Methods of characterizing and exploiting agent-coacervate interactions
By measuring and adjusting the incorporation of drugs into aggregates, the problem of determining the extent of drug incorporation into cells has been solved, enabling precise characterization and enhanced efficacy of drugs in aggregates, and providing new cancer treatment methods.
Patent Information
- Authority / Receiving Office
- CN · China
- Patent Type
- Patents(China)
- Current Assignee / Owner
- Filing Date
- 2020-05-15
- Publication Date
- 2026-03-31
AI Technical Summary
Existing technologies are insufficient to effectively characterize the extent of drug incorporation and mechanism of action in aggregates, making it difficult to determine the efficacy of drugs within cells. Furthermore, traditional drug targets are difficult to control due to their disordered nature.
The incorporation of drugs into different types of aggregates was measured using Raman spectroscopy, spectrophotometry, and quantitative phase microscopy. The distribution of drugs in aggregates was regulated by modifying the aromatic side chains of the drugs or by coupling them with detectable tags. The composition and dissociation of transcription aggregates were regulated by using peptide inhibition of nuclear receptor and cofactor binding.
This enables precise characterization of drugs in aggregates, improves drug efficacy within cells, reduces off-target effects, and provides new cancer treatment strategies.
Smart Images

Figure CN114173879B_ABST
Abstract
Description
[0001] Related applications
[0002] This application claims the benefits of U.S. Provisional Application Serial No. 62 / 848,539, filed May 15, 2019, and U.S. Provisional Application Serial No. 62 / 927,073, filed October 28, 2019, the contents of which are incorporated herein by reference in their entirety.
[0003] Government support
[0004] This invention was carried out with government support under licenses GM123511, CA213333, and CA155258 granted by the National Institutes of Health, and PHY1743900 granted by the National Science Foundation. The government holds certain rights to this invention. Technical Field
[0005] This article describes methods for characterizing drug incorporation into aggregates, methods for reducing the transcription of aggregate-associated oncogenes, and methods for using peptides to inhibit the binding of nuclear receptors and cofactors in aggregates. Background Technology
[0006] Transcription factors and cofactors occupying superenhancers form liquid-like condensates that compartmentalize and aggregate transcriptional apparatus at key cellular identity genes. Tumor cells acquire large superenhancers at driver oncogenes, thus contributing to transcriptional dysregulation, a hallmark of cancer. Summary of the Invention
[0007] This paper demonstrates that transcriptional condensates participate in driving tumorigenesis and provide a framework for novel entry points in cancer therapy. The discovery that multiple proteins key to the transcriptional machinery are present within these structures may make previously uncontrollable targets (due to their disordered nature) attractive as drug targets. Unexpectedly, this paper shows that some agents (e.g., small molecules) enter transcriptional condensates independently of the presence of drug targets. The methods disclosed herein for measuring the extent to which agents can enter condensates and the specificity of agents for different types of condensates (e.g., transcriptional condensates, heterochromatin or repressor condensates, splice dot condensates, nucleolar, chromatin condensates, multicomb condensates, DNA damage repair condensates) provide valuable information about drug exposure and off-target effects. The methods disclosed herein can determine how much drug is allocated to the condensate and how much is allocated to the exterior of the condensate to help determine the efficacy of candidate drugs in cells or organisms. Methods for modulating agent incorporation into condensates by adjusting the number of aromatic side chains on the agent or condensate components are also provided. Furthermore, determining how a drug works in aggregates can enable the use of known drugs for new purposes.
[0008] Some aspects of the present invention relate to methods for characterizing pharmaceutical agents, the methods comprising contacting the pharmaceutical agent with a composition comprising a coagulant having at least one component, and measuring the incorporation of the pharmaceutical agent in the coagulant. In some embodiments, the incorporation of the pharmaceutical agent in the coagulant is detected without using a detectable label on the pharmaceutical agent. In some embodiments, the incorporation of the pharmaceutical agent in the coagulant is detected using Raman spectroscopy, spectrophotometry, and quantitative phase microscopy or a spin-down assay. In some embodiments, the pharmaceutical agent comprises a detectable label. In some embodiments, the component or coagulant comprises a detectable label. In some embodiments, the detectable label is a fluorescent label.
[0009] In some embodiments, the method includes contacting a drug with a detectable label with the composition containing the agglomerate, measuring the incorporation of the drug with the detectable label in the agglomerate, contacting the composition containing the agglomerate and the drug with the detectable label with a control drug without a detectable label, and measuring again the incorporation of the drug with the detectable label in the agglomerate.
[0010] In some embodiments, the method includes contacting the agent with multiple coagulants having one or more different components. In some embodiments, the method includes contacting the agent with multiple compositions, each comprising a coagulant having at least one different component. In some embodiments, the method includes contacting multiple agents with multiple compositions, each comprising a coagulant having the same component.
[0011] In some embodiments, the at least one component is a transcriptional condensate component, a heterochromatin condensate component, a condensate component physically associated with mRNA initiation, a condensate component physically associated with mRNA elongation, a chromatin condensate component, a multicomb condensate component, or a DNA damage repair condensate component. In some embodiments, the at least one component is a mediator, a mediator component, MED1, BRD4, POLII (i.e., POL2), SRSF2, FIB1, NPM1, HP1α, histones, histone tail portions, a multicomb repression complex 1 (PRC1) component (e.g., CBX2), or 53BP1. In some embodiments, the at least one component is a super-enhancer condensate, splice dot condensate, heterochromatin condensate, nucleolus, chromatin condensate, multicomb condensate, or a component of a DNA damage repair condensate, or a functional portion thereof. In some embodiments, the component comprises an intrinsically disordered region (IDR).
[0012] In some embodiments, the component contains a detectable label different from that of the pharmaceutical agent. In some embodiments, the incorporation of the pharmaceutical agent is measured relative to a control. In some embodiments, the incorporation of multiple pharmaceutical agents is measured and compared with each other.
[0013] In some embodiments, the agent is capable of binding to a target. In some embodiments, the aggregate does not contain a target. In some embodiments, the target is primarily located on the exterior of the aggregate. In some embodiments, the target is primarily located within the aggregate. In some embodiments, the target is a therapeutic target. In some embodiments, the target is an enzyme, receptor, ligand, oncogene, oncogene product, or transcription factor. In some embodiments, the target is genomic DNA. In some embodiments, the composition contains a target.
[0014] In some embodiments, the relative amounts of the agent incorporated into or not incorporated into the agglomerate are measured. In some embodiments, the agglomerate physically associates with DNA.
[0015] In some embodiments, the agglomerate is in cells. In some embodiments, the cells are diseased cells. In some embodiments, the agglomerate is in vitro. In some embodiments, the agent is a small molecule, peptide, or nucleic acid. In some embodiments, the agent is a known chemotherapeutic agent. In some embodiments, the agent is a candidate chemotherapeutic agent. In some embodiments, the agent is or contains cisplatin or a derivative thereof. In some embodiments, the agent is or contains JQ1 (( S )- Uncle -Butyl-2-(4-(4-chlorophenyl)-2,3,9-trimethyl-6 H -Thiophene[3,2-f [1,2,4]triazolo[4,3- a [1,4]diazazo-6-yl)acetate or a derivative thereof. In some embodiments, the agent is or contains tamoxifen or a derivative thereof.
[0016] Some aspects of the present invention relate to a method for characterizing a first agent, the method comprising contacting the first agent with a composition comprising a coagulant having at least one component, wherein the coagulant contains at least a second agent, and measuring the ability of the first agent to expel the second agent from the coagulant. In some embodiments, the second agent comprises a detectable tag. In some embodiments, the detectable tag is a fluorescent tag. In some embodiments, the coagulant component is a target of the second agent.
[0017] Some aspects of the present invention relate to compositions comprising an aggregate and a pharmaceutical agent having a therapeutic target, wherein the aggregate does not contain the therapeutic target. In some embodiments, the therapeutic target is genomic DNA.
[0018] As shown in the embodiments below, dyes that are not preferentially allocated to agglomerates can be modified to preferentially allocate to agglomerates by coupling with an agent or partially coupling with the agent. Some aspects of the invention relate to a method of regulating the allocation of a first agent to agglomerates, the method comprising coupling the first agent to a second agent to regulate the allocation of the first agent to the agglomerates. In some embodiments, the agglomerates are selected from super-enhancer agglomerates, splice dot agglomerates, heterochromatin agglomerates, or nucleoli. In some embodiments, the allocation of the first agent to the agglomerates is increased. In some embodiments, the allocation of the first agent to the agglomerates is reduced. In some embodiments, the therapeutic efficacy of the coupled first agent is increased compared to the uncoupled first agent. In some embodiments, the adverse reactions of the coupled first agent are reduced compared to the uncoupled first agent.
[0019] As also shown in the embodiments below, increasing the content of aromatic side chains in the agent increases the distribution of the agent in the MED1 in vitro aggregate (i.e., droplets). Some aspects of the invention relate to a method of regulating the distribution of an agent into an aggregate by modifying the agent to increase or decrease the number of aromatic side chains. In some embodiments, the distribution of a modified agent into the aggregate is increased compared to an unmodified agent. In some embodiments, the distribution of a modified agent is reduced compared to an unmodified agent.
[0020] Some aspects of this disclosure relate to a method for screening candidate agents with regulated aggregate partitioning, the method comprising modifying an agent having an aggregate partition coefficient and measuring the aggregate partition coefficient of the modified agent, wherein if the modified agent has a partition coefficient different from that of the agent, the modified agent is identified as a candidate agent with regulated aggregate partitioning. In some embodiments, the aggregate partition coefficient of the modified agent is measured in an in vitro aggregate. In some embodiments, the aggregate partition coefficient of the modified agent is measured in an aggregate in cells. In some embodiments, if a candidate agent has increased partitioning into an aggregate containing a therapeutic target of the candidate agent, the candidate agent is identified as an improved candidate agent. In some embodiments, if a candidate agent has decreased partitioning into an aggregate not containing a therapeutic target of the candidate agent, the candidate agent is identified as an improved candidate agent. In some embodiments, the candidate agent with regulated aggregate partitioning is a chemotherapeutic agent. In some embodiments, the modification comprises increasing or decreasing the number of aromatic side chains of the agent.
[0021] Some aspects of the present invention relate to a method for reducing the transcription of oncogenes, the method comprising modulating the composition, dissolution, or dissociation of the transcriptional aggregates by contacting the transcriptional aggregates associated with the oncogenes with an agent.
[0022] In some embodiments, the agent dissolves the transcriptional aggregate, causing the aggregate to uncouple from genomic DNA containing the oncogene, or expelling one or more components of the transcriptomic aggregate. In some embodiments, the agent is an inhibitor, an intercalator, or a cyclin-dependent kinase inhibitor. In some embodiments, the agent binds to components of the transcriptomic aggregate. In some embodiments, the agent preferentially accumulates in the transcriptomic aggregate. In some embodiments, the aggregate is located within a cell. In some embodiments, the cell is a cancer cell.
[0023] In some embodiments, the agent is administered to a subject suffering from cancer. In some embodiments, the cancer is colon cancer, lymphoma, multiple myeloma, prostate cancer, or breast cancer.
[0024] Some aspects of the present invention relate to methods for treating a subject with cancer characterized by transcription of oncogenes, the methods comprising administering to the subject an agent that modulates the composition, dissolution, or dissociation of a transcriptional aggregate associated with the oncogene. In some embodiments, the agent is an inhibitor, an intercalator, or a cyclin-dependent kinase inhibitor. In some embodiments, the agent binds to components of the transcriptional aggregate. In some embodiments, the agent preferentially accumulates in the transcriptional aggregate. In some embodiments, the cancer is colon cancer, lymphoma, multiple myeloma, prostate cancer, or breast cancer.
[0025] In some embodiments, the subject is a human being. In some embodiments, the drug is administered to the subject orally, subcutaneously, locally, or intravenously. In some embodiments, the drug is a small molecule, peptide, or nucleic acid.
[0026] Some aspects of this disclosure relate to methods for inhibiting transcription associated with transcriptional condensates, the methods comprising inhibiting the binding of nuclear receptors associated with the transcriptional condensates to cofactors having LXXLL domains, wherein the binding is inhibited by contacting the condensate with a peptide that binds to the LXXLL domain.
[0027] In some embodiments, the nuclear receptor is a nuclear hormone receptor, an estrogen receptor, or retinoic acid receptor α. In some embodiments, the cofactor is MED1. In some embodiments, transcription of the oncogene is repressed. In some embodiments, the transcriptional condensate is located in a cell. In some embodiments, the cell is a cancer cell. In some embodiments, the peptide is administered to a subject. In some embodiments, the subject has cancer.
[0028] Some aspects of the present invention relate to a method for inhibiting transcription associated with transcriptional condensates, the method comprising inhibiting a cofactor having an LXXLL binding domain and associated with a nuclear receptor having an LXXLL binding domain, wherein the binding is inhibited by contacting the condensate with a peptide that binds the LXXLL domain.
[0029] In some embodiments, the nuclear receptor is a nuclear hormone receptor, an estrogen receptor, or retinoic acid receptor α. In some embodiments, the cofactor is MED1. In some embodiments, transcription of the oncogene is repressed. In some embodiments, the transcriptional condensate is located in a cell. In some embodiments, the cell is a cancer cell. In some embodiments, the peptide is administered to a subject. In some embodiments, the subject has cancer.
[0030] Some aspects of the present invention relate to compositions comprising cells, said cells comprising a first aggregate having a first detectable marker and a second aggregate having a different second detectable marker, wherein said first aggregate and second aggregate are different aggregate types selected from super-enhancer aggregates, splice dot aggregates, heterochromatin aggregates, nucleoli, chromatin aggregates, multicomb aggregates, or DNA damage repair aggregates. In some embodiments, the composition further comprises an agent that contacts the cells. In some embodiments, said agent is a known therapeutic agent. In some embodiments, said agent is a candidate therapeutic agent. In some embodiments, the second detectable marker is detectably distinguishable from the first detectable marker.
[0031] Some aspects of the present invention relate to compositions comprising a first in vitro aggregate, a second in vitro aggregate, and an agent in contact with the first and second in vitro aggregates. In some embodiments, at least one of the first, second, and agent comprises a detectable marker. In some embodiments, the composition further comprises a third and optionally a fourth in vitro aggregate, each in contact with the agent. In some embodiments, at least one of the in vitro aggregates comprises a component or functional fragment of a transcription aggregate, a super-enhancer aggregate, a splice dot aggregate, a heterochromatin aggregate, a nucleolus, a chromatin aggregate, a multicomb aggregate, or a DNA damage repair aggregate. Some embodiments relate to articles comprising a first in vitro aggregate in contact with an agent, a second in vitro aggregate in contact with the same agent, and a multiwell plate separating the first and second in vitro aggregates into separate wells. In some embodiments, the article further comprises at least a third in vitro aggregate in contact with the agent. In some embodiments, the article further comprises at least a fourth in vitro aggregate in contact with the agent. The first, second, third, and fourth in vitro aggregates may each contain components or functional fragments of different aggregates (e.g., super-enhancer aggregates, splice dot aggregates, heterochromatin aggregates, nucleoli, chromatin aggregates, multicomb aggregates, or DNA damage repair aggregates). The first, second, third, and fourth in vitro aggregates may each contain different detectable markers.
[0032] Some aspects of the present invention relate to a method for assessing whether differential expression of one or more aggregate components in drug-resistant cells causes or contributes to said resistance, the method comprising providing drug-resistant cells, contacting said drug-resistant cells with said drug, and assessing the localization, concentration and / or therapeutic activity of said drug compared with a control.
[0033] Some aspects of the present invention relate to a method for assessing whether differential expression of one or more aggregate components in drug-resistant cells causes or contributes to said resistance, the method comprising providing aggregates isolated from drug-resistant cells, contacting said aggregates with said drug, and assessing the localization, concentration, and / or therapeutic activity of said drug compared with a control.
[0034] Some aspects of the present invention relate to a method for assessing whether differential expression of one or more aggregate components in drug-resistant cells causes or contributes to said resistance, the method comprising providing an in vitro aggregate (e.g., droplets) containing differential amounts of an aggregate component or fragment thereof differentially expressed in drug-resistant cells, contacting said aggregate with said drug, and assessing the localization, concentration, and / or therapeutic activity of said drug compared with a control.
[0035] Some aspects of the present invention relate to a method for assessing whether differential expression of one or more aggregate components in drug-resistant cells causes or contributes to said resistance, the method comprising providing an in vitro aggregate (e.g., droplets) containing a mutant aggregate component or a fragment thereof corresponding to a mutant aggregate component in drug-resistant cells, contacting said aggregate with said drug, and assessing the localization, concentration, and / or therapeutic activity of said drug compared with a control.
[0036] Some aspects of the present invention relate to methods for characterizing drug resistance agglomerates, the methods comprising contacting the agglomerate with one or more second agents and evaluating at least one of the agent localization, concentration or therapeutic activity and / or agglomerate morphology, stability or solubility. In some embodiments, the second agent is contacted with cells containing the drug resistance agglomerate. In some embodiments, the agglomerate has been isolated from the cells. In some embodiments, the agglomerate is an in vitro agglomerate (e.g., droplets). In some embodiments, the agglomerate comprises a mutant form of an agglomerate component or fragment thereof associated with drug resistance. Attached Figure Description
[0037] The patent or application document contains at least one drawing completed in color. A copy of the patent or application publication with a color drawing will be provided by the office upon request and payment of the necessary fees.
[0038] Figure 1 This is a schematic diagram showing that changes in the transcription apparatus are a hallmark of cancer. Adapted from Bradner, Hnisz and Young, Cell 2017.
[0039] Figure 2ChIP-seq data identifying superenhancers are shown. Superenhancers are large clusters of enhancers that regulate genes that play a prominent role in cell identity, characterized by abnormally high density of proteins rich in intrinsically disordered domains and high levels of eRNA. Adapted from Hnisz et al., Cell (2013).
[0040] Figure 3 This study demonstrates that tumor cells acquire abnormally large superenhancers at driver oncogenes via small changes in DNA and are particularly sensitive to transcriptional drugs. Illustrations adapted from Mansour et al., Science (2014) and Loven et al., Cell (2013).
[0041] Figure 4 The study showed that transcription factors and mediator co-activators contribute to the formation of condensates at superenhancers. See Sabari, Dall'Agnese et al., Science 2018; Cho, Spille et al., Science 2018; and Boija, Klein et al., Cell 2018.
[0042] Figure 5 This demonstrates that biomolecular condensates can be produced through phase separation. Adapted from Brangwynne CP. JCB2013.
[0043] Figure 6 This demonstrates that transcriptional condensates are involved in oncogene expression and are potential therapeutic targets. TxEx - transcriptase; TF - transcription factor; CoA - co-activator; SE-driven oncogenes - super-enhancer-driven oncogenes.
[0044] Figures 7A-7C The transcriptional aggregate containing the driver transcription factor (TF) and the mediator MED1 subunit was shown to occur at the MYC oncogene in human tumor tissue. Figure 7A The images show H&E staining of carcinoma breast cancer and ER+ breast cancer. Figure 7B The demonstration showed the use of an anti-MED1 antibody (MED1 IF) or an anti-estrogen receptor antibody (ER IF), followed by... Myc Immunofluorescence microscopy of RNA FISH on ER+ breast cancer tissue. The upper right image (with zoom) shows MED1 and... Myc Transcriptional co-localization occurs within the aggregate. The lower right figure shows the estrogen receptor and... Myc Transcriptional colocalizes in condensates. Figure 7C The demonstration showed the use of an anti-MED1 antibody (MED1 IF) or an anti-estrogen receptor antibody (ER IF), followed by... MycDNA FISH immunofluorescence microscopy of ER+ breast cancer tissue. The upper right image (with zoom) shows MED1 and... Myc The gene is co-localized in the aggregate. The lower right figure shows the estrogen receptor and... Myc Genes are colocalized in aggregates.
[0045] Figure 8 This indicates that mediator aggregates are present in multiple cancer cell types. MYC superior.
[0046] Figure 9 DNA with ER binding sites was shown to promote MED1 aggregate formation. MED1 and ER formed droplets in in vitro droplet assays in the presence of DNA with ER binding sites, but in the absence of control DNA or no DNA at all. All assays were performed in the presence of estrogen.
[0047] Figure 10A-10D This study demonstrates that ligand-dependent aggregate formation links phase separation to oncogene expression. Figure 10A The results showed that MED1 was present in the presence of estrogen, but not in the absence of estrogen, or in the presence of both estrogen and tamoxifen. Myc DNA co-localizes together in the aggregate. Figure 10B This shows that in the presence of estrogen MYC Expression increases, but decreases to constitutive levels in the presence of estrogen and tamoxifen. Figure 10C This shows that ER is incorporated into the aggregate in the presence of estrogen, but not in the presence of both estrogen and tamoxifen. ER droplets are depicted in the top row, MED1 droplets in the middle row, and the merging of ER and MED1 droplets is depicted in the bottom row. Figure 10D The study showed that the enrichment rate of ER in MED1 aggregates was significantly increased in the presence of estrogen.
[0048] Figure 11 This demonstrates that the transcriptional condensate is a multi-component structure. Using IF and Myc FISH confirmed that BRD4, p300, CDK7, CDK6, proteosomes, and topoisomerases are related to... Myc Co-localization in transcriptional condensates. p300 and CDK7 were detected in ovarian cancer cells. All other components were detected in the breast cancer cell line MCF7.
[0049] Figure 12 This shows that the transcriptional condensate is a multi-component structure.
[0050] Figure 13Tools for determining the effect of small molecules on transcriptional aggregates are shown. All HCT116 colon cancer cell lines endogenously labeled with MED1-GFP, BRD4-GFP, POL2-GFP, or HP1a-GFP (mimics) formed aggregates in the nucleus.
[0051] Figures 14A-14D The JQ1-dissolved genome transcription condensate was shown. Figure 14A JQ1 was shown to reduce or eliminate the amount of MED1, BRD4, and POL2 aggregates. Figure 14B The results of fluorescence recovery after photobleaching (FRAP) assays using fluorescently labeled BRD4 are shown. The presence of JQ1 significantly increased the turnover rate of BRD4 in the photo-irradiated condensate, and replacing the photobleached BRD4 with fluorescent BRD4 resulted in significantly faster recovery (10 s vs. 120 s). Figure 14C The results showed a higher level of BRD4 at the super enhancer (SE) than at the typical enhancer (TE). Figure 14D (Left figure) shows that gene expression via superenhancer is more sensitive to JQ1 repression compared to typical enhancers. Figure 14D (Right figure) shows that JQ1 reduces BRD4 genome occupancy in superenhancers to a greater extent than typical enhancers.
[0052] Figure 15 The results showed that antimetabolites had no effect on transcriptional aggregates. Specifically, 5 μM 5-FU and 5 μM 5-Aza had no detectable effect on MED1, BRD4, or POL2 aggregates.
[0053] Figure 16 The effects of various inhibitors on MED1, BRD4, and POL2 aggregates in the HCT116 colon cancer cell line endogenously labeled with MED1-GFP, BRD4-GFP, and POL2-GFP were shown.
[0054] Figure 17 The effects of various intercalating agents on MED1, BRD4, and POL2 aggregates in the HCT116 colon cancer cell line endogenously labeled with MED1-GFP, BRD4-GFP, and POL2-GFP were shown.
[0055] Figure 18 The effects of various CDK inhibitors on aggregates containing MED1, BRD4, and POL2 in the HCT116 colon cancer cell line endogenously labeled with MED1-GFP, BRD4-GFP, and POL2-GFP were shown.
[0056] Figure 19 A model of the effects of drugs on transcription aggregates was provided. Bortezomib, mitoxantrone, daunorubicin, THZ1, and dinaciclib caused complete dissolution of the aggregates. See also Figure 16-18 Prolonged exposure (e.g., 24 hours) to JQ1, as well as exposure to A485 and palbociclib, causes genomic release and consolidation of the aggregates. See Figures 14, 16, and 18. Short-term exposure (e.g., 5 minutes) to JQ1, as well as exposure to U0216, causes the expulsion (i.e., selective expulsion) of some aggregate components. See Figures 14 and 16.
[0057] Figures 20A-20B Small molecules were shown In vitro Approaching condensate. Figure 20A (Left image) shows the co-localization of estrogen receptor (ER) (green) and MED1 (red) in the presence of estrogen. in vitro In the droplets, estrogen receptors do not incorporate into the aggregates in the presence of estrogen and tamoxifen. Figure 20A The top right column shows cells with attached ER-containing LAC arrays exhibiting reduced ER-containing (green) and MED1-containing (red) aggregates in the presence of tamoxifen. The bottom right column shows the relative fluorescence intensities of ER and MED1 in the presence and absence of tamoxifen. Figure 20B (Top) Shows the structures of fluorescently labeled tamoxifen (FLTX1) and Cy5 dyes with similar molecular weights. Figure 20B (Bottom) shows FLTX1 incorporated into MED1 aggregates, while similarly sized Cy5 dyes were not incorporated.
[0058] Figure 21 The image shows tamoxifen “chasing” fluorescent tamoxifen from MED1 droplets. The top row shows that the MED1 droplets are unaffected by the addition of FLTX1, or FLTX1 and tamoxifen. The bottom row shows that FLTX1 was incorporated into the MED1 droplets, but was diluted out by the addition of a 10-fold excess of tamoxifen, confirming that FLTX1 and tamoxifen have similar aggregate incorporation characteristics.
[0059] Figure 22 The images show that fluorescent tamoxifen specifically accumulates in MED1 condensates. The lower left panel shows FLTX1 incorporation into MED1 droplets. MED1 is a component of transcriptional condensates. The lower right panel shows FLTX1 not incorporating into heterochromatin protein 1 (HP1a) droplets. HP1a is a component of heterochromatin condensates. Notably, FLTX1 is incorporated into MED1 droplets in the absence of its target estrogen receptor.
[0060] Figure 23 The study showed that the drug was enriched in the MED1 aggregates. Mitoxantrone, curcumin, and daunorubicin each exhibited fluorescent activity and induced aggregate dissolution. Figure 23 (Base image) shows that these drugs were immediately incorporated into the MED1 droplets.
[0061] Figure 24 The image shows an ER / MED1 droplet in contact with a fluorescent peptide (left). Following estrogen exposure, the estrogen receptor undergoes a conformational change that allows it to interact with the MED1 LXXLL domain (right).
[0062] Figure 25 The addition of the LXXLL peptide (QNPILTSLLQITG; SEQ ID NO: 1) to the ER / MED1 droplet resulted in the incorporation of the peptide into the MED1 droplet, leading to a reduction in the distribution of ER into the MED1 droplet.
[0063] Figure 26 This study demonstrated the incorporation of peptides into MED1 / ER droplets in the presence of estrogen. Polyproline (Poly P) and RNA polymerase II CTD repeat YSPTSPS peptide (CTD) had no effect on ER / MED1 droplet formation, while polyglutamic acid (Poly-E) peptide (acidic) and polylysine (Poly-K) peptide (basic) eliminated MED1 / ER droplet formation.
[0064] Figure 27 The cell-penetrating LXXLL peptide labeled with HIV-TAT was shown to be incorporated into U2OS cells, demonstrating that the peptide can be visualized in living cells.
[0065] Figures 28A-28E Nucleus aggregates were shown in human tissues and in vitro. Figure 28A A model illustrating the potential behavior of small molecules in nucleocondensates is presented. Figures 28B-28C This image shows cells from benign and malignant human breasts, imaged at 100x using a fluorescence confocal microscope, with nuclei stained with Hoechst. Figure 28B ) and benign and malignant colon tissue ( Figure 28C Immunofluorescence of scaffold proteins from various nuclear aggregates in tissue biopsies. Figure 28D A schematic diagram of an in vitro droplet formation assay measuring the distribution of small molecules into nucleated condensates is shown. Figure 28EThe image shows an in vitro droplet assay, imaged at 150x on a confocal fluorescence microscope, demonstrating the behavior of the fluorescein dye in the presence of six protein aggregates formed in 125 mM NaCl and 10% PEG with 10 μM protein and 5 μM fluorescein. Quantification of drug enrichment is shown on the right, with error bars representing SEM.
[0066] Figures 29A-29E The partitioning behavior of small molecule drugs in nucleopolymers in droplet assays is shown. Six nucleopolymers formed in 125 mM NaCl and 10% PEG with 10 μM protein were imaged at 150x using confocal fluorescence microscopy. Figure 29A 5μM cisplatin-TMR, Figure 29B 50 μM mitoxantrone, ( Figure 29C 100μM FLTX1, ( Figure 29D 5μM THZ1-TMR or ( Figure 29E The drug was processed using 1 μM JQ1-ROX. Quantitative enrichment of the drug within the droplets is shown on the right side of each graph, with error bars representing SEM.
[0067] Figures 30A-30F This shows that the concentration of small molecules within the aggregates affects drug activity. Figure 30A The in vitro droplet assay of MED1 and HP1α condensates formed in 125 mM NaCl and 10% PEG, 5 nM 450 bp DNA, 10 μM MED1 and 5 μM cisplatin-TR is shown on confocal fluorescence microscopy at 150x. Figure 30B Bioanalytical tracers of DNA contained in MED1 or HP1α droplets exposed to cisplatin at the indicated concentrations are shown. Figure 30C The diagram (top) shows a determination of the position of platinum-coated DNA relative to various nuclear aggregates. (Bottom) Co-immunofluorescence of platinum-coated DNA and the proteins shown in HCT116 cells treated with 50 μM cisplatin for 6 hours. Imaged at 100x on a confocal fluorescence microscope. Overlapping quantifications are shown on the right. Figure 30D The diagram shows (top) a schematic of the live cell aggregate lysis assay. (Bottom) HCT116 cells labeled with endogenous mEGFP (MED1, HP1α, or FIB1) were treated with 50 μM cisplatin for 12 hours. Quantification of MED1, HP1α, or FIB1 aggregate scores is shown on the right. Figure 30EThe image shows MED1 ChIP-seq in HCT116 cells treated with the medium or 50 μM cisplatin for 6 hours. (Left) shows the mean read density of MED1 at superenhancers and typical enhancers (error bars show minimum and maximum values), and (Right) shows gene tracing of MED1 ChIP at the MYC superenhancer and AQPEP typical enhancer. Figure 30F A metaplot comparing super-enhancers and typical enhancers in cisplatin-DNA-seq in cisplatin-treated HeLa cells is shown.
[0068] Figures 31A-31F This demonstrates the role and resistance of tamoxifen in MED1 aggregates. Figure 31A This diagram illustrates the resistance to tamoxifen in breast cancer caused by ER mutations and MED1 overexpression. Figure 31B The in vitro droplet assay of GFP-labeled ER in the presence of estrogen + / - 100 μM tamoxifen is shown. Droplets were formed in 125 mM NaCl and 10% PEG with 10 μM of each protein and 100 μM estrogen. Figure 31C The image shows (left) immunofluorescence of MED1 in tamoxifen-sensitive (MCF7) and resistant (TAMR7) ER+ breast cancer cell lines, imaged at 100x using confocal fluorescence microscopy. (Top right) Quantification of the size of MED1 aggregates in breast cancer cells. (Bottom right) Relative amount of MED1 in the breast cancer cell lines shown, measured by Western blotting; error bars indicate SEM. Figure 31D The in vitro droplet determination is shown in the presence of 100 μM estrogen, + / - 100 μM tamoxifen, and ER in the presence of 5 μM (low) or 20 μM (high) MED1. Droplets formed in 125 mM NaCl and 10% PEG with 5 μM ER were imaged at 150x on a confocal fluorescence microscope. Error bars are from SEM. Figure 31E The results show the in vitro droplet determination in 125 mM NaCl and 10% PEG with 5 μM (low) or 20 μM (high) MED1 and 100 μM FLTX1, with error bars in SD. Figure 31F This study demonstrates a model of tamoxifen resistance caused by altered drug affinity (via ER mutation) or concentration (via MED1 overexpression).
[0069] Figures 32A-32C Nuclear aggregates in cell lines and human tumor tissues are shown. Figure 32AMouse embryonic stem cells transfected with constructs expressing mEGFP-tagged proteins (MED1, BRD4, SRSF2), mCherry-tagged proteins (HP1α), or GFP-tagged proteins (NPM1, FIB1) were visualized by confocal fluorescence microscopy. Figure 32B Clinical data from biopsied breast and colon cancer specimens are presented. Figure 32C The images show H&E staining in ER-positive breast cancer and colon adenocarcinoma.
[0070] Figures 33A-33C The volume and quantity of nuclear aggregates in normal and tumor tissues are shown. Figure 33A The volume of nuclear aggregates is shown in normal and malignant breast tissue (upper part) and in normal and malignant colon tissue (lower part). Values represent nuclear volume percentage and standard deviation. There were no significant differences between individual nuclear aggregates in normal and malignant states. Figure 33B It is a table showing the average volume of nuclear aggregates in normal and malignant tissues. Figure 33C It is a table showing the average number of nuclear aggregates in normal and malignant tissues.
[0071] Figures 34A-34B The protein formed by nuclear condensation is shown. Figure 34A A schematic representation of the constructs used to purify nuclear condensate proteins is shown. Individual IDRs (intrinsically disordered regions) were used for MED1 and BRD4 proteins, and full-length regions were used for HP1α, SRSF2, NPM1, and FIB1 proteins. Figure 34B The table shows (top) the number of hydrophobic amino acids phenylalanine (F), tryptophan (W), and tyrosine (Y) in the IDR and full-length protein. The MED1 IDR has the highest number of hydrophobic residues. (Bottom) A table of positively charged interaction elements (CIE+) and negatively charged interaction elements (CIE-) for the IDR or full-length nucleocondensate protein. These results suggest that the MED1 protein may be involved in interactions governed by the π system.
[0072] Figures 35A-35B The image shows in vitro droplets of proteins that have formed aggregates. Figure 35A Confocal microscopy was used to demonstrate the in vitro droplet formation assay of the GFP-labeled proteins shown in 125 mM NaCl and 10% PEG. MED1 and BRD4 proteins were only the IDR fractions. Figure 35B Confocal microscopy images of MED1, BRD4, SRSF2, HP1α, FIB1, and NPM1 nuclear condensates at the indicated concentrations (125 mM, 350 mM, 650 mM, and 1000 mM NaCl) are shown. Experiments were performed in 10% PEG with 10 μM protein.
[0073] Figure 36 A schematic representation of the enrichment ratio calculation is shown. The droplet is confined within a protein channel, and the maximum drug intensity is measured in that region to obtain the drug... 进入 (Left image) Measurement of background in drug channels within a region defined by protein channels in an in vitro droplet reaction containing protein but without drug (middle image), and measurement of drug in a droplet reaction without protein. 扩散 Intensity (right image).
[0074] Figures 37A-37D The distribution of small molecules in nucleocondensates was shown. Figure 37A Confocal microscopy was used to demonstrate the in vitro droplet formation assay of the individual small molecules (4.4 kDa dextran, fluorescein, and hoechst) without the addition of any protein to the reaction. All small molecules individually exhibited diffuse fluorescence signals, indicating that the molecules alone do not form droplets. Figure 37B-37C Confocal microscopy images are shown, illustrating hoechst in 125 mM NaCl and 10% PEG. Figure 37B ) and 4.4 kDa beta-glucan ( Figure 37C The behavior of the six nucleus aggregates formed in vitro is shown relative to their quantification on the right, with error bars representing SEM. Both Hoechst and dextran diffuse freely through the aggregates tested without being excluded or aggregated. A schematic diagram of the determination is shown at the top. Figure 37D Confocal microscopy images of fluorescently labeled 4.4 kDa, 10 kDa, 40 kDa, and 70 kDa dextran in MED1 aggregates are shown. Experiments were conducted with 10 μM protein and 0.1 mg / ml TRITC-labeled dextran in 125 mM salt and 16% sucrose. Smaller dextran (4.4 kDa and 10 kDa) diffused freely through the aggregates, while larger dextran (40 kDa and 70 kDa) were partially excluded from the MED1 aggregates. This indicates that the effective pore size of the studied aggregates is at least 10 kDa.
[0075] Figures 38A-38D This demonstrates that the properties of small molecule drugs, rather than their fluorescent components, dominate the distribution into the aggregates. Figure 38A Confocal microscopy was used to demonstrate the in vitro droplet formation assays of the indicated small molecule drugs (cisplatin, FLTX1, THZ1, mitoxantrone, and JQ1) individually without the addition of any protein to the reaction. All small molecule drugs individually showed diffuse fluorescence signals, indicating that the indicated molecules do not form droplets on their own. Figure 38BThe enrichment of ROX and Texas Red in MED1 droplets formed in 125 mM NaCl and 10% PEG, as measured by confocal microscopy, is shown. Neither of the two dyes used for drug visualization were enriched in the MED1 aggregates. Figure 38C A schematic diagram of an in vitro droplet drug eviction assay is shown. Labeled cisplatin was added to MED1 droplets to form MED1 droplets aggregated with cisplatin-TR. Unlabeled trans-platinum or unlabeled cisplatin was added to the droplet mixture, and the amount of labeled cisplatin-TR remaining in the droplets was measured after eviction. Trans-platinum, a clinically ineffective trans isomer of cisplatin, could not evoke cisplatin-TR, while high concentrations of unlabeled cisplatin could. Figure 38D A schematic diagram of the in vitro droplet drug expulsion experiment is shown. A graph showing the enrichment of FLTX1 in the MED1 droplet after the addition of tamoxifen, measured by confocal microscopy, is also shown. Tamoxifen was able to expel FLTX1 from the MED1 droplet. All error bars shown represent SEM.
[0076] Figures 39A-39C This showed that small molecule drugs can aggregate in MED1 aggregates up to 100 times. Figure 39A Quantitative phase microscopy of MED1 droplets formed in 125 mM NaCl and 10% PEG is shown. Colored bars indicate optical phase delay. The concentration of MED1 in individual aggregates was calculated from the phase image, in degrees. Figure 39B The graph shows the concentrations of MED1 in in vitro droplets after the addition of no drug, 5 μM cisplatin, or 50 μM mitoxantrone. Data points are population means (n = 272, 115, and 85 individual aggregates for each condition). Error bars represent standard deviations. Figure 39C This demonstrates the addition of different concentrations of cisplatin or mitoxantrone to MED1 droplets and the measurement of the remaining drug concentration in the solution by ultraviolet (UV) spectroscopy. The spectral measurements are compared with those from (… Figure 39B The estimates of the total volume of the MED1 condensate phase obtained from measurements in the study combined with the estimates of cisplatin partition ratio up to 600-fold, while the partition ratio of mitoxantrone was approximately 100-fold.
[0077] Figures 40A-40B The association between the drug target and the transcriptional condensate was demonstrated. Figure 40AImmunofluorescence of MED1, HP1α, CDK7, ER, and BRD4 along with MYC RNA FISH is shown. Consistent with the findings that MED1 (a marker of transcriptional condensation) is present at the tactile site of the MYC oncogene, and that CDK7, ER, and BRD4 are also present at the MYC tactile site, these results reflect those obtained at this locus via ChIP-Seq. In contrast, no signal of HP1α (a marker of heterochromatin condensation) was found in MYC. Averaged and randomized image analyses are shown on the right. Figure 40B The diagram (top) shows an in vitro droplet assay, illustrating the mixing of nucleopolymer proteins (MED1 or HP1α) with various drug target proteins (CDK7, ER, or BRD4), with partitioning measured by confocal microscopy. (Middle) In vitro droplet assays were performed using 10 μM of MED1, ER, HP1α, and BRD4, and 200 nM of CDK7. Droplets were formed in 125 mM NaCl, 10% PEG, and droplet-forming buffer. All drug targets tested aggregated in the MED1 aggregate. ER was found to aggregate in both the MED1 and HP1α aggregates, consistent with previous reports and its ability to associate with both co-activators and co-inhibitors. (Bottom) Quantification of the enrichment of target proteins in the aggregates shown; error bars represent SEM.
[0078] Figure 41 The partitioning behavior of various small molecule drugs in the entire mediator complex is shown. Confocal microscopy images of the drugs (THZ1, mitoxantrone, cisplatin, FLTX1, fluorescein, and 4.4 kDa dextran) in the entire mediator complex aggregate are presented. The mediator is imaged in bright field, while the small molecules are imaged through their fluorescent channels. Experiments were performed in 10% PEG and 125 mM NaCl. The partitioning behavior of various small molecule drugs in the entire mediator complex is a replica of the partitioning behavior of the drugs in the MED1 aggregate. The quantification of enrichment is shown on the right, and the error bars represent SEM.
[0079] Figure 42 This image shows the partitioning behavior of various small molecule drugs in MED1 aggregates formed in sucrose. Confocal microscopy images of the aggregation behavior of small molecule drugs (THZ1, mitoxantrone, cisplatin, FLTX1, fluorescein, and JQ1) in MED1 aggregates in the presence of 125 mM NaCl and 20% sucrose are presented. The partitioning behavior of the small molecules is similar and independent of the crowdder used to form MED1 droplets. Quantification of enrichment is shown on the right, with error bars representing SEM.
[0080] Figures 43A-43B This demonstrates that cisplatin molecules are highly mobile within MED1 droplets. Figure 43AConfocal microscopy images show fluorescence recovery after photobleaching (FRAP) with TR-cisplatin and MED1 in aggregates formed in the presence of 125 mM NaCl and 10% PEG with 5 μM TR-cisplatin and 10 μM protein. Figure 43B The quantification of FRAP is shown (error bars represent SEM).
[0081] Figures 44A-44D The concentration of specific chemical components dominated in MED1 aggregates is shown. Figure 44A It is a description of a small molecule boron-dipyrrolemethylene (BODIPY) library. Figure 44B The fluorescence intensity of the probe library in MED1 droplets is shown, measured by confocal microscopy. Experiments were conducted in 125 mM NaCl and 10% PEG with 10 μM MED1 and 1 μM small molecules. The fluorescence of individual molecules of BODIPY is highlighted in red. Figure 44C The fluorescence intensity of 18 probes randomly selected from a library without the MED1 protein is shown, demonstrating that they have similar fluorescence intensities. Figure 44D The top 5 (left) and bottom 5 (right), R2 and R1 side chains are shown in order of fluorescence intensity.
[0082] Figures 45A-45E The results show that the aromatic residues of MED1 facilitate the partitioning of small molecules into MED1 aggregates, but are dispensable for aggregate formation. Figure 45A Confocal microscopy images are shown of MED1, BRD4, SRSF2, HP1α, FIB1, and NPM1 nuclear condensates formed in 125 mM NaCl and 10% PEG with the highest fluorescence intensity-ranked 5 μM small molecule probes within the MED1 condensate. The probes specifically aggregated into the MED1 condensate, indicating that the probe's chemical signature selectively interacts with the chemical signature of the MED1 condensate. The highest-ranking probes aggregated in the MED1 condensate showed preference for BODIPY molecules modified with aromatic rings. This suggests that the π system may facilitate interactions between small molecules and MED1. Figure 45B A schematic diagram of the MED1 IDR mutant protein is shown. The π system governs the interactions of supramolecular assemblies, with π-π or π-polar interactions playing a significant role. To test whether these interactions govern the partitioning of small molecules into MED1 aggregates, and encouraged by the observation that MED1 IDR is enriched in both aromatic and basic amino acid residues compared to other proteins studied in this paper, aromatic MED1 IDR mutants (all 30 aromatic residues replaced with alanine) and basic MED1 IDR mutants (all 114 basic residues replaced with alanine) were generated. Figure 45CIn the presence of 125 mM NaCl and 10% PEG, the ability of MED1 mutants to form droplets was tested by confocal microscopy using wild-type MED1, a basic mutant (all basic amino acids replaced by alanine), and an aromatic mutant (all aromatic amino acids replaced by alanine). The basic mutant showed impaired droplet formation in vitro, indicating that the basic residues of MED1 are essential for isomorphic interactions governing droplet formation. The aromatic mutant formed droplets similar to those of the wild-type MED1 protein. Figure 45D The role of MED1 aromatic residues in the incorporation of aromatic small molecule probes was demonstrated. Confocal microscopy images and quantifications of the highest-hit BODIPY probe, along with MED1 or MED1 aromatic mutants, showed a significantly reduced partitioning behavior of aromatic probes in MED1 aromatic mutant droplets. Experiments were conducted in 10% PEG and 125 mM NaCl using 10 μM protein and 5 μM small molecules. Figure 45E Confocal microscopy images and quantifications of cisplatin with MED1 or MED1 aromatic mutants are shown, revealing a significantly reduced partitioning behavior of cisplatin in MED1 aromatic mutant droplets. Experiments were performed in 10% PEG and 125 mM NaCl with 10 μM protein and 5 μM cisplatin-TR. In summary, these results indicate that the π-system facilitates the partitioning of small molecules into MED1 aggregates. All error bars represent SEM.
[0083] Figure 46 This demonstrates that DNA can be compartmentalized and aggregated in nucleopolymers. (Top) Schematic diagram of droplet assay, showing protein, DNA, and cisplatin mixed under droplet-forming conditions, followed by centrifugation to separate the droplet phase from the dilution phase. The amount of DNA in both phases was then measured using a Bioanalyzer. DNA is enriched in the MED1 and HP1α droplet phases (left) compared to the MED1 and HP1α dilution phases (right).
[0084] Figures 47A-47D This shows that the concentration of small molecules in specific aggregates may affect target binding. Figure 47A The study showed that HCT116 cells were treated with DMSO or 50 μM cisplatin for 6 hours, followed by cisplatin immunofluorescence. The antibody recognized only platinum-treated DNA in the cisplatin-treated cells, supporting antibody specificity. Figure 47B The image shows that treatment with JQ1 for 24 hours resulted in a reduction of MED1 aggregates in (left) mEGFP-MED1-labeled HCT116 cells. (Right) Meta-plot of MED1 ChIP-Seq in HCT116 cells treated with DMSO and JQ1. Figure 47CCells were treated with JQ1 and then with cisplatin to determine whether the reduction of MED1 aggregates led to a decrease in DNA platinumization at the MYC locus. MYC DNA FISH and MED1 immunofluorescence showed a loss of signal in platinumized DNA after JQ1 treatment, indicating that the presence of MED1 aggregates contributes to DNA platinumization at this locus. Figure 47D The image shows (left) MED1 ChIP-seq tracing at MYC in HCT116 cells treated with DMSO or JQ1, showing the loss of MED1 load after JQ1 treatment. (Right) Quantification of cisplatin IF signal at the MYC DNA FISH focus in HCT116 cells treated with DMSO or JQ1; error bars represent SEM.
[0085] Figure 48A-48G Genotyping of endogenously labeled cell lines is shown. mEGFP-labeled cells are shown in HCT116 colon cancer cells. Figure 48A MED1, ( Figure 48B HP1α, ( Figure 48C FIB1, ( Figure 48D NPM1, ( Figure 48F BRD4 and ( Figure 48G Schematic image and genotyping agarose gel of SRSF2. Figure 48E It is an agarose gel expressing FIB1 and NPM1.
[0086] Figures 49A-49B This shows that nuclear condensates in cells are highly dynamic. (mEGFP-labeled...) Figure 49A MED1 and ( Figure 49B FRAP of HP1α in HCT116 cell line (error bars represent SEM) (n = 7).
[0087] Figures 50A-50B The dissolution of MED1 aggregates in cells was shown after prolonged cisplatin treatment. Figure 50A HCT116 cells endogenously expressing GFP-labeled MED1, treated with DMF or 50 μM cisplatin for 3, 6, or 12 hours, are shown. Quantification is shown on the right, with error bars indicating SD. Figure 50B Cell viability assays of HCT116 cells expressing GFP-MED1 treated with DMF or 50 μM cisplatin for 12 hours are shown.
[0088] Figure 51 The effects of cisplatin on various nucleated condensates were demonstrated. Figure 24HCT116 cells carrying endogenous GFP markers (MED1, BRD4, HP1α, FIB1, NPM1, or SRSF2) were shown after treatment with 50 μM cisplatin for 12 hours. Cisplatin specifically disrupted MED1 and BRD4 aggregates, consistent with the selective aggregation of cisplatin and BRD4 in MED1 aggregates.
[0089] Figure 52 The figure shows a reduction in MED1 genomic occupancy after cisplatin treatment. The graph illustrates MED1 ChIP-seq results 6 hours after treatment with DMSO or 50 μM cisplatin, demonstrating a decrease in MED1 genomic levels following cisplatin treatment.
[0090] Figures 53A-53D Characterization of MED1 aggregates in MCF7 cells is shown. Figure 53A Western blots of MED1 in MCF7 and MCF cells infected with the MED1-mEGFP lentiviral vector are shown. Figure 53B The FRAP of MED1-mEGFP in MCF7 cells expressing this fusion protein via a lentiviral vector is shown. Quantification is shown on the right, with the black bars representing the 95% confidence interval of the best-fit line. Figure 53C MCF7 cells expressing MED1-mEGFP were shown to grow under estrogen-free conditions, then stimulated with 100 nM estrogen for 15 minutes and imaged under a confocal fluorescence microscope for 4 minutes. Figure 53D Shown in ( Figure 53C The quantification of the size and strength of the fused MED1 aggregates shown in the figure.
[0091] Figures 54A-54B The formation of estrogen- and tamoxifen-dependent MED1 aggregates at the MYC oncogene was shown. Figure 54A DNA FISH and immunofluorescence are shown in MCF7 cells that have been estrogen-starved for 24 hours after treatment with either 100 nM estrogen or 100 nM estrogen and 5 μM tamoxifen. Average and random image analyses are shown on the right. Figure 54B RT-qPCR is shown, illustrating relative MYC RNA expression in MCF7 cells that are estrogen-starved, estrogen-stimulated, or treated with estrogen and tamoxifen. Error bars represent SEM.
[0092] Figure 55This image shows FLTX1 aggregates in MED1 aggregates within cells. (Left) Schematic diagram of MED1 or HP1α tethered to the LAC array in U2OS cells producing MED1 or HP1α aggregates. (Middle) Representative image of U2OS cell nuclei isolated from MED1 or HP1α tethered to the LAC array and exposed to FLTX1. Zoomed image of the LAC array is shown in the inset, and merged image is shown on the right. (Right) Quantification of FLTX1 enrichment on LAC arrays tethered to MED1 or HP1α; error bars represent SEM. ESR1 is not expressed in this osteosarcoma cell line.
[0093] Figure 56 This diagram shows patient-derived hormone therapy resistance mutations associated with ESR1. An ER mutation frequency plot from a set of 220 patients derived from the cBioPortal database shows the locations of ER point mutations with hotspots at 537 and 538.
[0094] Figures 57A-57B The enrichment ratios of ER and ER mutants in MED1 droplets are shown. Figure 57A This study demonstrates the quantification of the enrichment ratio of ER or ER mutants in MED1 droplets in the presence of estrogen or estrogen and tamoxifen. Figure 57B The image shows a representative picture of the partitioning of the ER mutant in MED1 droplets (left), with the enrichment ratio shown on the right. The assays were performed in 125 mM NaCl, 10% PEG, 10 μM of each protein, and 100 μM estrogen (with or without the 100 μM ligand shown). Figure 57A )and( Figure 57B The experiments for both. All error bars represent SD.
[0095] Figures 58A-58C MED1 overexpression was observed in tamoxifen-resistant breast cancer cells. Figure 58A This diagram illustrates the drug concentration in the aggregate after increasing aggregate volume via scaffold protein overexpression. Assuming a limited drug supply in the system, the drug concentration in the MED1 droplets is expected to decrease after the aggregate volume expands. Figure 58B Western blot analysis of MED1 and actin in MCF7 cells (sensitive to tamoxifen) and TAMR7 cells (a tamoxifen-resistant derivative of MCF7) showed that MED1 levels were higher in TAMR7 cells. Quantifications from the western blot are shown below, representing the average of three experiments. Figure 58C The quantification of MED1 aggregates in tamoxifen-sensitive and resistant cell lines is shown, illustrating the volume of MED1 aggregates and the number of aggregates in each cell nucleus.
[0096] Figures 59A-59BThe results showed that the size of MED1 aggregates increased with increasing MED1 concentration. Figure 59A The image shows pixel-level droplet sizes obtained from in vitro droplet assays in 125 mM NaCl and 10% PEG with either 5 μM (low) or 20 μM (high) MED1-GFP. Quantification is shown on the right, and error bars represent SD. Figure 59B A schematic phase diagram of MED1 is shown, indicating that as the total concentration of MED1 increases, the droplet size increases while maintaining the protein concentration within the droplet phase.
[0097] Figure 60 The MED1 condensation on the Lac array is shown. Figure 60 A schematic diagram of the Lac array assay is shown (left). U2OS cells carrying 50,000 copies of the Lac binding site were transfected with a construct expressing a Lac DNA-binding domain (DBD) fused to an estrogen receptor ligand-binding domain (LBD). Mediator aggregates (center) were detectable by immunofluorescence when the transcriptional apparatus was recruited to the site. U2OS-Lac cells were transfected with a construct expressing a Lac DBD fused to an ER LBD and a GFP+ / - construct overexpressing MED1. Cells were grown in estrogen-deprived medium and treated with 10 nM estrogen + / - 10 nM tamoxifen, then fixed and subjected to MED1 IF. The top image shows the location of the ER-LBD on the Lac array, and the bottom image shows the MED1 IF. The inset image shows zoom. (Right) Error bars represent SD relative to the quantification of MED1 enrichment on the Lac array.
[0098] Figures 61A-61D A computer simulation model of small molecule partitioning in aggregates is presented. To demonstrate the behavior of small molecule drugs binding to targets contained within aggregates, a simple model was developed where both the drug and target are contained within the aggregate, with percentage target binding as the reading. In this model, target partitioning is unaffected by drug binding. Figure 61A A table showing the values used to establish a drug binding model within the agglomerates is presented, derived from known values of ER and tamoxifen. Agglomerate integral values are derived from an analysis of MED1 IF from human ER+ breast cancer biopsies. Figure 61B The diagram shows target binding as a function of drug concentration in the simulation. Dashed lines represent systems where the target and drug diffuse freely through the cell. Red and blue lines represent systems where the target and drug are aggregated in aggregates. The blue line represents target binding in aggregates containing both drug and target, and the red line represents target binding in the nucleoplasm dilution phase. In summary, these data indicate that, at a given concentration, the drug binds a higher percentage of target molecules inside the aggregate than outside. Figure 61CThis shows the fraction of targets bound at a given drug concentration under various partition coefficients of the drug. Dashed lines represent target binding in the diffuse state. In summary, this simulation shows that the percentage of targets bound at a given concentration increases as the partition coefficient of the drug in the aggregate increases. Figure 61D The simulations show drug target binding in settings with larger agglomerates. Target binding as a function of drug concentration is presented in settings with normal agglomerate volume (2% of the core volume) and larger agglomerate volume (4% of the core volume). Diffusion controls are shown as dashed lines. In summary, these data suggest that the effectiveness of drug binding to its target in larger agglomerates may be lower. Detailed Implementation
[0099] Unless otherwise stated, the practice of this invention generally employs conventional techniques within the scope of the art, including cell biology, cell culture, molecular biology, transgenic biology, microbiology, recombinant nucleic acid (e.g., DNA) technology, immunology, and RNA interference (RNAi). Non-limiting descriptions of some of these techniques can be found in the following publications: Ausubel, F. et al. (eds.), Current Protocols in Molecular Biology, Current Protocols in Immunology, Current Protocols in Protein Science, and Current Protocols in Cell Biology, all published by John Wiley & Sons, NY, editions up to December 2008; Sambrook, Russell, and Sambrook, Molecular Cloning: A Laboratory Manual, 3rd ed., Cold Spring Harbor Laboratory Press, Cold Spring Harbor, 2001; Harlow, E., and Lane, D., Antibodies – A Laboratory Manual, Cold Spring Harbor Laboratory Press, Cold Spring Harbor, 1988; Freshney, RI, “Culture of Animal Cells, A Manual of Basic Technique”, 5th ed., John Wiley & Sons, Hoboken, NJ, 2005. Non-restrictive information about the therapeutic agent and human disease can be found in Goodman and Gilman's *The Pharmacological Basis of Therapeutics*, 11th edition, McGraw Hill, 2005, Katzung, B. (ed.) *Basic and Clinical Pharmacology*, McGraw-Hill / Appleton & Lange; 10th edition (2006) or 11th edition (July 2009).Non-restricted information on genes and hereditary disorders can be found at McKusick, VA: Mendelian Inheritance in Man. A Catalog of Human Genes and Genetic Disorders. Baltimore: Johns Hopkins University Press, 1998 (12th edition) or more recently at the online database: Online Mendelian Inheritance in Man, OMIM™. McKusick-Nathans Institute of Genetic Medicine, Johns Hopkins University (Baltimore, MD) and National Center for Biotechnology Information, National Library of Medicine (Bethesda, MD), as of May 1, 2010, ncbi.nlm.nih.gov / omim / and Online Mendelian Inheritance in Animals (OMIA) (which is a database of genes, hereditary disorders, and traits in animal species other than humans and mice), accessible at omia.angis.org.au / contact.shtml. All patents, patent applications, and other publications (e.g., scientific articles, books, websites, and databases) mentioned herein are incorporated in their entirety by reference. In the event of any conflict between this specification and any incorporated references, this specification (including any modifications thereof, which may be based on the incorporated references) shall prevail. Unless otherwise specified, the standard technical meanings accepted for the terms used herein are as follows. Standard abbreviations are used for various terms herein.
[0100] The inventors were surprised to discover that some agents were incorporated into aggregates that did not contain the agents. See For example Figure 22This has important implications for drug efficacy. For example, if a drug is isolated within an aggregate, its effectiveness may be lower, thus preventing interaction with the target. Alternatively, if the aggregate inhibits the drug's proximity to the target, its effectiveness may be lower. This phenomenon can help explain why some candidate drugs exhibit high activity against therapeutic targets in vitro but not in cells or organisms. It can also explain the surprising observation that inhibiting global gene regulators such as BRD4 or CDK7 can selectively target oncogenes with acquired large superenhancers; selectively allocating inhibitors such as JQ1 and THZ1 into superenhancer aggregates preferentially disrupts transcription at those loci. The inventors have also surprisingly discovered that aggregates aggregate some clinically important small-molecule cancer therapeutics, thereby altering their pharmacodynamic properties. Thus, aggregates can aggregate small molecules, thereby guiding their biological activity.
[0101] Therefore, some aspects of the present invention relate to methods for characterizing agents, the methods comprising contacting the agent with a composition (e.g., a solution) comprising a coagulant having at least one component, and measuring the incorporation of the agent into the coagulant. In some embodiments, the method further includes determining whether the agent is a potential therapeutic agent based on whether both the target in the appropriate cells and the agent are at effective concentrations in or outside the coagulant. In some embodiments, the method further includes characterizing a variety of agents (e.g., drug candidates) and selecting one or more lead agents having a desired or optimal coagulant distribution profile (e.g., accumulating in the coagulant in the appropriate cells when the target of the agent is present in the coagulant, or accumulating outside the coagulant when the target of the agent is present outside the coagulant). As used herein, the term "agent" refers to any compound or substance, such as, but not limited to, small molecules, nucleic acids, polypeptides, peptides, pharmaceuticals, ions, etc. "Agent" can be any chemical, entity, or portion, including but not limited to synthetic and naturally occurring protein and non-protein entities. In some embodiments, the agent is a nucleic acid; a nucleic acid analog; a protein; an antibody; a peptide; an aptamer; an oligomer of nucleic acid, amino acid, or carbohydrate, including but not limited to proteins, oligonucleotides, ribozymes, DNases, glycoproteins, siRNAs, lipoproteins, aptamers, and modifications and combinations thereof. In some embodiments, the agent is selected from nucleic acids, small molecules, polypeptides, and peptides. In some embodiments, the agent is a small molecule having a chemical moiety. For example, the chemical moiety includes unsubstituted or substituted alkyl, aromatic, or heterocyclic moieties, including macrolides, leprosycin, and related natural products or analogs thereof. Known compounds may have the desired activity and / or properties, or may be selected from a library of different compounds. In some embodiments, the agent is small enough to diffuse into the aggregate. In some embodiments, the agent is less than about 4.4 kDa. In some embodiments, the agent has a partition coefficient of at least 100, 150, 200, 300, 350, 400, 450, 500, 550, 600, 650, 700, or greater than that of the aggregates described herein. In some embodiments, the agent has a distribution coefficient of the aggregate described herein that is less than about 10, 20, 50, 100, 150, 200, 300, 350, 400, 450, 500, 550 or 600.
[0102] In some embodiments, the agent is a small molecule. The term "small molecule" refers to an organic molecule with a mass less than about 2 kilodaltons (kDa). In some embodiments, the small molecule is less than about 1.5 kDa, or less than about 1 kDa. In some embodiments, the small molecule is less than about 800 Da, 600 Da, 500 Da, 400 Da, 300 Da, 200 Da, or 100 Da. Typically, the small molecule has a mass of at least 50 Da. In some embodiments, the small molecule is non-polymerized. In some embodiments, the small molecule is not an amino acid. In some embodiments, the small molecule is not a nucleotide. In some embodiments, the small molecule is not a sugar. In some embodiments, the small molecule contains multiple carbon-carbon bonds and may contain one or more heteroatoms and / or one or more functional groups, such as amine, carbonyl, hydroxyl, or carboxyl groups, which are important for structural interactions (e.g., hydrogen bonding) with proteins, and in some embodiments, at least two functional groups. The small molecule typically contains one or more cyclic carbon or heterocyclic structures and / or aromatic or polyaromatic structures, optionally substituted by one or more of the aforementioned functional groups. In some implementations, the small molecule contains at least one, at least two, at least three or more aromatic side chains.
[0103] In some embodiments, the agent is a protein or polypeptide. The term "polypeptide" refers to a polymer of amino acids linked by peptide bonds. A protein is a molecule containing one or more polypeptides. A peptide is a relatively short polypeptide, typically between about 2 and 100 amino acids (aa) in length, for example, between 4 and 60 aa; between 8 and 40 aa; between 10 and 30 aa. The terms "protein," "polypeptide," and "peptide" are used interchangeably. Generally, in various embodiments, a polypeptide may contain only standard amino acids or may contain one or more non-standard amino acids (which may be naturally occurring or non-naturally occurring amino acids) and / or amino acid analogs. "Standard amino acids" are any of the 20 L amino acids commonly used in mammalian protein synthesis and encoded by the genetic code. "Non-standard amino acids" are amino acids that are not commonly used in mammalian protein synthesis. Non-standard amino acids include naturally occurring amino acids (in addition to the 20 standard amino acids) and non-naturally occurring amino acids. Amino acids (e.g., one or more amino acids in a polypeptide) can be modified, for example, by adding (e.g., covalently linking) moieties such as alkyl groups, alkyl acyl groups, carbohydrate groups, phosphate groups, lipids, polysaccharides, halogens, linkers for conjugation, protecting groups, small molecules (such as fluorophores), etc. In some embodiments, the agent is a protein or polypeptide comprising at least 5, at least 10, at least 15, at least 20, at least 25, at least 30, or more aromatic amino acids.
[0104] In some implementations, the agent contains or is composed of DNA or RNA.
[0105] In some embodiments, the agent is a peptide mimic. The terms “mimic,” “peptide mimic,” and “peptide mimic” are used interchangeably herein and generally refer to a peptide, partial peptide, or non-peptide molecule that mimics the tertiary binding structure or activity of a selected natural peptide or protein functional domain (e.g., binding motif or active site). These peptide mimics include recombinant or chemically modified peptides, as well as non-peptide agents such as small molecule drug mimics.
[0106] The agent may be a known drug. The type of drug is not limited to any one that can be used as a suitable medicine. In some embodiments, the agent may be an anticancer drug. In some embodiments, the known drug will be used to treat human diseases or conditions.
[0107] In some embodiments, the agent is a chemotherapeutic agent or a derivative thereof. In some embodiments, the chemotherapeutic agent is selected from actinomycin D, adelleukin, retinoic acid, all-trans retinoic acid / ATRA, hexamethylmelamine, amascrine, asparaginase, azacitidine, azathioprine, and BCG. Calmette-Gurin / BCG, Bendamustine Hydrochloride, Bexarotin, Bicalutamide, Bleomycin, Bortezomib, Busulfan, Capecitabine, Carboplatin, Carfilzomib, Carmustine, Chlorobutazone, Cisplatin, Cladribine, Cyclophosphamide, Cytabarine, Dacarbazine, Daunorubicin, Dinnisin, Dexrazosen, Docetaxel, Doxorubicin, Epirubicin, Etoposide, Fludarabine, Fluorouracil (5-FU), Gemcitabine, Goserelin, Hydrocortisone, Hydroxyurea, Idarubicin, Ifosfamide, Interferon Alpha, Irinotecan CPT-11, Lapatinib, Lenalidomide, Leucine Proprene, mechlorethamine, methylphenidate, methylprednisolone, mitomycin, mitotane, mitoxantrone, octreotide, oxaliplatin, paclitaxel, permab, pegaspargase, pefescine, PEG-interferon, pemetrexed, pentostatin, phenylalanine mustard, prilocytic erythromycin / light Cinnamomum, prednisone, prednisolone, procarbazine, raloxifene, romistamine, saxaglastine, streptozotocin, tamoxifen, temozolomide, tansimolimus, teniposide, thalidomide, thioguanine, thiophosphoramide / thiotepa, thiotepa, topotecan hydrochloride, toremifene, retinoic acid, pentorubicin, vincristine, vinblastine, vinorelbine, vorinostat, zoledronic acid, and combinations thereof. In some embodiments, the agent is or comprises cisplatin or a derivative thereof. In some embodiments, the agent is or comprises JQ1 (( S )- Uncle -Butyl-2-(4-(4-chlorophenyl)-2,3,9-trimethyl-6 H -Thiophene[3,2- f [1,2,4]triazolo[4,3- a [1,4]diazazo-6-yl)acetate or a derivative thereof. In some embodiments, the agent is or contains tamoxifen or a derivative thereof.
[0108] In some embodiments, the agent comprises a protein transduction domain (PTD). A PTD, or cell-penetrating peptide (CPP), is a peptide or peptide-like substance capable of crossing the plasma membrane of many (if not all) mammalian cells. A PTD can enhance the uptake of the portion to which it is attached or in which it is present. These peptides are typically rich in arginine. For example, the PTD of the Tat protein of human immunodeficiency virus types 1 and 2 (HIV-1 and HIV-2) has been extensively studied and used to transport cargo into mammalian cells. See, for example, Fonseca SB et al., Adv Drug Deliv Rev., 61(11):953-64, 2009; Heitz F et al., Br JPharmacol., 157(2):195-206, 2009, and any of the foregoing references, which are incorporated herein by reference. In some embodiments, the cell-penetrating peptide is HIV-TAT.
[0109] In some embodiments, the agent is capable of binding to a target. In some embodiments, the target is present in the composition comprising the agglomerates. In some embodiments, the target is primarily present (e.g., at least 51%, at least 60%, at least 70%, at least 80%, at least 90%, at least 95%, at least 97%, at least 99%, at least 99.5%, at least 99.9%, at least 99.99% or more) outside the agglomerates. In some embodiments, the concentration of the target outside the agglomerates is at least 2, at least 3, at least 4, at least 5, at least 6, at least 7, at least 8, at least 9, at least 10, at least 20, at least 50, at least 100 or more than the concentration of the target inside the agglomerates. In some embodiments, the target is primarily present (e.g., at least 51%, at least 60%, at least 70%, at least 80%, at least 90%, at least 95%, at least 97%, at least 99%, at least 99.5%, at least 99.9%, at least 99.99% or more) in the agglomerates. In some implementations, the concentration of the target in the agglomerate is at least 2, at least 3, at least 4, at least 5, at least 6, at least 7, at least 8, at least 9, at least 10, at least 20, at least 50, at least 100, or more times the concentration of the target outside the agglomerate.
[0110] In some embodiments, the agent is a candidate agent as described herein. In some embodiments, the agent is generated from an agent that has been modified to be incorporated into the aggregate of interest. In some embodiments, the agent is generated from the coupling or connection of a first agent and a second agent as described herein.
[0111] As shown in the examples below, molecules with aromatic rings have been found to preferentially aggregate in MED1 aggregates. Therefore, in some embodiments, the agent is modified to increase or decrease the number of aromatic rings. In some embodiments, the agent is modified to increase the number of aromatic rings by at least about 1, 2, 3, 4, 5, 6, 7, 8, 9, 10, 11, 12, 13, 14, 15, 16, 17, 18, 19, 20, 21, 22, 23, 24, 25, 26, 27, 28, 29, 30, 35, 40, 45, 50 or more. In some embodiments, the agent (e.g., composed of or containing small molecules) is modified to contain at least one or at least two or more aromatic rings, such as... Figure 44A The groups R1 and R2 provided are shown in the diagram. In some embodiments, the agent (e.g., composed of or comprising small molecules) is modified to include groups selected from... Figure 44A The components M66, K19, M101, M195, K18, M103, and M66 shown contain at least one or at least two aromatic rings or more aromatic rings. In some embodiments, the pharmaceutical agent (e.g., composed of or comprising small molecules) is modified to contain at least two or three structures, such as... Figure 44D The results are shown in each row below the "Top 5 Probes" provided in the documentation.
[0112] In some embodiments, the agent is composed of or comprises a peptide, polypeptide, or protein, and the number of aromatic rings is increased by replacing one or more non-aromatic amino acid residues with aromatic amino acid residues (e.g., phenylalanine, tryptophan, tyrosine, and / or histidine). In some embodiments, the agent is composed of or comprises a peptide, polypeptide, or protein, and the number of aromatic rings is increased by adding one or more aromatic amino acids. In some embodiments, the aromatic amino acid residue is not histidine. In some embodiments, the aromatic amino acid residue is phenylalanine. In some embodiments, the aromatic amino acid residue is a non-naturally occurring amino acid residue or a non-standard amino acid residue (e.g., L-DOPA (l-3,4-dihydroxyphenylalanine)).
[0113] In some embodiments, the agent is composed of or contains peptides, polypeptides, or proteins, and the number of aromatic rings is reduced by replacing one or more aromatic amino acids with a non-aromatic amino acid (e.g., alanine). In some embodiments, the number of aromatic rings is reduced by deleting or modifying one or more aromatic amino acids.
[0114] In some implementations, the number of aromatic rings is reduced by deleting, modifying, and / or substituting two or more aromatic amino acids.
[0115] In some embodiments, the modified agent has increased affinity for aggregates (e.g., transcription aggregates, heterochromatin aggregates, splice dot aggregates, nucleoli, chromatin aggregates, multicomb aggregates, DNA damage repair aggregates, or aggregates physically associated with mRNA initiation or elongation complexes). In some embodiments, the modified agent has increased affinity for aggregates containing specific aggregate components (e.g., mediators, mediator components, MED1, BRD4, POLII, SRSF2, FIB1, NPM1, or HP1α). In some embodiments, the modified agent has increased affinity for aggregates containing one or more specific mediator components (e.g., MED1). In some embodiments, the aggregate contains an aggregate component (e.g., MED1) with one or more aromatic side loops. In some implementations, the modified agent has an affinity for the aggregate that is at least 2, 3, 4, 5, 6, 7, 8, 9, 10, 20, 50, or 100 times greater than that of the corresponding unmodified agent.
[0116] In some embodiments, the modified agent has reduced affinity for aggregates (e.g., transcription aggregates, heterochromatin aggregates, splice dot aggregates, nucleoli, chromatin aggregates, multicomb aggregates, DNA damage repair aggregates, or aggregates physically associated with mRNA initiation or elongation complexes). In some embodiments, the modified agent has reduced affinity for aggregates containing specific aggregate components (e.g., mediators, mediator components, MED1, BRD4, POLII, SRSF2, FIB1, NPM1, or HP1α). In some embodiments, the modified agent has reduced affinity for aggregates containing one or more specific mediator components (e.g., MED1). In some embodiments, the aggregate contains aggregate components having one or more aromatic side loops. In some implementations, the modified agent has an affinity for the aggregate that is at least 2, 3, 4, 5, 6, 7, 8, 9, 10, 20, 50, or 100 times lower than that of the corresponding unmodified agent.
[0117] In some embodiments, the modified agent has an affinity for the second agent. In some embodiments, the modified agent is capable of increasing the concentration or amount of the second agent in the aggregate by at least 2, 3, 4, 5, 6, 7, 8, 9, 10, 20, 50, 100, or more times compared to the concentration or amount of the second agent in the aggregate in the absence of the modified agent. In some embodiments, the modified agent is capable of decreasing the concentration or amount of the second agent in the aggregate by at least 2, 3, 4, 5, 6, 7, 8, 9, 10, 20, 50, 100, or more times compared to the concentration or amount of the second agent in the aggregate in the absence of the modified agent.
[0118] The target is not limited. In some embodiments, the target is an anticancer target. In some embodiments, the target is an enzyme (e.g., oxidoreductase, transferase, hydrolase, lyase, isomerase, ligase, kinase, cyclin-dependent kinase, MAPK, phosphatidylinositol kinase, sphingosine kinase, carbohydrate kinase, nucleoside-phosphokinase, nucleoside-bisphosphokinase), a receptor (e.g., a nuclear receptor), an oncogene, a transcription factor, or a signaling factor. In some embodiments, the target is genomic DNA. In some embodiments, the target is any component described herein.
[0119] As used herein, agglomerates refer to phase-separated multimolecular assemblies. In some embodiments, agglomerates refer to in vitro agglomerates (sometimes referred to herein as “droplets”). In some embodiments, in vitro agglomerates are artificially generated using one or more agglomerate components in solution. In some embodiments, in vitro agglomerates contain components that mimic agglomerates found in cells. In some embodiments, in vitro agglomerates are isolated from cells.
[0120] This document covers any suitable means of isolating aggregates from cells or compositions. In some embodiments, the aggregates are chemically or immunologically precipitated. In some embodiments, the aggregates are separated by centrifugation (e.g., at about 5,000 x g, 10,000 x g, 15,000 x g for about 5–15 minutes; at about 10,000 x g for about 10 minutes). Aggregates can be isolated from cells by lysing cell nuclei under suitable buffer conditions using a homogenizer (i.e., a Dounce homogenizer), followed by centrifugation and / or filtration to separate the aggregates.
[0121] In some embodiments, the aggregate is present in cells. The aggregate can be naturally occurring. In other embodiments, the aggregate can be present in transgenic cells or other manipulated cells. In some embodiments, the aggregate can contain a detectable tag. In some embodiments, the detectable tag is present on the aggregate components. In some embodiments, the detectable tag is incorporated into the aggregate. The detectable tag (sometimes referred to herein as a detectable marker) is not limited and can be any detectable tag described herein. In some embodiments where multiple detectable tags are present, the detectable tags can be distinctly detectable.
[0122] In some embodiments, the agglomerate may be a transcriptional agglomerate, heterochromatin agglomerate, splice dot agglomerate, nucleolus, chromatin agglomerate, multicomb agglomerate, DNA damage repair agglomerate, or a agglomerate physically associated with the mRNA initiation or elongation complex. In some embodiments, the agglomerate may be an in vitro agglomerate having one or more components of a transcriptional agglomerate, heterochromatin agglomerate, splice dot agglomerate, nucleolus, chromatin agglomerate, multicomb agglomerate, DNA damage repair agglomerate, or a agglomerate physically associated with the mRNA initiation or elongation complex. In some embodiments, the agglomerate is physically associated with DNA (e.g., genomic DNA, cellular genomic DNA). In some embodiments, the agglomerate, its components, agents, or methods for assessing the properties of the agglomerate are those described in PCT / US2019 / 023694, filed March 22, 2019 (which is incorporated herein by reference in its entirety). In some embodiments, the aggregates (e.g., in vivo aggregates, ex vivo aggregates, in vitro aggregates, or droplets) comprise aggregate components overexpressed in cancer cells resistant to anticancer agents, wherein the overexpression is associated with resistance to the anticancer agent. In some embodiments, the amount of the aggregate component overexpressed in anticancer agent-resistant cancer cells is greater in the aggregate than the amount present in aggregates from cancer cells that do not express the aggregate component. In some embodiments, the volume of the aggregate containing the aggregate component overexpressed in anticancer agent-resistant cancer cells is greater than the volume of the aggregate found in cancer cells that do not overexpress the aggregate component.
[0123] In some embodiments, at least one component of the aggregate is a mediator, a mediator component, MED1, BRD4, POLII, SRSF2, FIB1, NPM1, or HP1α. In some embodiments, the at least one component is a component of a nuclear aggregate. In some embodiments, the at least one component is a component of a super-enhancer aggregate, splice dot aggregate, heterochromatin aggregate, nucleolus, splice dot aggregate, nucleolus, chromatin aggregate, multicomb aggregate, DNA damage repair aggregate, or a functional fragment of such a component. In some embodiments, at least one component is a component of an aggregate located in the cell nucleus or a functional fragment thereof. In some embodiments, at least one component of the aggregate comprises an intrinsically disordered region (IDR).
[0124] As used herein, “transcriptional condensate” is a phase-separated multimolecular assembly that occurs at the transcription site and is a high-density co-assembly that may include transcription factors, cofactors (e.g., coactivators), chromatin regulators, DNA, noncoding RNA, nascent RNA, RNA polymerase II, kinases, proteasomes, topoisomerases, and / or enhancers (see, for example...). Figure 4 , Figure 11 and Figure 12 As used herein, a “super-enhancer condensate” is a transcriptional condensate that occurs at a super-enhancer. Super-enhancers are known in the art. See, for example, U.S. Patent Application Publication No. 20140287932 A1, which is incorporated herein by reference. As used herein, a “heterochromatin condensate” is a phase-separated multimolecular assembly that is physically associated with heterochromatin (e.g., occurs on heterochromatin). Heterochromatin condensates have been shown to be associated with repression of gene transcription. As used herein, a condensate that is physically associated with the mRNA initiation or elongation complex is a phase-separated multimolecular assembly that occurs at the relevant complex. In some embodiments, a condensate that is physically associated with the elongation complex contains splicing factors. In some embodiments, a condensate that is physically associated with the elongation complex is a splicing spot. As used herein, a “splicing spot” (sometimes also called a nuclear spot or interchromatin granule cluster) is a condensate rich in splicing factors. See, for example, Y. Chen, AS Belmont, Genome organization around nuclearspeckles. Curr. Opin. Genet. Dev.55, 91–99 (2019), which is incorporated herein by reference. As used herein, the nucleolus or “nucleolus” (plural form) is a condensation of RNA and proteins that occurs in the cell nucleus. See, for example, M. Feric et al., Coexisting Liquid Phases Underlie Nucleolar Subcompartments. Cell 165, 1686–1697 (2016), which is incorporated herein by reference. As used herein, “chromatin condensate” is a phase-separated multimolecular assembly that is physically associated with chromatin. See Gibson et al., Organization of Chromatin by Intrinsic and Regulated Phase Separation, Cell (2019), which is incorporated herein by reference. As used herein, “polycomb condensate” is a phase-separated multimolecular assembly that is physically associated with chromatin and can repress gene transcription. See Plys et al., Phase separation of Polycomb-repressive complex 1 is governed by a charged disordered region of CBX2, Genes Dev. 2019 July 1;33(13-14):799-813, which is incorporated herein by reference. As used herein, “DNA damage repair condensate” is a phase-separated multimolecular assembly that is physically associated with double-stranded DNA breaks. See Pessina et al., Functional transcription promoters at DNA double-strand breaksmediate RNA-driven phase separation of damage-response factors, Nature Cell Biology, Vol. 21, pp. 1286-1299 (2019), which is incorporated herein by reference.
[0125] In some preferred embodiments of the methods disclosed herein, the condensate is a transcriptional condensate or an in vitro condensate containing one or more components of a transcriptional condensate. In some preferred embodiments of the methods disclosed herein, the condensate is a super-enhancer condensate or an in vitro condensate containing one or more components of a super-enhancer condensate. In some preferred embodiments of the methods disclosed herein, the condensate is a splice dot condensate or an in vitro condensate containing one or more components of a splice dot condensate. In some preferred embodiments of the methods disclosed herein, the condensate is a heterochromatin condensate or an in vitro condensate containing one or more components of a heterochromatin condensate. In some preferred embodiments of the methods disclosed herein, the condensate is a heterochromatin condensate or an in vitro condensate containing one or more components of a heterochromatin condensate. In some preferred embodiments of the methods disclosed herein, the condensate is a nucleolus or an in vitro condensate containing one or more components of a nucleolus. In some preferred embodiments of the methods disclosed herein, the condensate is a chromatin condensate or an in vitro condensate containing one or more components of a chromatin condensate. In some preferred embodiments of the methods disclosed herein, the condensate is a multicomb condensate or an in vitro condensate containing one or more components of a multicomb condensate. In some preferred embodiments of the methods disclosed herein, the aggregate is a DNA damage repair aggregate or an in vitro aggregate containing one or more components of a DNA damage repair aggregate.
[0126] As used herein, the phrase "agglomerate component" refers to peptides, proteins, nucleic acids, signaling molecules, lipids, etc., that are part of or have the ability to be part of an aggregate (e.g., transcription aggregates, super-enhancer aggregates, splice dot aggregates, heterochromatin aggregates, nucleoli, chromatin aggregates, multicomb aggregates, or DNA damage repair aggregates). In some embodiments, the component is within the aggregate. In some embodiments, the component is essential for aggregate formation or stability. In some embodiments, the component is not essential for aggregate formation or stability. In some embodiments, the component is a protein or peptide and comprises one or more inherently ordered domains (e.g., IDR of the activation domain of a transcription factor, IDR interacting with the IDR of the activation domain of a transcription factor, IDR of a signaling factor, IDR of a methyl-DNA binding protein, IDR of a gene silencing factor, IDR of a polymerase, IDR of a splicing factor, IDR of a nucleolar small nucleoribonucleoprotein, IDR of a nucleophosphorus protein, IDR of a histone, IDR of CBX2, IDR of 53BP1). In some embodiments, the components are non-structural elements of the aggregate (e.g., not essential for aggregate integrity). In some embodiments, the aggregate comprises, is composed of, or is substantially composed of, one, two, three, four, five, six, seven, eight, nine, ten, or more components. In some embodiments, the aggregate (e.g., in vitro aggregate) does not contain nucleic acids. In some embodiments, the aggregate (e.g., in vitro aggregate) does not contain RNA. In some embodiments, the components are fragments of proteins or nucleic acids.
[0127] As illustrated in the following examples, replacing the basic amino acid in MED1 with alanine weakens the ability of the mutant MED1 to form droplets (i.e., in vitro aggregates) in solution. Therefore, in some embodiments, the aggregate component is a naturally occurring protein or polypeptide that has been modified to increase or decrease the number of basic amino acid residues and thereby modulate the ability of the aggregate component to form aggregates (e.g., droplets). In some embodiments, at least about 10%, at least about 20%, at least about 30%, at least about 40%, at least about 50%, at least about 60%, at least about 70%, at least about 80%, at least about 90%, or all of the basic amino acid residues have been replaced with non-basic amino acid residues (e.g., alanine or other neutral amino acids such as asparagine, cysteine, glutamine, glycine, isoleucine, leucine, methionine, phenylalanine, proline, serine, threonine, tryptophan, tyrosine, valine, etc.). In some embodiments, at least 1, 2, 3, 4, 5, 6, 7, 8, 9, 10, 11, 12, 13, 14, 15, 16, 17, 18, 19, 20, 25, 30, or more basic amino acid residues are replaced by non-basic amino acid residues. In some embodiments, at least 1, 2, 3, 4, 5, 6, 7, 8, 9, 10, 11, 12, 13, 14, 15, 16, 17, 18, 19, 20, 25, 30, 35, 40, 45, 50, or more basic amino acid residues are added to the condensate component.
[0128] In some embodiments, the ability of a modified agglomerate component to form agglomerates (e.g., droplets) is reduced by approximately 1.1 times, 1.2 times, 1.3 times, 1.4 times, 1.5 times, 1.6 times, 1.7 times, 1.8 times, 1.9 times, 2 times, 2.5 times, 3 times, 4 times, 5 times, 6 times, 7 times, 8 times, 9 times, 10 times, 20 times, 50 times, or 100 times compared to an unmodified agglomerate component. In some embodiments, the ability of a modified agglomerate component to form agglomerates (e.g., droplets) is increased by approximately 1.1 times, 1.2 times, 1.3 times, 1.4 times, 1.5 times, 1.6 times, 1.7 times, 1.8 times, 1.9 times, 2 times, 2.5 times, 3 times, 4 times, 5 times, 6 times, 7 times, 8 times, 9 times, 10 times, 20 times, 50 times, or 100 times compared to an unmodified agglomerate component.
[0129] As illustrated in the examples below, replacing aromatic amino acids in MED1 with alanine impairs the ability of agents containing aromatic substituents to be incorporated into modified MED1 droplets. Therefore, in some embodiments, the aggregate component is a naturally occurring protein or polypeptide that has been modified to increase or decrease the number of aromatic amino acid residues and thereby modulates the ability to incorporate agents containing aromatic substituents into the aggregate containing the aggregate component. In some embodiments, at least about 10%, at least about 20%, at least about 30%, at least about 40%, at least about 50%, at least about 60%, at least about 70%, at least about 80%, at least about 90%, or all of the aromatic amino acid residues have been replaced with non-aromatic amino acid residues (e.g., alanine or other neutral amino acids such as asparagine, cysteine, glutamine, glycine, isoleucine, leucine, methionine, phenylalanine, proline, serine, threonine, tryptophan, tyrosine, valine, etc.). In some embodiments, at least 1, 2, 3, 4, 5, 6, 7, 8, 9, 10, 11, 12, 13, 14, 15, 16, 17, 18, 19, 20, 25, 30 or more aromatic amino acid residues are substituted with non-aromatic amino acid residues. In some embodiments, at least 1, 2, 3, 4, 5, 6, 7, 8, 9, 10, 11, 12, 13, 14, 15, 16, 17, 18, 19, 20, 25, 30, 35, 40, 45, 50 or more aromatic amino acid residues are added to the condensate component.
[0130] In some embodiments, the ability to incorporate an agent containing aromatic substituents into a aggregate containing a modified aggregate component is reduced by approximately 1.1 times, 1.2 times, 1.3 times, 1.4 times, 1.5 times, 1.6 times, 1.7 times, 1.8 times, 1.9 times, 2 times, 2.5 times, 3 times, 4 times, 5 times, 6 times, 7 times, 8 times, 9 times, 10 times, 20 times, 50 times, or 100 times compared to a corresponding aggregate containing an unmodified aggregate component. In some embodiments, the ability to incorporate an agent containing aromatic substituents into a coagulant containing a modified coagulant component is increased by approximately at least 1.1 times, at least 1.2 times, at least 1.3 times, at least 1.4 times, at least 1.5 times, at least 1.6 times, fold, at least 1.7 times, at least 1.8 times, at least 1.9 times, at least 2 times, at least 2.5 times, at least 3 times, at least 4 times, at least 5 times, at least 6 times, at least 7 times, at least 8 times, at least 9 times, at least 10 times, at least 20 times, at least 50 times, or at least 100 times compared to a corresponding coagulant containing an unmodified coagulant component.
[0131] In some specific embodiments, this document provides a method for obtaining a reagent having a desired partition coefficient, the method comprising (a) providing a first reagent having a partition coefficient and at least a second reagent, the second reagent being identical to the first reagent except that one or more non-aromatic amino acids are replaced by aromatic amino acids and / or one or more aromatic amino acids are added, and (b) measuring the partition coefficient of the second reagent, thereby obtaining a reagent having the desired partition coefficient.
[0132] Intrinsically disordered regions (also known as intrinsically (or inherently) disordered regions (IDRs) or intrinsically (or inherently) disordered domains) can be found in many protein condensate components. Each of these terms is used interchangeably throughout this disclosure. IDRs lack stable secondary and tertiary structures. In some embodiments, IDRs can be identified by methods disclosed in the following literature: Ali, M. and Ivarsson, Y. (2018). High ‐throughput discovery of functional disordered regions. Molecular Systems Biology , 14 (5), e8377. IDRs are known in the art and can be identified by any suitable method.
[0133] In some embodiments, the components are signal transduction factors, methyl-DNA binding proteins, BRD4, mediators, mediator components, MED1, MED15, transcription factors, RNA polymerases, DNA sequences (e.g., enhancer DNA sequences, methylated DNA sequences, superenhancer DNA sequences, the 3' end of a transcribed gene, signal response elements, hormone response elements, oncogenes, or portions thereof), gene silencing factors, splicing factors, elongation factors, initiation factors, histones (e.g., modified histones), cofactors, RNA (e.g., ncRNA), mediators, RNA polymerases (e.g., RNA polymerase II), kinases (e.g., cyclin-dependent kinases, CDK7, CDK8), proteasomes, or topoisomerases. In some embodiments, the components are MED1, BRD4, POLII, SRSF2, FIB1, NPM1, histones, CBX2, 53BP1, or HP1α, or functional fragments thereof (e.g., fragments containing IDRs). In some embodiments, the cofactors contain the LXXLL motif. In some embodiments, the cofactor comprises an LXXLL motif and has an increased TF (e.g., nuclear receptor, master transcription factor) valence when bound to a ligand (e.g., a homologous ligand, a naturally occurring ligand, or a synthetic ligand). Cofactors having an LXXLL motif are known in the art. In some embodiments, the component is a fragment of a cofactor comprising an IDR and an LXXLL motif. In some embodiments, the component is a protein or nucleic acid. The component is not limited and can be any condensate component identified in the art.
[0134] As used herein, a “mediator component” comprises a polypeptide whose amino acid sequence is identical to that of a naturally occurring mediator complex polypeptide, or is composed of a polypeptide whose amino acid sequence is identical to that of a naturally occurring mediator complex polypeptide. A naturally occurring mediator complex polypeptide can be any of approximately 30 polypeptides found, for example, in mediator complexes that are present in or purified from cells (see, for example, Conaway et al., 2005; Kornberg, 2005; Malik and Roeder, 2005). In some embodiments, the naturally occurring mediator component is any of Med1–Med 31 or any naturally occurring mediator polypeptide known in the art. For example, a naturally occurring mediator complex polypeptide can be Med6, Med7, Med10, Med12, Med14, Med15, Med17, Med21, Med24, Med27, Med28, or Med30. In some embodiments, the mediator peptide is a subunit found in the Med11, Med17, Med20, Med22, Med8, Med18, Med19, Med6, Med30, Med21, Med4, Med7, Med31, Med10, Med1, Med27, Med26, Med14, and Med15 complex. In some embodiments, the mediator peptide is a subunit found in the Med12 / Med13 / CDK8 / cyclin complex. Mediators are further described in detail in PCT International Application WO 2011 / 100374 (the teachings of which are incorporated herein by reference in their entirety).
[0135] In some embodiments, the components of the condensate are signal transduction factors selected from TCF7L2, TCF7, TCF7L1, LEF1, β-catenin, SMAD2, SMAD3, SMAD4, STAT1, STAT2, STAT3, STAT4, STAT5A, STAT5B, STAT6, and NF-κB. In some embodiments, the signal transduction factors contain one or more intrinsically disordered domains. In some embodiments, the condensate contains a master transcription factor.
[0136] In some embodiments, the component of the aggregate is a methyl-DNA binding protein that preferentially binds to methylated DNA. In some embodiments, the methyl-DNA binding protein is MECP2, MBD1, MBD2, MBD3, or MBD4. In some embodiments, the methyl-DNA binding protein is associated with gene silencing. In some embodiments, the component is an inhibitor associated with heterochromatin. In some embodiments, the methyl-DNA binding protein is HP1α, TBL1R (transductionin β-like protein), HDAC3 (histone deacetylase 3), or SMRT (silencing mediator of retinoic acid and thyroid receptors).
[0137] In some embodiments, the component of the aggregate is an RNA polymerase associated with mRNA initiation and elongation. In some embodiments, the RNA polymerase is RNA polymerase II or the C-terminal region of RNA polymerase II. In some embodiments, the C-terminal region of RNA polymerase II contains an intrinsically disordered region (IDR). In some embodiments, the IDR contains a phosphorylation site. In some embodiments, the component is a splicing factor selected from SRSF2, SRRM1, or SRSF1.
[0138] In some embodiments, the components of the aggregate are transcription factors. In some embodiments, the transcription factors are OCT4, p53, MYC or GCN4, NANOG, MyoD, KLF4, SOX family transcription factors, GATA family transcription factors, or nuclear receptors (e.g., nuclear hormone receptors, estrogen receptors, retinoic acid receptor α).
[0139] In some implementations, the nuclear receptor (NR) is a member of nuclear receptor subfamily 0, nuclear receptor subfamily 1, nuclear receptor subfamily 2, nuclear receptor subfamily 3, nuclear receptor subfamily 4, nuclear receptor subfamily 5, or nuclear receptor subfamily 6. In some implementations, the nuclear receptors are NR1D1 (subfamily 1, group D member 1), NR1D2 (subfamily 1, group D member 2), NR1H2 (subfamily 1, group H member 2; synonym: liver X receptor β), NR1H3 (subfamily 1, group H member 3; synonym: liver X receptor α), NR1H4 (subfamily 1, group H member 4), NR1I2 (subfamily 1, group I member 2; synonym: pregnane X receptor), NR1I3 (subfamily 1, group I member 3; synonym: constitutive androstenedione receptor), NR1I4 (subfamily 1, group I member 4), NR2C1 (subfamily 2, group C member 1), NR2C2 (subfamily 2, group C member 2), NR2E1 (subfamily 2, group E member 1), NR2E3 (subfamily 2, group E member 3), NR2F1 (subfamily 2, group F member 1), NR2F2 NR2F6 (Member 2 of nuclear receptor subfamily 2F), NR3C1 (Member 1 of nuclear receptor subfamily 3C; synonym: glucocorticoid receptor), NR3C2 (Member 2 of nuclear receptor subfamily 3C; synonym: aldosterone receptor, mineralocorticoid receptor), NR4A1 (Member 1 of nuclear receptor subfamily 4A), NR4A2 (Member 2 of nuclear receptor subfamily 4A), NR4A3 (Member 3 of nuclear receptor subfamily 4A), NR5A1 (Member 1 of nuclear receptor subfamily 5A), NR5A2 (Member 2 of nuclear receptor subfamily 5A), NR6A1 (Member 1 of nuclear receptor subfamily 6A), NR0B1 (Member 1 of nuclear receptor subfamily 0B), NR0B2 (Member 2 of nuclear receptor subfamily 0B), RARA (retinoic acid receptor, α), RARB (retinoic acid receptor, β), RARG (retinoic acid receptor, γ), RXRA (Retinoid X receptor, α; Synonym: Nuclear receptor subfamily 2, B group member 1), RXRB (Retinoid X receptor, β; Synonym: Nuclear receptor subfamily 2, B group member 2), RXRG (Retinoid X receptor, γ; Synonym: Nuclear receptor subfamily 2, B group member 3), THRA (Thyroid hormone receptor, α), THRB (Thyroid hormone receptor, β), AR (Androgen receptor), ESR1 (Estrogen receptor 1), ESR2 (Estrogen receptor 2);Synonyms: ERβ, ESRRA (estrogen-associated receptor α), ESRRB (estrogen-associated receptor β), ESRRG (estrogen-associated receptor γ), PGR (progesterone receptor), PPARA (peroxisome proliferator-activated receptor α), PPARD (peroxisome proliferator-activated receptor δ), PPARG (peroxisome proliferator-activated receptor γ), or VDR (vitamin D (1,25-dihydroxyvitamin D3) receptor).
[0140] In some embodiments, the nuclear receptor is a naturally occurring truncated form of the nuclear receptor, such as a truncated RXR α or a truncated estrogen receptor, generated through proteolytic cleavage. In some embodiments, the nuclear receptor is an HSP70 client. For example, the androgen receptor (AR) and glucocorticoid receptor (GR) are HSP70 clients. Extensive information on NRs can be found in Germain, P. et al., Pharmacological Reviews, 58:685-704, 2006 (which provides a review of the nomenclature and structure of nuclear receptors) and other articles in the same issue of Pharmacological Reviews that review the NR subfamily. In some embodiments, the HSP90A client is a steroid hormone receptor (e.g., estrogen, progesterone, glucocorticoid, mineralocorticoid, or androgen receptor), PPAR α, or PXR. In some embodiments, the nuclear receptor (NR) is a ligand-dependent NR. Ligand-dependent NRs are characterized by the regulation of NR activity by the binding of the ligand to the NR. In some embodiments, ligand binding to a ligand-dependent NF causes a conformational change in the NR, resulting in, for example, nuclear translocation of the NR, dissociation of one or more proteins from the NR, activation of the NR, or repression of the NR. In some embodiments, the NR is a mutant lacking one or more activities of the wild-type NR (e.g., nuclear translocation of the NR, dissociation of one or more proteins from the NR, activation of the NR, or repression of the NR) upon ligand binding. In some embodiments, the NR is a mutant having ligand-binding-independent activity (e.g., nuclear translocation of the NR, dissociation of one or more proteins from the NR, activation of the NR, or repression of the NR), which is ligand-dependent in the wild-type NR. In some embodiments, the nuclear receptor activates transcription upon binding to a homologous ligand. In some embodiments, the nuclear receptor is a mutant nuclear receptor that activates transcription in the absence of a homologous ligand.
[0141] In some embodiments of the methods disclosed herein, the transcription factor is a human transcription factor identified in the following literature: Lambert et al., Cell. 2018 Feb 8; 172(4):650-665. In some embodiments, the nuclear receptor activates transcription when bound to a homologous ligand. In some embodiments, the nuclear receptor is a mutant nuclear receptor that activates transcription in the absence of a homologous ligand, or has a higher level of transcriptional activity (e.g., at least 1.5-fold, at least 2-fold, at least 3-fold or more) in the absence of a homologous ligand compared to a wild-type nuclear receptor in the presence of a natural ligand (e.g., a homologous ligand). In some embodiments, the nuclear receptor is a mutant nuclear transcription factor that regulates transcription to a different degree than a wild-type nuclear receptor in the presence of a homologous ligand. In some embodiments, the transcription factor is a fusion oncogenic transcription factor. In some embodiments, the fusion oncogenic transcription factor is selected from MLL-rearrangements, EWS-FLI, ETS fusions, BRD4-NUT, and NUP98 fusions. The oncogenic transcription factor can be any oncogenic transcription factor identified in the art.
[0142] In some embodiments, the components of the condensate are those found in the transcription condensate. In some embodiments, the transcription condensate components include transcription factors, cofactors, chromatin regulators, DNA, non-coding RNA, nascent RNA, RNA polymerase II, kinases, proteasomes, topoisomerases, and / or enhancers. In some embodiments, the transcription factors are, for example, OCT4, p53, MYC, GCN4, NANOG, MyoD, KLF4, SOX family transcription factors, GATA family transcription factors, nuclear receptors, or fusion oncogenic transcription factors.
[0143] In some embodiments, the components of the aggregate are those found in the nucleolus. In some embodiments, the nucleolar components are rRNA processing factors, POL1, FIB1, nucleophosphoproteins, ribosomal DNA gene clusters, and / or POLR1E.
[0144] In some embodiments, the incorporation of the agent in the agglomerate is detected without the use of a detectable tag. In some embodiments, the agent fluoresces naturally. In some embodiments, the agent has a color that distinguishes it from the agglomerate and / or from a background or area outside the agglomerate. In some embodiments, the incorporation of the agent is detected by Raman spectroscopy (see, for example, Smith et al.). Analyst(2016, 141, pp. 3590-3600). In some embodiments, the incorporation of the reagent is detected by nuclear magnetic resonance (NMR). In some embodiments, the incorporation of the reagent is detected by mass spectrometry. In some embodiments, the incorporation of the reagent is detected by spectrophotometry and quantitative phase microscopy. In some embodiments, the incorporation of the reagent is detected by coherence-controlled holographic microscopy. In some embodiments, the incorporation of the reagent is detected by rotational sedimentation. It should also be understood that the incorporation of the reagent in the agglomerate can be detected by detecting the amount or proportion of the reagent not incorporated into the agglomerate.
[0145] In some embodiments, the incorporation of a drug into the agglomerate is detected by separating the agglomerate from the drug not incorporated into the agglomerate and then measuring the remaining drug in the agglomerate. Any suitable method for separating the agglomerate can be used and is not limited thereto. In some embodiments, the agglomerate is separated by removing it from cells containing the agglomerate. In some embodiments, the agglomerate is separated by removing it from an in vitro composition (e.g., a solution) containing the agglomerate. In some embodiments, the agglomerate is cross-linked to facilitate its separation. In some embodiments, the separated agglomerate is destroyed and the amount or proportion of the drug is measured. Any suitable destruction method can be used, including physical and / or chemical means. In some embodiments, the agglomerate can be destroyed by increasing or decreasing the concentration of salt or crowding agent in the solution. In some embodiments, the agglomerate can be destroyed by sonication, centrifugation, or by changing the temperature. In some embodiments, the drug from the destroyed agglomerate is measured by chromatography (e.g., HPLC).
[0146] In some embodiments, the incorporation of the agent in the agglomerate is measured relative to a control. The control may be a compound known to be incorporated into the agglomerate under appropriate physiological conditions. The control may also be a compound having similar physical or chemical properties to the agent and having known incorporation characteristics in the agglomerate. In some embodiments, an enrichment ratio or partition coefficient (i.e., the relative concentration of the agent in and outside the agglomerate) is determined. In some embodiments, the enrichment ratio is determined by measuring the fluorescence of a fluorescent tag on the agent both in and outside the agglomerate. In some embodiments, the enrichment ratio is detected by the methods described in the Examples section. Methods for determining enrichment ratios and partition coefficients are known in the art and are not limited thereto. In some embodiments, the amount of agent dispensed into the agglomerate is determined. In some embodiments, the agent comprises a detectable tag. In some embodiments, the incorporation of the agent in the agglomerate is measured using a detectable tag. As used herein, the terms "detectable tag" or "detectable label" include, but are not limited to, detectable labels such as fluorophores, radioisotopes, colorimetric substrates, or enzymes; commercially available heteroepitopes for which specific antibodies are targeted, such as FLAG tags; heteroamino acid sequences as ligands of commercially available binding proteins, such as Strep tags, biotin; fluorescence quenchers typically used in conjunction with fluorescent tags on other peptides; and complementary bioluminescent or fluorescent peptide fragments. Tags as detectable labels or complementary bioluminescent or fluorescent peptide fragments can be measured directly (e.g., by measuring the fluorescence or radioactivity of a related peptide compared to an unrelated peptide, or by incubating with a suitable substrate or enzyme to produce a spectrophotometrically detectable color change of the related peptide compared to an unrelated peptide). Tags as heteroepitopes or ligands are typically detected with a second component (e.g., an antibody or binding protein) bound thereto, wherein the second component associates with the detectable label. In some embodiments, the detectable tag is a fluorescent tag. In some embodiments, both the aggregate component and the reagent contain the detectable tag. In some implementations, the component contains a detectable label that is different from that of the pharmaceutical agent.
[0147] The method for calculating the incorporation of the agent in the aggregate is not limited and can be any method known in the art. In some embodiments, by... Figure 36 The method shown determines the enrichment ratio of a reagent. In some embodiments, the enrichment ratio of a reagent (e.g., a reagent with a detectable label or a reagent with detectable properties) for a particular agglomerate is determined by providing the agglomerate in a solution containing the reagent and detecting the intensity of the reagent in the agglomerate by confocal microscopy to obtain... drug 进入 Value; provide the agglomerate in a solution without the reagent and detect the background intensity within the agglomerate to obtain backgroundValue; and the agent is provided in a solution without said agglomerates and the strength of the agent is detected to obtain drug 扩散 Value; wherein the enrichment ratio is equal to ( Drug entry - back scene ) / ( drug 扩散 In some embodiments, reagent dispensing can be determined experimentally using spectrophotometry and quantitative phase microscopy. In some embodiments, a sample consisting of two coexisting phases (i.e., a diluent phase and a condensate phase) is considered, wherein the volume fraction... dilution phase and Condensed phase = 1. If the reagent also... c If the total average concentration present in the sample, then the mass conservation requirement applies.
[0148] c 总计 = c 稀释相 稀释相 + c 凝聚相 凝聚相 , (1)
[0149] Where c 稀释相 and c 凝聚相 These are the concentrations of the reagent in the dilution phase and the condensed phase, respectively. The distribution coefficient of the reagent in the condensed phase is defined as... P = c 凝聚相 / c 稀释相 Based on this definition and the requirement that the sum of phase volume fractions must be 1, Eq 1 can be written as
[0150] c 总计 = c 稀释相 (1- 凝聚相 ) + c 稀释相 P 凝聚相 (2)
[0151] It can be simplified and reorganized to produce
[0152]
[0153] As described below, estimation is performed from fluorescence spectroscopy measurements. c 总计 / c 稀释相The ratio, and 凝聚相 This is derived from the lever rule as follows (M. Rubinstein, RH Colby, Polymer Phyics (Oxford University Press, 2003)): the concentration of aggregate proteins (e.g., MED1) is determined by... s represents The law of conservation of mass gives s Total = s 稀释相 稀释相 + s 凝聚相 凝聚相 Similar to Eq.1. Again, using the requirement that the sum of the volume fractions of the coexisting phases must be 1, this can be rearranged to produce...
[0154]
[0155] in s 总计 and s 稀释相 Depend on For example The optical absorbance at 280 nm was measured spectrophotometrically, and s 凝聚相 Measured by quantitative phase microscopy using, for example, a coherent-controlled holographic microscope.
[0156] Ultraviolet-visible spectroscopy can be used to estimate the absolute concentration of a reagent in solution using the Beer-Lambert law of Eq 5.
[0157]
[0158] Where A is the measured absorbance (in absorbance units (AU)), I0 is the intensity of the incident light at a given wavelength, I is the transmitted intensity, L is the path length through the sample, and c is the concentration of the absorbing substance. For each substance and wavelength, ε is a constant called the molar absorptivity or extinction coefficient. This constant is a fundamental molecular property in a given solvent at a specific temperature and pressure, and has a value of 1 / M. The unit is cm.
[0159] In some implementations, the amount of dispensed reagent can be measured using a rotational sedimentation assay. Specifically, a known concentration of reagent is added along with the aggregate component, allowing droplet formation. The mixture is then centrifuged to precipitate the droplets, the supernatant is collected, and the concentration of reagent in the supernatant is measured. The amount of dispensed reagent can then be determined by subtracting the concentration of reagent in the supernatant from the total known concentration of the added reagent.
[0160] In some implementations, quantitative phase measurements can be performed using coherent controlled holographic microscopy, for example, as detailed in the embodiments below. Software can be used to construct compensated phase images from the acquired holograms. In some implementations, each phase image is spatially segmented based on intensity, and a window containing each segmented object is fitted to a spatial function of that form.
[0161]
[0162] in ( x, y ) is at pixel position ( x, y Phase intensity at ) ; It is the illumination wavelength, Δ n It is the difference in refractive index between the aggregate and the surrounding diluted phase, and H ( x, y | R () is the radius R The projected height of the sphere. The fitting parameter in Eq. 6 is Δ. n and R Assuming no PEG is allocated to the coagulants, and calculating the average scaffold concentration in the coagulants of each filter as follows:
[0163]
[0164] here n 0 is the refractive index of the buffer solution in the absence of a scaffold and PEG. n 稀释相 This refers to the refractive index of the diluted phase, and both are measured using a digital refractometer. The refractive index increment of the aggregate protein... dn / ds It can be estimated from the amino acid composition.
[0165] In some embodiments, drug-target interactions in the presence of aggregates can be modeled. Such modeling can be used, for example, to determine the effective partition coefficient and / or concentration of the drug effective for targeted therapy. In some embodiments, the modeling can be a simplified model as illustrated in the embodiments herein. This simplified model of drug-target interactions in the presence of aggregates was developed. The relevant substances are the drug (D) (i.e., the agent), the target (T), and the drug-target complex (DT). It is assumed that only two types of phases exist, namely the bulk / dilution nucleus phase (n) and the aggregate phase (c), which are expressed in volume fractions. f = V 凝聚物 / V 细胞核 It exists. At equilibrium, the following allocation conditions apply:
[0166]
[0167] in , It is the allocation coefficient between drugs and targets. This represents the concentration of substance D in the condensate phase (and similarly for other components / phases). In this model, the drug and target complex has... K D The dissociation constant independent of the phase.
[0168]
[0169] In order to solve the total level , The equilibrium concentrations of all existing substances; the mass equilibrium is written as:
[0170]
[0171] These six concentrations were solved using two equations and four constraints (two from distribution and two from reaction equilibrium). Figures 61A-61D In this context, the target-based fraction is defined as:
[0172]
[0173] Similar expressions are used for fractions of target binding in the nuclear (bulk or diluted) phase. In the case of plotting controls, plotted fractions are drawn when only one phase exists (f = 0).
[0174] In some cases, the presence of a detectable label on a pharmaceutical agent may alter the agent's incorporation activity into the agglomerate. However, if a labeled agent is incorporated into agglomerates that can be washed away with an excess of unlabeled agent, the incorporation of the labeled agent into the agglomerate is not mediated by the label. Therefore, in some embodiments, the methods disclosed herein include contacting a pharmaceutical agent with a detectable label with the composition comprising the agglomerate, measuring the incorporation of the pharmaceutical agent with a detectable label in the agglomerate, contacting the composition comprising the agglomerate (e.g., a solution) and the pharmaceutical agent with a detectable label with a control agent without a detectable label (i.e., the same agent without a detectable label), and measuring the incorporation of the pharmaceutical agent with a detectable label in the agglomerate again. In some embodiments, the contact involves contact with at least an equal concentration of the control agent. In some embodiments, the agent is exposed to an excess of the control agent (e.g., at least 2, 3, 4, 5, 6, 7, 8, 9, 10, 20, 50, 100, or more times the control agent). In some embodiments, the agglomerate incorporating the labeled agent is contacted with an increasing gradient of the control agent, and the loss of the labeled agent is measured continuously or at discrete intervals. In some embodiments, the method may further include contacting the agglomerate (e.g., droplets) with the agent labeled for the agglomerate and isomers of the agent having a lower partition coefficient. In some embodiments, the isomers of the agent are not detectably partitioned into the agglomerate. In some embodiments, the labeled agent causes the target to be expelled from the agglomerate upon contact with a target in the agglomerate. In some embodiments, contact between the aggregate and the labeled agent and the isomer of the labeled agent that is not significantly partitioned into the aggregate does not reduce the amount of target expelled after binding with the labeled target, compared to a labeled target in the absence of isomers. In some embodiments, the isomer is trans-platinum, which is an isomer of cisplatin, the labeled agent is labeled cisplatin, and the target is an estrogen receptor.
[0175] In some embodiments, the components of the agglomerate contain a detectable tag. In some embodiments, both the agent and the components of the agglomerate contain a detectable tag. The detectable tag is not limited and can be any detectable tag disclosed herein. In some embodiments, DNA or RNA incorporated into or associated with the agglomerate contains a detectable tag.
[0176] The following are some specific implementation schemes for characterizing the pharmaceutical agents disclosed herein:
[0177] Displacement / competitive droplet determination:
[0178] In some embodiments, this document provides a method for determining whether a first agent modifies the incorporation of a second agent into a coagulant, the method comprising: (a) measuring the incorporation of the second agent into the coagulant in the presence of the first agent; and (b) comparing the incorporation of the second agent into the coagulant in the presence of the first agent with a reference to determine whether the first agent modifies the incorporation of the second agent into the coagulant. In some embodiments, the reference is based on the incorporation of the second agent into the coagulant in the absence of the first agent. The first agent and the second agent can be any agent described herein and are not limited thereto. In some embodiments, at least the first agent or the second agent is a small molecule as described herein.
[0179] In some embodiments, this document provides a method for determining whether a first agent modifies the incorporation of a second agent into a coagulant, the method comprising: (a) measuring the incorporation of the second agent into the coagulant in the absence of the first agent; (b) measuring the incorporation of the second agent into the coagulant in the presence of the first agent; and (c) comparing the incorporation of the second agent into the coagulant in the absence of the first agent with the incorporation of the second agent into the coagulant in the presence of the first agent, thereby determining whether the first agent modifies the incorporation of the second agent into the coagulant.
[0180] In some embodiments, this document provides a method for determining whether a first agent modifies the incorporation of a second agent into a coagulant, the method comprising: (a) mixing the coagulant and the second agent to form a reactive composition, wherein the coagulant component comprises a first detectable tag, wherein the second agent comprises a second detectable tag, and wherein the signals of the first detectable tag and the second detectable tag are distinguishable; (b) measuring the incorporation of the second agent into the coagulant in the absence of the first agent; (c) incorporating the first agent into the reactive composition; (d) measuring the incorporation of the second agent into the coagulant in the presence of the first agent; and (e) comparing the incorporation of the second agent into the coagulant in the absence of the first agent with the incorporation of the second agent into the coagulant in the presence of the first agent, thereby determining whether the first agent modifies the incorporation of the second agent into the coagulant.
[0181] In some embodiments, this document provides a method for determining whether a first agent modifies the incorporation of a second agent into a coagulant, the method comprising: (a) mixing a composition comprising a component of the coagulant with a second agent to form a reactive composition and cause the formation of the coagulant in the reactive composition, wherein the coagulant component comprises a first detectable tag, wherein the second agent comprises a second detectable tag, and wherein the signals of the first detectable tag and the second detectable tag are distinguishable; (b) measuring the incorporation of the second agent into the coagulant in the absence of the first agent; (c) mixing the first agent into the reactive composition; (d) measuring the incorporation of the second agent into the coagulant in the presence of the first agent; and (e) comparing the incorporation of the second agent into the coagulant in the absence of the first agent with the incorporation of the second agent into the coagulant in the presence of the first agent, thereby determining whether the first agent modifies the incorporation of the second agent into the coagulant. In some embodiments, measuring the incorporation of a reagent in a flocculation includes using techniques including Raman spectroscopy, spectrophotometry, quantitative phase microscopy, fluorescence microscopy (including quantitative fluorescence microscopy), and / or rotational sedimentation assays. In some embodiments, the first and / or second reagents contain a detectable label, such as a fluorescent label or marker. In some embodiments, the flocculation contains a component containing a detectable label (e.g., a fluorescent label or marker). In some embodiments, the first reagent is unlabeled, and the second reagent contains a detectable label, such as a fluorescent marker. In some embodiments, the second reagent comprises the first reagent and a detectable label, such as a fluorescent marker. In some embodiments, measuring the incorporation of a reagent in a flocculation includes quantifying the signal intensity of the reagent within the boundary range of one or more flocculations, wherein the boundary range of said one or more flocculations is based on the labeled components of the flocculation, such as those described in the measurement techniques disclosed herein and / or as shown in the accompanying drawings.
[0182] In some embodiments, this document provides a method for determining whether an agent regulates the incorporation of a coagulant component in a coagulant, the method comprising: (a) measuring the incorporation of the coagulant component in the coagulant in the presence of the agent; and (b) comparing the incorporation of the coagulant component in the coagulant in the presence of the agent with a reference to determine whether the agent regulates the incorporation of the coagulant component in the coagulant. In some embodiments, the reference is based on the incorporation of the coagulant component in the coagulant in the absence of the agent. In some embodiments, the coagulant comprises more than one coagulant component, such as a first component and a second component. In some embodiments, this document provides a method for determining whether an agent modifies the incorporation of a first coagulant component in a coagulant, wherein the coagulant comprises a first coagulant component and a second coagulant component when the agent is absent, the method comprising: (a) measuring the incorporation of the first coagulant component in the coagulant in the absence of the agent; (b) measuring the incorporation of the first coagulant component in the coagulant in the presence of the agent; and (c) comparing the incorporation of the first coagulant component in the coagulant in the absence of the agent with the incorporation of the first coagulant component in the coagulant in the presence of the agent, thereby determining whether the agent modifies the incorporation of the first coagulant component in the coagulant. In some embodiments, measuring the incorporation of the agent and / or coagulant component in the coagulant includes using techniques including Raman spectroscopy, spectrophotometry, quantitative phase microscopy, fluorescence microscopy (including quantitative fluorescence microscopy), and / or rotational sedimentation assays. In some embodiments, the agent comprises a detectable label, such as a fluorescent label or marker. In some embodiments, one or more aggregate components contain a detectable tag, such as a fluorescent tag or marker. In some embodiments, a first aggregate component contains a first detectable tag, and a second aggregate component contains a second detectable tag, wherein the first and second detectable tags are distinguishable, for example, by fluorescing at different wavelengths. In some embodiments, measuring the incorporation of an aggregate component in an aggregate includes quantifying the signal intensity of the aggregate component within the boundary range of one or more aggregates, wherein the boundary range of the one or more aggregates is based on the labeled components of the aggregate, such as those described in the measurement techniques disclosed herein and / or shown in the accompanying drawings.
[0183] Identifying reagents with the desired coagulation coefficient
[0184] In some embodiments, this document provides a method for identifying an agent having a desired coagulation partition coefficient. In some embodiments, this document provides a method for identifying an agent having a desired coagulation partition coefficient, the method comprising: (a) measuring the coagulation partition coefficient of the agent; and (b) comparing the coagulation partition coefficient of the agent with a reference, thereby identifying an agent having the desired coagulation partition coefficient. The agent can be any agent described herein and is not limited thereto. In some embodiments, the agent is a small molecule as described herein.
[0185] In some embodiments, the method for identifying agents having a desired coagulation partition coefficient is used to screen a plurality of agents and / or select certain agents having the desired coagulation partition coefficient. In some embodiments, the coagulation partition coefficient of the first agent is measured in the absence of a second agent. For example, in some embodiments, this document provides a method for identifying one or more agents having a desired coagulation partition coefficient from a plurality of agents, wherein the plurality of agents includes a first agent and a second agent, the method comprising: (a) measuring the coagulation partition coefficient of the first agent; (b) measuring the coagulation partition coefficient of the second agent; and (c) comparing the coagulation partition coefficient of the first agent with the coagulation partition coefficient of the second agent, thereby identifying one or more agents having the desired coagulation partition coefficient from the plurality of agents. The first agent and the second agent can be any agent described herein and are not limited thereto. In some embodiments, at least the first agent or the second agent is a small molecule as described herein.
[0186] In some embodiments, the agglomeration partition coefficient of the first agent in the agglomerate is measured in the presence of the second agent, for example, through a competitive assay. For example, in some embodiments, this document provides a method for identifying one or more agents having a desired agglomeration partition coefficient from a plurality of agents, wherein the plurality of agents includes a first agent and a second agent, the method comprising: (a) measuring the agglomeration partition coefficient of the first agent in the absence of the second agent; (b) measuring the agglomeration partition coefficient of the first agent in the presence of the second agent; and (c) comparing the agglomeration partition coefficient of the first agent in the absence of the second agent with the agglomeration partition coefficient of the first agent in the presence of the second agent, thereby identifying one or more agents having the desired agglomeration partition coefficient from the plurality of agents. In some embodiments, measuring the agglomeration partition coefficient of an agent in the agglomerate includes using techniques including Raman spectroscopy, spectrophotometry, quantitative phase microscopy, fluorescence microscopy (including quantitative fluorescence microscopy), and / or rotational sedimentation assays. In some embodiments, the first agent and / or the second agent includes a detectable tag, such as a fluorescent tag or marker. In some embodiments, the agglomerate contains a component with a detectable label (e.g., a fluorescent label or marker). In some embodiments, measuring the agglomerate partition coefficient of the agent in the agglomerate includes quantifying the signal intensity of the agent within the boundary range of one or more agglomerates, wherein the boundary range of said one or more agglomerates is based on the labeled component of the agglomerate, such as that described in the measurement techniques disclosed herein and / or shown in the accompanying drawings.
[0187] Isomers
[0188] In some embodiments, the first and second reagents are isomers of each other (e.g., cisplatin and transplatin), such as any structural isomer, stereoisomer, enantiomer, diastereomer, cis / trans isomer, conformational isomer, or rotational isomer, and the methods described herein can be used to identify one or more isomers having a desired condensate partition coefficient by screening a variety of isomers.
[0189] For example, in some embodiments, this document provides a method for identifying one or more isomers having a desired coagulation partition coefficient, the method comprising: (a) measuring the coagulation partition coefficient of a first isomer agent; (b) measuring the coagulation partition coefficient of a second isomer agent; and (c) comparing the coagulation partition coefficient of the first isomer agent with the coagulation partition coefficient of the second isomer agent to identify one or more isomers having the desired coagulation partition coefficient. In some embodiments, the first isomer agent and the second isomer agent are isomers of each other. In some embodiments, the first isomer agent and the second isomer agent are small molecules. The isomer agent is not limited and may be any agent described herein.
[0190] In some embodiments, this document provides a method for identifying one or more isomers having a desired coagulation partition coefficient, the method comprising: (a) measuring the coagulation partition coefficient of a first isomer agent in the absence of a second isomer agent; (b) measuring the coagulation partition coefficient of the first isomer agent in the presence of the second isomer agent; and (c) comparing the coagulation partition coefficient of the first isomer agent in the absence of the second isomer agent with the coagulation partition coefficient of the first isomer agent in the presence of the second isomer agent, thereby identifying one or more isomers having the desired coagulation partition coefficient.
[0191] In some embodiments, the disclosed methods for identifying one or more isomers having a desired coagulation partition coefficient may include referring to a composition comprising a mixture of different isomers (such as a racemic mixture of isomers). For example, in some embodiments, a method for identifying isomers having a desired coagulation partition coefficient is provided, the method comprising: (a) measuring the coagulation partition coefficient of a first isomer agent; and (b) comparing the coagulation partition coefficient of a racemic mixture comprising the first isomer agent to identify the isomer having the desired coagulation partition coefficient. In some embodiments, the racemic mixture is a known therapeutic agent (e.g., an anticancer agent). In some embodiments, a particular isomer of the agent will have the desired coagulation partition coefficient compared to other isomeric forms of the agent. Therefore, in some aspects, this document provides pure isomer compositions having a desired coagulation partition coefficient, and methods for preparing said pure isomer compositions, the methods comprising identifying isomer agents having the desired coagulation partition coefficient according to the methods disclosed herein.
[0192] Labeled nucleic acids
[0193] In some implementations, this document provides for conglomerates having nucleic acid conglomerate components and / or containing nucleic acids. A method for contacting (e.g., droplets) with an agent capable of adding a portion to nucleic acids and detecting the addition of said portion. In some implementations, the amount of the added component is compared to a control or reference level. In some implementations, the... The pharmaceutical preparation is a preparation modified by the methods disclosed herein, and the control or reference level is obtained by using an unmodified pharmaceutical preparation. The amount of the agent added. In some embodiments, said portion is or includes a reagent for detecting the addition of said portion. Detection tag. In some embodiments, the addition of the aforementioned portion regulates the expression of gene products associated with the nucleic acid, and Furthermore, the expression of the gene product is used to detect the addition of the moiety. In some embodiments, the moiety is platinum-plated. (Plantation) section. In some embodiments, the addition of this section is measured by HPLC after contact with the pharmaceutical agent.
[0194] In some implementations, this document provides for conglomerates having nucleic acid conglomerate components and / or containing nucleic acids. A method for contacting (e.g., droplets) with an agent capable of removing portions from nucleic acids and detecting the removal of said portions. In some embodiments, the amount of the removed portion is compared with a control or reference level. In some embodiments, the... The pharmaceutical preparation is a preparation modified by the methods disclosed herein, and the control or reference level is obtained by using an unmodified pharmaceutical preparation. The amount of the portion removed by the agent. In some embodiments, said portion is or includes a component for detecting the removal or retention of said portion. A detectable tag remaining on the nucleic acid. In some embodiments, the removal of said portion is regulated in relation to the nucleic acid. The expression of the relevant gene product, and the expression of the gene product is used to detect the removal of the portion. In some embodiments In this case, the portion is methylated. In some embodiments, after contact with the pharmaceutical agent, the result is measured by HPLC. Removal of fractions.
[0195] Determination of tethered aggregate composition
[0196] In some embodiments, this document provides a method for characterizing a pharmaceutical agent, the method comprising providing a fusion construct comprising a condensate component or a functional fragment thereof and a nucleic acid-binding domain in contact with a nucleic acid, the nucleic acid being capable of binding the nucleic acid-binding domain and contacting the fusion construct with the pharmaceutical agent, thereby characterizing the pharmaceutical agent. In some embodiments, the fusion construct anchors a condensate comprising the condensate component or functional fragment to a nucleic acid, and the pharmaceutical agent contacts the condensate. In some embodiments, the pharmaceutical agent is contacted with the fusion construct along with one or more condensate components capable of forming a condensate with the fusion construct.
[0197] In some embodiments, the fusion construct comprises MED1 or an IDR of MED1. In some embodiments, the fusion construct comprises HP1α or an IDR of HP1α. In some embodiments, the fusion construct comprises ESR1 or an activated domain of ESR1. In some embodiments, one or more aggregate components capable of forming aggregates with the fusion construct comprise the same aggregate component as the aggregate component of the fusion construct. In some embodiments, the fusion construct comprises an IDR of MED1, and the one or more aggregate components comprise MED1. In some embodiments, the fusion construct comprises an IDR of HP1α, and the one or more aggregate components comprise HP1α. In some embodiments, the fusion construct comprises an activated domain of HP1αESR1, and the one or more aggregate components comprise MED1.
[0198] In some implementations, the nucleic acid binding domain is LacI and the nucleic acid contains a lac operon sequence (e.g., a lac array).
[0199] In some embodiments, the fusion construct further includes a detectable tag. The detectable tag is not limited and can be any detectable tag disclosed herein. In some embodiments, the detectable tag is a fluorescent tag. In some embodiments, the aggregate component other than the fusion construct aggregate component or functional fragment includes a detectable tag. The detectable tag is not limited and can be any detectable tag disclosed herein. In some embodiments, the detectable tag is a fluorescent tag. In some embodiments, both the fusion construct and the aggregate component other than the fusion construct aggregate component or its functional fragment each include a detectable tag. In some embodiments, the fusion construct and the aggregate component other than the fusion construct aggregate component or its functional fragment each include a detectable tag, and the ability of the agent to modulate the amount of aggregate component associated with the fusion construct is measured by detecting the co-localization of the respective detectable tags.
[0200] In some embodiments, the fusion construct further includes a linker between the nucleic acid-binding domain and the condensate component or functional fragment. The linker is not limited and can be any linker described herein. In some embodiments, the linker is GAPGSAGSAAGGSG (SEQ ID NO: 16).
[0201] Drug resistance aggregates
[0202] Some aspects of this disclosure relate to methods for assessing whether differential expression of one or more aggregate components in cells resistant to a drug causes or contributes to resistance.
[0203] In some embodiments, the method includes providing drug-resistant cells, contacting the drug-resistant cells with the drug, and evaluating the localization, concentration, and / or therapeutic activity of the drug compared to a control. In some embodiments, the control comprises corresponding non-resistant cells. In some embodiments, the cells are cancer cells. The cancer is not limited and may be any cancer disclosed herein. In some embodiments, the cells are breast cancer cells. The methods for evaluating the localization, concentration, and / or therapeutic activity of the drug are not limited and may include any methods disclosed herein. In some embodiments, the cells contain aggregates with detectable markers. In some embodiments, the drug contacting the cells contains detectable markers. In some embodiments, both the aggregates in the cells and the drug contain detectable markers. The drug is not limited and may be any drug disclosed herein. In some embodiments, the drug is a small molecule.
[0204] In some embodiments, the method includes providing an agglomerate isolated from drug-resistant cells, contacting the agglomerate with the drug, and evaluating the localization, concentration, and / or therapeutic activity of the drug compared to a control. In some embodiments, the control comprises a corresponding agglomerate from non-resistant cells. In some embodiments, the cells are cancer cells. The cancer is not limited and may be any cancer disclosed herein. In some embodiments, the cells are breast cancer cells. The methods for evaluating the localization, concentration, and / or therapeutic activity of the drug are not limited and may include any methods disclosed herein. In some embodiments, the agglomerate contains a detectable marker. In some embodiments, the drug contains a detectable marker. In some embodiments, both the agglomerate and the drug contain a detectable marker. The drug is not limited and may be any drug disclosed herein. In some embodiments, the drug is a small molecule.
[0205] In some embodiments, the method includes providing an in vitro aggregate (e.g., droplets) containing differentially expressed amounts of an aggregate component or fragment thereof in drug-resistant cells, contacting the aggregate with the drug, and assessing the localization, concentration, and / or therapeutic activity of the drug compared to a control. In some embodiments, the control comprises a corresponding aggregate that does not contain differentially expressed amounts of the aggregate component or fragment thereof. In some embodiments, the drug-resistant cells are cancer cells. The cancer is not limited and may be any cancer disclosed herein. In some embodiments, the drug-resistant cells are breast cancer cells. The methods for assessing the localization, concentration, and / or therapeutic activity of the drug are not limited and may include any methods disclosed herein. In some embodiments, the aggregate contains a detectable marker. In some embodiments, the drug contains a detectable marker. In some embodiments, both the aggregate and the drug contain a detectable marker. The drug is not limited and may be any drug disclosed herein. In some embodiments, the drug is a small molecule. In some embodiments, the agglomerate component is a mediator, MED1, BRD4, SRSF2, HP1α, FIB1, NPM1, or a functional fragment thereof containing an IDR. In some embodiments, the differential amount of the agglomerate component is at least 1.5 times, 2 times, 3 times, 4 times, 5 times, 6 times, 7 times, 8 times, 9 times, 10 times, 15 times, 20 times, 50 times, or more than the agglomerate component found in agglomerates in non-resistant cells. In some embodiments, the differential amount of the agglomerate component is about 1.5 times, 2 times, 3 times, 4 times, 5 times, 6 times, 7 times, 8 times, 9 times, 10 times, 15 times, 20 times, 50 times, or more less than the agglomerate component found in agglomerates in non-resistant cells.
[0206] In some embodiments, the method includes providing an in vitro aggregate (e.g., droplets) containing a mutant aggregate component or a fragment thereof corresponding to a mutant aggregate component in drug-resistant cells, contacting the aggregate with the drug, and evaluating the localization, concentration, and / or therapeutic activity of the drug compared to a control. In some embodiments, the control comprises a corresponding aggregate containing a non-mutant form of the aggregate component or a fragment thereof. In some embodiments, the drug-resistant cells are cancer cells. The cancer is not limited and may be any cancer disclosed herein. In some embodiments, the drug-resistant cells are breast cancer cells. The methods for evaluating the localization, concentration, and / or therapeutic activity of the drug are not limited and may include any methods disclosed herein. In some embodiments, the aggregate contains a detectable marker. In some embodiments, the drug contains a detectable marker. In some embodiments, both the aggregate and the drug contain a detectable marker. The drug is not limited and may be any drug disclosed herein. In some embodiments, the drug is a small molecule. In some embodiments, the mutant aggregate component is a mediator containing IDR and having the mutation, MED1, BRD4, SRSF2, HP1α, FIB1, NPM1, or a functional fragment thereof.
[0207] Some aspects of this disclosure relate to characterizing drug resistance agglomerates, said characterization including contacting the agglomerate with one or more second drug agents and assessing at least one of the drug agent localization, concentration or therapeutic activity and / or agglomerate morphology, stability or solubility. In some embodiments, the method includes determining whether the second drug agent counteracts the effect of drug resistance (e.g., drug resistance) caused by the first drug agent (e.g., determining whether contact with the second drug agent reduces the size of the agglomerate or eliminates the agglomerate).
[0208] In some embodiments, the method includes providing drug-resistant cells, contacting the drug-resistant cells with the second drug agent, and evaluating at least one of the second drug agent's localization, concentration, or therapeutic activity and / or agglomerate morphology, stability, or solubility. In some embodiments, the cells are cancer cells. The cancer is not limited and may be any cancer disclosed herein. In some embodiments, the cells are breast cancer cells. In some embodiments, the cells contain agglomerates with a detectable label. In some embodiments, the drug agent contacting the cells contains a detectable label. In some embodiments, both the agglomerate in the cells and the second drug agent contain a detectable label. The second drug agent is not limited and may be any drug disclosed herein. In some embodiments, the second drug agent is a small molecule. In some embodiments, the cells are contacted with both the second drug agent and the drug to which the cells are resistant. In some embodiments, the drug agent to which the cells are resistant has a detectable label. In some embodiments, the size or solubility of the agglomerate is evaluated compared to a control. In some embodiments, the method includes determining whether the second agent counteracts the effect of resistance to the agent (e.g., drug resistance) caused by the first agent (e.g., determining whether contact with the second agent reduces the size of the agglomerates or eliminates the agglomerates).
[0209] In some embodiments, the method includes providing an agglomerate isolated from drug-resistant cells, contacting the agglomerate with the second drug agent, and evaluating at least one of the second drug agent's localization, concentration, or therapeutic activity and / or the agglomerate's morphology, stability, or solubility. The cancer is not limited and may be any cancer disclosed herein. In some embodiments, the cells are breast cancer cells. In some embodiments, the agglomerate contains a detectable marker. In some embodiments, the second drug agent contains a detectable marker. In some embodiments, both the agglomerate and the second drug agent contain a detectable marker. The second drug agent is not limited and may be any drug disclosed herein. In some embodiments, the second drug agent is a small molecule. In some embodiments, the agglomerate is contacted with both the second drug agent and the drug to which the cells are resistant. In some embodiments, the drug to which the cells are resistant has a detectable marker. In some embodiments, the size or solubility of the agglomerate is evaluated compared to a control. In some embodiments, the method includes determining whether the second agent counteracts the effect of resistance to the agent (e.g., drug resistance) caused by the first agent (e.g., determining whether contact with the second agent reduces the size of the agglomerates or eliminates the agglomerates).
[0210] In some embodiments, the method includes providing an in vitro aggregate (e.g., droplets) containing differentially expressed amounts of an aggregate component or fragment thereof in drug-resistant cells, contacting the aggregate with a second drug agent, and evaluating at least one of the second drug agent's localization, concentration, or therapeutic activity and / or the aggregate's morphology, stability, or solubility. In some embodiments, the drug-resistant cells are cancer cells. The cancer is not limited and can be any cancer disclosed herein. In some embodiments, the drug-resistant cells are breast cancer cells. In some embodiments, the aggregate contains a detectable marker. In some embodiments, the second drug agent contains a detectable marker. In some embodiments, both the aggregate and the second drug agent contain a detectable marker. The second drug agent is not limited and can be any drug disclosed herein. In some embodiments, the second drug agent is a small molecule. In some embodiments, the aggregate is contacted with both the second drug agent and the drug to which the cells are resistant. In some embodiments, the drug to which the cells are resistant has a detectable marker. In some embodiments, the agglomerate component is a mediator, MED1, BRD4, SRSF2, HP1α, FIB1, NPM1, or a functional fragment thereof containing an IDR. In some embodiments, the differential amount of the agglomerate component is at least 1.5 times, 2 times, 3 times, 4 times, 5 times, 6 times, 7 times, 8 times, 9 times, 10 times, 15 times, 20 times, 50 times, or more than the agglomerate component found in agglomerates in non-resistant cells. In some embodiments, the differential amount of the agglomerate component is about 1.5 times, 2 times, 3 times, 4 times, 5 times, 6 times, 7 times, 8 times, 9 times, 10 times, 15 times, 20 times, 50 times, or more less than the agglomerate component found in agglomerates in non-resistant cells. In some embodiments, the size or solubility of the agglomerate is evaluated compared to a control. In some embodiments, the method includes determining whether the second agent counteracts the effect of resistance to the agent (e.g., drug resistance) caused by the first agent (e.g., determining whether contact with the second agent reduces the size of the agglomerates or eliminates the agglomerates).
[0211] In some embodiments, the method includes providing an in vitro aggregate (e.g., droplets) containing a mutant aggregate component or a fragment thereof corresponding to a mutant aggregate component in drug-resistant cells, contacting the aggregate with a second drug agent, and evaluating at least one of the second drug agent's localization, concentration, or therapeutic activity and / or aggregate morphology, stability, or solubility. In some embodiments, the control comprises a corresponding aggregate containing a non-mutant form of the aggregate component or a fragment thereof. In some embodiments, the drug-resistant cells are cancer cells. The cancer is not limited and may be any cancer disclosed herein. In some embodiments, the drug-resistant cells are breast cancer cells. In some embodiments, the aggregate contains a detectable marker. In some embodiments, the second drug agent contains a detectable marker. In some embodiments, both the aggregate and the second drug agent contain a detectable marker. The second drug agent is not limited and may be any drug disclosed herein. In some embodiments, the second drug agent is a small molecule. In some embodiments, the aggregate is contacted with both the second drug agent and the drug to which the cells are resistant. In some embodiments, the cells have a detectable marker for the agent to which they are resistant. In some embodiments, the mutant aggregate component is a mediator containing an IDR and having the mutation, such as MED1, BRD4, SRSF2, HP1α, FIB1, NPM1, or a functional fragment thereof. In some embodiments, the size or solubility of the aggregate is evaluated compared to a control. In some embodiments, whether the second agent counteracts the effect of drug resistance to the agent (e.g., contact with the second agent reduces the size of the aggregate or eliminates the aggregate).
[0212] High-throughput screening
[0213] In some implementations, high-throughput screening (HTS) is performed to characterize multiple agents and / or multiple different aggregates (e.g., two or more of super-enhancer aggregates, splice dot aggregates, heterochromatin aggregates, nucleoli, chromatin aggregates, multicomb aggregates, or DNA damage repair aggregates; or two or more in vitro aggregate types containing super-enhancer aggregate components, splice dot aggregate components, heterochromatin aggregate components, nucleolar components, chromatin aggregates, multicomb aggregates, or DNA damage repair aggregates). High-throughput screening can utilize cell-free or cell-based assays (e.g., cells containing aggregates, in vitro aggregates as described herein). High-throughput screening typically involves testing large numbers of compounds at high efficiency, such as in parallel. For example, thousands of compounds can be screened over short time periods (e.g., hours to days). Typically, such screening is performed in multi-well plates containing at least 96 wells or other containers with multiple physically separated cavities or depressions in the matrix. High-throughput screening typically involves automated use, for example, for liquid handling, imaging, data acquisition and processing, etc. Certain general principles and techniques applicable to implementations of the HTS of this invention are described in the following literature: Macarrón R and Hertzberg RP. Design and implementation of high-throughput screening assays. Methods Mol Biol., 565:1-32, 2009, and / or An WF and Tolliday NJ., Introduction: cell-based assays for high-throughput screening. Methods Mol Biol. 486:1-12, 2009, and / or references in any of these literatures. Useful methods are also disclosed in the following literature: William P. Janzen's Methods and Protocols (Methods in Molecular Biology) (2002) and Jorg H. Ser's High-Throughput Screening in DrugDiscovery (Methods and Principles in Medicinal Chemistry) (2006).
[0214] In some embodiments of the methods disclosed herein, multiple agents (e.g., 10, 50, 100, 1000, 10,000, 100,000 or more) are each contacted with a coagulant, and the incorporation of the agents in the coagulant is measured or determined. In some embodiments, the coagulants contacted with the multiple agents contain the same components. In some embodiments, at least some of the coagulants contain different components.
[0215] In some embodiments of the methods disclosed herein, the agent is contacted with multiple compositions (sequentially or more preferably in parallel), each of which has a coagulant containing at least one different component. In some embodiments, each of the multiple compositions is contained in a separate container (e.g., a separate opening in a multi-walled plate).
[0216] In some embodiments, multiple different agents are contacted with aggregates, each having the same composition. In some embodiments, the incorporation of the multiple different agents is compared. In some embodiments, each of the different agents contains incremental differences, thus enabling the identification of key properties of the agents regulating aggregate incorporation.
[0217] In some embodiments of the methods disclosed herein, a pharmaceutical agent is contacted with a composition (e.g., a solution) comprising multiple aggregates having different components. In some embodiments, aggregates with different components are identified using different detectable tags. In some embodiments, the aggregates comprise nucleic acids. In some embodiments, the nucleic acids are DNA or RNA. In some embodiments, the nucleic acids comprise detectable tags (e.g., fluorescent tags).
[0218] In some embodiments, the agent is contacted with the agglomerates for 1 minute to 48 hours. In some embodiments, the agent is contacted with the agglomerates for about 1 minute, about 5 minutes, about 10 minutes, about 15 minutes, about 30 minutes, about 45 minutes, about 1 hour, about 2 hours, about 3 hours, about 5 hours, about 8 hours, about 10 hours, about 12 hours, about 18 hours, about 24 hours, about 36 hours, about 48 hours, or longer. In some embodiments, the incorporation of the agent into the agglomerates is monitored at multiple time points as described herein or continuously (e.g., for up to 48 hours or longer after continuous contact, for the first 5 minutes, the first 10 minutes, or the first hour). It will be apparent to those skilled in the art that the incorporation of the agent into the agglomerates and the effect of the agent on the agglomerates may include both rapid and long-term phases.
[0219] Some aspects of the present invention relate to a method for regulating the distribution of a first agent to a condensate, the method comprising coupling the first agent to a second agent to regulate the distribution of the first agent to the condensate. In some embodiments, the condensate is a transcriptional condensate. In some embodiments, the condensate is selected from super-enhancer condensates, splice dot condensates, heterochromatin condensates, nucleoli, chromatin condensates, multicomb condensates, or DNA damage repair condensates. The method of coupling the agent to the second agent is not limited and may be any suitable method disclosed in the art. In some embodiments, the first agent and the second agent are covalently coupled. In some embodiments, the first agent and the second agent are non-covalently or ionicly coupled. In some embodiments, the first agent and the second agent are coupled via a linker. In some embodiments, the first agent and the second agent are conjugated together. In some embodiments, the first agent has therapeutic activity.
[0220] As used herein, the term "connector" refers to a chemical group or molecule that covalently links a first agent and a second agent. In some embodiments, the connector is located between or flanking two groups, molecules, or portions and is covalently linked to each group, molecule, or portion, thereby connecting the two agents. In some embodiments, the connector is an amino acid or multiple amino acids. In some embodiments, the connector is an organic molecule, group, or chemical part. In some embodiments, the connector comprises or is composed of a polypeptide. In some embodiments, the connector may comprise or be composed of one or more glycine residues, and in some embodiments, it comprises or is composed of one or more serine and / or threonine residues. In some embodiments, the connector comprises 1, 2, 3, 4, 5, 6, 7, 8, 9, 10, 11, 12, 13, 14, 15, 16, 17, 18, 19, 20, or more than 20 amino acids. In some embodiments, the connector comprises an oligoglycine sequence. Any suitable connector known in the art can be used and is not limited thereto. For example, in some embodiments, if the first agent and the second agent are proteins, the linker may be a polypeptide (e.g., a polypeptide that links the C-terminus of one agent to the N-terminus of another agent).
[0221] In some embodiments, the partitioning (e.g., partition coefficient) of the first agent in the aggregate is increased by coupling with a second agent. In some embodiments, the partition coefficient is increased by at least about 1.1 times, at least 1.2 times, at least 1.3 times, at least 1.4 times, at least 1.5 times, at least 1.6 times, at least 1.7 times, at least 1.8 times, at least 1.9 times, at least 2 times, at least 2.5 times, at least 3 times, at least 4 times, at least 5 times, at least 6 times, at least 7 times, at least 8 times, at least 9 times, at least 10 times, at least 20 times, at least 50 times, or at least 100 times compared to the uncoupled agent. As used herein, the partition coefficient or enrichment ratio is the ratio of the concentration of a compound (e.g., an agent) in the aggregate of interest to that outside the aggregate of interest (e.g., in the surrounding solution). In some embodiments, the partition coefficient of the uncoupled agent is less than about 5, less than about 2, about 1, less than about 1, less than about 0.5, or less than about 0.1. In some embodiments, the partition coefficient of the conjugated first agent is greater than 1, greater than about 1.5, greater than about 2, greater than about 3, greater than about 4, greater than about 5, greater than about 10, greater than about 20, greater than about 50, or greater than about 100. In some embodiments, the partition coefficient of the conjugated agent is increased by about 5%, 10%, 15%, 20%, 25%, 30%, 35%, 40%, 45%, 50%, 55%, 60%, 65%, 70%, 75%, 80%, 85%, 90%, 95%, 99%, or more compared to the unconjugated agent. In some embodiments, the aggregate contains the therapeutic target of the first agent.
[0222] In some embodiments, the partitioning (e.g., partition coefficient) of the first agent in the aggregate is reduced. In some embodiments, the partition coefficient is reduced by about 2-fold, at least 3-fold, at least 4-fold, at least 5-fold, at least 6-fold, at least 7-fold, at least 8-fold, at least 9-fold, at least 10-fold, at least 20-fold, at least 50-fold, or at least 100-fold compared to the uncoupled agent. In some embodiments, the partition coefficient is reduced by about 5%, 10%, 15%, 20%, 25%, 30%, 35%, 40%, 45%, 50%, 55%, 60%, 65%, 70%, 75%, 80%, 85%, 90%, 95%, 99%, or more compared to the uncoupled agent. In some embodiments, the partition coefficient of the uncoupled agent is about 10 or greater, about 5 or greater, about 2 or greater, about 1 or greater, or about 0.5 or greater. In some embodiments, the partition coefficient of the coupled first agent is less than about 10, less than about 5, less than about 2, less than about 1, less than about 0.5, less than about 0.1, or less than about 0.01. In some embodiments, the aggregate does not contain the therapeutic target of the first agent.
[0223] In some embodiments, the uncoupled second agent preferentially partitions into the aggregate of interest. In some embodiments, the uncoupled second agent has a partition coefficient greater than 1, greater than about 1.5, greater than about 2, greater than about 3, greater than about 4, greater than about 5, greater than about 10, greater than about 20, greater than about 50, or greater than about 100. In some embodiments, the second agent has a partition coefficient with respect to the aggregate of interest that is at least 2 times, at least 5 times, at least 10 times, at least 15 times, at least 20 times, at least 50 times, at least 100 times, or at least 400 times lower than the first agent. In some embodiments, the second agent is a small molecule with a high partition coefficient for the aggregate of interest. In some implementations, the second agent is a small molecule having a partition coefficient greater than 10, greater than 20, greater than 30, greater than 50, or greater than 100 for the aggregate of interest.
[0224] In some embodiments, uncoupled second agents are preferentially excluded from the aggregates of interest. In some embodiments, the uncoupled second agent has a partition coefficient less than 0.9, 0.8, 0.5, 0.1, 0.05, or 0.01. In some embodiments, the second agent is a small molecule with a low partition coefficient for the aggregates of interest. In some embodiments, the second agent is a small molecule with a partition coefficient less than 0.5, less than 0.1, less than 0.05, or less than 0.01 for the aggregates of interest. The second agent used to cause the first agent attached thereto to aggregate in or be expelled from the aggregates of interest may be a small molecule that is non-toxic to the subject administering it and, in some embodiments, does not itself have significant biological activity. The second agent (e.g., a small molecule) may contain one or more functional groups adapted to react with the second functional group to attach the agent of interest, thereby altering the partitioning behavior of the agent of interest with respect to one or more aggregates.
[0225] In some embodiments, the therapeutic efficacy of the conjugated first agent is increased compared to the unconjugated first agent. In some embodiments, the therapeutically effective dose of the conjugated first agent is reduced by approximately 2-fold, 3-fold, 4-fold, 5-fold, 6-fold, 7-fold, 8-fold, 9-fold, 10-fold, 20-fold, 50-fold, or 100-fold compared to the unconjugated first agent. In some embodiments, the therapeutically effective dose of the conjugated first agent is reduced by approximately 5%, 10%, 15%, 20%, 25%, 30%, 35%, 40%, 45%, 50%, 55%, 60%, 65%, 70%, 75%, 80%, 85%, 90%, 95%, 99%, or more compared to the unconjugated first agent.
[0226] In some embodiments, the conjugated first agent has one or more reduced side effects (e.g., reduced or eliminated in severity or duration) compared to the unconjugated first agent. In some embodiments, the conjugated first agent has increased therapeutic efficacy and reduced side effects compared to the unconjugated agent.
[0227] Some aspects of this disclosure relate to a method for screening candidate agents with regulated aggregate partitioning, the method comprising modifying an agent having an aggregate partition coefficient and measuring the aggregate partition coefficient of the modified agent, wherein if the modified agent has a partition coefficient different from that of the agent, the modified agent is identified as a candidate agent with regulated aggregate partitioning. Modification can be performed using well-known medicinal chemistry techniques and modifications. In some embodiments, modification increases or decreases the solubility of the agent. In some embodiments, modification modifies the electrostatic properties of the agent. In some embodiments, modification is a coupling of a portion or second agent that preferentially partitions into a desired aggregate. In some embodiments, modification is a coupling of a portion or second agent that preferentially does not partition into one or more aggregate types (e.g., super-enhancing aggregates, nucleoli, etc.).
[0228] In some embodiments, the aggregation partition coefficient of the modified drug is measured in in vitro aggregates. In some embodiments, the aggregation partition coefficient of the modified drug is measured in aggregates within cells.
[0229] In some embodiments, a candidate drug is identified as an improved candidate drug if the distribution to the aggregate containing the therapeutic target of the candidate drug has been increased. In some embodiments, a candidate drug is identified as an improved candidate drug if the distribution is increased by about 2, 3, 4, 5, 6, 7, 8, 9, 10, 20, 50, or 100 times compared to an unmodified drug. In some embodiments, a candidate drug is identified as an improved candidate drug if the distribution is increased by about 5%, 10%, 15%, 20%, 25%, 30%, 35%, 40%, 45%, 50%, 55%, 60%, 65%, 70%, 75%, 80%, 85%, 90%, 95%, 99%, or more compared to an unmodified drug.
[0230] In some embodiments, a candidate drug is identified as an improved candidate drug if it has reduced distribution to aggregates of therapeutic targets that do not contain the candidate drug. In some embodiments, a candidate drug is identified as an improved candidate drug if, compared to an unmodified drug, distribution is reduced by approximately 2-fold, 3-fold, 4-fold, 5-fold, 6-fold, 7-fold, 8-fold, 9-fold, 10-fold, 20-fold, 50-fold, or 100-fold. In some embodiments, a candidate drug is identified as an improved candidate drug if, compared to an unmodified drug, distribution is reduced by approximately 5%, 10%, 15%, 20%, 25%, 30%, 35%, 40%, 45%, 50%, 55%, 60%, 65%, 70%, 75%, 80%, 85%, 90%, 95%, 99%, or more.
[0231] In some embodiments, a candidate agent is identified as an improved candidate agent if the amount of the candidate agent in the aggregate of interest is adjusted (e.g., the total number of candidate agent molecules, the concentration of the candidate agent) compared to an unmodified agent. In some embodiments, the amount of the candidate agent in the aggregate of interest is increased. In some embodiments, this increase corresponds to an increase in the partition coefficient in the aggregate of interest. However, this increase may also be due to increased availability of the candidate agent for incorporation into the aggregate. For example, the candidate agent may have a reduced partition in aggregates of non-interest, making it available for incorporation into the aggregate of interest. In some embodiments, the amount of the candidate agent in the aggregate of interest is reduced.
[0232] In some embodiments, adjusting the distribution of the first agent in the agglomerates (e.g., by modifying the first agent, such as coupling the first agent with a second agent – thus producing a candidate agent) results in an increase in the concentration of the modified or coupled first agent in the agglomerates relative to the concentration of the unmodified / uncoupled first agent that would be present in the agglomerates. In some embodiments, modifying or coupling the first agent increases the distribution coefficient of the first agent in the agglomerates. In some embodiments, modifying or coupling the first agent causes a decrease in the distribution of the first agent to different agglomerates (e.g., agglomerates of no interest) in which it would otherwise aggregate. In some embodiments, modifying or coupling the first agent decreases the distribution coefficient of the first agent in the agglomerates. In some embodiments, modifying or coupling the first agent causes an increase in the distribution of the first agent to different agglomerates (e.g., agglomerates of no interest) in which it would otherwise aggregate.
[0233] In some implementations, candidate agents with regulated agglomerate distribution are chemotherapeutic agents.
[0234] Some aspects of the present invention relate to compositions comprising cells having a first aggregate containing a first detectable marker and a second aggregate having a different second detectable marker. In some embodiments, the first and second aggregates are different aggregate types selected from super-enhancer aggregates, splice dot aggregates, heterochromatin aggregates, nucleoli, chromatin aggregates, multicomb aggregates, or DNA damage repair aggregates. In some embodiments, at least one of the aggregates is a transcription aggregate. In some embodiments, the composition further comprises an agent that contacts the cells. In some embodiments, the agent is a known therapeutic agent. In some embodiments, the agent is a candidate therapeutic agent.
[0235] Some aspects of the present invention relate to compositions comprising a first in vitro aggregate, a second in vitro aggregate, and an agent in contact with the first and second in vitro aggregates. In some embodiments, the first and second in vitro aggregates are separated from each other. In some embodiments, at least one of the first, second, and agent comprises a detectable marker. In some embodiments, the composition further comprises a third and optionally a fourth in vitro aggregate, each in contact with the agent. In some embodiments, at least one of the in vitro aggregates comprises a component of a super-enhancer aggregate, splice dot aggregate, heterochromatin aggregate, nucleolus, chromatin aggregate, multicomb aggregate, or DNA damage repair aggregate. In some embodiments, this document discloses a multiwell plate (e.g., a 96-well plate) having a first in vitro aggregate in contact with an agent and a second in vitro aggregate in contact with the same agent, wherein the first and second in vitro aggregates each comprise different components, and wherein the first and second in vitro aggregates are located in different wells of the multiwell plate.
[0236] Some embodiments relate to an article comprising a first in vitro aggregate in contact with a pharmaceutical agent, a second in vitro aggregate in contact with the same pharmaceutical agent, and a multi-well plate separating the first and second in vitro aggregates into separate wells. In some embodiments, the article further comprises at least a third in vitro aggregate in contact with the pharmaceutical agent. In some embodiments, the article further comprises at least a fourth in vitro aggregate in contact with the pharmaceutical agent. The first, second, third, and fourth in vitro aggregates may each comprise components of different aggregates (e.g., super-enhancer aggregates, splice dot aggregates, heterochromatin aggregates, nucleoli, chromatin aggregates, multicomb aggregates, or DNA damage repair aggregates). The first, second, third, and fourth in vitro aggregates may each comprise different detectable markers.
[0237] In some embodiments, the agents disclosed herein are contacted with agglomerates at a total concentration between about 1 nM and 500 µM. For example, the agents may be added to a solution containing the agglomerates to provide a total concentration in solution between about 1 nM and 500 µM. In some embodiments, the agents are contacted with the agglomerates at a total concentration between 10 nM and 100 nM, between 10 nM and 1 µM, between 1 µM and 10 µM, between 10 µM and 100 µM, or between 100 µM and 500 µM. In some embodiments, the agents are added to a composition (e.g., a solution) containing the agglomerates to provide a total concentration between about 1 nM and 500 µM. In some embodiments, an agent is added to the composition containing the aggregate to provide a total concentration between 10 nM and 100 nM, between 10 nM and 1 µM, between 1 µM and 10 µM, between 10 µM and 100 µM, or between 100 µM and 500 µM.
[0238] In some embodiments, the aggregate is in cells. The type of cell is not limited. In some embodiments, the cells are mammalian cells, such as human or mouse cells. In some embodiments, the cells are somatic cells. In some embodiments, the cells are pluripotent stem cells. In some embodiments, the cells are germ cells, stem cells, or zygotes. In some embodiments, the cells are primary cells. In some embodiments, the cells are diseased cells. In some embodiments, the cells are cancer cells. In some embodiments, the cells are leukocytes or fibroblasts. In some embodiments, the cells are cells that have been isolated from an embryo.
[0239] In some embodiments, the cells are cells isolated from a patient suffering from a disease, disorder, or condition. In some embodiments, the cells are derived from cells of a patient suffering from a disease, disorder, or condition. In some embodiments, the cells are differentiated cells of induced pluripotent stem cells derived from cells of a patient suffering from a disease, disorder, or condition. In some embodiments, the cells are induced pluripotent stem cells derived from cells of a patient suffering from a disease, disorder, or condition. In some embodiments, the cells are genetically modified cells expressing one or more aggregate components with detectable markers. In some embodiments, the genetically modified cells express at least two different aggregate components with different detectable markers and / or markers detectably distinguishable from each other. In some embodiments, the genetically modified cells express at least three different aggregate components with different detectable markers and / or markers detectably distinguishable from each other. In some embodiments, the genetically modified cells express at least four different aggregate components with different detectable markers and / or markers detectably distinguishable from each other. In some embodiments, the aggregate component of each type of marker is a component of a different aggregate (e.g., super-enhancer aggregate, splice dot aggregate, heterochromatin aggregate, nucleolus, chromatin aggregate, multicomb aggregate, or DNA damage repair aggregate). In some embodiments, the genetically modified cell expresses both a super-enhancer component and a labeled nucleolar component. In some embodiments, the markers of the different aggregate components are detectable and distinguishable from each other.
[0240] The terms “disease,” “disorder,” or “symptom” are used interchangeably and can refer to any alteration in the health status and / or normal function of an organism, such as physical or mental abnormalities that cause pain, discomfort, dysfunction, suffering, decline, or death in an affected individual. A disease includes any disease known to a person skilled in the art. In some embodiments, a disease is a chronic disease, for example, one that typically lasts or has lasted for at least 3-6 months or longer, such as 1 year, 2 years, 3 years, 5 years, 10 years or more, or indefinitely. A disease may have a characteristic set of symptoms and / or signs common in individuals suffering from said disease. Diseases and their diagnosis and treatment are described in standard medical textbooks such as Longo, D. et al. (eds.), Harrison's Principles of Internal Medicine, 18th edition; McGraw-Hill Professional, 2011, and / or Goldman's Cecil Medicine, Saunders; 24th edition (August 5, 2011). In some embodiments, a disease is a polygenic disorder (also known as a complex, multifactorial, or polygenic disorder). Such diseases may be associated with the effects of multiple genes, and sometimes with environmental factors (e.g., exposure to specific physical or chemical agents or biological agents such as viruses), lifestyle factors (e.g., diet, smoking, etc.)). Polygenic disorders can be any disease for which multiple genes (e.g., specific alleles of such genes, specific polymorphisms in such genes) are known or suspected to contribute to the risk of developing the disease and / or to the manner in which the disease manifests (e.g., its severity, age of onset, rate of progression, etc.). In some embodiments, a polygenic disease is a disease having genetic components such as those exhibited through familial clustering (more common in certain families than in the general population) but not following Mendelian laws of inheritance (e.g., the disease does not clearly follow a dominant, recessive, X-linked, or Y-linked inheritance pattern). In some embodiments, a polygenic disease is a disease that is not typically controlled by a variant with a large effect in a single gene (as is the case with Mendelian disorders). In some embodiments, polygenic diseases may occur familially and sporadically. Examples include, for example, Parkinson's disease, Alzheimer's disease, and various types of cancer. Examples of polygenic diseases include many common conditions such as hypertension, diabetes (e.g., type II diabetes), cardiovascular disease, cancer, and stroke (ischemic, hemorrhagic). In some embodiments, the disease (e.g., a polygenic disease) is a mental, neurological, or neurodevelopmental disorder; a neurodegenerative disorder; a cardiovascular disease; an autoimmune disease; cancer; a metabolic disorder; or a respiratory disease. In some embodiments, at least one gene is associated with a familial form of polygenic disease.
[0241] In some implementations, the disease is cancer, a term often used interchangeably, referring to a disease characterized by one or more tumors (e.g., one or more malignant or potentially malignant tumors). As used herein, the term "tumor" encompasses abnormal growth, including abnormally proliferating cells. As is known in the art, tumors are typically characterized by excessive cell proliferation that is not properly regulated (e.g., lack of normal response to physiological influences and signals that normally limit proliferation) and may exhibit one or more of the following characteristics: developmental abnormalities (e.g., lack of normal cell differentiation, resulting in an increased number or proportion of immature cells); degenerative development (e.g., greater loss of differentiation, greater loss of structural tissue, cell pleomorphism, abnormalities such as large overstained nuclei, high nucleocytoplasmic ratio, atypical mitosis, etc.); invasion of adjacent tissues (e.g., disruption of the basement membrane); and / or metastatic foci. Malignant tumors have a tendency to continue growing and the ability to spread (e.g., local invasion and / or local metastasis and / or spread to distant sites), while benign tumors typically remain localized to their site of origin and are generally self-limiting in terms of growth. The term "tumor" includes malignant solid tumors, such as carcinomas (cancers originating from epithelial cells), sarcomas (cancers originating from cells of mesenchymal origin), and malignant growths in which there may not be a detectable solid mass (e.g., certain hematologic malignancies). Cancers include, but are not limited to: breast cancer; biliary tract cancer; bladder cancer; brain cancer (e.g., glioblastoma, medulloblastoma); cervical cancer; choriocarcinoma; colon cancer; endometrial cancer; esophageal cancer; gastric cancer; hematologic malignancies, including acute lymphoblastic leukemia and acute myeloid leukemia; T-cell acute lymphoblastic leukemia / lymphoma; hairy cell leukemia; chronic lymphocytic leukemia, chronic myeloid leukemia, multiple myeloma; adult T-cell leukemia / lymphoma; intraepithelial neoplasia, including Bowen's disease. Paget's disease; liver cancer; lung cancer; lymphoma, including Hodgkin's disease and lymphocytic lymphoma; neuroblastoma; melanoma; oral cancer (including squamous cell carcinoma); ovarian cancer, including ovarian cancer originating from epithelial cells, stromal cells, germ cells, and mesenchymal cells; neuroblastoma; pancreatic cancer; prostate cancer; rectal cancer; sarcomas, including angiosarcoma, gastrointestinal stromal tumor, leiomyosarcoma, rhabdomyosarcoma, liposarcoma, fibrosarcoma, and osteosarcoma; kidney cancer, including renal cell carcinoma and Wilms' tumor; skin cancer, including basal cell carcinoma and squamous cell carcinoma; testicular cancer, including germ cell tumors such as seminoma, non-seminomatous tumors (teratoma, choriocarcinoma), stromal tumors, and germ cell tumors; thyroid cancer, including thyroid adenocarcinoma and medullary carcinoma. It should be understood that many different tumor types can occur in certain organs, which may differ in, for example, clinical and / or pathological features and / or molecular markers.Tumors occurring in a variety of different organs are discussed in the following literature: for example, the International Agency for Research on Cancer (IARC), the WHO Classification of Tumours series, 4th or 3rd edition (Pathology and Genetics of Tumors series), WHO Press, Geneva, Switzerland, all volumes of which are incorporated herein by reference. In some embodiments, cancer is a cancer in which mutations or overexpression of a particular gene are known or suspected to play a role in the development, progression, recurrence, etc., of the cancer. In some embodiments, such genes are targets for genetic modification according to the methods described herein. In some embodiments, the gene is an oncogene, a proto-oncogene, or a tumor suppressor gene. The term “oncogene” encompasses nucleic acids that, when expressed, can increase the likelihood of cancer initiation or progression or contribute to cancer initiation or progression. Normal cellular sequences (“proto-oncogenes”) can be activated into oncogenes (sometimes referred to as “activated oncogenes”) through mutation and / or aberrant expression. In various embodiments, an oncogene may contain the complete coding sequence of a gene product or at least a portion of the sequence that maintains the oncogenic potential of the complete sequence or the sequence encoding a fusion protein. Oncogenic mutations can lead to, for example, altered protein activity (e.g., increased activity), loss of appropriate regulation, or altered RA or protein levels (e.g., increased activity). Aberrant expression may occur, for example, due to chromosomal rearrangements resulting in juxtaposition with regulatory elements such as enhancers, epigenetic mechanisms, or due to amplification, and may result in increased amounts of the proto-oncogene product or its production in inappropriate cell types. Proto-oncogenes typically encode proteins that control or participate in cell proliferation, differentiation, and / or apoptosis. These proteins include, for example, various transcription factors, chromatin remodeling agents, growth factors, growth factor receptors, signal transducers, and apoptosis regulators. A TSG can be any gene in which loss of function or reduction of function of the gene's expression product can increase the likelihood of or contribute to cancer initiation or progression. Loss of function or reduction of function can occur, for example, due to mutations or epigenetic mechanisms. Many TSGs encode proteins that typically function to inhibit or negatively regulate cell proliferation and / or promote apoptosis. Exemplary oncogenes for the methods disclosed herein include, for example, MYC, SRC, FOS, JUN, MYB, RAS, RAF, ABL, ALK, AKT, TRK, BCL2, WNT, HER2 / NEU, EGFR, MAPK, ERK, MDM2, CDK4, GLI1, GLI2, IGF2, TP53, etc.Exemplary TSGs include, for example, RB, TP53, APC, NF1, BRCA1, BRCA2, PTEN, CDK repressor proteins (e.g., p16, p21), PTCH, WT1, etc. It should be understood that many of these oncogene and TSG names encompass multiple family members, and many other TSGs are known. In some embodiments, the cancer is breast cancer. In some embodiments, the breast cancer is ER+ breast cancer. In some embodiments, the breast cancer is resistant to tamoxifen and contains an ER mutation. In some embodiments, the breast cancer is resistant to tamoxifen and overexpresses coagulant components.
[0242] In some implementations, the disease is a cardiovascular disease, such as atherosclerotic heart disease or vascular disease, congestive heart failure, myocardial infarction, cerebrovascular disease, peripheral artery disease, or cardiomyopathy.
[0243] In some implementations, the disease is a mental, neurological, or neurodevelopmental disorder, such as schizophrenia, depression, bipolar disorder, epilepsy, autism, or addiction. Neurodegenerative diseases include, for example, Alzheimer's disease, Parkinson's disease, amyotrophic lateral sclerosis (ALS), and frontotemporal dementia.
[0244] In some implementations, the disease is an autoimmune disease, such as acute disseminated encephalomyelitis, alopecia areata, antiphospholipid syndrome, autoimmune hepatitis, autoimmune myocarditis, autoimmune pancreatitis, autoimmune polyendocrine syndrome, autoimmune uveitis, inflammatory bowel disease (Crohn's disease, ulcerative colitis), type 1 diabetes (e.g., juvenile diabetes), multiple sclerosis, scleroderma, ankylosing spondylitis, sarcoidosis, pemphigus vulgaris, bullous pemphigoid, psoriasis, myasthenia gravis, systemic lupus erythematosus, rheumatoid arthritis, juvenile arthritis, psoriatic arthritis, Behcet's syndrome, Leter's disease, Berger's disease, dermatomyositis, polymyositis, antineutrophil cytoplasmic antibody-associated vasculitis (e.g., granulomatous disease with polyangiitis, also known as Wegener's granulomatosis). Granulomatosis), microscopic polyangiitis and Churg-Strauss syndrome, scleroderma, Sjögren's syndrome, antiglomerular basement membrane disease (including Goodpasture's syndrome), dilated cardiomyopathy, primary biliary cirrhosis, thyroiditis (e.g., Hashimoto's thyroiditis, Graves' disease), transverse myelitis, and Guillane-Barre syndrome.
[0245] In some implementations, the disease is a respiratory disease, such as allergies, asthma, chronic obstructive pulmonary disease, pulmonary hypertension, pulmonary fibrosis, and sarcomatoid disease that affect the respiratory system.
[0246] In some implementations, the disease is a kidney disease, such as polycystic kidney disease, lupus, nephropathy (nephropathy or nephritis), or glomerulonephritis (any type).
[0247] In some implementations, the disease is, for example, age-related vision loss or hearing loss.
[0248] In some implementations, a disease is an infectious disease, such as any disease caused by a virus, bacteria, fungus, or parasite.
[0249] In some implementations, the disease exhibits hypermethylation (e.g., aberrant hypermethylation) or unmethylation (e.g., aberrant unmethylation) in the genomic sequence. For example, Fragile X syndrome exhibits... FMR-1 Hypermethylation. In some embodiments, the methods described herein can be used to treat or prevent diseases or disorders exhibiting aberrant methylation (e.g., hypermethylated or unmethylated). In some embodiments, the agents disclosed herein preferentially incorporate into aggregates associated with aberrant methylation. For example, aggregates (e.g., transcription aggregates) can form in regions associated with aberrant unmethylated or hypomethylated sites, leading to aberrant gene transcription. In some embodiments, the agents described herein preferentially incorporate into such aggregates and regulate (e.g., reduce) aberrant gene transcription. In some embodiments, unmethylated or hypomethylated sites are associated with oncogenes. In other embodiments, aggregates (e.g., splice dot aggregates, heterochromatin aggregates) can form in regions associated with aberrant hypermethylation, leading to aberrant gene transcription. In some embodiments, the agents described herein preferentially incorporate into such aggregates and regulate aberrant gene transcription.
[0250] It should be understood that the classification of diseases in this document is not intended to be restrictive. Those skilled in the art will understand that various diseases can be appropriately classified into several different groups.
[0251] In some embodiments, the method further includes characterizing aggregate incorporation (e.g., enrichment ratio) of multiple agents (e.g., potential drug candidates, potential drug candidates from families with different structural features) for, for example, lead optimization, in vivo toxicology or efficacy studies, or Phase I clinical trials. In some embodiments, the method includes the steps of: performing a profile analysis of drug candidates against one aggregate or a group of aggregates, and (1) selecting candidates that are not undesirably isolated in aggregates at sites where the expected target is present or active, or (2) selecting candidates that aggregate in aggregates at sites where the expected target is present or active, or at least not expelled from aggregates at sites where the expected target is present or active. This method may help avoid selecting candidates that have a higher tendency to aggregate in aggregates without the target (or candidates that have a higher tendency to aggregate in aggregates containing the target) if one is optimizing a lead compound and has many different optimization candidates to choose from.
[0252] Some aspects of the present invention relate to a method for characterizing a first agent, the method comprising contacting the first agent with a composition comprising a coagulant having at least one component, wherein the coagulant contains at least one second agent, and measuring the ability of the first agent to expel the second agent from the coagulant. This method can be used, for example, to identify agents (first agents) that release the second agent from the coagulant. For example, if the therapeutic target of the second agent is not in the coagulant, the release of the agent from the coagulant may enhance the therapeutic activity of the agent. Furthermore, this method can be used to identify first agents that have a higher affinity for targets in the coagulant compared to the second agent.
[0253] In some embodiments, measuring the ability of the first agent to expel the second agent from the agglomerate includes measuring the loss of the second agent from the agglomerate (e.g., by measuring changes in the amount, concentration, or proportion of the second agent in or outside the agglomerate). This can be measured by any of the methods described herein (e.g., via the natural fluorescence or color of the second agent, Raman spectroscopy, NMR, mass spectrometry, chromatography, etc.). In some embodiments, the second agent has a detectable label. In some embodiments, the second agent is measured via a detectable label.
[0254] The first and second agents are not limited and may be any agents described herein. The aggregate component is also not limited and may be any aggregate component described herein. In some embodiments, the aggregate component is a transcription aggregate component. In some embodiments, the aggregate component is located within a cell. The cell is not limited and may be any cell described herein. In some embodiments, the aggregate is an in vitro aggregate.
[0255] In some embodiments, the agglomerate component is a target of the second agent (e.g., the second agent specifically binds to the agglomerate component). In some embodiments, the first agent displaces the second agent from the target (e.g., displaces the second agent from the agglomerate).
[0256] Some aspects of this disclosure relate to compositions comprising a coagulant and an agent having a therapeutic target, wherein the coagulant does not contain or preferably does not contain the therapeutic target. In some embodiments, the coagulant comprises a detectable label (e.g., the coagulant comprises a component having a detectable label). In some embodiments, the agent has a detectable label. In some embodiments, both the agent and the coagulant have detectable labels (e.g., different detectable labels).
[0257] Destroy cancer genes
[0258] The inventors hereby demonstrate for the first time the effect of this invention on primary breast cancer. Myc Aggregates containing MED1 and ER are present at RNA transcription sites. See For example, as shown in Figure 7. MED1 in Myc The presence of condensates at RNA sites has also been confirmed in transcription in colon cancer, Burkitt lymphoma, multiple myeloma, prostate cancer, and breast cancer cell lines. See For example Figure 8-9 It has already been Myc Other aggregate components, including topoisomerase, protein body, CDK6, CDK7, p300, and BRD4, were found in the aggregates at RNA transcription sites. See Figure 11 Using colon cancer cell lines and GFP-labeled MED1, BRD4, or POL2, various inhibitors, intercalators, and cyclin-dependent kinase inhibitors showed lysis, eliciting genome release, or selectively releasing from the genome. Myc Components are expelled from the condensate at the RNA transcription site. See Figure 14 and Figure 16-19 Finally, this paper shows that ER does not mix with the agglomerates in the presence of tamoxifen, and that the drug dissolved in the agglomerates is enriched in the agglomerates before they dissolve. See Figure 20 Figure 22 and Figure 24 .
[0259] Therefore, some aspects of the present invention relate to methods for reducing the transcription of oncogenes, the methods including regulating the composition, dissolution, or dissociation of transcriptional aggregates associated with the oncogene. In some embodiments, the transcriptional aggregates are regulated by contacting them with an agent. In some embodiments, the agent dissolves the transcriptional aggregates, causing the transcriptional aggregates to uncouple from genomic DNA containing the oncogene, or expelling one or more components of the transcriptional aggregates.
[0260] The agent is not limited and may be any agent described herein. In some embodiments, the agent is an inhibitor, an intercalator, or a cyclin-dependent kinase inhibitor. In some embodiments, the agent binds to a component of the transcription condensate. In some embodiments, the component is BRD4, p300, CDK7, CDK6, a protein body, a topoisomerase, a transcription factor (e.g., a nuclear receptor, an estrogen receptor), a mediator, a mediator component, or an enhancer. In some embodiments, the agent binds to a component of the transcription condensate and dissolves the transcription condensate, causing the transcription condensate to uncouple from genomic DNA containing oncogenes, or to expel one or more components of the transcription condensate (e.g., expelling components to which the agent has bound or components that are binding partners of components to which the agent has bound).
[0261] In some embodiments, the agent preferentially dissolves the transcriptional aggregate, causing it to uncouple from genomic DNA containing oncogenes, or, when the aggregate contains one or more specific aggregate components, expels one or more components of the transcriptional aggregate. The components can be any components described herein and are not limited thereto. In some embodiments, the components are BRD4, p300, CDK7, CDK6, proteases, topoisomerases, transcription factors (e.g., nuclear receptors, estrogen receptors), mediators, mediator components, or enhancers.
[0262] In some embodiments, the aggregate is an in vitro aggregate as described herein. In some embodiments, the aggregate can be in cells. The cells are not limited and can be any cells described herein. In some embodiments, the cells are cancer cells. In some embodiments, the cells are colon cancer cells, lymphoma cells, multiple myeloma cells, prostate cancer cells, or breast cancer cells.
[0263] In some embodiments, the cells are in a subject. In some embodiments, the subject is a mammal (e.g., human, non-human primate, rodent, canine, feline, bovine). In some embodiments, the subject is a person with cancer. The cancer is not limited and can be any cancer described herein. In some embodiments, the cancer has a disordered... Myc Gene expression. In some embodiments, the agent reduces the transcription of the MYC oncogene in the subject's cancer cells by at least about 5%, 10%, 15%, 20%, 25%, 30%, 35%, 40%, 45%, 50%, 55%, 60%, 65%, 70%, 75%, 80%, 85%, 90%, 95%, 99% or more. In some embodiments, the cancer has dysregulated oncogenes selected from SRC, FOS, JUN, MYB, RAS, ABL, HOXI1, HOXI1 1L2, TAL1 / SCL, LMO1, LMO2, EGFR, MYCN, MDM2, CDK4, GLI1, IGF2, activated EGFR, mutated genes (such as FLT3-ITD), mutated forms of TP53, PAX3, PAX7, BCR / ABL, HER2 / NEU, FLT3R, FLT6-ITD, SRC, ABL, TAN1, PTC, B-RAF, PML-RAR-α, E2A-PRX1 and NPM-ALK, and fusions of members of the PAX and FKHR gene families. In some embodiments, the agent reduces the transcription of the oncogene in the subject's cancer cells by at least about 5%, 10%, 15%, 20%, 25%, 30%, 35%, 40%, 45%, 50%, 55%, 60%, 65%, 70%, 75%, 80%, 85%, 90%, 95%, 99% or more.
[0264] In some implementations, the agent is administered to a subject suffering from cancer to treat the cancer. As used herein, “treatment” encompasses any treatment of a disease or condition (e.g., cancer) in mammals (particularly humans) and includes: (a) preventing the occurrence of symptoms of the disease or condition (e.g., cancer) in subjects who may be susceptible to the disease or condition but have not yet begun to experience symptoms; (b) inhibiting the disease or condition (e.g., preventing its development); or (c) alleviating the disease or condition (e.g., causing the disease or condition to subside, providing improvement in one or more symptoms). The method of administration is not limited and can be any suitable method.
[0265] The agent can be administered in a pharmaceutically acceptable solution, which may conventionally contain pharmaceutically acceptable concentrations of salts, buffers, preservatives, compatible carriers, adjuvants, and optionally other therapeutic ingredients.
[0266] The pharmaceutical preparations can be formulated as solid, semi-solid, liquid, or gaseous forms (such as tablets, capsules, powders, granules, ointments, solutions, deposits, inhalants, and injections) and as formulations for commonly used oral, parenteral, or surgical administration methods. The invention also includes the formulation of pharmaceutical compositions for topical application (such as via implants).
[0267] Compositions suitable for oral administration may be present as discrete units (such as capsules, tablets, lozenges, each containing a predetermined amount of active agent). Other compositions include suspensions in aqueous or non-aqueous liquids, such as syrups, elixirs, or emulsions.
[0268] In some implementations, the agent can be applied directly to the tissue. Direct tissue application can be achieved through direct injection. The agent can be administered once, or alternatively, it can be administered in multiple doses. If administered multiple times, the peptide can be administered via different routes. For example, the first (or initial few) doses can be administered directly to the affected tissue, while subsequent doses can be systemic.
[0269] For oral administration, the composition can be readily formulated by combining the pharmaceutical agent with a pharmaceutically acceptable carrier well known in the art. Such carriers enable the pharmaceutical agent to be formulated as tablets, pills, sugar-coated pills, capsules, liquids, gels, syrups, slurries, suspensions, etc., for oral ingestion by a subject to be treated. Pharmaceutical formulations for oral use can be obtained as solid excipients, optionally by grinding the resulting mixture, and, if necessary, by processing the granular mixture after adding suitable excipients to obtain tablets or sugar-coated pill cores. Suitable excipients are particularly fillers, such as sugars, including lactose, sucrose, mannitol, or sorbitol; cellulose preparations, such as corn starch, wheat starch, rice starch, potato starch, gelatin, tragacanth gum, methylcellulose, hydroxypropyl methylcellulose, sodium carboxymethylcellulose, and / or polyvinylpyrrolidone (PVP). If desired, disintegrants such as croscarmellose, agar, alginate, or salts thereof (such as sodium alginate) can be added. Optionally, oral formulations may also be prepared in saline or buffer solutions to neutralize internal acidic conditions or may be administered without any carrier.
[0270] The sugar-coated core is provided with a suitable coating. For this purpose, a concentrated sugar solution may be used, which may optionally contain gum arabic, talc, polyvinylpyrrolidone, carbomer gel, polyethylene glycol and / or titanium dioxide, lacquer solution, and suitable organic solvents or solvent mixtures. Dyes or pigments may be added to the coating of the tablet or sugar-coated core for the identification or characterization of different combinations of active compound dosages.
[0271] Orally administered pharmaceutical formulations include push-fit capsules made of gelatin and sealed soft capsules made of gelatin and plasticizers such as glycerin or sorbitol. Hard capsules may contain the active ingredient mixed with a filler (such as lactose), a binder (such as starch), and / or a lubricant (such as talc or magnesium stearate), and optionally a stabilizer. In soft capsules, the active compound may be dissolved or suspended in a suitable liquid (such as fatty oil, liquid paraffin, or liquid polyethylene glycol). Additionally, a stabilizer may be added. Microspheres formulated for oral administration may also be used. Such microspheres are well-defined in the art. All formulations intended for oral administration should be at a dosage suitable for such administration. For buccal administration, the composition may be in the form of tablets or lozenges formulated in a conventional manner.
[0272] When systemic delivery is desired, the compound can be formulated for parenteral administration by injection (e.g., by bolus injection or continuous infusion). Injectable formulations can be presented in unit doses, for example in ampoules or multi-dose containers, and may contain preservatives. The composition may be in the form of a suspension, solution, or emulsion, such as in an oily or aqueous medium, and may contain formulations such as suspending agents, stabilizers, and / or dispersants.
[0273] Formulations for parenteral administration include sterile aqueous or non-aqueous solutions, suspensions, and emulsions. Examples of non-aqueous solvents are propylene glycol, polyethylene glycol, vegetable oils (such as olive oil), and injectable organic esters (such as ethyl oleate). Aqueous carriers include water, alcohol / aqueous solutions, emulsions, or suspensions, including saline and buffer media. Parenteral media include sodium chloride solutions, Ringer's glucose, glucose and sodium chloride, lactated Ringer's, or non-volatile oils. Intravenous media include fluids and nutritional supplements, electrolyte supplements (such as those based on Ringer's glucose), etc. Preservatives and other additives may also be present, such as antimicrobial agents, antioxidants, chelating agents, and inert gases. In cases where the initial dose administered is insufficient for the subject's response, a higher dose (or an effective higher dose via a different, more localized route of delivery) may be used to the extent permitted by the patient's tolerance. In some embodiments, multiple daily doses are considered to achieve appropriate systemic levels of the compound. In some embodiments, the method further includes administering an effective amount of at least one chemotherapeutic agent to the subject. There are no restrictions on the chemotherapy agents used, and they can be any suitable chemotherapy agent known in the art.
[0274] Some aspects of the present invention relate to a method for treating a subject with cancer characterized by oncogene transcription, the method comprising administering to the subject an agent that modulates the composition, dissolution, or dissociation of oncogene-associated transcription aggregates.
[0275] The agent is not limited and may be any agent described herein. In some embodiments, the agent is a small molecule, peptide, or nucleic acid. In some embodiments, the agent is an agent that exhibits preferential isolation within oncogene-associated transcriptional condensates or has components of oncogene-associated transcriptional condensates. In some embodiments, the agent is an inhibitor, intercalator, or cyclin-dependent kinase inhibitor. In some embodiments, the agent binds to a component of the transcriptional condensate. The component is not limited and may be any transcriptional condensate component described herein (e.g., mediator component, MED1). In some embodiments, the agent preferentially aggregates in the transcriptional condensate.
[0276] The cancer is not limited and can be any cancer described herein. In some embodiments, the cancer is colon cancer, lymphoma, multiple myeloma, prostate cancer, or breast cancer.
[0277] The subjects are not limited and can be any subjects described herein. In some implementations, the subjects are human beings.
[0278] The pharmaceutical agent may be in the composition. The composition is not limited and may be any composition described herein. The method of administration of the pharmaceutical agent is also not limited and may be any method of administration described herein. In some embodiments, the pharmaceutical agent is administered to the subject orally, subcutaneously, topically, or intravenously.
[0279] Inhibition of nuclear receptor-mediated transcription
[0280] Some aspects of the present invention relate to a method for inhibiting transcription associated with transcriptional condensates, the method comprising inhibiting the binding of a nuclear receptor having an LXXLL binding domain associated with a transcriptional condensate to a cofactor having an LXXLL binding domain by contacting the condensate with a peptide that binds to an LXXLL binding domain of a nuclear receptor.
[0281] The nuclear receptor is not limited, as long as it can bind to a cofactor having an LXXLL domain, at least when binding to its ligand. In some embodiments, the nuclear receptor is a nuclear hormone receptor, estrogen receptor, or retinoic acid receptor α. The cofactor is not limited, as long as it has an LXXLL domain. Cofactors having an LXXLL motif are known in the art. In some embodiments, the cofactor is MED1.
[0282] In some embodiments, the binding of nuclear receptors to cofactors is inhibited by at least about 5%, 10%, 15%, 20%, 25%, 30%, 35%, 40%, 45%, 50%, 55%, 60%, 65%, 70%, 75%, 80%, 85%, 90%, 95%, 98%, 99%, 99.5%, 99.9% or more compared to a reference level (e.g., untreated control cells or agglomerates). In some embodiments, transcription associated with transcription aggregates is inhibited by at least about 5%, 10%, 15%, 20%, 25%, 30%, 35%, 40%, 45%, 50%, 55%, 60%, 65%, 70%, 75%, 80%, 85%, 90%, 95%, 98%, 99%, 99.5%, 99.9% or more compared to a reference level (e.g., untreated control cells or agglomerates). In some embodiments, transcription of oncogenes is inhibited. Oncogenes are not limited and may be any oncogene described herein. In some embodiments, the oncogene is Myc .
[0283] In some embodiments, the transcriptional condensate is an in vitro transcriptional condensate. In some embodiments, the transcriptional condensate is in cells. The cells are not limited and may be any cells described herein. In some embodiments, the cells are cancer cells. The cancer is not limited and may be any cancer described herein. In some embodiments, the methods disclosed herein can be used to treat diseases or conditions associated with abnormal nuclear receptor activity or expression. The disease or condition may be any disease or condition described herein. In some embodiments, the disease is cancer. In some embodiments, the disease is ER+ breast cancer.
[0284] The peptide is not limited as long as it binds to the LXXLL binding domain. In some embodiments, the peptide comprises or is substantially composed of the peptide sequence QNPILTSLLQITG (SEQ ID NO: 1). In some embodiments, the peptide comprises or is substantially composed of acidic residues (e.g., polyglutamic acid) or basic residues (e.g., polylysine).
[0285] In some embodiments, the peptide comprises a protein transduction domain (PTD). The PTD is not limited and can be any PTD described herein. In some embodiments, the PTD is HIV-TAT.
[0286] In some embodiments, the peptide is administered to a subject to treat a disease or condition associated with abnormal nuclear receptor activity or expression. The disease or condition can be any disease or condition described herein. In some embodiments, the disease is cancer. In some embodiments, the disease is ER+ breast cancer. The method of administration is not limited and can be any method of administration of a pharmaceutical agent as described herein. In some embodiments, the peptide is administered as a composition. The composition is not limited and can be any composition described herein for administering a pharmaceutical agent.
[0287] Some aspects of the present invention relate to a method for inhibiting transcription associated with transcriptional condensates, the method comprising inhibiting a cofactor having an LXXLL binding domain and associated with a nuclear receptor having an LXXLL binding domain, wherein the binding is inhibited by contacting the condensate with a peptide that binds the LXXLL domain of the cofactor.
[0288] In some embodiments, the binding of nuclear receptors to cofactors is inhibited by at least about 5%, 10%, 15%, 20%, 25%, 30%, 35%, 40%, 45%, 50%, 55%, 60%, 65%, 70%, 75%, 80%, 85%, 90%, 95%, 98%, 99%, 99.5%, 99.9% or more compared to a reference level (e.g., untreated control cells or agglomerates). In some embodiments, transcription associated with transcription aggregates is inhibited by at least about 5%, 10%, 15%, 20%, 25%, 30%, 35%, 40%, 45%, 50%, 55%, 60%, 65%, 70%, 75%, 80%, 85%, 90%, 95%, 98%, 99%, 99.5%, 99.9% or more compared to a reference level (e.g., untreated control cells or agglomerates). In some embodiments, transcription of oncogenes is inhibited. Oncogenes are not limited and may be any oncogene described herein. In some embodiments, the oncogene is Myc .
[0289] In some embodiments, the transcriptional condensate is an in vitro transcriptional condensate. In some embodiments, the transcriptional condensate is in cells. The cells are not limited and may be any cells described herein. In some embodiments, the cells are cancer cells. The cancer is not limited and may be any cancer described herein. In some embodiments, the methods disclosed herein can be used to treat diseases or conditions associated with abnormal nuclear receptor activity or expression. The disease or condition may be any disease or condition described herein. In some embodiments, the disease is cancer. In some embodiments, the disease is ER+ breast cancer.
[0290] The peptide is not limited as long as it binds to the LXXLL domain. In some embodiments, the peptide comprises a protein transduction domain (PTD). The PTD is not limited and can be any PTD described herein. In some embodiments, the PTD is HIV-TAT.
[0291] In some embodiments, the peptide is administered to a subject to treat a disease or condition associated with abnormal nuclear receptor activity or expression. The disease or condition can be any disease or condition described herein. In some embodiments, the disease is cancer. In some embodiments, the disease is ER+ breast cancer. The method of administration is not limited and can be any method of administration of a pharmaceutical agent as described herein. In some embodiments, the peptide is administered as a composition. The composition is not limited and can be any composition described herein for administering a pharmaceutical agent.
[0292] Inhibit transcription associated with overexpression of condensate components
[0293] As shown in the examples below, the MED1-containing aggregates in tamoxifen-resistant ER+ breast cancer cell lines overexpressing MED1 have a larger volume than those in breast cancer cells that do not overexpress MED1. Furthermore, the examples show that when tamoxifen is contacted with an in vitro MED1 aggregate (e.g., droplets) with a 4-fold increase in MED1 levels, the aggregates have a much lower concentration of tamoxifen.
[0294] Therefore, some aspects of the present invention relate to methods for inhibiting the growth or proliferation of cancer cells that overexpress a coagulation component (e.g., MED1) and are resistant to an anticancer agent (e.g., tamoxifen). In some embodiments, the method includes inhibiting the expression of the coagulation component or coagulation-forming activity. In some embodiments, the method includes contacting the coagulation with a modified coagulation component that increases the partitioning of the anticancer agent in the coagulation. For example, in some embodiments, the coagulation component may be modified to increase the content of aromatic side chains, thereby increasing the affinity of the coagulation containing the modified component for agents having aromatic side chains. In some embodiments, the coagulation having increased levels of the coagulation component may be contacted with an agent that has affinity for both the anticancer agent and the coagulation, thereby increasing the concentration of the anticancer agent in the coagulation. In some embodiments, the anticancer agent may be modified to increase its partitioning in the coagulation. For example, in some embodiments, anticancer agents (e.g., tamoxifen) can be modified to increase the number of aromatic side chains, and thereby increase their distribution in aggregates containing aggregate components having aromatic side chains.
[0295] Other aspects of the invention include determining whether cancers that overexpress a gene and are resistant to an anticancer agent contain larger agglomerates than the corresponding agglomerates in cancers that do not overexpress the gene. In some embodiments, the overexpressed gene is associated with resistance to an anticancer agent. In some embodiments, the concentration of the anticancer agent in the enlarged agglomerate from resistant cancer is compared to the concentration of the anticancer agent in non-resistant cancers that do not overexpress the gene.
[0296] Some embodiments also include providing enlarged agglomerates from resistant cancer or in vitro agglomerates (e.g., droplets) containing overexpressed gene products. In some embodiments, the enlarged agglomerates or in vitro agglomerates are contacted with one or more modified anticancer agents, and the concentration of the modified anticancer agent in the contacted agglomerate is determined. In some embodiments, a library of modified anticancer agents is contacted with the agglomerate, and the concentration of the modified anticancer agent is determined to screen for modified anticancer agents effective against the cancer.
[0297]
[0298] The description of embodiments of this disclosure is not intended to be exhaustive or to limit this disclosure to the precise forms disclosed. Although specific embodiments and examples of this disclosure are described herein for illustrative purposes, those skilled in the art will recognize that various equivalent modifications are possible within the scope of this disclosure. For example, while method steps or functions are presented in a given order, alternative embodiments may perform functions in a different order, or functions may be performed substantially simultaneously. The teachings of this disclosure provided herein can be applied to other procedures or methods as appropriate. Various embodiments described herein may be combined to provide additional embodiments. If desired, aspects of this disclosure may be modified to employ the combinations, functions, and concepts of the foregoing references and applications to provide yet another embodiment of this disclosure. These and other changes may be made to this disclosure based on the detailed description.
[0299] Specific elements of any of the foregoing embodiments may be combined or substituted for elements in other embodiments. Furthermore, while advantages relating to certain embodiments of this disclosure have been described in the context of these embodiments, other embodiments may also exhibit such advantages, and not all embodiments must exhibit such advantages to fall within the scope of this disclosure.
[0300] All patents and other publications identified are expressly incorporated herein by reference for the purpose of describing and disclosing methods that may be used in conjunction with the present invention, such as those described in such publications. These publications are provided solely because they were published prior to the filing date of this application. In this respect, they should not be construed as an admission that the inventor has no right to any prior disclosure by virtue of a prior invention or prior disclosure or for any other reason. All statements regarding dates or expressions concerning the content of these documents are based on information available to the applicant and do not constitute any endorsement of the accuracy of the dates or content of these documents.
[0301] It will be readily understood by those skilled in the art that the present invention is well adapted to achieve the stated objectives and obtain the mentioned goals and advantages, as well as those inherent therein. The description and details of the embodiments herein are representative of certain implementations, are exemplary, and are not intended to limit the scope of the invention. Modifications and other uses will be apparent to those skilled in the art. These modifications are covered within the spirit of the invention. It will be apparent to those skilled in the art that various substitutions and modifications can be made to the invention disclosed herein without departing from the scope and spirit of the invention.
[0302] Unless explicitly stated otherwise, the articles “a” and “an” as used herein in the specification and claims should be understood to include plural references. Claims or descriptions including “or” among one or more members of a group should be considered to satisfy the condition that one, more than one, or all of the members of the group are present in, applied to, or otherwise associated with the given product or method, unless otherwise indicated or clearly different from the context. The invention includes embodiments in which an exact member of the group is present in, applied to, or otherwise associated with the given product or method. The invention also includes embodiments in which more than one or all of the members are present in, applied to, or otherwise associated with the given product or method. Furthermore, it should be understood that the invention provides for all variations, combinations, and substitutions in which one or more limitations, elements, clauses, descriptive terms, etc., from one or more of the enumerated claims are incorporated into another claim (or any other related claim) subordinate to the same basic claim, unless otherwise specified or unless it would clearly cause contradiction or inconsistency to a person skilled in the art. It is conceivable that all embodiments described herein may be applied to all different aspects of the invention where appropriate. It is also conceivable that any embodiment or aspect may be freely combined with one or more other such embodiments or aspects where appropriate. When elements are presented in a list form (e.g., in Markush groups or similar forms), it should be understood that each subgroup of these elements is also disclosed, and any element may be removed from that group. It should be understood that, generally, when the invention or multiple aspects of the invention are referred to as including specific elements, features, etc., certain embodiments of the invention or multiple aspects of the invention consist of or are substantially composed of such elements, features, etc. For simplicity, those embodiments are not described in such detail in each case herein. It should also be understood that any embodiment or aspect of the invention may be expressly excluded from the claims, regardless of whether such specific exclusions are recited in the specification. For example, any one or more active agents, additives, ingredients, optional pharmaceutical agents, biotypes, barriers, subjects, or combinations thereof may be excluded.
[0303] Where the claims or description relate to a composition of substance, it should be understood that methods for preparing or using the composition of substance according to any method disclosed herein, and methods for using the composition of substance for any purpose disclosed herein, are aspects of the invention, unless otherwise specified or unless they would clearly cause contradiction or inconsistency to those skilled in the art. Where the claims or description relate to a method, for example, it should be understood that methods for preparing compositions that can be used to perform said methods and products produced according to said methods are aspects of the invention, unless otherwise specified or unless they would clearly cause contradiction or inconsistency to those skilled in the art.
[0304] Where the scope is given herein, the invention includes embodiments that include endpoints, embodiments that exclude two endpoints, and embodiments that include one endpoint while excluding the other. Unless otherwise specified, it should be assumed that two endpoints are included. Furthermore, it should be understood that, unless otherwise specified or otherwise apparent from the context and to those skilled in the art, values expressed as ranges may be assumed to be any specific value or subrange within the stated range in different embodiments of the invention, up to one-tenth of the unit of the lower limit of the range, unless the context explicitly states otherwise. It should also be understood that where a series of numerical values is stated herein, the invention includes embodiments similarly relating to any intermediate value or range defined by any two values in the series, and the lowest value may be considered the minimum and the highest value the maximum. Numerical values as used herein include values expressed as percentages. For any embodiment of the invention where the numerical value is preceded by "about" or "approximately," the invention includes embodiments where precise values are listed. For any embodiment of the invention where the numerical value is not preceded by "about" or "approximately," the invention includes embodiments where the value is preceded by "about" or "approximately."
[0305] The terms “about” or “approximately” generally include numbers that fall within 1% of the number in any direction (greater or less than the number), or in some embodiments within 5% of the number, or in some embodiments within 10% of the number, unless otherwise stated or otherwise apparent from the context (unless such a number is not permitted to exceed 100% of the possible value). It should be understood that, unless expressly indicated to the contrary, in any method claimed herein involving more than one action, the order of the actions of the method is not necessarily limited to the order in which the actions of the method are narrated, but the invention includes embodiments where the order is so limited. It should also be understood that, unless otherwise specified or apparent from the context, any product or composition described herein may be considered “isolated”.
[0306] Example
[0307] Example 1
[0308] Formation of extracorporeal aggregates:
[0309] Many aggregate components are known to form in vitro aggregates. Typically, one or more aggregate components are added to a solution (e.g., an aqueous solution) at different concentrations in the presence of a salt (e.g., NaCl) and optionally a crowding agent (e.g., polyethylene glycol, sucrose). See, for example, Boija et al. Cell Volume 175, Issue 7, pp. 1842-1855 (2018); Sabari et al. Science Volume 361, pp. 361-371 (2018); Bergeron-Sandoval et al. Cell Volume 165, Issue 5, pp. 1067-1079 (2016). May 19; 165(5):1067-1079, the related methods of which are expressly incorporated herein. In some embodiments, an in vitro aggregate containing MED1 is formed by adding about 10 µM of MED1 to a solution containing 150 µM NaCl and 10% PEG (e.g., PEG-8000). In some embodiments, an in vitro aggregate containing MED1 and estrogen receptor (ER) is formed by adding about 10 µM of MED1 and ER, respectively, to a solution containing 150 µM NaCl and 10% PEG (e.g., PEG-8000) or 16% sucrose-400.
[0310] Imaging condensates
[0311] Methods for imaging condensates in vitro and in cells have been taught in this art, and are not limited thereto. In some embodiments, deconvolution microscopy, structured illumination microscopy, or interference microscopy are used to image condensates. See, for example, Boija et al. Cell Volume 175, Issue 7, pp. 1842-1855 (2018) and Sabari et al. Science Volume 361, pp. 361-371 (2018), and its related methods are explicitly incorporated into this paper.
[0312] In some specific implementations, cells containing the relevant aggregates were grown on 35 mm glass plates and imaged in 2i / LIF medium using an LSM880 confocal microscope equipped with an Airyscan detector. Cell imaging was performed on a 37°C heated stage supplemented with humidified air at 37°C. Additionally, the microscope was sealed in an incubation chamber heated to 37°C. ZEN blackedition version 2.3 (Zeiss, Thornwood NY) was available for acquisition. Images could be acquired in super-resolution (SR) mode using a Plan-Apochromat 63x / 1.4 oily objective lens with an Airyscan detector. Raw Airyscan images could be processed using ZEN 2.3 (Zeiss, Thornwood NY).
[0313] In some implementations, DNA-FISH or RNA-FISH can be used to transcribe or genomic DNA by labeling relevant RNA (e.g., Myc The location of the aggregates within the cell is determined by their position. See, for example, Boija et al. Cell Volume 175, Issue 7, pp. 1842-1855 (2018). This technique can be used in combination with other methods disclosed herein to determine whether an agent is co-located in a relevant aggregate (e.g., via fluorescent microscopy with labeled agents).
[0314] To analyze in vitro phase separation imaging experiments, MATLAB scripts can be written to identify droplets and characterize their size, aspect ratio, condensation fraction, and partition coefficient. For any given experimental conditions, images can be segmented using intensity and size thresholds (2-pixel radius) based on histogram peak values, at which points the region of interest can be defined, and the signal intensity inside and outside the droplets can be quantified.
[0315] Calculation of distribution coefficient
[0316] As used herein, the partition coefficient or enrichment ratio is the ratio of the concentration of a compound (e.g., an agent) within the aggregate to its concentration outside the aggregate (e.g., in the surrounding solution). The partition coefficient of an agent as described herein can be obtained using any suitable technique for determining agent concentration (such as the microscopy technique described herein). In some embodiments, Fiji can be used to calculate the partition coefficient in live-cell imaging. Using a single confocal plane for each cell, the average signal intensity within the aggregate can be quantified and compared to the average signal intensity from 8–12 non-heterochromatin regions within the cell's nuclear boundary. The boundaries of the heterochromatin regions and nuclear boundaries can be defined in the Hoechst channel. For quality control, cells with >3 heterochromatin foci in the selected plane can have calculated partition coefficients.
[0317] Example 2
[0318] The cell nucleus contains phase-separated aggregates of biomolecules with different physicochemical properties, which compartmentalize and aggregate. This raises the question of whether the aggregation of small-molecule cancer therapeutics alters their pharmacodynamic properties. Antitumor drugs were found to aggregate in vitro into specific protein aggregates, and this occurs through physicochemical properties independent of the drug target. This behavior was also observed in tumor cells, where drug partitioning influenced drug activity. It was found that altering the properties of the aggregates affected drug concentration and activity. These results suggest that the selective partitioning and aggregation of small molecules within aggregates contributes to drug pharmacodynamics, and a further understanding of this phenomenon could advance disease treatment.
[0319] The 5-10 billion protein molecules in a cell are compartmentalized into membrane-bound and non-membrane-bound organelles (1-3). Many non-membrane-bound organelles are phase-separated biomolecular condensates with different physicochemical properties, capable of absorbing and aggregating specific proteins and nucleic acids (4-17). There is reason to believe that selective condensate distribution may also occur alongside small molecule drugs whose targets are present within the condensates. Figure 28A Furthermore, the therapeutic index and efficacy of such compounds may therefore be related to their ability to dissociate into condensates containing their targets. To test this idea, this study focused on a collection of nuclear condensates previously reported in various cell lines, demonstrating that they all occur in normal human cells and tumor cells, and then developed an in vitro condensate droplet assay using key components of each nuclear condensate to enable the testing of small molecules.
[0320] Nuclear condensates have been described in different cultured cell lines, but it has not yet been demonstrated that each of the following—transcriptional condensates, splice condensates, heterochromatin condensates, and nucleolar condensates—occurs in cells of normal and malignant primary human tissues. Each of these condensates contains one or more proteins that can be used both as markers of the condensate and as scaffolds for condensate formation in in vitro droplet assays (10–12, 18–32). Specifically, transcriptional condensates are labeled by the condensate-forming proteins MED1 and BRD4 (10, 12, 19), splice dot condensates by SRSF2 (11, 20), heterochromatin condensates by HP1α (21, 22), and nucleoli by FIB1 and NPM1 (23–25). Figure 32A To determine whether such aggregates could also be observed in cells of healthy and malignant human tissues, we obtained biopsies of mammary ductal epithelium, invasive ductal carcinoma, normal colon, and colon cancer. Figure 32B , 32CImmunofluorescence revealed nuclei containing these marker proteins in both normal and transformed tissues. Figure 28B , 28C As expected of dynamic biomolecular aggregates, the nuclei exhibited a wide distribution in size and number, and no significant differences were observed between benign and malignant tissues. Figures 33A-33C However, tumor cells acquire large superenhancers at the driver oncogenes (33), and these can form tumor-specific transcriptional condensates, as described below.
[0321] A assay was developed to simulate these nuclei and to study the behavior of small molecules within these droplets. Figure 28D The proteins that label each nuclear aggregate have previously been shown to form individual aggregates in vitro (10, 11, 21, 23). Recombinant fluorescently labeled forms of MED1, BRD4, SRSF2, HP1α, FIB1, and NPM1 were generated and purified (Figure 34), and the ability of these proteins to form droplets in in vitro assays was confirmed. Figure 35A , 35B To investigate the partitioning behavior of small molecules, the dyes fluorescein (332 Da) and Hoechst (452 Da), along with fluorescently labeled dextran with an average 4.4 kDa, were first added to a solution containing each of six protein aggregates. The dyes and dextran appeared to diffuse through all aggregates with virtually no partitioning. Figure 28E , Figure 36 , Figures 37A-37D Small molecule drugs are typically smaller than 1 kDa, so these results suggest that small molecule drugs can diffuse freely through these nuclei unless factors other than size affect the distribution are present.
[0322] The next step was to determine whether different clinically important drugs with targets residing in nuclear aggregates also exhibited free diffusion through these aggregates. The initial focus was on cisplatin and mitoxantrone, members of a class of antitumor compounds that are modified by platinumization or insertion into DNA and can be modified to exhibit fluorescent properties (cisplatin) (34) or intrinsic fluorescence (mitoxantrone). When added to droplet-forming buffers containing purified MED1, BRD4, SRSF2, HP1α, FIB1, or NPM1, cisplatin was found to selectively aggregate in MED1 droplets (…). Figure 29A , Figure 38A The allocation coefficient is as high as 600. Figures 39A-39C Fluorescent modification of cisplatin does not appear to contribute to this behavior in vitro, as the modified drug can be expelled from aggregates containing unmodified cisplatin, and isomers of cisplatin do not exhibit the same behavior. Figures 38B-38DMitoxantrone also aggregated in MED1 aggregates as well as FIB1 and NPM1 aggregates. Figure 29B , Figure 38A , Figures 39A-39C Consistent with these results, mitoxantrone is known to aggregate in the nucleoli of FIB1 and NPM1 (35, 36). These results suggest that aggregates formed in vitro possess the physicochemical properties to selectively aggregate specific small molecule drugs even in the absence of a drug target.
[0323] Antitumor drugs targeting transcriptional regulators expected to be contained within cellular transcriptional condensates were selected for further investigation. These targets included: a) the estrogen receptor (ER), which is a transcription factor and nuclear hormone receptor; b) CDK7, a cyclin-dependent kinase that plays a role in transcription initiation and cell cycle control; and c) BRD4, a bromodomain protein and co-activator involved in oncogene regulation (Figure 40). To monitor drug behavior using confocal fluorescence microscopy, fluorescent tamoxifen analogue (FLTX1) targeting ER and modified fluorescent THZ1 and JQ1 targeting CDK7 and BRD4, respectively, were used (37, 38). These compounds were added to parallel droplet formation assays containing MED1, BRD4, SRSF2, HP1α, FIB1, and NPM1 proteins. FLTX1 and THZ1 preferentially aggregated in MED1 droplets ( Figures 29C-29D , Figure 38A ), and this behavior cannot be attributed to the fluorescent part ( Figure 38B , Figure 38D JQ1 concentrations exhibited different patterns, accumulating in MED1, BRD4, and NPM1 droplets. Figure 29E , Figure 38A , Figure 38B Strengthening these results, it was found that small molecules aggregated in MED1 aggregates also aggregated in aggregates formed from purified, intact mediator complexes. Figure 41 ) and in MED1 aggregates formed in alternative crowding agents ( Figure 42 The targets of these three compounds (ERα, CDK7, and the Bromo domain of BRD4) are not present in these in vitro aggregates, but are present in super-enhancers that form aggregates in vivo along with transcription factors and mediators (10, 12, 39). Figure 40A , 40B This suggests that the ability of some small molecules to preferentially aggregate in aggregates that are the same as their protein targets may contribute to the pharmacological properties of these drugs.
[0324] To further understand the nature of the interactions governing the enrichment of small molecules in aggregates, the study focused on MED1-IDR aggregates. Photobleaching-after-fluorescence recovery (FRAP) experiments showed that cisplatin molecules are highly mobile in these aggregates. Figure 43A , 43B This indicates that the aggregates are generated in a highly dynamic and mobile state, creating a physiologically and chemically conducive environment for drug aggregation. To understand the chemical characterization of small molecules that may contribute to selective association with MED1 in the aggregates, a small molecule library of 81 compounds was used, among which the fluorescent molecule boron-dipyrrolemethylene (BODIPY) was modified with various combinations of chemical side groups. Figure 44A Furthermore, the relative ability of these molecules to aggregate in MED1 condensates was measured using confocal fluorescence microscopy. It was found that molecules containing aromatic rings preferentially aggregated in MED1 condensates. Figures 44A-44D , Figure 45A This indicates that π-π or π-cation interactions are one of the physicochemical properties that facilitate the partitioning of small molecules into MED1 aggregates. MED1 contains more aromatic amino acids (the number of which exceeds that of other aggregate-forming proteins studied in this paper). Figure 34B This may contribute to such interactions, and to investigate this possibility, a mutant MED1 protein was created in which all 30 aromatic amino acids were mutated to alanine, and its ability to form aggregates and aggregate molecules was tested. Figure 45B The MED1 aromatic mutant protein retains its ability to form droplets in vitro, indicating that aromatic amino acids are not essential for droplet formation. Figure 45C However, small molecule probes containing aromatic rings and polar molecule cisplatin no longer partition into aggregates formed by MED1 aromatic mutant proteins. Figure 45D , 45E These results indicate that the aromatic residues in MED1 aggregates contribute to the selective aggregation of these small molecules' physicochemical properties.
[0325] The ability of small molecules to aggregate in specific aggregates is expected to affect target binding and thus drug pharmacodynamics. To investigate this, the ability of MED1 and HP1α aggregates to incorporate DNA was utilized. Figure 30A The relative efficiency of cisplatin for DNA platinization was measured in MED1 aggregates where cisplatin was aggregated versus in HP1α aggregates where cisplatin was freely diffused. Figure 29A DNA and proteins are mixed under droplet-forming conditions, where the DNA strongly partitions into the droplet phase. Figure 46 These aggregates were treated with cisplatin, and DNA platinumization was visualized by size shift on a bioanalyzer. The results showed that DNA was platinumized more efficiently in MED1 aggregates than in HP1α aggregates. Figure 30B This is consistent with the expectation that elevated cisplatin concentrations in MED1 aggregates would produce enhanced target binding. If cisplatin accumulates in mediator aggregates within cells, it is expected that DNA co-localized with the mediator aggregates will be preferentially platinumized. To test this, antibodies that specifically recognize platinum-plated DNA were used. Figure 47A (40) and co-immunofluorescence of antibodies specific to MED1, HP1α, or FIB1 in cisplatin-treated HCT116 colon cancer cells. Consistent with cisplatin's in vitro preference for MED1 aggregates, platinum-treated DNA was found to frequently colocalize with MED1 aggregates, but not with HP1α or FIB1 aggregates. Figure 30C To determine whether the ability of cisplatin to bind DNA depends on the presence of MED1 aggregates, cells were treated with JQ1, which resulted in the loss of MED1 aggregates. Figure 47B Furthermore, a decrease in platinum-modified DNA at the MYC oncogene was observed. Figure 47C , 47D These results are consistent with the idea that the concentration of small molecules in specific aggregates may affect target binding efficiency.
[0326] In cells, preferential DNA modification in MED1-containing aggregates can be expected to selectively disrupt these aggregates through prolonged treatment. To test this, HCT116 colon cancer cells were engineered to express GFP-tagged marker proteins for each of the six nuclear aggregates. Figures 48A-48F , Figure 49A , Figure 49B When exposed to cisplatin, a decrease in the selectivity and progressiveness of MED1 aggregates was observed. Figure 30D , Figure 50A , Figure 50B , Figure 51 Consistent with this, cisplatin treatment leads to preferential loss of the MED1 ChIP-seq signal at the super-enhancer. Figure 30E , Figure 52 Furthermore, high-throughput sequencing data from platinum-modified DNA (41) revealed that cisplatin-modified DNA preferentially appeared at super-enhancers (SEs) where MED1 aggregated (42). Figure 30F These results are consistent with reports of cisplatin preferentially modifying transcribed genes (41, 43) and suggest that this effect is due to preferential condensate allocation. In summary, these results indicate a model of cisplatin preferentially modifying SE DNA, which in turn leads to the dissolution of these condensates. Previous studies have shown that different tumor cells become highly dependent on super-enhancer-driven oncogene expression (44–48), which may explain why platinum drugs capable of general DNA modification are effective therapeutic agents in various cancers (49).
[0327] To explore the behavior of another clinically important antitumor drug, tamoxifen, in order to assess whether drug response and resistance are related to its distribution in aggregates. Figure 31A ERα was incorporated into MED1 aggregates in vitro in an estrogen-dependent manner (12); droplet assays confirmed this and revealed that the addition of tamoxifen resulted in the expulsion of ERα from MED1 aggregates ( Figure 31B Further investigation was conducted into the effects of estrogen and tamoxifen on MED1 aggregates in breast cancer cells, focusing on the MYC oncogene due to its significant oncogenic effects and responsiveness to estrogen (50). MED1 aggregates were observed on the MYC oncogene in the ER+ breast cancer cell line MCF7. Figure 40A , Figures 53A-53D DNA FISH with MED1 IF revealed that estrogen enhances the formation of MED1 aggregates at the MYC oncogene and tamoxifen treatment reduces these aggregates. Figure 54A , Figure 54B In the absence of ER, artificial MED1 aggregates accumulate FLTX1 at the aggregate site. Figure 55 This indicates that ER is not required to distribute FLTX1 into the MED1 aggregate in cells. These results are consistent with models that ERα interacts with the MED1 aggregate in an estrogen-dependent, tamoxifen-sensitive manner to drive oncogene expression in breast cancer cells.
[0328] The mechanisms underlying drug resistance can provide clues about drug activity in the clinical setting. Tamoxifen resistance is a persistent clinical challenge and may be mediated by multiple mechanisms, including ERα mutations and MED1 overexpression. Figure 31A , Figure 56 (51,52). To investigate whether ERα mutations alter ERα behavior in aggregates, we generated four patient-derived ERα mutant proteins and tested their partitioning in the presence of tamoxifen. In contrast to WT ERα, aggregates composed of patient-derived ERα mutants and MED1 were not disrupted upon tamoxifen treatment. Figure 31B , Figure 57A , Figure 57B ). ERα point mutations reduce the affinity for tamoxifen by about 10-fold (52), indicating that when this affinity is reduced, the drug concentration in the droplet is insufficient to flush out these ER mutant proteins.
[0329] MED1 overexpression is associated with tamoxifen resistance and poor prognosis in breast cancer (51), but it is unclear why overexpression of a subunit of the mediator complex produces resistance. The possibility of overexpressed MED1 being incorporated into transcriptional condensates containing mediator molecular clusters (39) is considered, thereby increasing their volume and diluting available tamoxifen. Figure 58A The tamoxifen-resistant breast cancer cell line TAMR7 (53), derived from the tamoxifen-sensitive cell line MCF7, was found to produce a 4-fold increase in MED1 protein levels. Figure 58B The volume of MED1-containing aggregates in these cells was twice as large. Figure 31C , Figure 58C When modeling in in vitro droplet assays, it was found that a 4-fold increase in MED1 levels resulted in a similar increase in droplet size. Figure 59A , Figure 59B Furthermore, it was found that 100 µM tamoxifen inhibited the incorporation of ERα into MED1 aggregates. Figure 31B , 31D However, it is much less effective in preventing ERα incorporation into larger MED1 aggregates produced with higher MED1 levels. Figure 31D To confirm that tamoxifen is more dilute in larger droplets, the enrichment of the fluorescent tamoxifen analog FLTX1 in MED1 droplets was measured, and it was found that larger aggregates had lower drug concentrations. Figure 31E These results are reflected in cells, where tethered ERα molecules aggregate to form MED1 aggregates that are eliminated by tamoxifen, but when MED1 is overexpressed, tamoxifen cannot dissociate ERα-MED1 aggregates. Figure 60 These results support a tamoxifen resistance model in which MED1 overexpression induces the formation of larger transcriptional condensates, where tamoxifen is diluted and thus less effective at dissociating ER from the condensate. Figure 31F ).
[0330] The results showed that drugs selectively partitioned into aggregates, which could occur through physicochemical properties independent of the presence of their molecular targets, and that cells could develop drug resistance through aggregate-altering mechanisms. This explains the surprising observation that inhibition of global gene regulators such as BRD4 or CDK7 can selectively target oncogenes with acquired large superenhancers (46); selective partitioning of inhibitors such as JQ1 and THZ1 into superenhancer aggregates preferentially disrupts transcription at those loci. These results also have implications for the future development of effective disease therapeutics; effective target binding will depend on measurable factors such as drug partitioning in aggregates (46). Figures 61A-61DTherefore, the type of aggregate assay described herein may help optimize aggregate distribution, target binding, and the therapeutic index of small molecule drugs.
[0331] Materials and methods
[0332] cell lines
[0333] The TamR7 cell line (ECACC 16022509) was obtained as shown. V6.5 mouse embryonic stem cells were a gift from R. Jaenisch of the Whitehead Institute. V6.5 were male cells derived from a C57BL / 6(F) x 129 / sv(M) hybrid. MCF7 cells were a gift from R. Weinberg of the Whitehead Institute, and HCT116 cells from ATCC (CCL-247) were used. V6.5 mouse embryonic stem cells were endogenously labeled with MED1-mEGFP (10), BRD4-mEGFP (10), SRSF2-mEGFP (11), or HP1α-mEGFP. Cells were tested to be mycoplasma negative. The CRISPR / Cas9 system was used to generate genetically modified, endogenously labeled ESC and HCT116 cells. Target-specific sequences were cloned into plasmids containing an sgRNA backbone (codon-optimized forms of Cas9 and BFP or mCherry). Homologous-directed repair templates were cloned into pUC19 cells using the NEBuilder HiFi DNA master mix (NEB E2621S). The homologous repair template consisted of an mCherry or mEGFP cDNA sequence with 800 bp homologous arms amplified from genomic DNA by PCR on each side. To generate genetically modified cell lines, 750,000 cells were transfected with 833 ng of Cas9 plasmid, and 1,666 ng of nonlinear homologous repair PCR genotyping was performed using Phusion polymerase (Thermo Scientific F531S). Amplification products were visualized on 1% agarose gels according to kit recommendations. The following primers were used for PCR genotyping:
[0334] HP1α-mCherry_fwd (mES):AACGTGAAGTGTCCACAGATTG (SEQ ID NO: 2)
[0335] HP1α-mCherry_rev (mES):TTATGGATGCGTTTAGGATGG (SEQ ID NO: 3)
[0336] HP1α-GFP_fwd (HCT116):CCAAGGTGAGGAGGAAATCA (SEQ ID NO: 4)
[0337] HP1α-GFP_rev (HCT116):CACAGGGAAGCAGAAGGAAG (SEQ ID NO: 5)
[0338] MED1α-GFP_fwd (HCT116):GAAGTTGAGAGTCCCCATCG (SEQ ID NO: 6)
[0339] MED1-GFP_rev (HCT116):CGAGCACCCTTCTCTTCTTG (SEQ ID NO: 7)
[0340] BRD4-GFP_fwd (HCT116):CTGCCTCTTGGGCTTGTTAG (SEQ ID NO: 8)
[0341] BRD4-GFP_rev (HCT116):TTTGGGGAGAGGAGACATTG (SEQ ID NO: 9)
[0342] SRSF2-GFP_fwd (HCT116):CAAGTCTCCTGAAGAGGAAGGA (SEQ ID NO: 10)
[0343] SRSF2-GFP_rev (HCT116):AAGGGCTGTATCCAAACAAAAAC (SEQ ID NO: 11)
[0344] FIB1-GFP_fwd (HCT116):CCTTTTAATCAGCAACCCACTC (SEQ ID NO: 12)
[0345] FIB1-GFP_rev (HCT116):GTGACCGAGTGAGAATTTACCC (SEQ ID NO: 13)
[0346] NPM1-GFP_fwd (HCT116):TCAAATTCCTGAGCTGAAGTGA (SEQ ID NO: 14)
[0347] NPM1-GFP_rev (HCT116):AACACGGTAGGGAAAGTTCTCA (SEQ ID NO: 15)
[0348] Cell culture
[0349] V6.5 mouse embryonic stem (mES) cells were grown under 2i + LIF conditions. mES cells were also grown on 0.2% gelled (Sigma, G1890) tissue culture plates. The culture medium used for 2i+ LIF conditions was as follows: 967.5 mL DMEM / F12 (GIBCO 11320), 5 mL N2 supplement (GIBCO 17502048), 10 mL B27 supplement (GIBCO17504044), 0.5 mM L-glutamine (GIBCO 25030), 0.5X non-essential amino acids (GIBCO 11140), 100 U / mL penicillin-streptomycin (GIBCO 15140), 0.1 mM β-mercaptoethanol (Sigma), 1 uM PD0325901 (Stemgent 04-0006), 3 uM CHIR99021 (Stemgent 04-0004), and 1000 U / mL recombinant LIF (ESGRO ESG1107). Cells were isolated from the plates using TrypLE expression enzyme (Life Technologies, 12604021). TrypLE was quenched with FBS / LIF-medium (DMEM K / O (GIBCO, 10829-018), 1X non-essential amino acids, 1% penicillin-streptomycin, 2 mM L-glutamine, 0.1 mM β-mercaptoethanol and 15% fetal bovine serum (FBS) (Sigma Aldrich, F4135)). Cells were rotated at 1000 rpm for 3 minutes at room temperature, resuspended in 2i medium, and 5 x 10⁶ cells were added. 6 One cell was seeded in a 15 cm culture dish.
[0350] MCF7 and HCT116 cells were grown in complete DMEM medium (DMEM (Life Technologies 11995073), 10% fetal bovine serum (FBS) (Sigma Aldrich, F4135), 1% L-glutamine (GIBCO, 25030-081), 1% penicillin-streptomycin (Life Technologies, 15140163)). To grow under estrogen-free conditions, MCF7 cells in conventional medium were washed three times with PBS, and then the medium was replaced with estrogen-free medium containing phenol red-free DMEM (Life Technologies 21063029), 10% activated charcoal-treated FBS (Life Technologies A3382101), 1% L-glutamine (GIBCO, 25030-081), and 1% penicillin-streptomycin (Life Technologies, 15140163) for 48 hours before use.
[0351] TamR7 cells were grown in TAMR7 medium (phenol red-free DMEM / F12 (Life Technologies 21041025), 1% L-glutamine (GIBCO, 25030-081), 1% penicillin and streptomycin (Life Technologies, 15140163), 1% fetal bovine serum (FBS) (Sigma Aldrich, F4135), 6 ng / mL insulin (Santa Cruz Biotechnology, sc-360248)). For passage, cells were washed in PBS (Life Technologies, AM9625). Cells were isolated from the plates using TrypLE expression enzyme (Life Technologies, 12604021). TrypLE was quenched with the specified medium.
[0352] Live cell imaging
[0353] Cells were grown on glass culture dishes (Mattek P35G-1.5-20-C). Before imaging, the medium was replaced with phenol red-free 2i medium, and imaging was performed using an Andor Revolution Spinning Disk confocal microscope. Raw Andor images were processed using FIJI. For imaging mESCs, coated glass culture dishes were used (incubated at 37°C for 30 min with 5 μg / ml poly-L-ornithine (Sigma-Aldrich, P4957), and incubated at 37°C for 2–16 h with 5 μg / ml laminin (Corning, 354232). To image FIB1 and NPM1 in mES cells, vectors encoding GFP-labeled NPM1 or FIB1 were transfected with Lipofectamine 3000 according to the package insert as described above.
[0354] Immunofluorescence of tissue samples
[0355] Freshly frozen breast and colon tissues were purchased from BioIVT. Frozen breast tissue was fixed in 2% PFA in PBS for 30 minutes to 1 hour. The fixed tissue was incubated in 30% sucrose in PBS at 4°C for 4 days. The tissue was embedded in OCT and frozen. Freshly frozen colon tissue was embedded in OCT and frozen. Tissue sections were sectioned to 10µm using a cryostat set to -25°C or -30°C. Sections were stored at -20°C. For IF, sections were brought to room temperature and fixed in 4% PFA in PBS for 10 minutes. After washing three times in PBS, the tissue was permeabilized with 0.5% TX100 in PBS, washed three times in PBS, and blocked with 4% BSA in PBS for 30 minutes. A primary antibody diluted in 4% BSA in PBS was added to the tissue sample for overnight incubation at room temperature. After washing three times in PBS, the sample was incubated with a secondary antibody diluted 1:500 in 4% BSA in PBS. Samples were washed in PBS, stained with 20 μm / mL Hoechst 33258 (Life Technologies, H3569) for 5 minutes, and fixed with Vectashield (VWR, 101098-042). Images were acquired for bioimaging using the Elyra super-resolution microscope at Harvard Center. Post-processing of images was performed using Fiji Is Just ImageJ (https: / / fiji.sc / ).
[0356] Quantitative analysis of the nuclear volume of condensates
[0357] For image acquisition: 10 z-slices were imaged. The outlines of the cell nuclei were manually defined in Fiji Is Just ImageJ (https: / / fiji.sc / ), and the volume of each nucleus was calculated as the nuclear area (μm). Number of z-slices for imaging (10) Voxel depth (0.1 μm).
[0358] The volume of aggregates in the cell nucleus was measured using a custom Python script and the scikit-image package. Aggregates were segmented from 3D images of protein channels according to two criteria: (1) an intensity threshold of three sd above the image average; and (2) a size threshold (minimum aggregate size of 10 pixels). The volume was then multiplied by the width (μm). Height (μm) Voxel depth (0.1 μm) is used to calculate the estimated volume of segmented objects. For each protein factor, the mean and SD volume of aggregates in healthy and malignant tissues are reported. The number of aggregates per nucleus is defined as the number of segmented objects contained within the defined nucleus perimeter. For each protein factor, the mean and SD number of aggregates per nucleus in healthy and malignant tissues are reported. The percentage of nucleus volume occupied by aggregates is calculated as follows: (∑Volume of all detected aggregates in the nucleus) / (Estimated nucleus volume).
[0359] Antibody
[0360] The following antibodies were used for immunofluorescence: NPM1 (ab10530), BRD4 (ab128874), MED1 (ab64965), HP1a (ab109028), FIB1 (ab5821), SRSF2 (ab11826), ER (ab32063), CDK7 (sc-7344), cisplatin-modified DNA (ab103261), 568 goat anti-rat A11077, and goat anti-rabbit IgG Alexa Fluor 488 (LifeTechnologies A11008).
[0361] Protein purification
[0362] Human cDNA was cloned into a modified form of the T7 pET expression vector. The base vector was engineered to include 5' 6x HIS, followed by BFP, mEGFP, or mCherry, and a 14-amino acid adapter sequence “GAPGSAGSAAGGSG” (SEQ ID NO: 16). These sequences (generated by PCR) were inserted into the frame along with the adapter amino acids using the NEBuilder® HiFi DNA Assembly Master Mixture (NEB E2621S). All expression constructs were sequenced to ensure sequence identity.
[0363] For protein expression, the plasmid was transformed into LOBSTR cells (a gift from the Chessman lab) and grown as follows: Fresh bacterial colonies containing the labeled MED1 construct were inoculated into LB medium containing kanamycin and chloramphenicol and grown overnight at 37°C. Cells were then grown in 500 ml of room temperature LB medium diluted 1:30 with freshly added kanamycin and chloramphenicol and grown at 16°C for 1.5 h. IPTG was added to 1 mM and growth continued for 20 h. Cells were collected and cryopreserved. Cells containing all other expression plasmids were treated in a similar manner, except that they were grown at 37°C for 5 h after IPTG induction.
[0364] Cell pellets of SRSF1 and SRSF2-IDR were resuspended in 15 ml denaturing buffer (50 mM Tris 7.5, 300 mM NaCl, 10 mM imidazole, 8 M urea) containing a complete protease inhibitor (Roche, 11873580001) and sonicated (15 sec on, 60 sec off, 10 cycles). The lysate was clarified by centrifugation at 12,000 g for 30 min and added to 1 ml of Ni-NTA agarose (Invitrogen, R901-15) pre-equilibrated with 10 volumes of the same buffer. The tubes containing this agarose lysate were incubated at room temperature for 1.5 h by rotation, followed by centrifugation at 3,000 rpm for 10 min. The eluent was washed with 2 x 5 ml lysis buffer and eluted with 3 x 2 ml lysis buffer containing 250 mM imidazole. The eluent was incubated at room temperature by rotation for at least 10 min and centrifuged at 3,000 rpm for 10 min to collect the protein. Fractions were electrophoresed on a 12% acrylamide gel. Proteins of the correct size were first dialyzed against a buffer containing 50 mM Tris pH 7.5, 500 mM NaCl, 1 M DTT, and 4 M urea, then against the same buffer containing 2 M urea, and finally dialyzed twice with a buffer containing 10% glycerol and no urea. Any precipitate after dialyzing was removed by centrifugation at 3,000 rpm for 10 min. All other proteins were purified similarly by resuspending the cell pellet in 15 ml buffer containing 50 mM Tris pH 7.5, 500 mM NaCl, and a complete protease inhibitor, sonicating, and centrifuging at 12,000 x g for 30 min at 4 °C. The lysate was added to 1 ml of pre-equilibrated Ni-NTA agarose and incubated at 4 °C for 1.5 h. Centrifuge the resin slurry at 3,000 rpm for 10 minutes, wash with 2 x 5 ml lysis buffer containing 50 mM imidazole, and incubate with 2 ml lysis buffer containing 250 mM imidazole for 10 minutes or longer, rotating three times, then centrifuge and perform gel analysis. Fractions containing the correct protein size are dialyzed twice at 4°C with a buffer containing 50 mM Tris 7.5, 125 mM NaCl, 10% glycerol, and 1 mM DTT, or for the HP1a construct, dialyzed with the same buffer containing 500 mM NaCl.
[0365] The following human proteins or protein fragments are used in production:
[0366] NPM1 - Full length, amino acids 1-294.
[0367] SRSF2 - Full-length amino acid 1-221.
[0368] HP1α- Full length, amino acids 1-191.
[0369] MED1 - Amino Acids 600-1581.
[0370] MED1 - Aromatic mutant amino acids 600-1581, where all aromatic residues are replaced with alanine.
[0371] MED1 - Basic mutant amino acids 600-1581, all basic residues are changed to alanine.
[0372] BRD4 - Amino Acid 674-1351.
[0373] FIB1 - Full length, amino acids 1-321.
[0374] ER and ER mutant - full length, amino acid 1-595 (WT).
[0375] Cbioportal data acquisition
[0376] To determine the frequency of patient mutations, query cbioportal (www.cbioportal.org / ) for the presence of ESR1 mutations in any breast cancer sequencing dataset.
[0377] Drugs and small molecules
[0378] Drugs and small molecules were obtained and processed as follows. Hoescht 33258 (Life Technologies H3569) was obtained and used in liquid form. Fluorescein (Sigma F2456) was dissolved in DMSO at 10 mM and then further diluted in droplet-forming buffer for use. Dextran conjugated with TRITC or FITC, ROX (Life Technologies 12223012), and Texas Red (Sigma Aldrich 60311-02-6) with measured values of 4.4 kDa (Sigma T1037), 10 kDa (Invitrogen D1816), 40 kDa (Invitrogen D1842), or 70 kDa (Invitrogen D1864) was diluted in droplet-forming buffer. FLTX1 (AOBIO 4054) was dissolved in DMSO and then further diluted in droplet-forming buffer. THZ1-TMR and JQ1-ROX were synthesized as described below to obtain Figures 29D-29EThe molecular structures shown are described. Cisplatin conjugated with Texas Red (Ursa Bioscience) was dissolved in DMSO to 2 mM and diluted in droplet-forming buffer for further use. Mitoxantrone (Sigma F6545) was dissolved in DMSO and diluted in droplet-forming buffer for further use. Chemical structures were prepared using ChemDraw software.
[0379] The following live cell expel experiments were conducted using unlabeled molecules: JQ1 (Cayman Chemical 11187), cisplatin (Selleck S1166), trans-platinum (Toku-E T108), tamoxifen (Sigma Aldrich T5648), and 4-hydroxytamoxifen (Sigma H7904).
[0380] In vitro droplet assay
[0381] Recombinant BFP, GFP, or mCherry fusion proteins were aggregated and desalted to the appropriate protein concentration and 125 mM NaCl using an Amicon Ultra centrifuge filter (30K MWCO, Millipore). The recombinant protein was also added. Droplet-forming buffer (50 mM Tris-HCl pH 7.5, 10% glycerol, 1 mM DTT) with the specified amounts of salt and the specified crowding agent (sucrose or PEG) was prepared. The protein solution was immediately loaded onto glass-bottomed 384-well plates (Cellvis P384-1.5HN) and imaged using an Andor confocal microscope with 150x objectives. Unless otherwise specified, the images presented are droplets deposited on glass coverslips.
[0382] The drug and small molecule concentrations used in the droplet experiment are as follows:
[0383] Texas Red Cisplatin – 5µM
[0384] FLTX1 – 100µM
[0385] Mitothrone – 50µM
[0386] Fluorescein - 5µM
[0387] Hoescht – 1 mg / mL
[0388] Labeled dextran – 0.05 mg / mL
[0389] THZ1-TMR – 5µM
[0390] JQ1-ROX - 1μM
[0391] ROX - 1μM
[0392] TR - 5μM
[0393] For the expulsion experiment, 5 μM labeled cisplatin-TR was added to the MED1 droplet reactants (10 μM MED1, 50 mM Tris-HCl pH 7.5, 10% glycerol, 1 mM DTT, 10% PEG) to form MED1 droplets aggregated with cisplatin-TR. Unlabeled trans-platinum or unlabeled cisplatin (mediator, 10 μM, 100 μM, or 500 μM) was added to the droplet mixture, and the amount of labeled cisplatin-TR remaining in the droplets was measured after expulsion. 100 μM fluorescent FLTX1 was added to the MED1 droplet reactants (10 μM MED1, 50 mM Tris-HCl pH 7.5, 10% glycerol, 1 mM DTT, 10% PEG) to form MED1 droplets aggregated with FLTX1. 1 mM of the non-fluorescent form of tamoxifen was added to the droplet mixture, and the amount of fluorescent FLTX1 remaining in the droplets was measured after efflux. To determine the efflux of ER from MED1 aggregates, fluorescently labeled ER and MED1 were mixed at a specified concentration in droplet formation buffer with the specified components in the presence of 100 μM estrogen (Sigma E8875). For tamoxifen-treated conditions, 4-hydroxytamoxifen (Sigma H7904) was then added to a final concentration of 100 μM, and imaging was performed on a confocal fluorescence microscope as described above.
[0394] For droplet assays using fluorescent DNA, a 451-base-pair DNA fragment was commercially synthesized in a vector with flanking M13F and M13R primer binding sites. Primers M13F and M13R, covalently bound to the Cy5 fluorophore, were commercially synthesized, and this fragment was amplified using these primers. The DNA fragment was then purified from the PCR reaction and diluted in droplet formation buffer for the described droplet assays. To test the ability of recombinant CDK7 to partition in MED1 or HP1α droplets, the recombinant CDK activation complex (Millipore 14-476) was provided at 0.4 mg / mL in 150 mM NaCl at pH 7.5. A vial of Cy5 single-reactive dye (Amersham PA23001) was resuspended in 30 μL of 0.2 M sodium bicarbonate (pH 9.3) in 150 mM NaCl solution. 5 μL of this reactant was added to 5 μL of protein and incubated at room temperature for 1 hour. The free dye was removed by passing it through a Zeba Spin desalting column (40MWCO, 87764, Thermo Scientific) into a droplet-forming buffer containing 1 mM DTT in 125 mM NaCl to a final concentration of 1 μM, as described in the package insert. The protein was then used in droplet assays as needed.
[0395] For screening, a modified BODIPY library of 80 modified BODIPY molecules was selected from a larger library set as previously described (54). These molecules were diluted to 1 mM in DMSO and then to 10 μM in droplet-forming buffer. Droplets of MED1-IDR-BFP were formed in droplet-forming buffer containing 125 mM NaCl, 10% PEG, and 5 μM protein. Probes were added to this reaction to a final concentration of 1 μM. The mixture was added to one well of a 384-well plate and imaged at 150x in the 488 (BODIPY) and 405 (protein) channels using an Andor confocal fluorescence microscope. These images were quantified through the aforementioned channels to quantify the maximum 488 signal intensity in the droplet defined by the 405 channel. These values were then graded to quantify top and bottom “hit”. To ensure equal fluorescence intensity of the probes, 18 random probes in 1 μM of droplet-forming buffer were imaged as described above, and the average fluorescence intensity in the field was determined. The same method was used to measure the fluorescence intensity of BODIPY (Sigma 795526) in MED1 droplets and in the diffuse state.
[0396] FRAP containing drug-containing in vitro droplets
[0397] For FRAP in vitro, five laser pulses with a residence time of 50 µs were applied to the MED1 channel, and 20 laser pulses with a residence time of 100 µs were applied to the cisplatin channel. Recovery was imaged every 1 s on an Andor microscope for the specified time period. Fluorescence intensity was measured using FIJI. The FRAP recovery data after bleaching were averaged over six replicates for each channel.
[0398] Calculate drug enrichment ratio
[0399] To analyze in vitro droplet experiments, a custom Python script using the scikit-image package was written to identify droplets and characterize their size, shape, and intensity. Droplets were segmented from the average image of the capture channels according to various criteria: (1) an intensity threshold of three sd above the image average; (2) a size threshold (minimum droplet size of 20 pixels); and (3) a minimum roundness (roundness = 4). π Area circumference 2)(circularity = 4π The perimeter of the area (2) is 0.8 (1 is a perfect circle). After segmentation, the average intensity of each droplet is calculated while excluding pixels near the phase interface, and the background is corrected by subtracting only the intensity of the dark image of the droplet forming buffer. For each experiment, droplets identified from 10 independent fields of view in the fluorescent protein channel are quantified. The maximum signal intensity within the droplet is calculated for each channel, and the maximum intensity in the drug channel is called the “maximum drug intensity”. To obtain the intensity of a single drug or dye in the diffused state (called the “diffused drug intensity”), the compound is added to the droplet forming buffer at the same concentration used in the droplet assay. It is then imaged on a confocal fluorescence microscope. The resulting images are processed in FIJI to obtain the fluorescence intensity of the field. To obtain the fluorescence intensity of the protein droplets oozing out of the drug channel (called the “background intensity”), the protein droplets are imaged in the fluorescent channel of the drug and processed as described above to obtain the average maximum intensity within the droplet on 10 images. The enrichment ratio is obtained by the following formula: [(maximum drug intensity) - (background intensity)] / (diffused drug intensity). The box plot shows the distribution of all droplets. Each point represents a single droplet.
[0400] Chromatin immunoprecipitation (ChIP) and sequencing
[0401] MCF7 cells were grown to 80% confluence in complete DMEM medium. Cells were cross-linked for 15 minutes using 1% formaldehyde in PBS, followed by quenching on ice with glycine to a final concentration of 125 mM. Cells were washed with cold PBS and harvested by scraping the cells from the cold PBS. The collected cells were precipitated at 1000 g for 3 minutes at 4°C, rapidly frozen in liquid nitrogen, and stored at 80°C. All buffers contained freshly prepared complete protease inhibitors (Roche, 11873580001). Frozen cross-linked cells were thawed on ice and then resuspended in lysis buffer I (50 mM HEPES-KOH (pH 7.5), 140 mM NaCl, 1 mM EDTA, 10% glycerol, 0.5% NP-40, 0.25% Triton X-100, protease inhibitor) and rotated at 4°C for 10 minutes, followed by rotation at 1350 rcf. at 4°C for 5 minutes. The precipitate was resuspended in lysis buffer II (10 mM Tris-HCl (pH 8.0), 200 mM NaCl, 1 mM EDTA, 0.5 mM EGTA, protease inhibitor) and rotated at 4°C for 10 min, then rotated at 1350 rcf. at 4°C for 5 min. The precipitate was resuspended in sonication buffer (20 mM Tris-HCl pH 8.0, 150 mM NaCl, 2 mM EDTA pH 8.0, 0.1% SDS and 1% Triton X-100, protease inhibitor) and then sonicated for 10 cycles on a Misonix 3000 sonicator, 30 seconds on ice (18–21 W) per cycle, with 60 seconds on ice between cycles. The sonicated lysate was clarified once by centrifugation at 16,000 rcf. at 4°C for 10 min. The input material was retained, and the residue was incubated overnight at 4°C with magnetic beads containing CDK7 Bethyl A300-405A antibody to enrich the DNA fragments bound by CDK7.Wash the beads twice with each of the following buffers: Wash Buffer A (50 mM HEPES-KOH pH 7.5, 140 mM NaCl, 1 mM EDTA pH 8.0, 0.1% Na-deoxycholate, 1% Triton X-100, 0.1% SDS); Wash Buffer B (50 mM HEPES-KOH pH 7.9, 500 mM NaCl, 1 mM EDTA pH 8.0, 0.1% Na-deoxycholate, 1% Triton X-100, 0.1% SDS); Wash Buffer C (20 mM Tris-HCl pH 8.0, 250 mM LiCl, 1 mM EDTA pH 8.0, 0.5% Na-deoxycholate, 0.5% IGEPAL C-630, 0.1% SDS); Wash Buffer D (TE buffer containing 0.2% Triton X-100) and TE buffer. DNA was eluted from the beads by intermittent vortexing in elution buffer (50 mM Tris-HCl pH 8.0, 10 mM EDTA, 1% SDS) at 65°C for 1 h. Crosslinking was reversed overnight at 65°C. To purify the eluted DNA, 200 mL of TE buffer was added, and RNA was degraded by adding 2.5 mL of 33 mg / mL RNase A (Sigma, R4642) and incubating at 37°C for 2 h. Proteins were degraded by adding 10 mL of 20 mg / mL proteinase K (Invitrogen, 25530049) and incubating at 55°C for 2 h. Phenol:chloroform:isoamyl alcohol extraction was performed, followed by ethanol precipitation. The DNA was then resuspended in 50 mL of TE buffer and used for sequencing. ChIP libraries were prepared using the Swift Biosciences Accel-NGS 2S Plus DNA Library Kit according to the kit instructions. After library preparation, the ChIP library was run on a 2% gel on a PippinHT with a size-collection window of 200–600 bases. The final library was quantified by qPCR using the KAPA Library Quantification Kit from Roche, and 40 bases were sequenced in single-read mode on an Illumina HiSeq 2500.
[0402] HCT116 cells were grown to 80% confluence in complete DMEM medium, followed by treatment with JQ1 or DMSO for 24 hours, and then permeabilized (using a 1:1000 solution of tx100 in PBS in the medium at 37°C for 10 minutes), and then treated with DMF or cisplatin for 6 hours. Cells were cross-linked with 1% formaldehyde in PBS for 15 minutes, followed by quenching on ice with glycine to a final concentration of 125 mM. Cells were washed with cold PBS and harvested by scraping off cells from the cold PBS. The collected cells were precipitated at 1000 g for 3 minutes at 4°C, rapidly frozen in liquid nitrogen, and stored at 80°C. All buffers contained freshly prepared complete protease inhibitors (Roche, 11873580001). Frozen cross-linked cells were thawed on ice and then resuspended in lysis buffer I (50 mM HEPES-KOH (pH 7.5), 140 mM NaCl, 1 mM EDTA, 10% glycerol, 0.5% NP-40, 0.25% Triton X-100, protease inhibitor) and rotated at 4°C for 10 min, followed by rotation at 1350 rcf. at 4°C for 5 min. The pellet was resuspended in lysis buffer II (10 mM Tris-HCl (pH 8.0), 200 mM NaCl, 1 mM EDTA, 0.5 mM EGTA, protease inhibitor) and then sonicated for 10 cycles on a Misonix 3000 sonicator, 30 seconds on ice (18–21 W) per cycle, with 60 seconds on ice between cycles. The sonicated lysate was clarified once by centrifugation at 16,000 rcf. at 4°C for 10 min. The input material was retained, and the residue was incubated overnight at 4°C with magnetic beads containing CDK7 Bethyl A300-405A antibody to enrich the DNA fragments bound by CDK7.Wash the beads twice with each of the following buffers: Wash Buffer A (50 mM HEPES-KOH pH 7.5, 140 mM NaCl, 1 mM EDTA pH 8.0, 0.1% Na-deoxycholate, 1% Triton X-100, 0.1% SDS); Wash Buffer B (50 mM HEPES-KOH pH 7.9, 500 mM NaCl, 1 mM EDTA pH 8.0, 0.1% Na-deoxycholate, 1% Triton X-100, 0.1% SDS); Wash Buffer C (20 mM Tris-HCl pH 8.0, 250 mM LiCl, 1 mM EDTA pH 8.0, 0.5% Na-deoxycholate, 0.5% IGEPAL C-630, 0.1% SDS); Wash Buffer D (TE buffer containing 0.2% Triton X-100) and TE buffer. DNA was eluted from the beads by intermittent vortexing in elution buffer (50 mM Tris-HCl pH 8.0, 10 mM EDTA, 1% SDS) at 65°C for 1 h. Crosslinking was reversed overnight at 65°C. To purify the eluted DNA, 200 mL of TE buffer was added, and RNA was degraded by adding 2.5 mL of 33 mg / mL RNase A (Sigma, R4642) and incubating at 37°C for 2 h. Proteins were degraded by adding 10 mL of 20 mg / mL proteinase K (Invitrogen, 25530049) and incubating at 55°C for 2 h. Phenol:chloroform:isoamyl alcohol extraction was performed, followed by ethanol precipitation. The DNA was then resuspended in 50 mL of TE buffer and used for sequencing. ChIP libraries were prepared using the Swift Biosciences Accel-NGS 2S Plus DNA Library Kit according to the kit instructions. After library preparation, the ChIP library was run on a 2% gel on a PippinHT with a size-collection window of 200–600 bases. The final library was quantified by qPCR using the KAPA Library Quantification Kit from Roche, and 40 bases were sequenced in single-read mode on an Illumina HiSeq 2500.
[0403] HCT116 cells were grown to 80% confluence in complete DMEM medium, followed by treatment with JQ1 or DMSO for 24 hours, and then permeabilized (using a 1:1000 solution of tx100 in PBS in the medium at 37°C for 10 minutes), and then treated with DMF or cisplatin for 6 hours. Cells were cross-linked with 1% formaldehyde in PBS for 15 minutes, followed by quenching on ice with glycine to a final concentration of 125 mM. Cells were washed with cold PBS and harvested by scraping off cells from the cold PBS. The collected cells were precipitated at 1000 g for 3 minutes at 4°C, rapidly frozen in liquid nitrogen, and stored at 80°C. All buffers contained freshly prepared complete protease inhibitors (Roche, 11873580001). Frozen cross-linked cells were thawed on ice and then resuspended in lysis buffer I (50 mM HEPES-KOH (pH 7.5), 140 mM NaCl, 1 mM EDTA, 10% glycerol, 0.5% NP-40, 0.25% Triton X-100, protease inhibitor) and rotated at 4°C for 10 min, followed by rotation at 1350 rcf. at 4°C for 5 min. The precipitate was resuspended in lysis buffer II (10 mM Tris-HCl (pH 8.0), 200 mM NaCl, 1 mM EDTA, 0.5 mM EGTA, protease inhibitor) and rotated at 4°C for 10 min, followed by rotation at 1350 rcf. at 4°C for 5 min. The precipitate was resuspended in sonication buffer (20 mM Hepes pH 7.5, 140 mM NaCl, 1 mM EDTA, 1 mM EGTA, 1% Triton X-100, 0.1% Na-deoxycholate, 0.1% SDS, protease inhibitor) and then sonicated for 10 cycles on a Misonix 3000 sonicator, 30 seconds on ice (18–21 W) per cycle, with 60 seconds on ice between cycles. The sonicated lysate was clarified once by centrifugation at 16,000 rcf. at 4°C for 10 min. The input material was retained, and the residue was incubated overnight at 4°C with magnetic beads bound to MED1 antibody (BethylA300-793A) to enrich DNA fragments bound to MED1.Wash the beads with each of the following buffers: twice with sonication buffer (20 mM Hepes pH 7.5, 140 mM NaCl, 1 mM EDTA, 1 mM EGTA, 1% Triton X-100, 0.1% Na-deoxycholate, 0.1% SDS), once with a high-salt sonication buffer (20 mM Hepes pH 7.5, 500 mM NaCl, 1 mM EDTA, 1 mM EGTA, 1% Triton X-100, 0.1% Na-deoxycholate, 0.1% SDS), once with LiCl wash buffer (20 mM Tris pH 8.0, 1 mM EDTA, 250 mM LiCl, 0.5% NP-40, 0.5% Na-deoxycholate), and once with TE buffer. Separately wash with elution buffer (50 mM Tris-HCl pH 8.0, 10 mM... DNA was eluted from the beads by incubation at 65°C for 15 minutes with stirring in EDTA (1% SDS). Crosslinking was reversed at 65°C for 12 hours. To purify the eluted DNA, 200 mL of TE buffer was added, and RNA was then degraded by adding 2.5 mL of 33 mg / mL RNase A (Sigma, R4642) and incubating at 37°C for 2 hours. Proteins were degraded by adding 4 μL of 20 mg / mL proteinase K (Invitrogen, 25530049) and incubating at 55°C for 30 minutes. DNA was purified using a Qiagen PCR purification kit, eluted in 30 μL of buffer EB, and used for sequencing. Sequencing was performed using Swift Biosciences Accel-NGS 2S Plus according to the kit instructions. ChIP libraries were prepared using a DNA library preparation kit. After library preparation, the ChIP libraries were run on a 2% gel on a PippinHT with a size-collection window of 200–400 bases. The final libraries were quantified by qPCR using the KAPA Library Quantification Kit from Roche, and 50 bases were sequenced in single-read mode on an Illumina HiSeq 2500.
[0404] ChIP-Seq data were aligned to the mm9 version of the mouse reference genome using bowtie with parameters –k 1 –m 1 –best and –l set to read length. Wiggle files were created using MACS with parameters –w –S –space = 50, –nomodel –shiftsize = 200 to display read coverage by bin, and the read counts for each bin were normalized to millions of mapped reads for wiggle file creation. Wiggle files normalized per million reads were displayed in the UCSC Genome Browser. For ER, MED1, BRD4, and H3K9me3 ChIP-Seq in MCF7 cells, publicly available datasets (GEO GSE60270, GSM1348516, and GSM945857, respectively) were used.
[0405] Purification of CDK8-Mediator
[0406] The CDK8-mediator sample was purified as described in (55). Prior to affinity purification, the P0.5M / QFT fraction was aggregated to 12 mg / mL by ammonium sulfate precipitation (35%). The precipitate was resuspended in a pH 7.9 buffer containing 20 mM KCl, 20 mM HEPES, 0.1 mM EDTA, 2 mM MgCl2, and 20% glycerol, and then dialyzed against a pH 7.9 buffer containing 0.15 M KCl, 20 mM HEPES, 0.1 mM EDTA, 20% glycerol, and 0.02% NP-40 prior to the affinity purification step. Affinity purification was performed as described, with the eluted material loaded into a 2.2 mL centrifuge tube containing 2 mL of 0.15 M KCl HEMG (20 mM HEPES, 0.1 mM EDTA, 2 mM MgCl2, and 10% glycerol) and centrifuged at 50 K RPM for 4 h at 4 °C. This is used to remove excess free GST-SREBP and aggregate CDK8-mediators in the final fraction. Prior to droplet assays, purified CDK8-mediators were aggregated using a Microcon-30kDa centrifugal filtration unit with an Ultracel-30 membrane (Millipore MRCF0R030) to obtain a 300 nM mediator complex. The aggregated CDK8-mediators were added to the droplet assay to a final concentration of 200 nM. The droplet reaction contained 10% PEG-8000 and 125 mM salt.
[0407] Immunofluorescence using RNA FISH
[0408] Cells were seeded on coverslips and grown for 24 hours, then fixed for 10 minutes with 4% paraformaldehyde (PFA) (VWR, BT140770) in PBS. After washing the cells three times in PBS, the coverslips were placed in a humidified chamber or stored in PBS at 4°C. Cells were permeabilized for 10 minutes with 0.5% Triton X-100 (Sigma Aldrich, X100) in PBS, followed by three washes with PBS. Cells were blocked for 30 minutes with 4% IgG-free bovine serum albumin (BSA) (VWR, 102643-516), and the primary antibody was added to PBS at a concentration of 1:500 for 4–16 hours. Cells were washed three times with PBS, then incubated in PBS for 1 hour with the secondary antibody at a concentration of 1:5000. After washing twice with PBS, cells were fixed for 10 minutes with 4% paraformaldehyde (PFA) (VWR, BT140770) in PBS. After washing twice with PBS, cells were incubated for 5 minutes with wash buffer A (20% Stellaris RNA FISH wash buffer A (Biosearch Technologies, Inc., SMF-WA1-60) and 10% deionized formamide (EMD Millipore, S4117) in RNase-free water (Life Technologies, AM9932). A 12.5 mM RNA probe (Stellaris) in hybridization buffer (90% Stellaris RNA FISH hybridization buffer (Biosearch Technologies, SMF-HB1-10) and 10% deionized formamide) was added to the cells and incubated overnight at 37°C. After washing with wash buffer A for 30 minutes at 37°C, the nuclei were stained with 20 mm / mL Hoechst 33258 (Life Technologies, H3569) for 5 minutes, followed by washing with wash buffer B (Biosearch Technologies, SMF-WB1-20) for 5 minutes. The cells were washed once in water and then stained with Vectashield... (VWR, 101098-042) Secure the coverslip to the glass slide and seal it with nail polish (Electron Microscopy Science Nm, 72180). Images were acquired using a 100x objective lens on an RPI Spinning Disk confocal microscope with MetaMorph acquisition software and a Hammatsu ORCA-ER CCD camera (WMKeck Microscopy Facility, MIT).Use Fiji Is Just ImageJ (FIJI) for post-processing of images.
[0409] RNA FISH Image Analysis
[0410] To analyze RNA FISH using immunofluorescence, a custom Python script was written to process and analyze 3D image data collected in the FISH and immunofluorescence channels. The FISH focus was automatically invoked using the scipy ndimage package. Then, the ndimage find_objects function was used to retrieve consecutive FISH focuses from the 3D images. These FISH focuses were then filtered according to various criteria, including size and maximum value. z Circularity of the projection (circularity == 4) rr Area and perimeter 2; 0.7 (circularity = 4π) Area perimeter 2; 0.7) and present in the cell nucleus (determined by nuclear masking). Then the FISH focus is concentrated on the 3D box (length dimension ( The immunofluorescence signals of each FISH and immunofluorescence pair were then combined, with the FISH focus centered, and the average intensity projection was calculated to provide the FISH focus centered. l × l The average data of immunofluorescence signal intensity within the squares. As a control, the same processing was performed on immunofluorescence signals centered at the same number of randomly selected nucleus locations. These average intensity values were then used to project and generate 2D contour plots of the signal intensity. The contour plots were generated using the matplotlib Python package. For the contour plots, the intensity-color range presented was customized over a linear range of colors. n =15). For the FISH channel, black to magenta was used. For the immunofluorescence channel, chroma.js (an online color generator) was used to generate colors across 15 bins, with key transition colors selected as black, blue-purple, medium blue, and gray. This was done to ensure that the reader's eye could more easily detect signal contrast. The generated color maps were used for 15 evenly spaced intensity bins across all immunofluorescence maps. The same color scale was used to plot the average immunofluorescence centered on either the FISH or randomly selected nucleus location, and settings were configured to include the minimum and maximum signals from each map.
[0411] Immunofluorescence was performed after cisplatin treatment.
[0412] HCT116 cells were seeded at 50 k cells per well in 24-well plates, yielding 100 k cells after 21 hours (HCT doubling time). Cells were permeabilized for 12 minutes at 37°C using a solution of Tx100 in PBS at 0.55 pmol / cell. Cells were then washed with 500 μL of PBS and treated with 50 μM cisplatin in PBS for 6 hours. After 6 hours, cells were washed once with room temperature PBS and fixed with 4% formaldehyde in PBS in 500 μL at room temperature for 12 minutes. Cells were then washed three more times with PBS. Coverslips were placed in a humidified chamber or stored in PBS at 4°C. Cells were permeabilized for 10 minutes using 0.5% Triton X-100 (Sigma Aldrich, X100) in PBS, followed by three washes with PBS. Cells were blocked for 30 minutes with 4% IgG-free bovine serum albumin (BSA) (VWR, 102643-516), and the primary antibody was added to PBS at a concentration of 1:500 for 4–16 hours. Cells were washed three times with PBS, followed by incubation in PBS for 1 hour with the secondary antibody at a concentration of 1:5000. Samples were washed in PBS, stained with DNA for 5 minutes using a 20 μm / mL Hoechst 33258 (Life Technologies, H3569) and fixed with a Vectashield (VWR, 101098-042). Images were acquired using a 100x objective lens on an RPI Spinning Disk confocal microscope with MetaMorph acquisition software and a Hammamatsu ORCA-ER CCD camera (WMKeck Microscopy Facility, MIT). Post-processing of images was performed using Fiji Is Just ImageJ (FIJI).
[0413] Cisplatin / condensate co-IF
[0414] To analyze co-immunofluorescence data, a custom Python script was written to process and analyze 3D image data from the IF and DAPI channels. Nuclei were detected using triangular thresholding, and nuclear masking was applied to the IF channels. A manual minimum threshold was applied to channel 488 to identify nuclear spots for proteins of interest (MED1, HP1a, or FIB1). Triangular thresholding was applied to channel 561 to identify nuclear spots for cisplatin. The percentage of cisplatin overlap was calculated by dividing the number of identified nuclear cisplatin spots overlapping with the protein of interest spots by the total number of nuclear cisplatin spots.
[0415] Cisplatin-seq analysis
[0416] From www.ncbi.nlm.nih.gov / sra / SRX1962532[accn] (Sequencing run ID SRR3933212) 41 Download the cisplatin-seq fastq file for cells treated for 24 hours (rep1). Use Bowtie2 to align the readings with the constructed human genome hg19 (GRCh37) to obtain the alignment .bam file. 56 Using the ROSE algorithm () 47, 57 H3k27Ac chip-seq readings from HELA cells were used to recall super enhancers. Super enhancers were separated from typical enhancers using a super enhancer table output via the ROSE algorithm. Typical enhancers were further decomposed by their H3k27Ac signals. The last decimates of enhancers were extracted based on H3k27Ac to obtain enhancers of the low H3k27Ac category. Each category of enhancers (super enhancers, typical enhancers, and low H3k27ac signal enhancers) was decomposed into their components, and components overlapping with blacklisted regions were excluded. The blacklisted regions were downloaded from the ENCODE file www.encodeproject.org / files / ENCFF001TDO / . Each enhancer component was then extended 2kb at either end. The 24-hour processed cisplatin-seq readings were mapped to each of the three categories of 2kb extended enhancers using the bamToGFF.py script. For each enhancer category, the component region and flanking region were divided into 50 equal-sized bins, and readings in each bin were counted. A meta-plot is generated using the average reading counts for each bin in all reinforcing subcomponents and flanking regions.
[0417] Live-cell imaging after cisplatin treatment
[0418] HCT116 cells with specified GFP knock-in were seeded at 35kJ per well on 8-well glass slides. After incubation overnight at 37°C, the cells were treated with 50 μM cisplatin in a 1:1000 dilution of DMEM or DMSO for 12 h. Prior to imaging, the cells were additionally treated with a 1:5000 dilution of Hoechst 33342 to stain DNA and with 2 μM propidium iodide to stain dead cells. For quantitative datasets of GFP-labeled MED1, HP1, or FIB1 cells in HCT116 cells, the cells were imaged at 100X magnification using an Andor confocal microscope. For representative images of each of the six labeled lines treated with the medium or 50 μM cisplatin, the cells were imaged at 37°C using a 63x objective lens on a Zeiss LSM880 confocal microscope with an Airyscan detector.
[0419] Agglomerate score analysis
[0420] use scikit-image , open-cv and scipy-ndimage This Python package segments cell nuclei from processed cell images using a custom Python script. It segments cell nuclei through median filtering and thresholding, separates them using a watershed algorithm, and further... scikit image tagging Functions are labeled. For each cell nucleus, if z-stacking is obtained, the GFP channels (corresponding to MED1, HP1) are labeled. The fluorescence signal in (or FIB1) is the maximum projected signal. Then, a gray-level co-occurrence matrix (GLCM) is generated from the projected signal, and the 'correlated' texture properties from the GLCM are calculated for each cell nucleus. GraphPad Prism version 8.2.0 for Mac is used. www.graphpad.com A one-way ANOVA was performed on the correlation values for each condition, followed by a Sidak multiple comparison test. Finally, to derive the cohesion score, these values were subtracted from 1.
[0421] FRAP in HCT116 mEGFP-labeled cell lines
[0422] FRAP was performed using a 488nm laser on an Andor confocal microscope. 100% laser power was used. r 漂白 ≈ 1 um Bleaching was performed within a specified range, and images were collected every two seconds. Fluorescence intensity was measured using FIJI. Background intensity was subtracted, and values relative to the pre-bleaching time points were reported. For each cell line and condition, the FRAP recovery data after bleaching were averaged across seven replicates.
[0423] The fractionation was determined by spectrophotometry and quantitative phase microscopy.
[0424] Deriving the expression for the drug partition coefficient in agglomerates
[0425] Here, based on quantities that are easily measured experimentally, an expression for the partition coefficient of customer molecules in the cond...
Claims
1. A method of characterizing a first agent, the method comprising: (i) contacting the first agent with a composition comprising a condensate, wherein the condensate comprises a second agent prior to contact with the first agent, and (ii) measuring the ability of the first agent to evict the second agent from the condensate; wherein eviction of the second agent from the condensate characterizes the first agent as having one or more of the following properties: (a) the first agent has a higher affinity for a component of the condensate than the second agent; (b) the first agent has a similar or higher condensate partitioning property than the second agent; or (c) the first agent and the second agent have similar structures; wherein the condensate is a phase-separated multi-molecular assembly selected from the group consisting of a transcription condensate, a super-enhancer condensate, a splice speck condensate, a heterochromatin condensate, a nucleolus, a chromatin condensate, a polycomb condensate, and a DNA damage repair condensate; and wherein the first agent and the second agent are both small molecules.
2. The method of claim 1, wherein the first agent and / or the second agent comprises a detectable tag.
3. The method of claim 2, wherein the detectable tag is a fluorescent tag.
4. The method of claim 2, wherein the detectable tag does not affect the condensate partitioning property of the first agent and / or the second agent.
5. The method of any one of claims 1-4, wherein the condensate comprises a target component of the second agent.
6. The method of any one of claims 1-4, wherein the condensate does not comprise a target component of the second agent.
7. The method of any one of claims 1-4, wherein the first agent is an isomer of the second agent.
8. The method of any one of claims 1-4, wherein the composition comprising a condensate is a cellular composition comprising a condensate within a cell.
9. The method of any one of claims 1-4, wherein the composition comprising a condensate does not comprise a cell.
10. The method of any one of claims 1-4, wherein the ability of the first agent to evict the second agent from the condensate is measured by the amount of second agent remaining in the condensate after contacting the composition with the first agent.
11. The method of any one of claims 1-4, wherein the ability of the first agent to evict the second agent from the condensate is measured by the amount of second agent outside of the condensate after contacting the composition with the first agent.
12. The method of any one of claims 1-4, wherein the ability of the first agent to evict the second agent from the condensate is measured by the ratio of second agent inside and outside of the condensate after contacting the composition with the first agent.
13. The method of any one of claims 1-4, wherein the ability of the first agent to evict the second agent from the condensate comprises use of a technique selected from one or more of the following: Raman spectroscopy, spectrophotometry, mass spectrometry, nuclear magnetic resonance, chromatography, quantitative phase microscopy, fluorescence microscopy, and a sedimentation assay.
14. The method of any one of claims 1-4, wherein the composition is contacted with increasing amounts of the first agent, and eviction of the second agent from the condensate is measured continuously or at discrete intervals.
15. The method of any one of claims 1-4, wherein the component of the condensate is a transcription condensate component, a heterochromatin condensate component, a condensate component physically associated with mRNA initiation, or a condensate component physically associated with mRNA elongation.
16. The method of any one of claims 1-4, wherein the component of the condensate is a mediator, a mediator component, MED1, BRD4, POL II, SRSF2, FIB1, NPM1, or HP1a.
17. The method of any one of claims 1-4, wherein the component of the condensate comprises an intrinsically disordered region (IDR).
18. The method of any one of claims 2-4, wherein the component of the condensate comprises a detectable tag that is different from the first agent and / or the second agent.
19. The method of claim 1, wherein the first agent is capable of binding a target.
20. The method of claim 19, wherein the target is genomic DNA or a protein.
21. The method of claim 19, wherein the condensate does not comprise the target.
22. The method of claim 19, wherein the target is predominantly present outside the condensate.
23. The method of claim 19, wherein the target is predominantly present in the condensate.
24. The method of any one of claims 19-23, wherein the target is a therapeutic target.
25. The method of any one of claims 19-23, wherein the target is an enzyme, a receptor, a ligand, an oncogene, an oncogene product, or a transcription factor.
26. The method of any one of claims 19-23, wherein the composition comprises the target.
27. The method of any one of claims 1-4, wherein the condensate is physically associated with DNA.
28. The method of claim 8, wherein the cell is a diseased cell.
29. The method of claim 9, wherein the cell is a diseased cell.
30. The method of claim 28 or 29, wherein the diseased cell is a cancer cell.
31. The method of any one of claims 1-4, wherein the first agent and / or the second agent is a chemotherapeutic agent.
32. The method of any one of claims 1-4, wherein the first agent and / or the second agent is a candidate chemotherapeutic agent.
Citation Information
Patent Citations
Electrical measuring instrument
CA155258A
Sawing machine
CA213333A
Super-enhancers and methods of use thereof
US20140287932A1
Mediator and cohesin connect gene expression and chromatin architecture
WO2011100374A2
Inhibitors of cyclin-dependent kinase 7 (CDK7)
WO2014063068A1