2 <211> 833 <212> PRT <213> Trichoderma reesei <400> 2 Met Ala Leu Lys Ser Ala Thr Thr Thr Thr Thr Thr Thr Gln Arg Ala 1 5 10 15 Leu Asp Ile Ile Asp Ile Gln Asn Ala Arg Ile Glu Val Asn Leu Lys 20 25 30 Asp Glu Ile Leu Ala Gln Met Asn Pro Glu Gln Gly Pro Arg Thr Leu 35 40 45 Pro Thr Leu Leu Leu Tyr Asp Glu Arg Gly Leu Gln Leu Phe Glu Glu 50 55 60 Ile Thr Tyr Leu Asp Glu Tyr Tyr Leu Thr Asn Tyr Glu Ile Glu Leu 65 70 75 80 Leu Lys Lys Ser Ala Ala Glu Met Ala Ser Gln Ile Pro Glu Gly Ala 85 90 95 Ile Val Val Glu Leu Gly Ser Gly Asn Leu Arg Lys Val Cys Leu Leu 100 105 110 Leu Gln Ala Phe Glu Asp Ala Lys Lys Lys Ile Asp Tyr Phe Ala Leu 115 120 125 Asp Leu Ser Gln Lys Glu Leu Glu Arg Thr Leu Ala Glu Ala Pro Val 130 135 140 Phe Glu Tyr Val Ser Cys Arg Gly Leu Arg Gly Thr Tyr Asp Asp Gly 145 150 155 160 Cys Glu Trp Leu Lys Gln Glu Ala Ile Leu Ala Arg Pro Lys Cys Ile 165 170 175 Leu His Leu Gly Ser Ser Ile Gly Asn Phe Thr Arg Asp Glu Ala Ala 180 185 190 Glu Phe Leu Arg Ser Phe Ala Glu Val Leu Gln Pro Ser Asp Leu Met 195 200 205 Ile Val Gly Val Asp Ser Cys Gln Asn Pro Asp Lys Val Tyr His Ala 210 215 220 Tyr Asn Asp Ser Lys Gly Val Thr His Gln Phe Val Leu Asn Gly Leu 225 230 235 240 Thr His Ala Asn Glu Val Leu Gly Gln Glu Ala Phe Asn Val Glu Glu 245 250 255 Trp Gln Val Ile Gly Glu Tyr Val Tyr Asp Val Asp Gly Gly Arg His 260 265 270 Gln Ala Phe Val Ser Pro Leu Glu Val Ala Ser Val Leu Gly His Ile 275 280 285 Ile Lys Pro His Glu Arg Ile Lys Ile Glu Gln Ser Phe Lys Tyr Ser 290 295 300 Asp Val Gly Leu Asp Lys Leu Phe Lys Thr Ala Gly Leu Val Glu Val 305 310 315 320 Ala Lys Trp Ser Arg Gln Gly Glu Tyr Gly Leu His Met Leu Lys Arg 325 330 335 Ala Lys Met Pro Phe Pro Arg Leu Arg Glu Leu Tyr Ala Ser Asp Thr 340 345 350 Leu Pro Thr Trp Ala Asp Trp Glu Asn Leu Trp Ala Ala Trp Asp Thr 355 360 365 Val Thr Arg Lys Met Leu Pro Asp Ala Glu Leu Asn Glu Lys Pro Ile 370 375 380 Lys Leu Arg Asn Ala Cys Ile Phe Tyr Leu Gly His Ile Pro Ala Phe 385 390 395 400 Leu Asp Ile Gln Leu Lys Lys Thr Thr Lys Ala Gly Gly Thr Glu Pro 405 410 415 Leu Tyr Phe His Thr Ile Phe Glu Arg Gly Ile Asp Pro Asp Val Asp 420 425 430 Asn Pro Glu Lys Cys His Asp His Ser Glu Val Pro Asp Glu Trp Pro 435 440 445 Pro Leu Glu Asp Ile Leu Lys Tyr Gln Asp Arg Val Arg Glu Arg Leu 450 455 460 Arg Lys Leu Tyr Ala Ser Pro Asp Glu Leu Val Gly Asp Val Arg Arg 465 470 475 480 Ala Val Trp Ile Gly Phe Glu His Glu Ala Leu His Leu Glu Thr Leu 485 490 495 Leu Tyr Met Leu Leu Gln Ser Asp Lys Thr Leu Pro Pro Pro His Thr 500 505 510 Val Val Pro Asp Phe Pro Lys Met Ala Gln Lys Ala Tyr Ala Ala Arg 515 520 525 Val Pro Asn Gln Trp Phe Asp Val Pro Glu Gln Thr Ile Thr Ile Gly 530 535 540 Met Asp Asp Pro Glu Asp Glu His Glu Ser Asn Arg His Phe Gly Trp 545 550 555 560 Asp Asn Glu Lys Pro Ala Arg Gln Glu Thr Val Arg Ala Phe Gln Ala 565 570 575 Lys Ala Arg Pro Ile Thr Asn Glu Glu Tyr Ala Lys Tyr Leu Tyr Ser 580 585 590 Ser His Ile Glu Asn Leu Pro Ala Ser Trp Ser Val Ile Pro Pro Asn 595 600 605 Tyr His His Asn Thr Asn Ala Thr Thr Pro Gly Lys Pro Ile Leu Ser 610 615 620 Glu Leu Pro Glu Ser Phe Leu His Asp Lys Ala Val Arg Thr Val Tyr 625 630 635 640 Gly Leu Val Pro Leu Arg Tyr Ala Leu Asp Trp Pro Val Phe Ala Ser 645 650 655 Tyr Asp Glu Leu Ala Gly Cys Ala Ala Trp Met Gly Gly Arg Ile Pro 660 665 670 Thr Met Glu Glu Ala Lys Ser Ile Tyr Ala Tyr Val Glu Arg Gln Lys 675 680 685 Asp Ile Ala Lys Gln Ser Lys Leu Ser Asn Lys Val Pro Ala Val Asn 690 695 700 Gly His Leu Val Asn Asp Gly Val Glu Glu Thr Pro Pro Ser Lys Pro 705 710 715 720 Ser Pro Ala Ser Leu Phe Val Asp Leu Ser Thr Thr Asn Thr Gly Phe 725 730 735 Leu His Trp His Pro Val Pro Val Thr Pro Asn Gly Gly Ser Leu Ala 740 745 750 Gly Gln Ala Glu Leu Gly Gly Val Trp Glu Trp Thr Ser Ser Val Leu 755 760 765 Arg Pro His Gln Gly Phe Arg Pro Met Ser Leu Tyr Pro Gly Tyr Thr 770 775 780 Ala Asp Phe Phe Asp Asp Lys His Asn Val Val Leu Gly Gly Ser Trp 785 790 795 800 Ala Thr His Pro Arg Ile Ala Gly Arg Lys Ser Phe Val Asn Trp Tyr 805 810 815 Gln Arg Asn Tyr Leu Tyr Ala Trp Val Gly Ala Arg Leu Val Arg Asp 820 825 830 Val <210> 3 <211> 1413 <212> DNA <213> Trichoderma reesei <400> 3 atggcgtctc tgccggttcg tcagcgagag gaaggagagg cgagggttgg cgaggatggc 60 ttcaaggtgt ttggcggcga gatgaagaag gactttttgt ttgctcccgg gtggacgaac 120 ctcaaccacg gctcgtacgg caccatcccc agggccatcc aagcaaaact gcgcagctac 180 caagacgaca ttgaggctcg tcccgacccc tttatccgct tcgagcacgc ccgcctgacg 240 gacgaatccc gcgccgccgt cgcgggcgtg ctcaacgtcc ccgtcgagac agtcgtcttc 300 gtcaacaacg cgaccgaggg cgtcaacacc gtcttccgca acatcaagtg ggacgccgac 360 gtcaacaacg cgaccgaggg cgtcaacacc gtcttccgca acatcaagtg ggacgccgac 360 ggcaaggacg tggcgctctg gttctcgacc gtgtacgagg cgtgcggcaa ggcgattgat 420 ggcaaggacg tggcgctctg gttctcgacc gtgtacgagg cgtgcggcaa ggcgattgat 420 ttcctgtacg actaccacgg ggacggacgg ctgtcgagcc gggagattga gattgcgtat 480 ttcctgtacg actaccacgg ggacggacgg ctgtcgagcc gggagattga gattgcgtat 480 ccgatcgagg acgacgagat cctgcggcgc ttccggagcg cggtggagca ggtccggagc 540 ccgatcgagg acgacgagat cctgcggcgc ttccggagcg cggtggagca ggtccggagc 540 gaggggaagc gcgccaagat ttgcatcttt gacgtggtgt cgtcgcggcc gggcgtggtg 600 gaggggaagc gcgccaagat ttgcatcttt gacgtggtgt cgtcgcggcc gggcgtggtg 600 tttccctggg agcgcatggt ggctgcgtgt cgcgagctgg gcgtgctgag cctcgtggac 660 tttccctggg agcgcatggt ggctgcgtgt cgcgagctgg gcgtgctgag cctcgtggac 660 ggcgcgcagg ggatcggcat ggtgaggctg gatctcgggg ccgcggatcc ggatttcttc 720 ggcgcgcagg ggatcggcat ggtgaggctg gatctcgggg ccgcggatcc ggatttcttc 720 gtgtcgaatt gtcacaagtg gttgtttacg ccgaggggtt gcgcggtgtt ttacgtgcct 780 gtgtcgaatt gtcacaagtg gttgtttacg ccgaggggtt gcgcggtgtt ttacgtgcct 780 gtgcggaatc agccgttgtt gccgtcgacg ctggcgacga gtcatgggta tgcttcgttg 840 gtgcggaatc agccgttgtt gccgtcgacg ctggcgacga gtcatgggta tgcttcgttg 840 acggggaaga ggagggcgcc ggcggggaag catgaagatg atgataatga tgacggttct 900 acggggaaga ggagggcgcc ggcggggaag catgaagatg atgataatga tgacggttct 900 ttgaagaaga gcgcgtttgt gagcaacttt gagtttacgg ggacgaggga ctatacgccg 960 ttgaagaaga gcgcgtttgt gagcaacttt gagtttacgg ggacgaggga ctatacgccg 960 aatttctgtg tcaaggatgc ggttgcgtat cggagggatg tgctgggtgg ggaggagagg 1020 aatttctgtg tcaaggatgc ggttgcgtat cggagggatg tgctgggtgg ggaggagagg 1020 attttggagt atctgtggga tttgaataag aaggggagta ggcttgttgc ggagaggctg 1080 ggcacggagg tgttggagaa taaagagggg acgttgacga actgcgcgat ggcgaacatt 1140 gccatgcctc tgtggaaggg cgaggcaggc aaggaggggg atgttgttgt gcctgaggag 1200 gatggggatc gggtggttgt gtggatgatg agcacgatgg cgaaggatta caatacgatt 1260 gtgcccatgt tttggctcgg gaagaggttc tgggtgagga tcagtgcgca ggtgtatttg 1320 gatttgggag attatgagta tggcgcggag acgttgaaga agttgattga gagggttggc 1380 aagggggagt ataagggtgg ccagaagatt tga 1413 <210> 4 <211> 470 <212> PRT <213> Trichoderma reesei <400> 4 Met Ala Ser Leu Pro Val Arg Gln Arg Glu Glu Gly Glu Ala Arg Val 1 5 10 15 Gly Glu Asp Gly Phe Lys Val Phe Gly Gly Glu Met Lys Lys Asp Phe 20 25 30 Leu Phe Ala Pro Gly Trp Thr Asn Leu Asn His Gly Ser Tyr Gly Thr 35 40 45 Ile Pro Arg Ala Ile Gln Ala Lys Leu Arg Ser Tyr Gln Asp Asp Ile 50 55 60 Glu Ala Arg Pro Asp Pro Phe Ile Arg Phe Glu His Ala Arg Leu Thr 65 70 75 80 Asp Glu Ser Arg Ala Ala Val Ala Gly Val Leu Asn Val Pro Val Glu 85 90 95 Thr Val Val Phe Val Asn Asn Ala Thr Glu Gly Val Asn Thr Val Phe 100 105 110 Arg Asn Ile Lys Trp Asp Ala Asp Gly Lys Asp Val Ala Leu Trp Phe 115 120 125 Ser Thr Val Tyr Glu Ala Cys Gly Lys Ala Ile Asp Phe Leu Tyr Asp 130 135 140 Tyr His Gly Asp Gly Arg Leu Ser Ser Arg Glu Ile Glu Ile Ala Tyr 145 150 155 160 Pro Ile Glu Asp Asp Glu Ile Leu Arg Arg Phe Arg Ser Ala Val Glu 165 170 175 Gln Val Arg Ser Glu Gly Lys Arg Ala Lys Ile Cys Ile Phe Asp Val 180 185 190 Val Ser Ser Arg Pro Gly Val Val Phe Pro Trp Glu Arg Met Val Ala 195 200 205 Ala Cys Arg Glu Leu Gly Val Leu Ser Leu Val Asp Gly Ala Gln Gly 210 215 220 Ile Gly Met Val Arg Leu Asp Leu Gly Ala Ala Asp Pro Asp Phe Phe 225 230 235 240 Val Ser Asn Cys His Lys Trp Leu Phe Thr Pro Arg Gly Cys Ala Val 245 250 255 Phe Tyr Val Pro Val Arg Asn Gln Pro Leu Leu Pro Ser Thr Leu Ala 260 265 270 Thr Ser His Gly Tyr Ala Ser Leu Thr Gly Lys Arg Arg Ala Pro Ala 275 280 285 Gly Lys His Glu Asp Asp Asp Asn Asp Asp Gly Ser Leu Lys Lys Ser 290 295 300 Ala Phe Val Ser Asn Phe Glu Phe Thr Gly Thr Arg Asp Tyr Thr Pro 305 310 315 320 Asn Phe Cys Val Lys Asp Ala Val Ala Tyr Arg Arg Asp Val Leu Gly 325 330 335 Gly Glu Glu Arg Ile Leu Glu Tyr Leu Trp Asp Leu Asn Lys Lys Gly 340 345 350 Ser Arg Leu Val Ala Glu Arg Leu Gly Thr Glu Val Leu Glu Asn Lys 355 360 365 Glu Gly Thr Leu Thr Asn Cys Ala Met Ala Asn Ile Ala Met Pro Leu 370 375 380 Trp Lys Gly Glu Ala Gly Lys Glu Gly Asp Val Val Val Pro Glu Glu 385 390 395 400 Asp Gly Asp Arg Val Val Val Trp Met Met Ser Thr Met Ala Lys Asp 405 410 415 Tyr Asn Thr Ile Val Pro Met Phe Trp Leu Gly Lys Arg Phe Trp Val 420 425 430 Arg Ile Ser Ala Gln Val Tyr Leu Asp Leu Gly Asp Tyr Glu Tyr Gly 435 440 445 Ala Glu Thr Leu Lys Lys Leu Ile Glu Arg Val Gly Lys Gly Glu Tyr 450 455 460 Lys Gly Gly Gln Lys Ile 465 470

Claims

1. A recombinant microorganism, which contains a nucleic acid molecule encoding a Tregt1 protein and a nucleic acid molecule encoding a Tregt2 protein, wherein the Tregt1 protein is as follows A1) or A2): A1) a protein with an amino acid sequence of SEQ ID NO: 2; A2) a fusion protein obtained by connecting a tag to the N-terminus and / or C-terminus of A1); the Tregt2 protein is as follows C1) or C2): C1) a protein with an amino acid sequence of SEQ ID NO: 4; C2) a fusion protein obtained by connecting a tag to the N-terminus and / or C-terminus of C1).

2. The recombinant microorganism according to claim 1, characterized in that: the nucleic acid molecule encoding the Tregt1 protein is a cDNA molecule with a coding sequence of SEQ ID NO: 1 in the sequence listing; the nucleic acid molecule encoding the Tregt2 protein is a cDNA molecule with a coding sequence of SEQ ID NO: 3 in the sequence listing.

3. Any of the following applications of the recombinant microorganism according to claim 1: X1. Producing ergothioneine; X2. Preparing a product for producing ergothioneine; X3. Preparing a cell protection product.

4. Use of the recombinant microorganism according to claim 1 in preparing a product for scavenging hydroxyl radicals, scavenging hypochlorous acid, scavenging peroxynitrite, activating antioxidant enzymes, chelating divalent metal ions, preventing ultraviolet damage or inhibiting hemoglobin oxidation.

5. Use of the recombinant microorganism according to claim 1 in preparing an anti-aging product.

6. A method for producing ergothioneine, comprising: Culturing the recombinant microorganism expressing Tregt1 and Tregt2 to express the Tregt1 and the Tregt2, and then continuously culturing the recombinant microorganism in a system containing L-histidine, L-methionine and L-cysteine to obtain ergothioneine; wherein the Tregt1 is as follows A1) or A2): A1) a protein with an amino acid sequence of SEQ ID NO: 2; A2) a fusion protein obtained by connecting a tag to the N-terminus and / or C-terminus of A1); the Tregt2 is as follows C1) or C2): C1) a protein with an amino acid sequence of SEQ ID NO: 4; C2) a fusion protein obtained by connecting a tag to the N-terminus and / or C-terminus of C1).

Images