Method for enhancing the transcription level of amino acid synthesis genes to improve the fermentation level of TG enzyme

Abstract

The present invention discloses a method for enhancing the transcription level of amino acid synthesis genes to improve the fermentation level of TG enzyme, which is to obtain a mutant strain with high TG enzyme production by over-expressing genes in the synthesis pathways of endogenous proline, histidine, aromatic amino acids, and arginine using its own promoter in Streptomyces pulmonaria IPIO. The present invention enhances the synthesis of proline, histidine, aromatic amino acids, and arginine synthesis genes by enhancing the transcription level of these amino acids, increases the amino acid supply in the TG enzyme synthesis process, and thereby improves the fermentation level of glutamine transaminase. The fermentation yield of glutamine transaminase of the engineered strains WD15, WD18, WD19, and WD22 obtained by the present invention is 22%, 50%, 48%, and 13% higher than that of the control strain at the laboratory shake flask level, respectively.

Description

Technical Field

[0001] The present invention belongs to the field of bioengineering technology and relates to a method for enhancing the transcription level of amino acid synthesis genes to improve the fermentation level of TG enzyme, specifically a method for enhancing the synthesis of proline, histidine, aromatic amino acids and arginine to improve the fermentation level of glutamine transaminase. Background Art

[0002] Transglutaminase (TGase) is a single-subunit protein produced by Streptomyces mobaraensis, which can catalyze the amidotransfer reaction between the γ-amide group of glutamine residues in proteins and the ε-amino group of lysine to form an isopeptide bond of ε-(γ-glutamine)-lysine, thereby changing the functional properties of proteins. It is widely used in food industry protein products, edible additives, cross-linked antibodies and drug molecules to produce antibody-coupled drugs, improve the strength of wool textiles, etc. The market demand is increasing year by year, but the current enzyme production is still low and needs to be further improved. Amino acids are precursors for the synthesis of TG enzyme. The present invention finds that in the process of TG enzyme production by Streptomyces mobaraensis, the intracellular proline, histidine, aromatic amino acids and arginine contents are relatively low. By overexpressing genes in the proline, histidine, aromatic amino acids and arginine synthesis pathways, the synthesis of these amino acids is enhanced, thereby increasing the yield of TG enzyme. Furthermore, the present invention, through genomic information, identified the proline biosynthesis genes SMDS_4329-SMDS_4331, histidine biosynthesis genes SMDS_4883-SMDS_4890, aromatic amino acid biosynthesis genes SMDS_5474-SMDS_5478, and arginine biosynthesis genes SMDS_5364-SMDS_5368 and SMDS_5394-SMDS_5395. Enhancing the expression of amino acid biosynthesis genes can enhance amino acid synthesis, thereby increasing the amino acid supply during the TG enzyme synthesis process and ultimately increasing the production of transglutaminase. Summary of the Invention

[0003] The present invention aims to provide a method for enhancing the transcription level of amino acid synthesis genes to improve the fermentation level of TG enzyme, specifically a method for enhancing the transcription level of proline, histidine, aromatic amino acid, and arginine synthesis genes to improve the fermentation level of glutamine transaminase. The method comprises overexpressing endogenous proline synthesis genes SMDS_4329-SMDS_4331, histidine synthesis genes SMDS_4883-SMDS_4890, aromatic amino acid synthesis genes SMDS_5474-SMDS_5478, and arginine synthesis genes SMDS_5364-SMDS_5368 and SMDS_5394-SMDS_5395 in Streptomyces moyuanensis IPIO using their own promoters, thereby enhancing the synthesis of proline, histidine, aromatic amino acids, and arginine, respectively, and ultimately significantly improving the production of glutamine transaminase.

[0004] To achieve the above objectives, the present invention provides the following technical solutions:

[0005] In a first aspect, the present invention provides a TGase high-yielding strain obtained by enhancing the transcription level of amino acid synthesis genes, wherein genes in the proline, histidine, aromatic amino acid or arginine synthesis pathway of the strain are overexpressed.

[0006] As an embodiment of the present invention, the strain is Streptomyces moyuanensis.

[0007] As one embodiment of the present invention, the strain overexpresses endogenous amino acid synthesis encoding genes.

[0008] As one embodiment of the present invention, the endogenous proline synthesis genes SMDS_4329-SMDS_4331, histidine synthesis genes SMDS_4883-SMDS_4890, aromatic amino acid synthesis genes SMDS_5474-SMDS_5478, and arginine synthesis genes SMDS_5364-SMDS_5368 and SMDS_5394-SMDS_5395 are overexpressed in Streptomyces moyuanensis IPIO, thereby enhancing the synthesis of proline, histidine, aromatic amino acids, and arginine, respectively, and ultimately significantly increasing the production of glutamine transaminase.

[0009] In a second aspect, the present invention relates to an integrative plasmid vector for overexpressing amino acid synthesis genes, wherein the vectors respectively contain the proline synthesis genes SMDS_4329-SMDS_4331 and their promoters P from Streptomyces moyuanensis IPIO. proB , histidine synthesis genes SMDS_4883-SMDS_4890 and their promoters P hisD , aromatic amino acid synthesis genes SMDS_5474-SMDS_5478 and their promoters ParoE , or arginine synthesis genes SMDS_5364-SMDS_5368 and SMDS_5394-SMDS_5395 and their promoters P 5364 and P 5394 .

[0010] As one embodiment of the present invention, the amino acid synthesis gene is derived from Streptomyces moyuanensis IPIO.

[0011] As an embodiment of the present invention, the proline synthesis gene and its promoter are SMDS_4329-SMDS_4331 and P shown in SEQ ID NO.1-NO.4. proB The histidine synthesis gene and its promoter are SMDS_4883-SMDS_4890 and P shown in SEQ ID NO.5-NO.13. hisD The aromatic amino acid synthesis gene and its promoter are SMDS_5474-SMDS_5478 and P shown in SEQ ID NO.14-NO.19. aroE The arginine synthesis gene and its promoter are SMDS_5364-SMDS_5368 and SMDS_5394-SMDS_5395 shown in SEQ ID NO.20-NO.28 and P 5364 and P 5394 .

[0012] As one embodiment of the present invention, the overexpression is homologous overexpression.

[0013] In a third aspect, the present invention relates to a method for constructing an integrative plasmid vector for overexpressing amino acid synthesis genes, the plasmid construction method comprising the following steps:

[0014] The 3661 bp P proB The PCR fragments of the SMDS_4329-SMDS_4331 gene sequences were ligated into the XbaI / EcoRI sites of the integrative plasmid pSET152 by enzyme digestion and ligation to obtain the integrative plasmid vector pLQ1766;

[0015] Alternatively, a 5760 bp P was obtained by PCR amplification. hisD The PCR fragments of the SMDS_4883-SMDS_4890 gene sequences were connected into the XbaI / EcoRI sites of the integrative plasmid pSET152 by Gibson ligation to obtain the integrative plasmid vector pLQ1769;

[0016] Alternatively, a 4773 bp P was obtained by PCR amplification. aroEThe PCR fragments of the SMDS_5474-SMDS_5478 gene sequences were ligated into the XbaI / EcoRI sites of the integrative plasmid pSET152 by Gibson ligation to obtain the integrative plasmid vector pLQ1770;

[0017] Or 4771bp P was obtained by PCR amplification 5364 The PCR fragment of SMDS_5364-SMDS_5368 gene sequence was amplified with the 3255 bp P- 5394 The PCR fragments of the SMDS_5394-SMDS_5395 gene sequences were connected into the XbaI / SpeI sites of the integrative plasmid pSET152 by enzyme digestion and ligation to obtain the integrative plasmid vector pLQ1772.

[0018] As one embodiment of the present invention, the primers used for the amplification are primers Pro-F / R as shown in SEQ ID NO.28 / 29, primers His-F / R as shown in SEQ ID NO.30 / 31, primers SA-F / R as shown in SEQ ID NO.32 / 33, and primers Arg-F1 / R1 and Arg-F2 / R2 as shown in SEQ ID NO.34 / 35-NO.36 / 37.

[0019] In a fourth aspect, the present invention relates to a Maoyuan Streptomyces strain that produces high transglutaminase, and the strain is obtained by introducing the aforementioned integrative plasmid vector, or the integrative plasmid vector constructed by the aforementioned method, into the recipient fungus Maoyuan Streptomyces for recombination.

[0020] As an embodiment of the present invention, the recombination is site-specific recombination.

[0021] As an embodiment of the present invention, after the recombination, the step of obtaining a recombinant mutant strain with overexpression of the gene by resistance and PCR verification screening is also included.

[0022] In a fifth aspect, the present invention relates to a method for increasing the production of transglutaminase, by enhancing the transcription level of proline, histidine, aromatic amino acid or arginine synthesis genes to enhance the synthesis of corresponding amino acids and increase the supply of amino acids in the TG enzyme synthesis process, thereby ultimately increasing the production of transglutaminase produced by Maoyuan Streptomyces fermentation.

[0023] As one embodiment of the present invention, the amino acid synthesis gene is derived from Streptomyces moyuanensis IPIO.

[0024] As one embodiment of the present invention, the proline synthesis gene is SMDS_4329-SMDS_4331 as shown in SEQ ID NO.1-NO.3; the histidine synthesis gene is SMDS_4883-SMDS_4890 as shown in SEQ ID NO.4-NO.12; the aromatic amino acid synthesis gene and its promoter are SMDS_5474-SMDS_5478 as shown in SEQ ID NO.14-NO.18; the arginine synthesis gene and its promoter are SMDS_5364-SMDS_5368 and SMDS_5394-SMDS_5395 as shown in SEQ ID NO.20-NO.26.

[0025] As one embodiment of the present invention, endogenous amino acid synthesis genes are overexpressed in Streptomyces truncatum IPIO to obtain overexpression mutants, which are then fermented to produce transglutaminase. As a specific example, the proline synthesis genes SMDS_4329-SMDS_4331, histidine synthesis genes SMDS_4883-SMDS_4890, aromatic amino acid synthesis genes SMDS_5474-SMDS_5478, and arginine synthesis genes SMDS_5364-SMDS_5368 and SMDS_5394-SMDS_5395 derived from Streptomyces truncatum IPIO are overexpressed in Streptomyces truncatum IPIO to obtain overexpression mutants (denoted as WD15, WD18, WD19, and WD22), which are then fermented to produce transglutaminase. By overexpressing endogenous amino acid synthesis genes in Streptomyces truncatum IPIO using their own promoters, amino acid synthesis is enhanced, thereby increasing transglutaminase production.

[0026] In one embodiment of the present invention, the fermentation comprises the following steps: inoculating activated overexpression mutant spores into a seed culture medium, culturing at 30°C and 200-220 rpm for 24 hours, transferring a 10% inoculum into a fermentation medium, and fermenting at 30°C and 200-220 rpm for 28-32 hours; and collecting the fermentation broth and performing enzyme activity assay.

[0027] As a specific example, the fermentation includes the following steps: inoculating the activated overexpression mutant spores into the seed culture medium, culturing at 30°C and 200 rpm for 24 hours, transferring the inoculation amount to the fermentation medium at 10%, and fermenting at 30°C and 200 rpm for 30 hours.

[0028] As one embodiment of the present invention, the seed culture medium includes 1-3% (w / v) glycerol, 0.4-0.8% (w / v) yeast extract, 1-3% (w / v) fish meal peptone, 0.1-0.3% (w / v) MgSO4·7H2O, and 0.1-0.3% (w / v) K2HPO4·3H2O. As a specific example, the seed culture medium includes 2% (w / v) glycerol, 0.6% (w / v) yeast extract, 2.5% (w / v) fish meal peptone, 0.2% (w / v) MgSO4·7H2O, and 0.2% (w / v) K2HPO4·3H2O.

[0029] As one embodiment of the present invention, the fermentation medium includes 1-3% (w / v) glycerol, 0.4-0.8% (w / v) yeast extract, 1-3% (w / v) fish meal peptone, 0.1-0.3% (w / v) MgSO4·7H2O, 0.1-0.3% (w / v) K2HPO4·3H2O, and 0.1-0.4% (w / v) fermentation promoter. As a specific example, the fermentation medium includes 2% (w / v) glycerol, 0.6% (w / v) yeast extract, 2.5% (w / v) fish meal peptone, 0.2% (w / v) MgSO4·7H2O, 0.2% (w / v) K2HPO4·3H2O, and 0.1% (w / v) fermentation promoter.

[0030] The plasmid pSET152 involved in the present invention has been described in the SCI database document "Wilkinson CJ, Hughes-Thomas ZA, Martin CJ, Bohm I, Mironenko T, Deacon M, Wheatcroft M, Wirtz G, Staunton J, Leadlay PF: Increasing the efficiency of heterologous promoters inactinomycetes. J Mol Microbiol Biotechnol 2002, 4(4): 417-426."

[0031] The strain Streptomyces mobaraensis IPIO involved in the present invention was obtained by strain mutagenesis of Taixing Dongsheng Biotechnology Co., Ltd. and deposited in the China Center for Type Culture Collection (CCTCC). The deposit address is: Wuhan University, Wuhan, China; the deposit number is M 2020196, and the deposit date is 2020.6.25.

[0032] Compared with the prior art, the present invention has the following beneficial effects:

[0033] 1) The present invention discovered that during fermentation, Streptomyces moyuanensis IPIO has relatively low levels of proline, histidine, aromatic amino acids, and arginine within its cells, which may be a factor limiting the increase in TG enzyme production. Enhancing the expression of these amino acid synthesis genes can enhance amino acid synthesis and ultimately increase transglutaminase production.

[0034] 2) The present invention further uses the integrative vector pSET152 in Streptomyces moyuanensis IPIO to insert one copy of the proline synthesis genes SMDS_4329-SMDS_4331, histidine synthesis genes SMDS_4883-SMDS_4890, aromatic amino acid synthesis genes SMDS_5474-SMDS_5478, and arginine synthesis genes SMDS_5364-SMDS_5368 and SMDS_5394-SMDS_5395, respectively, from Streptomyces moyuanensis IPIO on the IPIO chromosome. At the laboratory shake flask level, the enzyme activity was increased by 22%, 50%, 48%, and 13%, respectively, compared with the control strain (blank vector integrated strain); the present invention can significantly increase the fermentation yield of TG enzyme, while significantly reducing the fermentation cost. BRIEF DESCRIPTION OF THE DRAWINGS

[0035] Other features, objects and advantages of the present invention will become more apparent upon reading the detailed description of non-limiting embodiments with reference to the following drawings:

[0036] Figure 1 Schematic diagram of the construction of SMDS_4329-SMDS_4331 gene overexpression plasmid;

[0037] Figure 2 Schematic diagram of the construction of SMDS_4883-SMDS_4890 gene overexpression plasmid;

[0038] Figure 3 Schematic diagram of the construction of SMDS_5474-SMDS_5478 gene overexpression plasmid;

[0039] Figure 4 Schematic diagram of the construction of SMDS_5364-SMDS_5368 and SMDS_5394-SMDS_5395 gene overexpression plasmids;

[0040] Figure 5 Schematic diagram of TG enzyme fermentation yield of amino acid synthesis gene enhanced expression mutant strain and control strain;

[0041] Figure 6 Schematic diagram of the corresponding amino acid content in the cells of the amino acid synthesis gene enhanced expression mutant strain and the control strain. DETAILED DESCRIPTION

[0042] The present invention is described in detail below with reference to the examples. The following examples will help those skilled in the art to further understand the present invention, but are not intended to limit the present invention in any form. It should be noted that those skilled in the art may make several adjustments and improvements without departing from the scope of the present invention. These all fall within the scope of protection of the present invention. In the following examples, where no specific experimental conditions are specified, conventional conditions or the manufacturer's recommended conditions are used.

[0043] Example 1

[0044] This example describes a process for preparing mutant strains WD15, WD18, WD19, and WD22 that overexpress the proline synthesis genes SMDS_4329-SMDS_4331, histidine synthesis genes SMDS_4883-SMDS_4890, aromatic amino acid synthesis genes SMDS_5474-SMDS_5478, and arginine synthesis genes SMDS_5364-SMDS_5368 and SMDS_5394-SMDS_5395. The process specifically includes the following steps:

[0045] Step 1: Construction of plasmid pLQ1766: Using the genomic DNA of Streptomyces elegans IPIO as a template, primers Pro-F / R with restriction enzyme sequences introduced at both ends were used to amplify P proB The PCR fragment (3661 bp) of the SMDS_4329-SMDS_4331 gene sequence was inserted into the XbaI / EcoRI site of plasmid pSET152 to obtain plasmid pLQ1766. Figure 1 .

[0046] Step 2: Construction of plasmid pLQ1769: Using the genomic DNA of Streptomyces mogensis IPIO as a template, primers His-F / R that introduced Gibson repeat sequences at both ends were used to amplify P by PCR. hisD The PCR fragment (5760 bp) of the SMDS_4883-SMDS_4890 gene sequence was inserted into the XbaI / EcoRI site of plasmid pSET152 to obtain plasmid pLQ1769. Figure 2 .

[0047] Step 3: Construction of plasmid pLQ1770: Using the genomic DNA of Streptomyces elegans IPIO as a template, primers SA-F / R that introduce Gibson repeat sequences at both ends were used to amplify P by PCR. aroEThe PCR fragment (4773 bp) of the SMDS_5474-SMDS_5478 gene sequence was inserted into the XbaI / EcoRI site of plasmid pSET152 to obtain plasmid pLQ1770. Figure 3 .

[0048] Step 4: Construction of plasmid pLQ1772: Using the genomic DNA of Streptomyces elegans IPIO as a template, primers Arg-F1 / R1 with restriction enzyme sequences introduced at both ends were used to amplify P by PCR. 5364 and SMDS_5364-SMDS_5368 gene sequences (4771 bp); primers Arg-F2 / R2 with restriction enzyme sequences introduced at both ends were used to amplify P 5394 and SMDS_5394-SMDS_5395 gene sequence PCR fragment (3255bp); then connected to the XbaI / SpeI site of the integrative plasmid pSET152 by enzyme digestion and ligation to obtain the integrative plasmid vector pLQ1772, as shown in FIG. Figure 4 .

[0049] *The endonuclease recognition sites (enzyme cutting sites) involved in steps 1 to 4 are as follows:

[0050] XbaI recognition site: EcoRI recognition site: SpeI recognition site:

[0051] 5'...T^CTAGA...3' 5'...G^AATTC...3' 5'...A^CTAGT...3'

[0052] 3'...AGATC^T...5' 3'...CTTAA^G...5' 3'...TGATC^A...5'

[0053] *The primer sequences used in steps 1 to 4 are:

[0054]

[0055]

[0056] *PCR system and conditions used for gene fragment preparation in steps 1 to 4:

[0057] PCR reaction system: 30 ng DNA template, 20 pmol primers, 5 μL 13% DMSO, 10 nmol dNTP, 25 μL buffer, 1 unit Taq DNA polymerase, and make up to 50 μL with purified water;

[0058] PCR conditions: 95°C for 5 min; 95°C for 15 s; 60°C for 15 s; 72°C for 4 min; 30 cycles; 72°C for 10 min.

[0059] Step 5: The overexpression plasmid vectors pLQ1766, pLQ1769, pLQ1770, and pLQ1772 constructed in steps 1 to 4 were respectively introduced into the recipient strain Streptomyces spp. IPIO by conjugation for site-specific recombination, and the correct conjugates were screened by resistance and PCR verification to obtain mutant strains overexpressing the SMDS_4329-SMDS_4331, SMDS_4883-SMDS_4890, SMDS_5474-SMDS_5478, SMDS_5364-SMDS_5368, and SMDS_5394-SMDS_5395 genes. Specifically, the following steps were included:

[0060] The gene overexpression plasmids pLQ1766, pLQ1769, pLQ1770, and pLQ1772 were transformed into the host ET12567 (pUZ8002) respectively. The corresponding ET12567 (pUZ8002) was inoculated into LB containing three antibiotics: Apr (final concentration 50 μg / mL), Kan (final concentration 50 μg / mL), and Chl (final concentration 25 μg / mL), cultured at 37°C for 20 hours, and then rinsed with fresh LB solution to remove the antibiotics in the culture. At the same time, fresh spores of Streptomyces tumefaciens IPIO (activated on solid culture medium for about 7-10 days) were collected in TES solution, heat-shocked at 50°C for 10 minutes, rinsed with LB solution 2 to 3 times, and then mixed with the previously prepared host bacteria ET12567 (pUZ8002) (the ratio of recipient bacteria cells to donor bacteria was about 10). 8 :10 9) was evenly spread onto ISP4MYM solid medium containing 20 mM magnesium ions and incubated upside down at 37°C. After 14-16 hours, the plate was removed and two antibiotics, apramycin (final concentration 50 μg / mL) and trimethoprim (final concentration 50 μg / mL), were added to 1 mL of sterile water, mixed thoroughly, and then overlaid onto the ISP4MYM solid medium. The solid medium was air-dried and transferred to a 30°C incubator for inversion culture. Generally, after 3 to 5 days, conjugates can be seen growing on the plate. They are then transferred to ISP4MYM solid medium containing two antibiotics, apramycin (final concentration 50 μg / mL) and trimethoprim (final concentration 50 μg / mL), and cultured for expansion. Mycelial PCR verification and screening revealed gene-doubling mutants SMDS_4329-SMDS_4331, SMDS_4883-SMDS_4890, SMDS_5474-SMDS_5478, SMDS_5364-SMDS_5368, and SMDS_5394-SMDS_5395, which were designated WD15, WD18, WD19, and WD22, respectively.

[0061] *The primer sequences used in step 5 are:

[0062] Primer name base sequence AA-YZ-F ACCGCATCAGGCGCCATTCG SEQ ID NO.39 Pro-YZ-R GCCGCCGGTGCCGACGCCCG SEQ ID NO.40 His-YZ-R CCGCTCCACGTGCTTCGTCGCG SEQ ID NO.41 SA-YZ-R GGCGCGGGACCAGTCGGCGGT SEQ ID NO.42 Arg-YZ-R CCGGTGCCCGCCCCCGACCC SEQ ID NO.43

[0063] *The PCR system and conditions used in the fifth step to verify and screen mutants:

[0064] PCR system: DNA template 10-100 ng, primer 10 pmol, 13% DMSO 2 μL, 2× Mix buffer 10 μL, add pure water to 20 μL;

[0065] PCR conditions: 95°C for 10 min; 95°C for 30 s; 60°C for 30 s; 72°C for 1 min; 30 cycles; 72°C for 10 min.

[0066] Example 2

[0067] This example describes the fermentation process for producing TG enzyme using mutant strains WD15, WD18, WD19, and WD22 that overexpress amino acid synthesis genes. The specific steps are as follows: Mutants WD15, WD18, WD19, and WD22 were activated by plating on solid ISP4MYM medium. After incubation at 30°C for 7-10 days, spores were scraped from one plate and inoculated into a seed medium. The culture was then incubated at 30°C and 200 rpm for 24 hours. A 10% inoculum was then transferred to a fermentation medium and fermented at 30°C and 200 rpm for 30 hours. The fermentation broth was then collected and assayed for enzyme activity.

[0068] Table 1 Composition of seed culture medium and fermentation medium

[0069]

[0070] Example 3

[0071] This example is a method for detecting the enzyme activity of TG enzyme using colorimetry. Specifically, take 200 μL of fermentation liquid supernatant diluted 10-20 times into a test tube, add 200 μL of water to one tube as a control, add 2 mL of 37°C preheated solution A, react at 37°C for 10 minutes, and then add 2 mL of solution B to terminate the reaction. Use a quartz cuvette to measure the absorbance of the fermentation liquid at 525 nm in a spectrophotometer. Finally, the OD 525 The enzyme activity of TG enzyme was calculated by substituting the formula obtained from the standard curve into the formula.

[0072] The solution preparation method is as follows:

[0073] Solution A: Weigh 9.688 g of tris(hydroxymethyl)aminomethane, 2.780 g of hydroxylamine hydrochloride, 1.229 g of reduced glutathione, and 4.048 g of the substrate N-benzyloxycarbonyl-L-glutamylglycine (N-α-CBZ-GLN-GLY) into a beaker, add 350 mL of water, adjust the pH to 6.0, and dilute to 400 mL with water.

[0074] Solution B: 3 mol / L hydrochloric acid, 12% trichloroacetic acid, and 3% FeCl3 dissolved in 0.1 mol / L HCl. Mix the three solutions in equal amounts.

[0075] Figure 5 Schematic diagram of TGase fermentation yields of mutant strains with enhanced expression of amino acid biosynthesis genes and a control strain. Results showed that in laboratory shake flasks, the yields of mutant strains WD15, WD18, WD19, and WD22 increased by 22%, 50%, 48%, and 13%, respectively, compared to the wild-type strain.

[0076] Figure 6 Schematic diagram of the corresponding amino acid content in the mutants with enhanced expression of amino acid biosynthesis genes and the control strain. The results showed that the intracellular proline, histidine, phenylalanine, tyrosine, and arginine contents of mutants WD15, WD18, WD19, and WD22 were increased by 30%, 26%, and 52%, and 74% and 23%, respectively, compared to the wild-type strain.

[0077] The above describes the specific embodiments of the present invention. It should be understood that the present invention is not limited to the above specific embodiments, and those skilled in the art may make various variations or modifications within the scope of the claims, which do not affect the essence of the present invention. Sequence Listing <110> Shanghai Jiao Tong University <120> Method for enhancing the transcription level of amino acid synthesis genes to improve TG enzyme fermentation level <130> KAG48221 <141> 2021-12-06 <160> 43 <170> SIPOSequenceListing 1.0 <210> 1 <211> 726 <212> DNA <213> Streptomyces mobaraensis IPIO SMDS_4329 <400> 1 atgggcgcgg tcccggtcgt caacgagaac gacacggtgg ccacggacga gatccggttc 60 ggcgacaacg accggctcgc cgccctcgtc gcccacctcg tccgcgccga cctgctcgtc 120 ctcctctccg acgtggacgg cctctacgac ggcgacccca gcaccccggg cacctcgcgg 180 atcgccgagg tcagcgggcc gcaggacctg gaaggcgtct ccatcggcag cgccggcaag 240 gcgggcgtcg gcaccggcgg catggtgacc aaggtcgagg ccgcccggat cgccgccgcc 300 gcgggcatcc cggtcgtcct cacctccgcc agccgcgccg ccgacgccct cctcggccgg 360 cccaccggca ccctcttcca ccgcaccggc cgccgctccg ccgaccggct gctgtggctg 420 gcgcacgcct ccaccccgcg cggcgccctc acgctggacg acggcgcggt gcgcgcggtg 480 gtccggggca ccggctcgct gctgccggcg ggcatcgcgg ccgtcgaggg cgagttcagc 540 gcggggcgacc cggtcgagct gcgggacggc gcggggcccg cggtggcccg cgggctggtg 600 gcctacgacg cggggggagat cccgcagctg ctcggccgct ccccgggga cctggcccgc 660 gagctcgggc ccgagtacga gcgcgaggtc gtgcaccggg acgatctggt cgttctccac 720 ccctga <210> 2 <211> 144 <212> DNA <213> Manufacturer of IPIO(Streptomyces mobaraensis IPIO) SMDS_4330 <400> 2 atgacctcca gacccacgat ctcccagggc ggcagccggg ccgtcgagcg gtgctcgccc cagagccgca gggcgacggc cgccgcgtcg tgcaggtcgc gggcctcctc cagtaccgg 120 atctcggcgt ggtcgttggc gtag 144 <210> 3 <211> 1305 <212> DNA <213> Manufacturer of IPIO(Streptomyces mobaraensis IPIO) SMDS_4331 <400> 3 atgagcagcg acaccctccc gtccagtccc tccggcactc tccccgagtc ccccgtgctc cgtgccgcgg tccgcgcccg taccgccgcc gccgagctcg cgccgctgcc acgcgcggcc 120 aaggacgcgg cgctgctcgc cgtcgcggac gccctggagg cccggaccgc cgacatcgtc 180 gccgccaacg ccgaggacgt cgcgcgggcg cgcgccgccg gcaccgccga gggcgtcgtc 240 gaccggctga cgctcacccc cgagcgggtc ctggccatcg cggcggacgt gcgcagcgtg 300 gccgggctgc ccgacccggt cggcgaggtg gtgcgtggct ccaccctgcc caacggcatc 360 gacctgcggc aggtccgggt gccgctcggc gtcgtcggga tcgtctacga ggcccggccg 420 aacgtgacgg tggacgcggc cgcgctctgc ctgaagtccg gcaacgcggt cctgctgcgc 480 ggctcctcct cggcgtacgc gtcgaacacc gcgctggtgg ccgtcgtccg cgacgcggtg 540 gcgggcgccg ggctgcccgc ggacgccgtg cagctggtgc cgggggagag ccgggagtcc 600 gtgaaggagc tgatgcgcgc ccgcggcctg gtcgacgtgc tgatcccgcg cggcggcgcc 660 tcgctgatcc ggaccgtcgt cgaggagtcc acggtcccgg tgatcgagac gggcaccggc 720 aactgccacg tgtacgtgga cgccgacgcc gatctcggca cggcggtccg ggtgctcgtc 780 aactccaagg cgcaccgcgt cagcgtgtgc aacgccgccg agaccctcct cgtccaccgg 840 gacatcgccg agcgcctgct cccggccgcg ctggacgccc tggcggaggc cggggtgacc 900 gtgcacgccg acgagcgggt gcgggcgctg gccggcggga cgaaggcgac cgtggtgccc 960 gccacggagg aggactgggc gaccgagtac ctctcctacg acatcgcggc cgcggtggtg 1020 gactcgctgg acgacgccgt gcggcacatc cggcagtggt cctccggaca cacggaggcg 1080 atcgtcacca cctcgcagca ggcggcccgc cggttcaccc agctggtgga ttccacgacg 1140 gtcgcggtga acgcgtcgac gcggttcacc gacggcgggc agttcggttt cggcgccgag 1200 atcgggatct ccacgcagaa gctgcacgcg cgggggccga tggggctgcc ggagctcacc 1260 tcgaccaagt acatcgtcac gggcgacggg cacatccggg gctga 1305 <210> 4 <211> 739 <212> DNA <213> Streptomyces mobaraensis IPIO PproB <400> 4 cgcgagtagc gccgcggcct gtacggctcg gcgggggact gttccggcag gcactgggcg 60 ggctcctggc aggagaactg agggatcggg atggaccggg tcggacacgt catgggacaa 120 cggtctggac aacggccgca accgaccgta tgacggccgc tgggccagga gcaatcttcg 180 gtcacggcaa ccgccacaaa atagggtcga acgaccacaa tcgtcaggcg gtagattggc cgtttccagc ggaagacggc aggaccggcg ggcgagagca gaggtgcgga gcacggtgcg 300. ggcagggacg gcggaggaa cggcgaccgg agcggacgg gggatccggc cggaggtcac 360 cggcgcccgc aggatcgtgg tcaaggtggg ctcgtcctct ctcaccaccg cggggcgggggg 420 actggacgcc gaccgggttg acgccctcgt cgacgtcctg gcccgggc tcggcgacac 480 ggcgggcaag gagatcgtcc tcgtctcgtc cggcgccatc gccgccggcc tcgcgccgct 540 gggcctcgac cggcggccga aggacctggc ccgccagcag gccgccgcca gcgtcggcca 600 gggcctgctg gtcgcccgct acaccgcgtc cttcgcccgc tacggccgcc gcgtcgggca 660 ggtgctgctg accaccgacg acaccagccg ccgcgcgcac taccgcaacg cccgccggac 720 cctggaccag ctgctggcc 739 <210> 5 <211> 897 <212> DNA <213> Streptomyces mobaraensis IPIO SMDS_4883 <400> 5 atgaacgtcg tgcccgcgca ggaggccggc gtcgcctcgc tggccgtgtc gtccccgccg 60 cagaaggact tcgggggcct cccgcacccg accatcctcg ccgcctgcgc cctgctcggc 120 gtcgacgagg tgtacgcggc cggcggcgct caggccatcg ccatgttcgc ctacggcacc 180 gacgagtgcc ggcccgccca gctcgtcacc ggccccggca acatctgggt cgccgccgcc 240 aagcggctgc tcaagggccg tatcggcatc gacgccgagg ccggcccgac cgagatcgcg 300 atcctcgccg acgacaccgc cgacgcggcg cacgtcgccg ccgacctgat cagccaggcc 360 gagcacgaca cgctggccgc cgccgtcctc gtcacgccct ccgaggcgct cgccgaggcc 420 gtcgaggccg agctcaagac ccaggtggcc gcgacgaagc acgtggagcg gatcaccgag 480 gcgctggccg gccggcagtc ggggatcgtc ctcgtcgacg acctcgacca gggcctcgcc 540 gtcgtcgacg cctacgccgc cgaacacctg gagatccaga ccgccgacgc ctccgccgtc 600 gccgcccggg tccgcaacgc cggcgccgtc ttcgtcggcc cgtacgcgcc cgtctccctc 660 ggcgactact gcgccggctc caaccacgtc ctgcccaccg gcggctgcgc ctgccactcc 720 tccggcctgt ccgtgcagtc cttcctgcgc ggcatccacg tcgtggacta cagccgcgac 780 gcgctcgccg acgtcaccca ccacgtggtg acgctggcgg aggccgagga tctgccggcg 840 cacggcgcgg cgctcaaggc gcggttcggg tggaaggttc ccggtaagag ctcgtga 897 <210> 6 <211> 762 <212> DNA <213> Streptomyces mobaraensis IPIO SMDS_4884 <400> 6 atgggcttcg agccctcgta ctcgatgcac gcgctgatct cccggggcac cggcaccggc 60 tggctcgccg ggccgcgccg ggacgacttc accatcgacg tggacgcggc ggtcgacgcc 120 atcgccgagc accgccctga cgtcgtcttc gtctgctcgc ccaacaaccc caccggcacc 180 gccgtcgacg cggagaccgt gctgcggctg tacgacgcgg cgcaggcggc caagccgtcg 240 atggtcgtgg tcgacgaggc gtacggcgag ttcagccacc acccgtcgct gctgccgctg 300 atcgagggcc ggccgcacct cgtcgtctcg cggacgatgt ccaaggcgtt cggcgcggcc 360 gggctgcggc tgggctacct cgccgccgac ccggcggtgg tggacgccgt gcagctcgtc 420 cggctgccgt accacctctc gtccgtcacc caggcgaccg ccctcgcggc gctggagcac 480 accgacacgc tgctcggcta cgtcgagcgg ctcaagtccg agcgggaccg cctggtcgcc 540 gagctgcggg cgatgggctg cgaggtcacc gcgtccgacg cgaacttcgt ccagttcggg 600 gtgttcgagg acgcccacgc cgcctggcag gccattctcg accggggcgt cctggtccgg 660 gacaacggcg tgcccggccg gctgcgggtc accgcgggca cccccgagga gaacgacgcg 720 ttcctggacg cggtgcgcgc cgtcatgaag gagaaccgat ga 762 <210> 7 <211> 597 <212> DNA <2​​​​​​​​​ctgcacatcg acacccacca caccatcgag gacaccgccc tcgcgctggg cgccgccttc 300. cggcaggcgc tcggcgacaa ggtgggcatc taccggttcg gcaactgcac ggtcccgctg gacgagtcgc tggcccaggt gaccgtcgc ctctccggcc ggccatacct ggtgcacacc 360 gagcccgaga acatcgcgcc gatgatcggc acgtacgaca cgacgatgac ccggcacata ctggagtcct tcgtcgccca ggcgcagatc gcgctgcacg tccacgtgcc gtacgggcgc 480 aacgcccacc acatcgtgga gtgccagttc aaggcgctgg cgcggcgct gcggtacgcg 540 tgcgagcgcg acccgcgggc cgccggatc ctcccgtcca cgaagggtgc gctgtga 597 <210> 8 <211> 90 <212> DNA <213> Manufacturer of IPIO(Streptomyces mobaraensis IPIO) SMDS_4886 <400> 8 atgcccaagg gcgtcatcgt gctgcttggc atcggggccg cgatggccct gaccgccggt gtgatgcgga tcgaaagcct gtggtcatga <210> 9 <211> 636 <212> DNA <213> Manufacturer of IPIO(Streptomyces mobaraensis IPIO) SMDS_4887 <400> 9 atgagcaaga aggtcgtcgt cttcgactac gggttcggca acgtccggtc ggccgagcgg 60 gccctcgccc acgtcggcgc cgatgtcgag atcacccgcg acttcgaccg ggccatgaac 120 gccgacggcc tcctcgtccc cggcgtcggc gcgttcgccg cctgcatgag cgggctgcgc 180 gcggcgcgcg gcgactggat cgtcgaccgg cggctgtccg gcggccggcc cgtgatgggc 240 atctgcgtcg gcatgcaggt cctcttcgcc cggggcgtcg agcacggcgt cgagaccgac 300 ggcctggacg agtggcccgg caccgtcgag ccgctcaagg ccccggtcgt cccgcacatg 360 gggtggaaca ccgtcaccgc cgccgagggc tccgccctct tcgccgggct cgacgccgac 420 acgcgctact acttcgtgca ctcctacgcc gtccgcgact ggagcctcga cgtcaccaac 480 gaggccatca agccgcccct ggtgacctgg gccgagcatg gcgagccgtt cgtcgccgcc 540 gtcgagaacg ggcccctgtg ggccacccag ttccaccccg agaagtccgg cgacgccgga 600 tcccagctgc tgaccaactg gatcgagacc ctctga 636 <210> 10 <211> 726 <212> DNA <213> Streptomyces mobaraensis IPIO SMDS_4888 <400> 10 atgcccaagc tcgaactcct ccccgccgtc gacgtccgcg acggccaggc cgtacggctc 60 gtccatggcg agtcgggctc cgagacctcg tacggcgacc cgctggccgc cgcccgcgcc 120 tggcagcagg ccggcgccga gtggctgcac ctcgtcgacc tggacgccgc cttcggcacc 180 ggcgacaacc gggagcggat cgccgaggtc gtccgggcca tggacatcaa ggtcgagctg 240 tccggcggca tccgcgacga cgcctcgctg gccgccgccc tcgccaccgg ctgcacccgc 300 gtcaacctgg gcacggccgc cctggagacc cccgagtggg tcgccaaggt catcgccgag 360 cacggcgaca agatcgccgt cgggctggac gtgcgcggca ccacgctgcg cggccgcggc 420 tggacccgcg acggcggcga cctctacgag acgctcgccc gcctcgactc cgagggctgc 480 gcccgctacg tcgtcaccga catcgccaag gacggcaccc tccagggccc caacctggag 540 ctgctcaaga acgtctgcgc ggccaccgac aagccggtcg tcgcctccgg cggcgtctcc 600 tcccttgacg atctgcgggc cattgccagt ctggtaccgg agggtgtcga aggcgcgatc 660 gtgggcaagg ccctctacgc gaaggcgttc accttggaag aggccctgga ggcagtgtcc 720 gtatga 726 <210> 11 <211> 233 <212> DNA <213> Manufacturer of IPIO(Streptomyces mobaraensis IPIO) SMDS_4889 <400> 11 atgagtgaga ccccggctcc gcagcgcgtg cagacagaca gtccctggga agcgacgatc ggcttcgcac gtgccgtggc ggccggggac cgggtgcacg tcgccggcac gatgccgctc 120 gtcgacggcg tcctcgtcgg cgaggcgac ccctacgagc aggcccggggc cgccttctcc 180 aacgcgctcg ccgcgctgga gaagttcggc ctcggccccg agtccgtcgt ccg 233 <210> 12 <211> 651 <212> DNA <213> Manufacturer of IPIO(Streptomyces mobaraensis IPIO) SMDS_4890 <400> 12 atggcccgcg tctacggggcg ggaaggcgcc gacgagctca ccttcctcga catcacggcc tcttccggta atcgtgagac cacttatgac gtggtgcggc ggaccgccga gcaggttttc atcccgctca ccgtgggggg cggggttcgg accgccgacg acgtcgacaa gttgctgcgg gccggggccg acaaggtcgg ggtcaatacg gcggctattg agcggcccga tctcgtgcgg 240 gagatcgccg agcggttcgg gcggcaggtg ctggtgttgt cggttgacgc gcggcggact 300 ccgtccgggt ctttcgaggt caccacgcat ggcgggcggc gggggaccgg gctcgacgcc 360 gtcgagtggg cgcatcgggc ggcggagctc ggggccgggg agattctgct caactcgatg 420 gacgcggacg ggacgaagga cgggtacgac acggagatga tcgccgctgt gcggcggcat 480 gtgtcggtgc cggttatcgc cagcggcggc gcgggggagc tcgcgcactt cgcccctgcg 540 gtggcggcgg gcgcggacgc ggttctggcc gcgtccgtgt tccacttcgg tgatctgcgg 600 atcggggagg tcaagggggc gttgcgggag gctgggcatc ccgtgcggtg a 651 <210> 13 <211> 496 <212> DNA <213> Streptomyces mobaraensis IPIO PhisD <400> 13 ccggccggcg tatcactggg tggtacggag agccgtgcgg cgggacgggt ctgagacaat 60 tggccatgtg atctcccgaa tcgatctgcg cggcggagcc gtcaccgacg gcgtcatcga 120 ccgcgacctg ctgccccgag ccgaactcga cgtcgaggcc gccctggaga aggtgcggcc 180 ccgcgacctg ctgccccgag ccgaactcga cgtcgaggcc gccctggaga aggtgcggcc 180 catctgcgag gacgtgcatc atcgcgggac ggcggcactg atcgactacg cggagaggtt 240 catctgcgag gacgtgcatc atcgcgggac ggcggcactg atcgactacg cggagaggtt 240 cgacggcgtc accatcgacc gggtgcgcgt cgcgcccgag gcgatcgagc gcgccctggc 300 cgacggcgtc accatcgacc gggtgcgcgt cgcgcccgag gcgatcgagc gcgccctggc 300 ggagctggac ccggcggtcc gcgccgccct ggaggagtcc atccgccgcg cccgcctcgt 360 ggagctggac ccggcggtcc gcgccgccct ggaggagtcc atccgccgcg cccgcctcgt 360 ccaccgcgag cagcgccgca ccgacaagac cgtcaccgtc gtccccggcg gcacggtcac 420 ccaccgcgag cagcgccgca ccgacaagac cgtcaccgtc gtccccggcg gcacggtcac 420 cgagcgctgg gtgcccgtcg agcgcgtcgg cctgtacgtg ccgggcggca acgccgtcta 480 cgagcgctgg gtgcccgtcg agcgcgtcgg cctgtacgtg ccgggcggca acgccgtcta 480 cccgtcgtcc gtcgtg 496 cccgtcgtcc gtcgtg 496 <210> 14<210> 14 <211> 828<211> 828 <212> DNA<212> DNA <213> 茂源链霉菌IPIO(Streptomyces mobaraensis IPIO) SMDS_5474 <213> Streptomyces mobaraensis IPIO SMDS_5474 <400> 14 <400> 14 accgcgcggt ccgtcgaggc cgtcaacacc gtcctcgtcg gcgaggacgg ccggctcacc 300 ggcgacaaca cggacatccc gggcctggtc gccgccctgc gcgagcgcgg cgtcgacaag 360 gtcgcctcgg ccgccgtgct gggcgccggg gccaccgcgt cctcggcgct cgccgcgctc 420 gccgggatct gcgccggcga ggtcaccgcc tacgtccgca gcgccgggcg ggccgccgag 480 atgcggcggt ggggtgaacg gctcggggtg cctgtccgca ccgccgactg gtcccgcgcc 540 gccgaggcgt tcgaggcccc gctggtcgtc gcgaccaccc cggccggggc cgcggacgcg 600 ctcgcggccg ccgtccccga ccggcccggc accctcttcg acgtcctcta cgagccctgg 660 ccgaccccgc tggcggcggc ctgggccgcg cgcggcggca cggtcctggg cggcctcgac 720 ctgctcgtcc accaggcggt gctccaggtc gagcggatga cgggcgtctc gccggcaccg 780 ctcgcggcca tgcgggccgc cggggaagcg gccctcgcgg cccgctga 828 <210> 15 <211> 1086 <212> DNA <213> Streptomyces mobaraensis IPIO SMDS_5475 <400> 15 atggtggcgg accacctggc ccggcggcgc ctcggctatg ggcgcggcgc ccggatgaag 60 ttcgagcggg acgaggtgac cttcctcggc ggggtgcggc acggcctgtc catgggctcc 120 ccggtcgcgg tcatggtggg caacaccgag tggcccaagt gggagaaggt catggccgcc 180 gacccggtgg acccggccga gctcgccgaa ctcgcccgca acgccccgct gacccggccg 240 cgccccggcc acgcggacct cgccggcatg cagaagtacg gcttcgacga ggcccgtccg 300 gtcctggagc gggcctccgc gcgggagacc gcggcccgcg tcgcgctcgg cgccgtcgcc 360 cgctccttcc tgaaggaggc ggccggcatc gagatcgtct cccacgtcgt cgagctggcc 420 gccgccaagg cgccgtacgg cgtgtacccg aagccctcgg acgtcgagcg gctggacgcc 480 gacccggtgc gctgcctcga cgccgccgcg agcgaggcga tggtcgcaga gatcgaccag 540 gcgcacaagg acggcgacac cctcggcggc gtcgtcgagg tcctcgccta cggcgtgccc 600 gtcggcctcg gctcgcacgt gcactgggac cggcggctgg acgcccggct cgccgccgcc 660 ctgatgggca tccaggcgat caagggcgtc gagctcggcg acggcttcga cctggcccgg 720 gtgcccggct cgaaggcgca cgacgagatc gtcgccaccg aggagggcgt gcgccgcacg 780 tccggccgct ccggcggcac cgagggcggc ctgaccaccg gcgaactgct gcgcgtccgc 840 gccgcgatga agcccatcgc caccgtgccg aaggcgctcg ccaccatcga cgtcaccacc ggcgaggccg ccaaggccca ccaccagcgc tccgacgtgt gcgccgtccc cgcggccggc 960 atcgtcgccg aggcgatggt ggcgctcgtc ctggcggacg ccgtggtgga gaagttcggc 1020. 1080. ggcgacagcg tcaccgagac ccgccgcaac gtccgcggct acctcgacaa cctggccatc to 1086 <210> 16 <211> 288 <212> DNA <213> Manufacturer of IPIO(Streptomyces mobaraensis IPIO) SMDS_5476 <400> 16 atggacccgg acacccgggc gctgctcaag gggctgcccg tcgtcttcct cgacgtcgac 60 ctggccgacg cggtacggcg ggtggggctg gacgccccgc gtccgctgct ggccgtcaac 120 ccgcgcaagc ggtggcggga gctgatggag gcccgccgcc cgctctacac cgaggtcgcc 180 cgggtcgtcg tcgccaccgg aggccgcggc ccggccgagg tggccgacgc ggtgctcgac 240 agcctgcgcc cgcagcccgg cgcccgtacc cacgacacct cgcagtga 288 <210> 17 <211> 1092 <212> DNA <213> Streptomyces mobaraensis IPIO SMDS_5477 <400> 17 atgaccgacg cacccacccg tatccaggtc gccggcaccg ccggcaccgc gccgtatgag 60 gtcctgatcg ggcaccggct gctgggcgaa ctgcccgcgc tcatcgggac ggacgcccgg 120 cgcgtggccg tcctgcaccc ggaggcgctg gccgagaccg gcgaggtgct ccgcgccgac 180 ctggccgacc agggctacga ggccatcgcc atccaggtgc cgaacgcgga ggaggccaag 240 accgccgagg tcgccgccta ctgctggaag gcgctcgggc agtccggctt cacccgcacc 300 gacgtcgtcg tcggcgtcgg cggcggcgcc accaccgacc tggccggctt cgtcgccgcc 360 acctggctgc gcggcgtgcg ctggatcgcg gtgcccacca ccgtgctggc gatggtcgac 420 gccgccgtcg gcggcaagac cggcatcaac accgccgagg gcaagaacct cgtcggcgcc 480 ttccacccgc cggccggggt gctctgcgac ctgtccgcgc tggagtcgct gccggtccac 540 gactacgtca gcgggctcgc cgaggtcatc aaggccggct tcatcgccga cccggtgatc 600 ctcgacctga tcgagagcga ccccgcggcc gcccgcaccc cgtccggcgc gcacaccgcc 660 gagctcatcg agcgcgccat ccgggtcaag gccgacgtcg tctcccagga cctcaaggag 720 tccggcctcc gcgagatcct caactacggg cacaccctcg cccacgccat cgagaagaac 780<000..491>gagcggtaca actggcggca cggcgcggcc gtcgccgtcg gcatggtctt cgccgccgaa 840 ctcggccgga tcgccggccg gctggacgac gcgacggccg accggcaccg cgcggtgctg 900 gagtccgtcg gactgccggt gacctaccgg ggcgaccagt ggcccaagct gctggagacg 960 atgaagatcg acaagaagac gcggggcgac cggctgcgct tcatcgtgct cgacgggctg 1020 gcgaagccgg tggtgctgga ggctccggat ccggcgatgc tgctggccgc gcatgcggag 1080 atcgcggcgt ga 1092 <210> 18 <211> 186 <212> DNA <213> Streptomyces mobaraensis IPIO SMDS_5478 <400> 18 atgcgggacg ccgcctctca gcggaccgcg ccgctgatcg aggtgcacat ctccaatccg 60 catgcgcggg aggcgttccg gcacacctcc gtgatctccg ctgtcgcgtc cgggacgatc 120 gccgggttcg gtgtcgggtc gtaccggctc gcgttgcggg cgctcgcgga ggaactccgc 180 ggctga 186 <210> 19 <211> 464 <212> DNA[[ID=1十二]] <213> Streptomyces mobaraensis IPIO ParoE <400> 19 acctggaggg caaggccaag gagctgggcc tcaagtcccc gctccaggtg atcaccgtcg 60 ccagcctggt ccaggtcgag ggcaagtaca agcacgactt cgacaagatc gcccgggtcg 120 tctacaaccg gctcaagccg gacaacaagg agacgtacgg cctcctggac ttcgactcca 180 ]cggtcaacta cgccaagagc cagtccaccc tggacaccgg ctccgtcaac gacctgcgca 240 agttcaagga cccgtacaac acctacagca tcaagggcct gccgcccggg ccgatcagca 300 [[ID=二十七]]accccggcat ggacgccctg aagtcggcgc tcgaacccgc ctccgggccc tggtactact 360 tcgtctcgat caacgagaac gagacgcttt tcgcggtgac caacgcggag cacaacagga 420 accgggagcg gtaccggcag gagcacggaa agaccggcca atga 464 <210> 20 It should be noted that there may be some inaccuracies in the above translation due to the complexity and potential ambiguity of the original text. It is recommended to double-check with more context and relevant knowledge. <211> 1029 <212> DNA <213> Streptomyces mobaraensis IPIO SMDS_5364 <400> 20 atggcaatac gagcggcagt ggccggagcg agcggatacg cgggcggcga agtgctgcgt 60 ctgctgctcg ggcacccccg tgtcgagatc ggggcgctga ccggcaacag cagtgccggg 120 cggacgctcg gcgaggtgca gccccatctg ccggcgctgg ccgagcgggt cctccaggag 180 acctccgccg acgccctcgc cgggcatgac gtcgtcttcc tcgccctgcc gcacggacag 240 tccgccgcga tcgccgagca gctcggaccc gacgtcctcg tgatcgactg cggtgcggat 300 ttccggctgc gggacgcggg ggagtgggtg cggttctacg ggtcgccgca tgcggggacg 360 tggccgtacg ggctgccgga gctgccgggg gcgcgggagg cgttgcgggg aacgaagcgg 420 gtggcggtgc cggggtgtta tccgacggcg gtgtcgttgg cgttgtggcc ggtgttcgcg 480 gcggcgctgg tggagttgga ggcggtggtc gtggcggcgt cggggacgtc gggtgcgggg 540 aaggcggcga ggccgcatct gctgggcagt gaggtgatgg ggtcgatgag tccgtacggg 600 gtcgggggcg ggcaccggca tacgccggag atcgcgcaga acctggccgc cgtcgccggg 660 gggccggtga gcgtctcctt caccccgacc ctcgcgccca tgccccgcgg catcctcgcc 720 acgtgcagcg ccaaggcgca ccccggcacc accgcccaga ccgtccgcgc ggcgtacgag 780 aaggcgtacg gcgacgagcc gttcgtccgc ctcctgcccg aggggcgctg gccgtccacc 840 ggcgcggtga ccgggtccaa cgtggcgcag gtccaggtcg tcctggacga cgcggcgggc 900 cgcgtgatcg cggtgagcgc gatcgacaac ctgacgaagg gcactgccgg tggtgcggtg 960 cagagcatga acatcgccct cgggctggcc gaggagctgg gactttccac gacaggggtg 1020 gctccgtga 1029 <210> 21 <211> 243 <212> DNA <213> Streptomyces mobaraensis IPIO SMDS_5365 <400> 21 atgagcccgg tggaggccac cgcgacctcg ccggcgccgc agccgagcgc ctccgccgcc 60 ttctccgccg tcgcgtgggt gtcctggaag ccctccgggc cggtgcaggc gttggcgcca 120 ccggagttga ggacgaccgc cgccgcctcc cccgacttca gcacctgctg cgaccacagc 180 accggagccg ccttgacccg gttggaggtg aacacccccg ccgccgcccg cgacggcccc 240 tga 243 <210> 22 <211> 801 <212> DNA <213> Streptomyces mobaraensis IPIO SMDS_5366 <400> 22 atggataagc tgctgccggg cgtggagaag gccgcggcga gcctgtcggc gcacggcggc 60 gagaaggccg ccatcgcgat caagacgacg gacaccgtgc acaagacggc ggtcgtggag 120 cgggacggct gggtggtcgg gggcatggcc aagggcgcgg ggatgctcgc cccggggctg 180 gccacgatgc tcgtggtcct gaccaccgac gcggacgtgg acgcgcccgg cctggacgac 240 gcgctgcgtg ccgccgtccg cacgaccttc gaccgggtcg actccgacgg gtgcatgtcc 300 accaacgaca ccgtgctgct cctgtcctcc gccgcctccg ggatcgtccc ggatgccgcc 360 gtcttcaccg atgccgtgcg cgaggtgtgc gacgacctgg cgcggcagct gatcggggac 420 gcggaagggg cgagcaagga catccgcatc gaggtgatca acgcggccag cgaggaggac 480 gcggtggagg tgggccggtc catcgcccgc aacaacctgc tcaagtgcgc gctgcacggt 540<00005**********6>gaggatccca actggggccg ggtgctgtcc gcgatcggta ccacctccgc cgccttcgat 600 cccgaccggc tcaacgtggc gatcaacgac gtgtgggtct gccgcaacgg ctccgtcggt 660 gatgaccgcg acctcgtcga catgcgttac cgcgaggtcc gcatcaccgc cgacctggcc 720 gaaggcggcg aatccgccgt catctgggcc aacgacctca ccgccgacta cgtccacgag 780 aacagcgcct actcctcatg a 801 <210> 23 <211> 1044 <212> DNA <213> Streptomyces mobaraensis IPIO SMDS_5367 <400> 23 atgagcacca cgatcaccag cggaagcggc agcacccgca aacacaccgc cctcccgaag 60 gcccgcaccc tcgtcgaggc gctgccctgg ctgacgcggc accacggcaa gacggtcgtc 120 atcaagttcg gcggaaacgc catggtggac gacgagttga aggccgcctt cgcccaggac 180 gtcgtcttcc tccggcacgc cgggctccgc cctgtcgtcg tgcacggtgg cgggccgcag 240 atcagcgcgc agctcgaccg gttcgggatc gcgtccgagt tcaaggcggg cctgcgggtg 300 accacgcccg aggcgatgga cgtcgtccgg atggtcctcg ccgggcaggt ccagcgcgaa 360 ctcgtcggcc tgctcaaccg gcacggcccc ctcgccgtcg gcctcaccgg cgaggacgcc 420 cacaccatga ccgccacccg gcactacgcc cgcatcgacg gcgaacgcgt ggacctcggc 480 cgcgtcggcg agatcaccgc catcgacacc ggcgccgtcc aggccctgct cgacaacggc 540 cgcatcccgg tcgtctcctc gatcgcccgc agcgccgagg acgggcacgt ctacaacgtc 600 aacgccgaca ccgccgccgc cgcgctcgcc gccgccctcg gcgccgagac gctgatggtc 660 ctcaccgacg tcgagggcct ctacgcggac tggccgcaca gcgacgacgt catcagccgc 720 ctcaccgcga gcgaactgga ggcgctgctc ccggaactgt cgagcggcat ggtgcccaag 780 atggaggggt gtctgtacgc cgtccgcaac ggggtcgcca acgcccgcgt catcgacggc 840 cgggtgcagc actcgatcct gctggagatc ttcacggacg aggggatcgg cacgatggtc 900 gtcccggacg ttccggagaa caccgatcac ccgacacagc ccgggggtac cgcatcatga 960 gggcaggtgc tgctgaccac cgacgacacc agccgccgcg cgcactaccg caacgcccgc 1020 cggaccctgg accagctgct ggcc 1044 <210> 24 <211> 1260 <212> DNA <213> Streptomyces mobaraensis IPIO SMDS_5368 <400> 24 atgaccgcca ccaacgccga cctgacccgg cgctggcaga acgccctgat ggacaactac 60 ggcaccccgc gcgtcccgct cgtgcgcggc gagggcagca cggtctggga cgccgacggc 120 acggcgtacc tcgacctcgt cggcggcatc gccgtcaacg cgctcggcca cgcccacccg 180 gccgtcgtcc gcgcggtctc cgaccagatc gccaccctgg gccacgtctc caacctctac 240 gtggccgagc cccccgtggc gttggcggaa cggctgctgg agctggccgg ccgcgacgga 300 cgcgtctact tctgcaattc cggcgccgag gcggtcgagg ccgcgttcaa gatcgcccgg 360 cggaccgggc ggccgcgcat cgtcgccgcg cggggcgggt tccacggccg gacgatgggc 420 gccctcgcgc tcaccggcca gccggccaaa caggaaccct tcctcccgct ccccggcgac 480 gtcacccacg tcccgtacgg cgacaccgaa gccctgcgcg ccgccgtcac ggaacagacc 540 gccgccgtgt tcctggagcc ggtgcagggc gagaacggcg tcgtcgtccc gccgcccggc 600 tacctcgccg ccgcccgcga gatcacccag gcggcgggag cactgctggt gctggacgag 660 atccagacag gtatcggccg caccggccac tggttcgagc acctcgccca gggcgtcgaa 720 cccgacgtcg tcaccctcgc caagggcctc ggcggcggcc tccccatcgg cgccaccctc 780 gccttcggcg acgcggcggg cctgctgacc cccggtcagc acggttcgac gttcggcggc 840 aaccccgtcg cctgcgccgc cgccctcgcc gtcctcgaca ccctcgccgc cgaggacctc 900 cccgcgcgcg ccggccgcac cgggaccctg ctccgtgacg ggatcgccgc gctcggccac 960 cctctcgtcg accacgtccg tggcgcgggc ctgctgctgg gtattgtcct ttccaagccc 1020 ctcgcaccgg acgtgcagcg ggcggctcag gaagccggtc tcctggtgaa cgcggtcgcg 1080 cccgacgtgg tgcggctggc tcctccgctg atcatcacgg aagatgaggt ggagacgttc 1140 ctccgggtgc tccccggggt cctcgacgcc gtcgccgcca ccgccgctgt cgccgccgag 1200 gcaggggcgg ccgccgcagc cctgacgggg ggctcaggag aaccacgatc cggagactga 1260 <210> 25 <211> 1233 <212> DNA <213> Streptomyces mobaraensis IPIO SMDS_5394 <400> 25 atgcctacca ccgcatgtga tgcacgtaag gagaatcccg tgaccgagcg cgtcgtactc 60 gcctactcgg gcggcctgga cacctccgtc gccatcggct ggatcgccga ggagacgggc 120 gccgaggtca tcgccgtcgc cgtggacgtc ggccagggcg gcgaggacct ggacgtcatc 180 cgcaagcgcg cgctcgcctg cggtgcggtg gaggcggagg tcgccgacgc caaggacgag 240 ttcgccgagg agtactgcct cccggcgatc aaggccaacg ccctctacat ggaccggtac 300 ccgctggtct ccgccctctc ccggccgacg atcgtcaagc acctcgtcgc cgccgcgcgg 360 aagcacggcg ccaccacggt cgcccacggc tgcaccggca agggcaacga ccaggtgcgg 420 ttcgaggccg ggatctcctc gctcgcgccg gacctgaagt gcatcgcgcc cgtccgggac 480 tacgccatga cccgggacaa ggccatcgcc ttctgcgagg ccaagggcct gccgatcgcc 540 accaccaaga agtcgccgta ctcgatcgac cagaacgtct tcggccgggc cgtcgagacc 600 ggcttcctgg aggacatctg gaacgcgccc atcgaggacg tctacgacta cacggccaac 660 ggcttcctgg aggacatctg gaacgcgccc atcgaggacg tctacgacta cacggccaac 660 ccggccaccc cgcgcgacgc cgacgaggtc gtcatcacct tcgaggccgg cgtcccggtc 720 ccggccaccc cgcgcgacgc cgacgaggtc gtcatcacct tcgaggccgg cgtcccggtc 720 gcgatcgacg gccaggccgt caccgtcctc caggcgatcc agcagctcaa cgagcgggcg 780 gcgatcgacg gccaggccgt caccgtcctc caggcgatcc agcagctcaa cgagcgggcg 780 ggcgcccagg gcatcggccg gatcgacatg gtcgaggacc ggctcgtggg catcaagtcc 840 ggcgcccagg gcatcggccg gatcgacatg gtcgaggacc ggctcgtggg catcaagtcc 840 cgggagatct acgaggcgcc cggcgccatc gcgctgatca ccgcccacca ggagctggag 900 cgggagatct acgaggcgcc cggcgccatc gcgctgatca ccgcccacca ggagctggag 900 agcgtcaccg tcgagcgcga actcgcccgc tacaagcggc aggtcgagca gcggtggagc 960 agcgtcaccg tcgagcgcga actcgcccgc tacaagcggc aggtcgagca gcggtggagc 960 gaactggtct acgacgggct gtggttctcg ccgctcaagc gggcgctgga cggtttcatc 1020 gaactggtct acgacgggct gtggttctcg ccgctcaagc gggcgctgga cggtttcatc 1020 gccgaggcca acgagcacgt cagcggcgac atccggatga ccctgcacgg cggccgggcc 1080 gccgaggcca acgagcacgt cagcggcgac atccggatga ccctgcacgg cggccgggcc 1080 gtcgtcaccg gccggaagtc cgccaagtcg ctctacgact tcaacctcgc cacctacgac 1140 gtcgtcaccg gccggaagtc cgccaagtcg ctctacgact tcaacctcgc cacctacgac 1140 acgggtgaca ccttcgacca gtcgctctcc aagggcttca tcgagatctt cggcctctcg 1200 acgggtgaca ccttcgacca gtcgctctcc aagggcttca tcgagatctt cggcctctcg 1200 tcgaagatcg ccgccaagcg ggacctggtc tga 1233 tcgaagatcg ccgccaagcg ggacctggtc tga 1233 <210> 26 <210> 26 <211> 1242 <211> 1242 <212> DNA <212> DNA <213> 茂源链霉菌IPIO(Streptomyces mobaraensis IPIO) SMDS_5395 <213> Streptomyces mobaraensis IPIO SMDS_5395 <400> 26 atgctggacg ggctcgaccg gctggaggcc gacgtggcca ccggcgcctt caccggcacc 60 gtcgccgacg aggacgtcca caccgcgctg gagcgcggcc tcctcgaacg gctcggcccc 120 gacctcggcg gcaagctgcg cgccggacgc tcccgcaacg accaggtcgc caccctcttc 180 cggatgtacc tgcgcgacca cgcgcggatc atcggcggac tgctcaccga gctccaggaa 240 gcgctcgtcg gcctcgccga ggcacaccag gacgtggcga tgcccggccg gacccacctc 300 cagcacgccc agcccgtcct cttcgcccac cacgtcctcg cccacgtcca ggcgctcggc 360 cgggacgcgg aacggctgcg gcagtgggac gagcggacgg ccgtctcccc gtacggcgcc 420 ggcgccctcg ccgggtcctc actcggcctc gacccggagg cggtcgccgc cgacctcggc 480 ttcgagcgcg gctcggtggg caactccatc gacggcacgg cgtcccggga cttcgtcgcc 540 gagttcgcgt tcatcacggc gatgatcggg atcgatctct cgcggatcgc cgaggagatc 600 atcatctgga acacgaagga gttctccttc gtcaccctcc acgacgcgtt ctcgaccggc 660 tcgtcgatca tgccgcagaa gaagaacccg gacatcgcgg agctggcgcg cggcaagtcg 720 gggcggctga tcggcaatct gaccgggctg ctcgcgacgc tcaaggcgct gccgctcgcc 780 tacaaccgcg acctccagga ggacaaggag ccggtcttcg actcctgcga ccagctggag 840 atcctgctgc ccgccttcac cgggatgatg gcgacgctca ccgtgcaccg ggagcgcatg 900 gaggagctgg cgcctgccgg gttctcgctg gccacggaca tcgcggagtg gctggtgcgg 960 cagggggtgc cgttccgggt ggcgcatgag gtggcggggg agtgcgtgaa ggtgtgtgag 1020 cggcggggga tcgagctcga cgggctcacg gacgaggagt tcgcggcgat ctcgccgcat 1080 ttgacgccgg aggtgcggac cgttctggac gttccggggt cgctcgcttc ccgtagcggg 1140 cggggcggta cggcgccttc cgcggtcgcc gcgcagctgg ccgaggtgaa ggcggagctg 回页首1200 [[ID=?]]gtggtgcagc gggagtgggc gggcgcgaag cggcgggggt ga 1242 <210> 27 <211> 382 <212> DNA <213> Streptomyces mobaraensis IPIO P5364 <400> 27 It should be noted that there seems to be an error in the tag "回页首" in the provided text. It is likely a misrepresentation or an incorrect tag. The above translation is based on the best understanding of the text with the given tags.agtccgggcc gtgcagccac aggctctccg ccgcctcccg cagcagcacc ggatcgtccg 60 gccgttgcag cagcaccagc cggtacgcca ggttccgtat ccacaccggc aggtagccgt 120 cgaccaggta cgggctcagc tcgcgcagca tggcgaggat ctcgtccgcg ccggcgaagg 180 tcagctcctc gacgaagtag tgctccgcgt gccgcgcggc gcactccggc gtgggccggt 240 gttcgtcccc gtagaggcag cgggcgtgct cggtcagcgt ggtgtgcatg acgggcagcg 300 taggcggccg cacgcgaccg ccccccattg aataaatctt ctctccttcg tatagtcatg 360 ccatcgacga ggaggcaccc cg 382 <210> 28 <211> 500 <212> DNA <213> Streptomyces mobaraensis IPIO P5394 <400> 28 tagtcgttct tgtcgttctt cgacgagacg atctcgatcg cggccaagag atcttcatgc 60 gagtacgggt ctgtcgatcc gtcgtcggtg atcgccacgt ccgggcaccg atcgggctcc 120 ccggggaagc cgaactccac atcattcagg acgcgttgcc tgtcgacacc ggacgcgacg 180 attgcggtct ggacgtcgaa gacggtccag ctccgaacgc tgctctgcgg agtcatgatg 240 acccggtccc ccactgcctc gatcttgaag cccttgagca gcggcgacac gcgttcgatg 300 gcgttccgca tggattcgat ccccgcgtcg tgcggggact ccatccgcgc gttgtgcggg 360 cgctcaagct gcgcagtcat ggtctgcctc ccctactcgg gcctcgcgat actcgcatcg 420 tagaacgccc cgccgatacc cgtgcccgct tgattcaccc tttcgagccc ttgacgaaac 480 atacggcgca ctgcatagtt 500 <210> 29 <211> 32 <212> DNA <213> Artificial Sequence <400> 29 atattctaga cgcgagtagc gccgcggcct gt 32 <210> 30 <211> 32 <212> DNA <213> Artificial Sequence <400> 30 atatgaattc tcagccccgg atgtgcccgt cg 32 <210> 31 <211> 47 <212> DNA <213> Artificial Sequence <400> 31 gcttgggctg caggtcgact ctagaccggc cggcgtatca ctgggtg 47 <210> 32 <211> 47 <212> DNA <213> Artificial Sequence <400> 32 tacgaattac tagtcatgag aattctcacc gcacggggatg cccagcc 47 <210> 33 <211> 50 <212> DNA <213> Artificial Sequence <400> 33 cttgggctgc aggtcgactc tagaacctgg agggcaaggc caaggagctg 50 <210> 34 <211> 50 <212> DNA <213> Artificial Sequence <400> 34 tacgaattac tagtcatgag aattctcagc cgcggagttc ctccgcgagc 50 <210> 35 <211> 32 <212> DNA <213> Artificial Sequence <400> 35 atattctaga agtccgggcc gtgcagccac ag 32 <210> 36 <211> 32 <212> DNA <213> Artificial Sequence <400> 36 atatgaattc tcagtctccggatcgtggtt ct 32 <210> 37 <211> 34 <212> DNA <213> Artificial Sequence <400> 37 atatgaattc tagtcgttct tgtcgttctt cgac 34 <210> 38 <211> 31 <212> DNA <213> Artificial Sequence <400> 38 atatactagt tcacccccgc cgcttcgcgc c 31 <210> 39 <211> 20 <212> DNA <213> Artificial Sequence <400> 39 accgcatcag gcgccattcg 20 <210> 40 <211> 20 <212> DNA <213> Artificial Sequence <400> 40 gccgccggtg ccgacgcccg 20 <210> 41 <211> twenty two <212> DNA <213> Artificial Sequence <400> 41 ccgctccacg tgcttcgtcg cg 22 <210> 42 <211> twenty one <212> DNA <213> Artificial Sequence <400> 42 ggcgcgggac cagtcggcgg t 21 <210> 43 <211> 20 <212> DNA <213> Artificial Sequence <400> 43 ccggtgcccg cccccgaccc 20

Claims

1. A TG enzyme high-producing strain obtained by enhancing the transcription level of amino acid synthesis genes, characterized in that: The gene in the proline, histidine, aromatic amino acid or arginine synthesis pathway of the strain is overexpressed; specifically, the proline synthesis gene derived from the sequence of Streptomyces moyuanensis IPIO as shown in SEQ ID NO.1-NO.3 is overexpressed in Streptomyces moyuanensis IPIO SMDS_4329-SMDS_4331 , or overexpressing the histidine synthesis gene derived from Streptomyces oleraceus IPIO, such as the sequence shown in SEQ ID NO.5-NO.12 SMDS_4883-SMDS_4890 , or overexpressing aromatic amino acid synthesis genes derived from Streptomyces moyuanensis IPIO, such as the sequences shown in SEQ ID NO.14-NO.18 SMDS_5474-SMDS_5478 , or overexpressing the arginine synthesis gene derived from Streptomyces moyuanensis IPIO, such as the sequence shown in SEQ ID NO.20-NO.24 SMDS_5364-SMDS_5368 and the arginine synthesis gene whose sequence is shown in SEQ ID NO.25-NO.26 SMDS_5394- SMDS_5395 .

2. An integrative plasmid vector for overexpressing amino acid synthesis genes, characterized in that: The vector contains a proline synthesis gene derived from Streptomyces oleifera IPIO, as shown in SEQ ID NO.1-NO.3 SMDS_4329-SMDS_ 4331 Its promoter P proB , the sequence of histidine synthesis gene shown in SEQ ID NO.5-NO.12 SMDS_4883-SMDS_ 4890 Its promoter P hisD , the aromatic amino acid synthesis gene sequence as shown in SEQ ID NO.14-NO.18 SMDS_ 5474-SMDS_5478 Its promoter P aroE , or the arginine synthesis gene whose sequence is shown in SEQ ID NO.20-NO.24 SMDS_5364-SMDS_5368 Its promoter P 5364 , the arginine synthesis gene whose sequence is shown in SEQ ID NO.25-NO.26 SMDS_5394-SMDS_5395 Its promoter P 5394 ; The promoter P proB The sequence is shown in SEQ ID NO.4; the promoter P hisD The sequence is shown in SEQ ID NO.13; the promoter P aroE The sequence is shown in SEQ ID NO.19; the promoter P 5364 The sequence is shown in SEQ ID NO.27; the promoter P 5394 The sequence is shown in SEQ ID NO.

28.

3. A method for constructing an integrative plasmid vector according to claim 2, characterized in that: The construction steps are as follows: By PCR amplification, P proB and SMDS_4329-SMDS_4331 The PCR fragment of the gene sequence was connected to the integrative plasmid pSET152 by restriction digestion and ligation. XB I / Eco RI site to obtain the integrative plasmid vector pLQ1766; Alternatively, P hisD and SMDS_4883-SMDS_4890 The PCR fragment of the gene sequence was connected into the integrative plasmid pSET152 by Gibson ligation. XB I / Eco RI site to obtain the integrative plasmid vector pLQ1769; Alternatively, P aroE and SMDS_5474-SMDS_5478 The PCR fragment of the gene sequence was connected into the integrative plasmid pSET152 by Gibson ligation. XB I / Eco RI site to obtain the integrative plasmid vector pLQ1770; Or by PCR amplification to obtain P 5364 and SMDS_5364-SMDS_5368 The PCR fragment of the gene sequence was 3255 bp 5394 and SMDS_5394-SMDS_5395 The PCR fragment of the gene sequence was connected to the integrative plasmid pSET152 by restriction digestion and ligation. XB I / Spe I site to obtain the integrative plasmid vector pLQ1772.

4. A high-yield transglutaminase-producing Streptomyces masouensis strain, characterized in that: The integrative plasmid vector as claimed in claim 2 or the integrative plasmid vector constructed by the method as claimed in claim 3 is respectively introduced into the recipient bacterium Streptomyces pulex IPIO by conjugation transfer for site-specific recombination to obtain the strain.

5. A method for increasing the production of glutamine transaminase, characterized in that: By enhancing the transcription level of proline, histidine, aromatic amino acid or arginine synthesis genes, the yield of glutamine transaminase produced by Maoyuan Streptomyces fermentation is ultimately increased; specifically, the proline synthesis gene derived from Maoyuan Streptomyces IPIO, the sequence of which is shown in SEQ ID NO.1-NO.3, is overexpressed in Maoyuan Streptomyces IPIO SMDS_4329-SMDS_4331 , or overexpressing histidine synthesis genes derived from Streptomyces moyuanensis IPIO, such as the sequences shown in SEQ ID NO.5-NO.12 SMDS_4883-SMDS_4890 , or overexpressing aromatic amino acid synthesis genes derived from Streptomyces moyuanensis IPIO, such as the sequences shown in SEQ ID NO.14-NO.18 SMDS_5474-SMDS_5478 , or overexpressing the arginine synthesis gene derived from Streptomyces moyuanensis IPIO, such as the sequence shown in SEQ ID NO.20-NO.24 SMDS_5364-SMDS_5368 and the arginine synthesis gene whose sequence is shown in SEQ ID NO.25-NO.26 SMDS_5394-SMDS_5395 , obtain an overexpression mutant strain, ferment it, and obtain glutamine transaminase.

6. The method according to claim 5, characterized in that The fermentation comprises the following steps: inoculating the activated overexpression mutant spores into a seed culture medium, culturing at 30°C and 200-220 rpm for 24 h, transferring to a fermentation culture medium at a 10% inoculation rate, and fermenting at 30°C and 200-220 rpm for 28-32 h.

7. The method according to claim 6, characterized in that In w / v terms, the seed culture medium comprises 1-3% glycerol, 0.4-0.8% yeast extract, 1-3% fish meal peptone, 0.1-0.3% MgSO4•7H2O, and 0.1-0.3% K2HPO4•3H2O; In w / v terms, the fermentation medium comprises 1-3% glycerol, 0.4-0.8% yeast extract, 1-3% fish meal peptone, 0.1-0.3% MgSO4•7H2O, 0.1-0.3% K2HPO4•3H2O, and 0.1-0.4% fermentation promoter.

Images