Application of lncRNA FAM239A:31 in the diagnosis and treatment of allergic rhinitis

Abstract

The present invention relates to a lncRNA that can be used for diagnosing and treating allergic rhinitis. Specifically, the present invention discloses a lncRNA FAM239A:31 that is overexpressed in peripheral blood mononuclear cells (PBMCs) of patients with allergic rhinitis. The overexpression can promote the expression of tyrosine phosphatase SHP2, thereby promoting Th2 cell differentiation, while blocking Th1 and Treg cell differentiation, and promoting inflammatory response in allergic rhinitis. Reducing or inhibiting the expression of SHP2 can slow down the regulatory effect of lncRNA FAM239A:31 overexpression on downstream Th2, Th1, and Treg cells. The invention provides application value in clinical diagnosis and treatment of allergic rhinitis using lncRNA FAM239A:31 and SHP2, as well as providing drug targets.

Description

Technical Field

[0001] The present invention relates to the technical field of allergic rhinitis diagnosis and treatment, and specifically to application of lncRNA FAM239A:31 in the diagnosis and treatment of allergic rhinitis. Background Art

[0002] LncRNA, a non-coding RNA with a length of more than 200 nucleotides, is involved in the regulation of a variety of allergic diseases, including allergic rhinitis, asthma and allergic dermatitis. Studies have found that lncRNA in the cell nucleus can regulate the epigenetic state of genes, participate in transcriptional regulation, alternative splicing and other processes; while in the cytoplasm, it can participate in post-transcriptional regulation such as mRNA stability and translation regulation, protein binding, protein ubiquitination and phosphorylation regulation, etc.

[0003] Allergic rhinitis (AR) is a non-infectious inflammatory disease of the nasal mucosa. With the development of national industrialization, its incidence has gradually increased from 1.4% to 45% in recent decades, becoming a major public health issue and gradually attracting the attention of the international community. At present, the functional regulation of lncRNA in allergic rhinitis has become a hot topic of research. Previous studies have found that lncRNA can regulate immune cell differentiation and immune response, but there are no reports on lncRNA FAM239A:31 regulating immune cell differentiation and allergic rhinitis. Summary of the invention

[0004] The present invention provides a new application for the diagnosis and treatment of allergic rhinitis. Specifically, a long non-coding RNA that has not been studied before, namely, lncRNA FAM239A:31, is discovered. The present inventors combine theoretical research with experimental means to predict that the lncRNA FAM239A:31 has a strong regulatory potential in the occurrence and development of allergic rhinitis, and further study the mechanism of action of the lncRNA FAM239A:31, and find that it regulates downstream genes through SHP2. The above findings are all verified by experiments.

[0005] Therefore, the present invention relates to a long non-coding RNA--lncRNA FAM239A:31, which can be used for the diagnosis and treatment of allergic rhinitis. It is overexpressed in peripheral blood mononuclear cells PBMC of AR patients, and the overexpression promotes Th2 cell differentiation and blocks Th1 and Treg cell differentiation. The present invention also studies the mechanism of action of lncRNA FAM239A:31 and finds that lncRNA FAM239A:31 regulates genes of downstream cells through tyrosine phosphatase SHP2.

[0006] The objective of the present invention is achieved through the following technical measures: Application of lncRNA FAM239A:31 expression detection reagent in the diagnosis of allergic rhinitis.

[0007] Furthermore, the nucleotide sequence of the lncRNA FAM239A:31 is shown in SEQ ID NO:1 (EnsemblTranscript ID: ENST00000471090).

[0008] Furthermore, the lncRNA FAM239A:31 regulates SHP2 expression.

[0009] Furthermore, the SHP2 expression detection reagent is used in the diagnosis of allergic rhinitis.

[0010] Use of an agent for reducing or inhibiting the expression of lncRNA FAM239A:31 in the preparation of a drug for allergic rhinitis, wherein the agent is shRNA, siRNA, gamper, antisense RNA, esiRNA, miRNA, RNA aptamer, TALEN, CRISPR and zinc finger nuclease.

[0011] Furthermore, the nucleotide sequence of the lncRNA FAM239A:31 is shown in SEQ ID NO:1 (EnsemblTranscript ID: ENST00000471090).

[0012] Furthermore, the lncRNA FAM239A:31 regulates genes through SHP2.

[0013] Furthermore, the use of an agent for reducing or inhibiting the expression of SHP2 in the preparation of a drug for allergic rhinitis, wherein the agent is siRNA, gamper, antisense RNA, esiRNA, miRNA, RNA aptamer, TALEN, CRISPR and zinc finger nuclease.

[0014] Furthermore, the drug also includes another biological macromolecule drug or chemical small molecule drug, and the biological macromolecule drug or chemical small molecule drug is used to reduce or inhibit SHP2 expression.

[0015] Furthermore, the drug also includes another biological macromolecule drug or chemical small molecule drug, and the biological macromolecule drug or chemical small molecule drug is used to reduce or inhibit the expression of lncRNA FAM239A:31.

[0016] The present invention relates to a long non-coding RNA--lncRNA FAM239A:31, which can be used for the diagnosis and treatment of allergic rhinitis. It is overexpressed in peripheral blood mononuclear cells PBMC of AR patients, and the overexpression promotes Th2 cell differentiation and blocks Th1 and Treg cell differentiation. The present invention also studies the mechanism of action of lncRNA FAM239A:31, and finds that lncRNAFAM239A:31 regulates genes of downstream cells through tyrosine phosphatase SHP2. Specifically, SHP2 is abnormally highly expressed in the nasal mucosa and peripheral blood PBMC of allergic rhinitis, and inhibiting SHP2 expression in PBMC cells can reduce Th2 cell differentiation and increase Th1 and Treg cell differentiation. Overexpression of FAM239A in Jurkat cell lines promotes the expression of tyrosine phosphatase SHP2, thereby promoting the dephosphorylation of P-STAT1 and P-STAT5b, thereby reducing the expression of downstream genes T-bet and FOXP3 of STAT1 and STAT5b. Inhibition of SHP2 in Jurkat cell lines overexpressing FAM239A can inhibit the regulatory effect of FAM239A on downstream Th2, Th1, and Treg cells. This study confirmed for the first time the regulatory effect of lncRNA FAM239A:31 and SHP2 on helper T cells in allergic rhinitis. This invention provides clinical application value in the diagnosis and treatment of allergic rhinitis using lncRNA FAM239A:31 and SHP2, as well as in providing drug targets.

[0017] The present invention is described in detail below with reference to the accompanying drawings and specific embodiments. BRIEF DESCRIPTION OF THE DRAWINGS

[0018] Figure 1 A and B show that lncRNA FAM239A:31 is expressed in the cytoplasm and CD4 + (1A) PCR detection of lncRNA FAM239A:31 transcription levels in the nucleus and cytoplasm of Jurkat cells. (1B) qPCR detection of CD4 isolated from human PBMCs + and CD4 - Transcription level of lncRNA FAM239A:31 in cells, **p<0.01, n=3.

[0019] Figure 2AF is lncRNA FAM239A:31, which causes the imbalance of helper T cells. (2A) qPCR detection of the transcription level of FAM239A:31 in PBMCs of the control group (n=15) and AR group (n=11). (2B) qPCR detection of the transcription levels of T-bet, GATA3, RORG and FOXP3 in PBMCs of the control group and FAM239A overexpression (OE) group (n=3). (2C) qPCR detection of the transcription levels of IFNγ, IL-4, IL-17 and IL-10 in PBMCs of the control group and FAM239A overexpression (OE) group (n=3). (2D) Western blotting detection (hereinafter referred to as WB detection) of the expression levels of T-bet, GATA3, RORG and FOXP3 proteins in Jurkat cells of the control group and FAM239A overexpression (OE) group (n=3). (2E) WB detection of T-bet, GATA3, RORG and FOXP3 protein levels in Jurkat cells in the control group and FAM239A knockdown (FAM239A shRNA) group (n=3). (2F) qPCR detection of IFNγ, IL-4, IL-17 and IL-10 transcription levels in Jurkat cells in the control group and FAM239A knockdown (FAM239A shRNA) group. *p<0.05, **p<0.01, ***p<0.001, ****p<0.0001.

[0020] Figure 3 Figure AF shows that lncRNA FAM239A:31 reduces the phosphorylation levels of STAT1 and STAT5b. (3A) WB detection of STAT5b, P-STAT5b, STAT1 and P-STAT1 protein levels in the nasal mucosa of AR patients and the control group, and the statistical analysis of protein / β-ACTIN ratio is shown in (3B) (n=3). (3C) WB detection of STAT5b, P-STAT5b, STAT1 and P-STAT1 protein levels in Jurkat cells of the control group and FAM239A knockdown (FAM239A shRNA) group (n=3), and the statistical analysis is shown in (3D). (3E) WB detection of STAT5b, P-STAT5b, STAT1, P-STAT1 protein levels in Jurkat cells of the control group and FAM239A overexpression (OE) group (n=3), and the statistical analysis is shown in (3F). *p<0.05; **p<0.01; ns, p>0.05.

[0021] Figure 4Figures AE show that SHP2 regulates T helper cell responses in AR. (4A) WB detection of SHP2 expression in the nasal mucosa of the control group and AR patients (n=3). (4B) Statistical analysis of the SHP2 / β-ACTIN ratio (n=3). (4C) qPCR detection of SHP2 expression in PBMCs isolated from the control group and AR patients. Control n=8, AR n=6. (4D) Expression of IFNγ, IL-4 and IL-10 in PBMCs of the control group and SHP2 siRNA group (n=3). (4E) Expression of GATA3, FOXP3 and T-bet in PBMCs of the control group and SHP2 siRNA group (n=3). *p<0.05; **p<0.01.

[0022] Figure 5 AH in the figure indicates that SHP2 acts downstream of lncRNA FAM239A:31 to regulate the response of Treg and Th1 cells. (5A) WB detection of SHP2 protein expression in Jurkat cells of the control group and FAM239A overexpression (FAM239A OE) group and statistical analysis of SHP2 expression (n=3). (5B) WB detection of SHP2 protein expression in Jurkat cells of the control group and FAM239A knockdown (FAM239A shRNA) group and statistical analysis of SHP2 expression (n=3). (5C) STAT1, P-STAT1, STAT5b, P-STAT5b, T-bet, FOXP3, GATA3 protein expression in the control group, FAM239A overexpression group (FAM239A OE), SHP2 siRNA treatment group or cells with FAM239A overexpression and SHP2 siRNA co-expression (n=3). (5D) is the statistical analysis of the expression of P-STAT1 protein in (5C). (5E) is the statistical analysis of the expression of P-STAT5b protein in (5C). 5(F) is the statistical analysis of the expression of T-bet protein in (5C). (5G) is the statistical analysis of the expression of FOXP3 protein in (5C). (5H) is the statistical analysis of the expression of GATA3 protein in (5C).

[0023] *p<0.05; **p<0.01; ***p<0.001; ****p<0.0001. DETAILED DESCRIPTION

[0024] The term "lncRNA FAM239A:31" in the present invention refers to the LNCipedia database record transcription ID FAM239A:31, gene ID FAM239A, Ensembl record number Gene ID: ENSG00000205664, EnsemblTranscript ID: ENST00000471090, genome (hg38) positioning chrX: 3817535-3824598, transcription template chain (-), total length 922bp.

[0025] The specific sequence of SEQ ID NO: 1 is as follows (from 5' to 3'):

[0026] CAAGGCAGGTGGATCACAAGGTCAGGAGATCAAGACCATCCTCCTGGCTAACAAGGTGAAACCCTGTCTCTACTAAAAAAAATACAAAAAATTAGCCGGGCGTGGTGGCATGTACCTGTAGTCCCAGCTACTCAGGAGGCTGAGGCAGGAAAATCGCTTGAACCCAGGAAGTGGAGGTTGCAGTGAGCCAAGATCATACCACTGCACTCCAGCCTGGGCGACAGAGGGAGACTCCGTCTCAAAAAGAAAAAAAGCAATAAATGCTCTTCCAGAAAACTCAAAAATGAAGATAAGCTAAAAGAAAATGGAAAGCACCAGAATACCAGAATCTTTCCACTCACTGATGATCAGAGTTAATACCTCAGTGTCTTCTGTGGCTTCAGCGTCACCTAGTGCAGGCTGCCATTCAACAAACGCATTGTCAACAGTCAACCAAAAGAAACCCATTGGCCACCATACCCTGAGGACTAACCCTGACACAGATGCCCTTCCAGATGCCCTCAATAGTCTAACTGATTCCATCGCCCCAGCCTTGGGGGAGAAGCACTGCTGCCTATGCACTCCATTTACAGGGTTATAGAGTGGAAAGTCCCACAATCTTTTTCTTCTCTATTTTCAGAAAAACGTTGACCTCTTGGCGAGAATGCAAAGAAGGGAACGCTTGCTTATACGCTGTTGGTGAACTGTCACCCCTACAACTCAGCTTGCAACCAGCCCTGGCCACCAGTTTCCCCACACTGAGCTGAATATCGGACATGCCCATCTCAGACATTCCAGCCCATTCTGAAATTCCACATCGATTCACCTGACAAAGTCTGAAGTTCCAGGGCAATTTATCTGGAAAAGCTTACCTGGAATCACGTGTCATTTCAACCAACAACTGTTGAAGAGGACGTGGCATTAAAACCAAGGGTATCAATTA

[0027] The term "CD4" in the present invention +The "cells" specifically refer to a group of cells expressing CD4 on the cell surface, which can be separated from PBMC cells by magnetic beads coated with anti-CD4 antibodies.

[0028] The term "CD - Cells” specifically refers to PBMC cells that have been depleted of CD4 + cells, and then other PBMC cells.

[0029] The term "knockdown" in the present invention uses two methods, one is adenovirus shRNA and the other is siRNA.

[0030] In the present invention, the terms "PBMCs" and "PBMC" both refer to peripheral blood mononuclear cells, which are only different in singular and plural expression in English. In specific experiments, multiple peripheral blood mononuclear cells are used.

[0031] Unless otherwise specified, the terms in the present invention such as "overexpression", "expression", "Jurkat cells", "PBMCs", "Th1", "Th2", "Treg", "STAT5b", "STAT1", "P-STAT5b", "P-STAT1", "GATA3", "FOXP3", "T-bet", "RORG", "PCR", "qPCR detection", "IFNγ", "IL-4", "IL-17", "IL-10", "β-ACTIN" and the like should be understood according to the general technical meanings understood by those skilled in the art in the industry.

[0032] In one embodiment, the expression detection reagent of lncRNA FAM239A:31 is used in the diagnosis of allergic rhinitis. The detection method of lncRNA FAM239A:31 is qPCR.

[0033] The expression of lncRNA FAM239A:31 described in the present invention is detected as overexpression of lncRNA FAM239A:31 relative to a control (healthy or normal sample), indicating a high risk of allergic rhinitis.

[0034] The lncRNA FAM239A:31 expression detection reagent of the present invention is a qPCR primer, but is not limited to this reagent, and also includes a lncRNA FAM239A:31 specific probe, a gene chip, etc.

[0035] Further in this embodiment, the nucleotide sequence of the lncRNA FAM239A:31 is shown as SEQ ID NO:1.

[0036] Further in this embodiment, the lncRNA FAM239A:31 regulates SHP2 expression.

[0037] In this embodiment, the SHP2 expression detection reagent is used in the diagnosis of allergic rhinitis. The SHP2 detection method is RT-qPCR or WB detection.

[0038] The expression detection of SHP2 according to the present invention is the overexpression of SHP2 relative to a control (healthy or normal sample), indicating a high risk of allergic rhinitis.

[0039] The SHP2 expression detection reagent of the present invention is a qPCR primer, but is not limited to this reagent, and also includes a SHP2 specific probe, a gene chip, etc.

[0040] In another embodiment, an agent that reduces or inhibits the expression of lncRNA FAM239A:31 is used in the preparation of a drug for allergic rhinitis. The agent is shRNA and siRNA, but is not limited thereto. As long as it can reduce or inhibit the expression of lncRNAFAM239A:31, such as gamper, antisense RNA, esiRNA, miRNA, RNA aptamer, TALEN, CRISPR and zinc finger nuclease.

[0041] In another embodiment, the nucleotide sequence of the lncRNA FAM239A:31 is as shown in SEQ ID NO:1.

[0042] In another embodiment, the lncRNA FAM239A:31 regulates genes through SHP2.

[0043] In another embodiment, the reagent for reducing or inhibiting the expression of SHP2 is used in the preparation of a drug for allergic rhinitis. The reagent is siRNA, but is not limited thereto, as long as it can reduce or inhibit the expression of SHP2, such as gamper, antisense RNA, esiRNA, miRNA, RNA aptamer, TALEN, CRISPR and zinc finger nuclease.

[0044] In another embodiment, the drug further comprises another biomacromolecule drug or chemical small molecule drug, and the biomacromolecule drug or chemical small molecule drug is used to reduce or inhibit SHP2 expression.

[0045] In another embodiment, the drug further includes another biological macromolecule drug or a chemical small molecule drug, and the biological macromolecule drug or the chemical small molecule drug is used to reduce or inhibit the expression of lncRNA FAM239A:31.

[0046] By qPCR, the expression of lncRNA FAM239A:31 was detected in 15 blood PBMCs of non-allergic rhinitis patients and 11 blood PBMCs of allergic rhinitis patients. It was found that the expression of lncRNA FAM239A:31 in peripheral blood PBMCs of allergic rhinitis patients was significantly higher than that in the control group.

[0047] After overexpressing lncRNA FAM239A:31, the expression levels of transcription factors and cytokines of Th1, Th2 and Treg cells were detected, and it was found that FAM239A promoted the differentiation of Th2 cells and inhibited the differentiation of Th1 and Treg cells, thereby breaking the differentiation balance of Th1 / Th2 / Treg cells.

[0048] By qPCR, the expression of SHP2 was detected in 8 patients with non-allergic rhinitis and 6 patients with allergic rhinitis, and it was found that SHP2 was highly expressed in the peripheral blood PBMCs of AR patients. By WB, the expression of SHP2 was detected in 3 patients with non-allergic rhinitis and 2 patients with allergic rhinitis, and it was found that SHP2 was highly expressed in the nasal mucosa of allergic rhinitis.

[0049] After overexpression of lncRNA FAM239A:31, the expression of SHP2, STAT5b, STAT1, P-STAT5b and P-STAT1 was detected, and it was found that lncRNA FAM239A:31 promoted the expression of SHP2, did not affect the expression of STAT5b and STAT1, but reduced the expression of P-STAT5b and P-STAT1. Inhibition of lncRNA FAM239A:31 had the opposite effect.

[0050] When lncRNA FAM239A:31 was overexpressed and SHP2 expression was inhibited, the expression of STAT5b, STAT1, P-STAT5b and P-STAT1 was detected, and it was found that the expression of STAT5b and STAT1 was almost unchanged, but the reduced expression of P-STAT5b and P-STAT1 could be restored. SHP2 acts downstream of lncRNA FAM239A:31 to mediate its regulation of Th2, Th1 and Treg cell differentiation.

[0051] In summary, lncRNA FAM239A:31 and SHP2 are highly expressed in peripheral blood PBMCs of patients with allergic rhinitis. Experiments have shown that lncRNA FAM239A:31 regulates the expression of SHP2, thereby regulating the dephosphorylation of P-STAT1 and P-STAT5b, thereby regulating helper T cells Th2, Th1 and Treg cells.

[0052] Example 1. Detection of lncRNA FAM239A:31 expression in human blood PBMCs

[0053] Blood was drawn from patients with allergic rhinitis and the control group, and PBMCs cells were collected using human blood PBMCs separation reagent (Ficoll, SparkJade). Trizol (SparkJade) was added to lyse and extract total cell RNA, which was reverse transcribed into cDNA. The qPCR primers were designed according to the sequence of lncRNA FAM239A:31 as follows: lncRNA FAM239A:31F: 5'-ACCTCTTGGCGAGAATGCAA-3'; R: 5'-TGCAAGCTGAGTTGTAGGGG-3'; GAPDH was used as an internal reference, and the GAPDH primers were as follows: F: 5'-TGACTTCAACAGCGACACCCA-3'; R: 5'-CACCCTGTTGCTGTAGCCAAA-3'. Then qPCR was used to detect the expression of lncRNA FAM239A:31. Compared with the control group, the expression of lncRNA FAM239A:31 in the blood of AR patients was significantly increased ( Figure 2 , A).

[0054] Example 2: Functional study of lncRNA FAM239A:31

[0055] In vitro isolated PBMCs and Jurkat cell lines, lncRNA FAM239A was overexpressed by lentiviral transfection: 31 (2×10 6 / tube of cells, centrifuge to collect cell pellets, add 20ul RPMI 1640 (BI company) medium to resuspend the cells, add lentivirus to make MOI=5, treat for 20min, transfer to six-well plates, add 2ml medium to continue culturing, collect cells after 48h, and detect by RT-qPCR or Western blotting. The primer sequence is shown in Table 1 below, and it was found that T-bet and FOXP3 expression decreased, GATA3 expression increased, and RORG expression did not change ( Figure 2 , B and D), and the corresponding IFNγ and IL-10 expressions were decreased, IL-4 expression was increased, and IL-17 expression remained unchanged ( Figure 2, C), indicating that the response of Th1 and Treg cells decreased, the response of Th2 cells increased, and the response of Th17 cells did not change significantly. The expression of lncRNA FAM239A:31 was knocked down by shRNA adenovirus, and the knockdown sequence was as follows: lncRNA FAM239A:31 target sequence-1: CCATCCTCCTGG CTAACAA (site 36); lncRNA FAM239A:31 target sequence-2: CCTTCCAGATGCCC TCAAT (site 487). We found that the expression of transcription factors T-bet and FOXP3 increased, the expression of GATA3 decreased, and there was no significant change in RORG. At the same time, the expression of inflammatory factors IFNγ and IL-10 increased, the expression of IL-4 decreased, and there was no significant difference in the expression of IL-17 ( Figure 2 , E and F), which showed that knockdown of lncRNA FAM239A:31 promoted Th1 and Treg cell responses, reduced Th1 cell responses, and had no significant effect on Th17 cell responses.

[0056] Table 1.

[0057]

[0058]

[0059] Construction of shRNA interference adenovirus

[0060] Construction of the vector hU6-MCS-CMV-EGFP

[0061] lncRNA FAM239A:31 target sequence-1: CCATCCTCCTGGCTAACAA (site 36)

[0062] lncRNA FAM239A:31 target sequence-2: CCTTCCAGATGCCCTCAAT (site 487)

[0063] Example 3: lncRNA FAM239A:31 affects helper T cell response by regulating downstream genes through SHP2

[0064] The nasal mucosa tissue was isolated and the protein was extracted. The expression of SHP2 was detected by western blotting using SHP2 antibody (reagent purchased from Sino Biological). We found that SHP2 was highly expressed in the nasal mucosa of AR patients ( Figure 4, A, B). The isolated human blood PBMCs were lysed by adding Trizol (SparkJade) and total cell RNA was extracted and reverse transcribed into cDNA. qPCR primers were designed according to the sequence of SHP2. The SHP2 detection primer sequences are as follows: F: 5'-GACTTTTGGCGGATGGTGTTCC-3'; R: '-CGGCGCTTTCTTT GACGTTCCT-3'; RT-qPCR was performed to detect the expression of SHP2. We found that SHP2 was highly expressed in PBMCs of AR patients ( Figure 4 , C). In vitro, we knocked down SHP2 expression using siRNA in cell lines (see Table 3 for siRNA sequences), and found that the expression of transcription factors T-bet and FOXP3 increased, and the expression of GATA3 decreased; the corresponding inflammatory factors IFNγ and IL-10 increased, and the expression of IL-4 decreased ( Figure 4 , D and E).

[0065] The nasal mucosa of AR patients and the control group were collected, and proteins were extracted for WB detection. It was found that the expression of STAT5b and STAT1 as well as phosphorylated STAT5b (P-STAT5b) and phosphorylated STAT1 (P-STAT1) in AR was lower than that in the control group ( Figure 3 , A and B). When lncRNA FAM239A:31 was knocked down in the cell lines, the expression levels of STAT5b and STAT1 as well as phosphorylated STAT5b (P-STAT5b) and phosphorylated STAT1 (P-STAT1) were increased as detected by WB ( Figure 3 , C and D). In cell lines overexpressing lncRNA FAM239A:31, the expression levels of STAT5b and STAT1 as well as phosphorylated STAT5b (P-STAT5b) and phosphorylated STAT1 (P-STAT1) were reduced as detected by WB ( Figure 3 , E and F). In cell lines overexpressing lncRNA FAM239A:31, WB analysis revealed an increase in SHP2 expression ( Figure 5 , A), and at the same time, lncRNA FAM239A:31 was knocked down in the cell line, and WB detection found that SHP2 expression was reduced ( Figure 5 , B). siRNA knockdown of SHP2 resulted in increased expression of P-STAT5b and P-STAT1 ( Figure 5 , C, D, and E), T-bet and FOXP3 expression increased, and GATA3 expression decreased ( Figure 5, C, F, G, and H). Moreover, simultaneous overexpression of lncRNA FAM239A:31 and knockdown of SHP2 could rescue the reduced expression of P-STAT1 and P-STAT5b, the reduced expression of T-bet and FOXP3, and the increased expression of GATA3 caused by overexpression of lncRNA FAM239A:31 alone ( Figure 5 , C, F, G and H).

[0066] Table 2. lncRNA FAM239A:31 siRNA interference sequences

[0067]

[0068] Table 3 SHP2 siRNA interference sequences

[0069]

[0070]

[0071] It will be apparent to those skilled in the art that the invention is not limited to the details of the exemplary embodiments described above and that the invention can be implemented in other specific forms without departing from the spirit or essential features of the invention. Therefore, the embodiments should be considered exemplary and non-limiting in all respects, and the scope of the invention is defined by the appended claims rather than the foregoing description, and it is intended that all variations falling within the meaning and scope of the equivalent elements of the claims be included in the invention. Any reference numeral in a claim should not be considered as limiting the claim to which it relates.

[0072] In addition, it should be understood that although the present specification is described according to implementation modes, not every implementation mode contains only one independent technical solution. This description of the specification is only for the sake of clarity. Those skilled in the art should regard the specification as a whole. The technical solutions in each embodiment may also be appropriately combined to form other implementation modes that can be understood by those skilled in the art. SEQUENCE LISTING <110> Yantai Yuhuangding Hospital <120> Application of lncRNA FAM239A:31 in the diagnosis and treatment of allergic rhinitis <130> 11 <160> 1 <170> PatentIn version 3.3 <210> 1 <211> 922 <212> DNA <213> Artificial <220> <223> lncRNA FAM239A: 31 nucleotide sequence <400> 1 caaggcaggt ggatcacaag gtcaggagat caagaccatc ctcctggcta acaaggtgaa 60 accctgtctc tactaaaaaa aatacaaaaa attagccggg cgtggtggca tgtacctgta 120 gtcccagcta ctcaggaggc tgaggcagga aaatcgcttg aacccaggaa gtggaggttg 180 cagtgagcca agatcatacc actgcactcc agcctgggcg acagagggag actccgtctc 240 aaaaagaaaa aaagcaataa atgctcttcc agaaaactca aaaatgaaga taagctaaaa 300 gaaaatggaa agcaccagaa taccagaatc tttccactca ctgatgatca gagttaatac 360 ctcagtgtct tctgtggctt cagcgtcacc tagtgcaggc tgccattcaa caaacgcatt 420 gtcaacagtc aaccaaaaga aacccattgg ccaccatacc ctgaggacta accctgacac 480 agatgccctt ccagatgccc tcaatagtct aactgattcc atcgccccag ccttggggga 540 gaagcactgc tgcctatgca ctccatttac agggttatag agtggaaagt cccacaatct 600 ttttcttctc tattttcaga aaaacgttga cctcttggcg agaatgcaaa gaagggaacg 660 cttgcttata cgctgttggt gaactgtcac ccctacaact cagcttgcaa ccagccctgg 720 ccaccagttt ccccacactg agctgaatat cggacatgcc catctcagac attccagccc 780 attctgaaat tccacatcga ttcacctgac aaagtctgaa gttccagggc aatttatctg 840 gaaaagctta cctggaatca cgtgtcattt caaccaacaa ctgttgaaga ggacgtggca 900 ttaaaaccaa gggtatcaat ta 922

Claims

1. Use of an agent for reducing or inhibiting the expression of lncRNA FAM239A:31 in the preparation of a drug for allergic rhinitis, wherein the agent is shRNA; the nucleotide sequence of the lncRNA FAM239A:31 is shown in SEQ ID NO:1; the target sequence of the shRNA is: CCATCCTCCTGGCTAACAA or CCTTCCAGATGCCCTCAAT.

2. The use according to claim 1, characterized in that: The lncRNA FAM239A:31 achieves gene regulation through SHP2.

Images