Novel genetic loci associated with ear rot resistance in maize

Abstract

Compositions and methods for identifying, selecting and producing corn plants with enhanced ear rot resistance are provided. Ear rot resistant corn plants and germplasms are also provided. In some embodiments, methods for identifying ear rot resistant corn plants or germplasms are provided. These methods may include detecting markers associated with enhanced ear rot resistance in the plants or germplasms.

Description

Technical Field

[0001] The present disclosure relates to compositions and methods for identifying, selecting, and producing corn plants with enhanced disease and / or pathogen resistance.

[0002] Sequence Listing

[0003] An ordered list is attached to this application, which is named 81918-WO-Seq_ST25.txt, created on August 10, 2020, and is approximately 192 kb in size. This sequence list is incorporated herein by reference in its entirety. This sequence list is submitted with this application via EFS-Web and complies with 37 CFR §1.824(a)(2)-(6) and (b). Background Art

[0004] Maize ear rot is one of the most destructive fungal diseases threatening maize production worldwide. Since it was first reported in the United States in 1946 (Ullstrup 1946), maize ear rot has been detected in many other countries, including South Africa, Mexico, Brazil, Canada, Germany, India, etc. (Logrieco et al. 2002; Van et al. 2007). Since then, maize ear rot has become increasingly serious worldwide, which is attributed to the deployment of susceptible varieties, high humidity during the archival period and late storage. In China, ear rot was first reported in Henan Province (Pan et al. 1987) and then spread to all maize-growing areas in the country. It is estimated that ear rot usually reduces yield by 10%-20%, and even by 50% or more in some severely infected areas (REN 1993). To make matters worse, Fusarium can produce a series of mycotoxins, such as deoxynivalenol, nivalenol, zearalenone, ochratoxin, aflatoxin, and fumonisin. As carcinogens, mycotoxins can be lethal to human health and cause neural tube birth defects in livestock (Rheeder et al. 1992; Chu et al. 1994; Missmer et al. 2006).

[0005] More than ten Fusarium species can cause ear rot in corn, and each fungus has its own favorable infection environment. For example, Fusarium verticillata prefers low rainfall and high humidity environments, while Fusarium graminearum prefers high rainfall and cool environments (Munkvold 2003). To date, Aspergillus ear rot (AER), Fusarium ear rot (FER), and Gibberellic ear rot (GER) are among the most serious and prevalent ear rot diseases in the world (Mesterházy et al. 2012; Chen et al. 2009; Li et al. 2007). In the field, the occurrence of ear rot is usually caused by mixed fungi rather than a single fungus. In addition to ear rot, Fusarium graminearum is also a causative agent of other diseases, such as Fusarium head blight (FHB) in small grain cereals (Sutton 1982). With the large-scale application of mechanical harvesting, ear rot has become one of the key inhibitors because infected ears cannot be automatically removed during harvesting, resulting in the contamination of corn kernels with fumonisin mycotoxins.

[0006] Resistance to corn ear rot is controlled by multiple small-effect quantitative trait loci (QTLs) that exhibit additive, dominant, and additive / dominant interaction genetic effects, with additive / dominant playing a key role in resistance performance in the field (Boling et al. 1965; Robertson et al. 2006; Ding et al. 2008; Chen et al. 2012). In the past few decades, a large number of QTL analyses have been conducted, and resistance QTLs have been found to be scattered on all ten maize chromosomes. Three resistance QTLs were identified on chromosomes 4, 5, and 10, and a major QTL on chromosome 4 could explain 17.95% of the total phenotypic variation (Chen et al. 2012). By using two F2900 cultivars sharing a common susceptible parent, the resistance of corn ear rot was confirmed by the presence of a single resistance QTL on chromosome 4. 2:3 Populations, 9 and 7 QTLs for resistance to Fusarium ear rot have been identified, fully explaining 11%-44% of the cumulative phenotypic variation. Of these, three were consistently detected in both populations, one on chromosome 3 and two on chromosome 6 (Pérez et al. 2001). Using RIL populations from crosses between 87-1 and Zong 3 inbred lines, QTLs were detected on chromosomes 3, 5, 8 and 10, of which two QTLs in bin 3.04 (each explaining 13%-22% of the phenotypic variation) were consistently detected in all environments (Ding et al. 2008). Of the 15 QTLs for Fusarium ear rot and the 17 QTLs for fumonisin B1, a total of 8 QTLs were found between them located on chromosomes 1, 2, 3, 6, 7 and 9, making it possible to select genotypes with low disease severity and fumonisin contamination (Valentina et al. 2017). Recently, the auxin regulatory protein gene ZmAuxRP1 was found to enhance maize resistance to stalk rot and ear rot by regulating the balance between root growth and disease resistance (Ye et al. 2018).

[0007] High-density molecular markers can be generated to detect small-effect QTLs. Similarly, high-density markers are important for identifying many alleles in genome-wide association studies (GWAS). In a core panel of 267 different maize inbred lines and 47,445 SNPs, 3 SNPs were found to be significantly associated with ear rot resistance in GWAS, which explained 3%-12% of the total genotype variation. Of these, 2 were associated with genes responsible for programmed cell death (Zila et al. 2013). A year later in 2014, a large-scale GWAS analysis was performed on the same group with 1,687 different inbred lines and 200,978 SNPs, identifying 7 important SNPs in both populations. All SNPs are located in exons, and the associated genes are associated with a variety of cellular processes (Zila et al. 2014). Recently, a GWAS was performed in a group of 818 tropical inbred lines with 43,424 SNPs. A total of 45 SNPs were significantly associated with Fusarium ear rot and were located within or near 38 candidate genes. Six loci in bins 3.06, 4.04, 4.08, 5.03, 5.04, and 10.03 were in regions previously reported to be associated with Fusarium ear rot resistance, and another two loci in bins 4.04 and 9.01 contained genes of unknown function (Chen et al. 2016).

[0008] Plants need to manipulate complex defense strategies to defend against pathogen invasion. After Fusarium inoculation, transcriptome reprogramming has been reported in both resistant and susceptible maize lines. The differentially expressed genes (DEGs) can be divided into more than ten categories, most of which are classified as “cell rescue, defense, and virulence”, encoding PR proteins, detoxification enzymes, and β-glucosidases, etc. (Alessandra et al. 2010). By analyzing large-scale DEGs in bracts of resistant and susceptible lines, genes related to defense responses, such as pathogenesis-related protein 1 (PR-1), permeabilin (PR-5), RAB GTP binding (RAB), small ubiquitin-like modifier (SUM), ethylene-responsive protein (ERF), S-adenosylmethionine synthase (SAMS), abscission stress protein (ABA), and MYB family transcription factor (MYB), were greatly induced in the resistant genotype (Yuan et al. 2013). After inoculation, genes related to secondary metabolic classes such as shikimic acid, lignin, flavonoids, and terpenoids were highly expressed in resistant strains (Lanubile et al. 2014). Fifteen lipoxygenase (LOX) pathway genes were strongly induced in resistant strains at 3 or 7 days post inoculation (dpi), while they were reduced or delayed in susceptible strains at 14 dpi. Resistant strains limited fungal growth and fumonisin accumulation, and this may be related to the activation of genes for jasmonic acid biosynthesis (Maschietto et al. 2015). In addition, the expression levels of PR genes in resistant strains (CO441 and CO433) were constitutively higher than those in susceptible strains (CO354 and CO389) before and after inoculation (Maschietto et al. 2016). Interestingly, it was also reported that fungal infection indeed induced considerable transcriptome changes in susceptible but not in resistant strains, particularly in pathways related to carbon and amino acid metabolism (Campos-Bermudez et al. 2013).

[0009] The collection and evaluation of resistant germplasm is the key to corn breeding for ear rot resistance. So far, different research institutions have identified hundreds of resistant corn lines, such as CO387, CO388, CO441 (Agriculture Canada) (Duan et al. 2015), GE440 and NC300 (University of North Carolina) (Clements et al. 2004), 87-1 (China Agricultural University) (Ding et al. 2008) and BT-1 (Henan Agricultural University) (Chen et al. 2002). These resistant lines have been used to cultivate disease-resistant hybrids, which have been significantly accelerated in the past decade (Santiago et al. 2013). Due to the small impact and easy influence of environmental conditions, it is very difficult to finely map resistant QTLs.

[0010] So far, except for ZmAuxRP1, no resistance gene has been cloned to corn ear rot (Ye et al. 2018). However, genetic control of corn ear rot is an effective way to reduce ear rot, so the applicant needs tools to develop as many resistance QTLs as possible, such as aggregating multiple resistance genes through marker-assisted selection to improve corn resistance to ear rot. In addition, the applicant expects plants to have increased resistance to ear rot. Summary of the invention

[0011] Compositions and methods for identifying, selecting, and producing corn plants with enhanced ear rot resistance are provided. Ear rot resistant corn plants and germplasm are also provided.

[0012] In some embodiments, methods of identifying ear rot resistant corn plants or germplasm are provided. These methods may include detecting markers associated with enhanced ear rot resistance in the plants or germplasm.

[0013] In some embodiments, methods of producing ear rot resistant plants are provided. These methods may include detecting the presence of a marker associated with enhanced ear rot resistance in corn germplasm and producing progeny plants from the corn germplasm.

[0014] In some embodiments, methods for selecting ear rot resistant corn plants or germplasm are provided. Such methods may include crossing a first corn plant or germplasm with a second corn plant or germplasm, wherein the first corn plant or germplasm comprises a marker associated with enhanced ear rot resistance, and selecting progeny plants or germplasm having the marker.

[0015] In some embodiments, methods for introgressing alleles associated with enhanced ear rot resistance into corn plants or germplasm are provided. Such methods can include hybridizing a first corn plant or germplasm comprising an allele associated with enhanced ear rot resistance with a second corn plant or germplasm lacking the allele, and optionally repeatedly backcrossing a progeny plant comprising the allele with the second plant or germplasm to produce an ear rot resistant plant or germplasm comprising an allele associated with enhanced ear rot resistance. Progeny comprising an allele associated with enhanced ear rot resistance can be identified by detecting the presence of a marker associated with the allele in its genome.

[0016] Also provided are corn plants and / or germplasm identified, produced or selected by the methods of the invention, as well as any progeny and / or seeds derived from corn plants or germplasm identified, produced or selected by these methods.

[0017] Also provided are non-naturally occurring corn seeds, plants, and / or germplasm comprising one or more markers associated with enhanced ear rot resistance.

[0018] A marker associated with enhanced ear rot resistance may comprise, consist essentially of, or consist of a single allele or a combination of alleles at one or more genetic loci.

[0019] Additionally, some embodiments encompass combinations of corn plants selected, identified, or produced by using the markers described herein in combination with commercial fungicides for controlling pathogens (eg, Fusarium).

[0020] The above and other objects and aspects of the present invention are explained in more detail below.

[0021] Brief Description of Sequence Listing

[0022] Primers and probes for detecting intervals and alleles of the disclosure are listed in Table XI, Table XII, and Table XIII. BRIEF DESCRIPTION OF THE DRAWINGS

[0023] Figure 1 is the distribution of the Disease Severity Index (DSI) estimated by BLUP in the GWAS population.

[0024] Figure 2A The quantile-quantile and Manhattan plots of maize ear rot in Beijing in summer 2017 are shown (A, B).

[0025] Figure 2B The quantile-quantile and Manhattan plots of maize ear rot in Hainan in winter 2017 are shown (C, D).

[0026] Figure 2C The quantile-quantile and Manhattan plots of maize ear rot in Beijing in summer 2018 are shown (E, F).

[0027] Figure 2D Quantile-quantile and Manhattan plots of corn ear rot in BLUP are shown (G, H).

[0028] The dynamic expression patterns of genes at early stage after inoculation are shown in Figure 3. The genes in the resistant line CIMBL47 were transiently induced by the pathogen and reached their expression peaks at 0.5 hpi (AF) and 1.5 hpi (GL).

[0029] Figure 4 Differentially expressed genes (DEGs) involved in plant hormone signaling pathways are shown. Red and blue colors mark up-regulated and down-regulated DEGs in CIMBL47 compared with SY1035, respectively; while green indicates mixed (up and down) regulated DEGs.

[0030] Figure 5Differentially expressed genes (DEGs) involved in phenylpropanoid biosynthesis are shown. Only up-regulated DEGs (marked in red) were detected in CIMBL47 compared with SY1035 at 1.5 hpi.

[0031] Figure S1 The distribution of disease severity index (DSI) of the GWAS population under three environmental conditions is shown.

[0032] Figure S2 Functional categories of potential resistance genes revealed by GWAS are shown.

[0033] Figures S3.A-S3.E GO enrichment of differentially expressed genes (DEGs) between resistant CIMBL47 (R) and susceptible SY1035 (S) lines is shown. Scatter plot of enriched GO terms for R vs. S at 0 (A), 0.5 (B), 1.5 (C), 3 (D), and 6 (E) hours after inoculation. Enriched GO terms are listed in the ordinate; while the number of DEGs is represented in the abscissa. Differential colors are used to distinguish biological processes, cellular components, and molecular functions.

[0034] Figures S4.A-S4.E KEGG enrichment of differentially expressed genes (DEGs) between resistant CIMBL47 (R) and susceptible SY1035 (S) lines from 0 to 6 hpi is shown.

[0035] Figures S5.A.-S5.E show the distribution of DEGs of differential pathways between resistant CIMBL47 (R) and susceptible SY1035 (S) lines. The percentage of DEGs of differential pathways between R and S was estimated at 0 (A), 0.5 (B), 1.5 (C), 3 (D), and 6 (E) hours after inoculation.

[0036] Figure S6 shows the dynamic expression patterns of genes at early stages after inoculation. The genes in the susceptible line SY1035 were down-regulated to the lowest point at 1.5 hpi.

[0037] Figure S7 The dynamic expression pattern of the gene in the early stage after inoculation is shown. The gene is highly expressed in the resistant line CIMBL47 compared to the susceptible line SY1035.

[0038] Figure S8 The dynamic expression pattern of the gene in the early stage after inoculation is shown. The gene is highly expressed in the susceptible line SY1035 compared to the resistant line CIMBL47.

[0039] Figures S9.1 and S9.2 show changes in the expression levels of genes encoding hormone synthesis related to plant hormone signaling pathways.

[0040] Figure S10Corn half kernels used for RNA-seq analysis are shown. DETAILED DESCRIPTION

[0041] The present disclosure provides compositions and methods for identifying, selecting and / or producing corn plants with enhanced ear rot resistance, as well as corn plants identified, selected and / or produced by the methods of the present invention. In addition, the present invention provides corn plants and / or germplasm having one or more markers associated with enhanced ear rot resistance within their genome.

[0042] definition

[0043] Although it is believed that the following terms are well understood by one of ordinary skill in the art, the following definitions are set forth to facilitate understanding of the disclosed subject matter.

[0044] Unless otherwise defined below, all technical and scientific terms used herein are intended to have the same meaning as commonly understood by those of ordinary skill in the art. References to the technology employed herein are intended to reference technology commonly understood in the art, including variations of those technologies that are clear to those of ordinary skill in the art or replacement of equivalent technologies.

[0045] As used herein, the term "a / an" or "the" may refer to one or more than one. For example, "a / an" marker may refer to one marker or multiple markers.

[0046] As used herein, the term "and / or" refers to and encompasses any and all possible combinations of one or more of the associated listed items, as well as the lack of combinations when interpreted in the alternative ("or").

[0047] As used herein, the term "about" when used with respect to a measurable value (such as an amount of mass, dose, time, temperature, etc.) is meant to encompass variations of 20%, 10%, 5%, 1%, 0.5%, or even 0.1% of the specified amount.

[0048] The term "consisting essentially of (and grammatical variations thereof), when applied to a polynucleotide sequence of the invention, means a polynucleotide sequence consisting of both the recited sequence (e.g., SEQ ID NO) and a total of ten or fewer (e.g., 1, 2, 3, 4, 5, 6, 7, 8, 9, or 10) additional nucleotides at the 5' and / or 3' ends of the recited sequence, such that the function of the polynucleotide sequence is not substantially altered. The total of ten or fewer additional nucleotides includes the total number of additional nucleotides at both ends added together. The term "substantially altered," when applied to a polynucleotide of the invention, means that the ability to express a polynucleotide sequence is increased or decreased by at least about 50% or more compared to the expression level of a polynucleotide sequence consisting of the recited sequence.

[0049] As used herein, the term "allele" refers to one of two or more different nucleotides or nucleotide sequences occurring at a particular locus.

[0050] A marker is "associated" with a trait when it is linked to the trait and when the presence of the marker indicates whether and / or to what extent the desired trait or trait form will occur in the plant / germplasm containing the marker. Similarly, a marker is "associated" with an allele when it is linked to the allele and when the presence of the marker indicates whether the allele is present in the plant / germplasm containing the marker. For example, a "marker associated with enhanced ear rot resistance" refers to a marker whose presence or absence can be used to predict whether and / or to what extent a plant will exhibit an ear rot resistance phenotype.

[0051] As used herein, the terms "backcross" and "backcrossed" refer to a process whereby a progeny plant is repeatedly crossed back to one of its parents. In a backcrossing protocol, the "donor" parent refers to the parent plant that has the desired gene or locus to be introgressed. The "recipient" parent (used one or more times) or "recurrent" parent (used two or more times) refers to the parent plant into which the gene or locus is introgressed. See, for example, Ragot, M. et al., Marker-assisted Backcrossing: A Practical Example, Techniques et Utilisations des Marqueurs Moleculaires Les Colloques, Vol. 72, pp. 45-56 (1995); and Openshaw et al., Marker-assisted Selection in Backcross Breeding, Proceedings of the Symposium "Analysis of Molecular Marker Data," pp. 41-43 (1994). The initial cross produces the F1 generation. The term "BC1" refers to the second use of the recurrent parent, "BC2" refers to the third use of the recurrent parent, etc.

[0052] Centimorgan ("cM") is a unit of measure of recombination frequency. One cM equals a 1% chance that a marker at one genetic locus will segregate with a marker at a second locus due to crossover in a single generation.

[0053] As used herein, the term "chromosome interval defined by and including" used with respect to a particular locus and / or allele refers to the chromosomal interval defined by and including said locus / allele.

[0054] As used herein, the term "cross" or "crossed" refers to the fusion of gametes through pollination to produce progeny (e.g., cells, seeds, or plants). The term encompasses both sexual crossing (one plant being pollinated by another) and selfing (self-pollination, e.g., when the pollen and ovules are from the same plant). The term "crossing" refers to the act of fusing gametes through pollination to produce progeny.

[0055] As used herein, the phrase "introduction into a genome" refers to any known method that can be used to insert a given nucleotide sequence into the genome of an organism. For example, "introduction into a genome" of a soybean plant would encompass traditional plant breeding methods, transgenic expression of a gene, or gene editing methods (i.e., CRISPR, TALEN, etc.), wherein the plant did not have the nucleotide sequence in its genome prior to the introduction.

[0056] As used herein, the terms "cultivar" and "variety" refer to a group of similar plants that can be distinguished from other varieties within the same species by structural or genetic characteristics and / or performance.

[0057] As used herein, the terms "desired allele," "target allele," and "favorable allele" are used interchangeably to refer to an allele associated with a desired trait. In some embodiments, "desired allele" and / or "target allele" can be associated with an increase or decrease in or in a given trait, depending on the nature of the desired phenotype. In some embodiments, "desired allele" and / or "target allele" can be associated with changes in morphology, color, etc.

[0058] As used herein, the term "enhanced ear rot resistance" refers to an improvement, enhancement or increase in a plant's ability to tolerate and / or reproduce despite infection with Fusarium verticillium compared to one or more control plants (e.g., one or both of the parents, or a plant lacking a marker associated with enhanced ear rot resistance). Enhanced ear rot resistance includes any mechanism (other than whole plant immunity or resistance) that reduces the expression of symptoms indicative of infection.

[0059] As used herein, the terms "excellent" and "superior lines" refer to any lines produced by breeding and selection for desired agronomic performance. Superior lines can be substantially homozygous. Numerous superior lines are available and known to those skilled in the art.

[0060] As used herein, the term "elite germplasm" refers to any germplasm derived from or capable of producing superior plants.

[0061] As used herein, the terms "exotic," "exotic strain," and "exotic germplasm" refer to any plant, strain, or germplasm that is not superior. Typically, an exotic plant / germplasm is not derived from any known superior plant or germplasm, but is selected to introduce one or more desired genetic elements into a breeding program (e.g., to introduce novel alleles into a breeding program).

[0062] A "genetic map" is a description of the genetic linkage relationships between loci on one or more chromosomes within a given species, usually depicted in a graphical or tabular form. For each genetic map, the distances between loci are measured by the frequencies of recombination between them. Recombination between loci can be detected using a variety of markers. A genetic map is the product of the mapping population, the types of markers used, and the polymorphic potential of each marker between different populations. The order and genetic distances between loci can differ from one genetic map to another.

[0063] As used herein, the term " genotype " refers to the genetic composition of the individual (or individual group) at one or more genetic loci in contrast to observable and / or detectable and / or demonstrated proterties (phenotype). Genotype is defined by one or more alleles of one or more known loci of its parent by individual inheritance. The term genotype can be used to refer to the genetic composition of the individual at a single locus, a plurality of loci, or more generally, the term genotype can be used to refer to the individual inheritance of all genes in its genome. Genotype can be, for example, indirectly characterized using a mark and / or directly characterized by nucleic acid sequencing.

[0064] As used herein, the term "germplasm" refers to genetic material belonging to or coming from an individual (e.g., plant), an individual population (e.g., plant strain, variety or family), or a clone derived from a strain, variety, species or culture. Germplasm can be part of an organism or cell, or can be separated from the organism or cell. Typically, germplasm provides genetic material with a specific molecular makeup that provides a physical basis for some or all of the genetic qualities of an organism or cell culture. As used herein, germplasm can refer to seeds, cells (including protoplasts and callus), or tissues from which new plants can be grown, and plant parts (e.g., stems, buds, roots, leaves, etc.) that can be cultured into whole-strain plants.

[0065] "Haplotype" is the genotype of an individual at multiple genetic loci, i.e., a combination of alleles. Typically, the genetic loci defining a haplotype are physically and genetically linked, i.e., on the same chromosome segment. The term "haplotype" can refer to a polymorphism at a specific locus (e.g., a single marker locus), or a polymorphism at multiple loci along a chromosome segment.

[0066] As used herein, the term "heterozygous" refers to a genetic state in which different alleles are located at corresponding loci on homologous chromosomes.

[0067] As used herein, the term "homozygous" refers to a genetic state in which identical alleles are located at corresponding loci on homologous chromosomes.

[0068] As used herein, the term "hybrid" refers to a seed and / or plant produced when at least two genetically non-identical parents are crossed.

[0069] As used herein, the term "inbred" refers to a substantially homozygous plant or variety. The term can refer to a plant or variety that is substantially homozygous throughout the genome, or a plant or plant variety that is substantially homozygous with respect to a particular portion of the genome of interest.

[0070] As used herein, the term "indel" refers to an insertion or deletion in a pair of nucleotide sequences, wherein a first sequence may be referred to as having an insertion relative to a second sequence, or the second sequence may be referred to as having a deletion relative to the first sequence.

[0071] As used herein, the terms "introgression," "introgressing," and "introgressed" refer to the natural and artificial transfer of a desired allele or combination of desired alleles of one or more genetic loci from one genetic background to another. For example, a desired allele at a given locus can be transferred to at least one progeny by sexual hybridization between two parents of the same species, wherein at least one of the parents has the desired allele within its genome. Alternatively, for example, transfer of the allele can occur by recombination between two donor genomes, such as in fused protoplasts, wherein at least one donor protoplast has the desired allele in its genome. The desired allele can be a selected allele of a marker, a QTL, a transgenic, etc. Progeny comprising the desired allele can be repeatedly backcrossed with a strain having a desired genetic background, and selected for the desired allele, with the result that the desired allele becomes fixed in a desired genetic background. For example, a marker associated with enhanced ear rot resistance can be infiltrated from a donor into a recurrent parent that does not have ear rot resistance. The resulting progeny can then be repeatedly backcrossed and selected until the progeny has one or more ear rot resistance alleles in the recurrent parent background.

[0072] As used herein, the term "linkage" refers to the degree of association of a marker locus with another marker locus or some other loci (e.g., SDS tolerance locus). The linkage relationship between a molecular marker and a phenotype can be given as a "probability" or "adjusted probability". Linkage can be expressed as a desired limit or range. For example, in some embodiments, when a marker is separated by less than about 50, 40, 30, 25, 20, or 15 map distance units (or cM), any marker is linked to any other marker (genetically and physically).

[0073] In some aspects of the present invention, it is advantageous to limit the range of linkage (e.g., from about 10 cM and about 20 cM, from about 10 cM and about 30 cM, or from about 10 cM and about 40 cM). The tighter the linkage of the marker to the second locus, the better the indication effect of the marker on the second locus. Therefore, "tightly linked loci" (e.g., marker loci and second loci) show about 10%, 9%, 8%, 7%, 6%, 5%, 4%, 3%, or 2% or less recombination frequency between loci. In certain embodiments, the related loci show about 1% or less (e.g., about 0.75%, 0.5%, 0.25% or less) recombination frequency. Two loci that are located on the same chromosome and have a distance that allows the recombination between the two loci to occur at a frequency of less than about 10% (e.g., about 9%, 8%, 7%, 6%, 5%, 4%, 3%, 2%, 1%, 0.75%, 0.5%, or 0.25% or less) can also be considered to be "adjacent" to each other. Because one cM is the distance between two markers that show a recombination frequency of 1%, any marker is closely linked (genetically and physically) to any other marker that is in close proximity (e.g., at a distance equal to or less than about 10 cM). Two closely linked markers on the same chromosome can be located about 9 cM, 8 cM, 7 cM, 6 cM, 5 cM, 4 cM, 3 cM, 2 cM, 1 cM, 0.75 cM, 0.5 cM or 0.25 cM or less from each other.

[0074] As used herein, the term "linkage disequilibrium" refers to the non-random separation of genetic loci or proteus (or both). In either case, linkage disequilibrium means that the associated loci are physically close enough along a section of chromosome so that they are separated together with a frequency higher than random (i.e. non-random) (in the case of co-segregated proteus, the loci controlling these proteus are close enough to each other). Markers showing linkage disequilibrium are considered to be linked. The linked loci are co-segregated more than 50% of the time (e.g., from about 51% to about 100% of the time). In other words, two co-segregated markers have a recombination frequency less than 50% (and, by definition, separated less than 50cM on the same chromosome). As used herein, linkage can be present between two markers, or alternatively, between marker and phenotype. Marker loci can be "associated" (linkage) with proteus (such as SDS tolerance). For example, the degree of linkage of a molecular marker with a target proteus is measured as the statistical probability of the co-segregation of the molecular marker with the phenotype.

[0075] Linkage disequilibrium is most commonly measured using the measure r 2 Evaluation, the measure r 2The calculation was performed using the formula described in Hill and Robertson, Theor. Appl. Genet. 38:226 (1968). 2 =1, there is complete linkage disequilibrium between the two marker loci, meaning that the markers have not yet undergone recombination segregation and have the same allele frequency. 2 Values ​​greater than 1 / 3 indicate sufficiently strong linkage disequilibrium to be useful for mapping. Ardlie et al., Nature Reviews Genetics 3:299 (2002). Thus, when r between paired marker loci is 2 When the value is greater than or equal to about 0.33, 0.4, 0.5, 0.6, 0.7, 0.8, 0.9, or 1.0, the alleles are in linkage disequilibrium.

[0076] As used herein, the term "linkage equilibrium" describes a situation in which two markers segregate independently, ie, randomly distribute among progeny. Markers that exhibit linkage equilibrium are considered unlinked (regardless of whether they are located on the same chromosome or not).

[0077] A "locus" is a position on a chromosome where a gene or marker or allele is located. In some embodiments, a locus may encompass one or more nucleotides.

[0078] As used herein, the terms "marker" and "genetic marker" are used interchangeably to refer to nucleotides and / or nucleotide sequences that have been associated with a phenotype, a trait, or a trait form. In some embodiments, a marker can be associated with an allele or a target allele and can indicate the presence or absence of an allele or a target allele in a cell or organism. The marker can be, but is not limited to, an allele, a gene, a haplotype, a restriction fragment length polymorphism (RFLP), a simple sequence repeat (SSR), a random amplified polymorphic DNA (RAPD), a cleaved amplified polymorphic sequence (CAPS) (Rafalski and Tingey, Trends in Genetics [Genetics Trends] 9:275 (1993)), an amplified fragment length polymorphism (AFLP) (Vos et al., Nucleic Acids Res. [Nucleic Acids Research] 23:4407 (1995)), single nucleotide polymorphism (SNP) (Brookes, Gene [Gene] 234:177 (1993)), sequence characterized amplified region (SCAR) (Paran and Michelmore, Theor. Appl. Genet. [Theoretical and Applied Genetics] 85:985 (1993)), sequence tagged site (STS) (Onozaki et al., Euphytica [Proofing Consulting] 138:255 (2004)), single strand conformation polymorphism (SSCP) (Orita et al., Proc. N atl.Acad.Sci.USA [Proceedings of the National Academy of Sciences of the United States of America] 86:2766 (1989)), intersimple sequence repeats (ISSR) (Blair et al., Theor.Appl.Genet. [Theoretical and Applied Genetics] 98:780 (1999)), inter-retrotransposon amplification polymorphisms (IRAP), retrotransposon microsatellite amplification polymorphisms (REMAP) (Kalendar et al., Theor.Appl.Genet. [Theoretical and Applied Genetics] 98:704 (1999)), chromosomal intervals or RNA cleavage products (such as Lynx tags). The marker can be present in a genomic nucleic acid or an expressed nucleic acid (e.g., EST). The term marker can also refer to a nucleic acid used as a probe or primer (e.g., primer pair) for amplification, hybridization, and / or detection of nucleic acid molecules according to methods well known in the art.

[0079] The marker corresponding to the genetic polymorphism between the members of the colony can be detected by methods generally recognized in the art. These methods include, for example, nucleic acid sequence, hybridization method, amplification method (for example, sequence-specific amplification method based on PCR), restriction fragment length polymorphism detection (RFLP), isozyme marker detection, polynucleotide polymorphism detection by allele-specific hybridization (ASH), amplification variable sequence detection of plant genome, autonomous sequence replication detection, simple repeat sequence detection (SSR), single nucleotide polymorphism detection (SNP), and / or amplified fragment length polymorphism detection (AFLP). Known generally recognized methods are also used to detect expressed sequence tags (ESTs) and SSR markers derived from EST sequences, as well as randomly amplified polymorphic DNA (RAPD).

[0080] A "marker allele," also described as an "allele of a marker locus," may refer to one of a plurality of polymorphic nucleotide sequences found at a marker locus that are polymorphic for the marker locus in a population.

[0081] "Marker assisted selection" (MAS) is a method of selecting phenotypes based on marker genotypes. In some embodiments, marker genotypes are used to identify plants that will be selected for breeding programs or for planting. In some embodiments, marker genotypes are used to identify plants that will not be selected for breeding programs or for planting (i.e., counter-selected plants), allowing them to be removed from the breeding / planting population.

[0082] As used herein, the term "marker locus (marker locus and marker loci)" refers to one or more specific chromosomal locations in an organism's genome where one or more specific markers can be found. The marker locus can be used to track the presence of a second linked locus (e.g., a linked locus that encodes or contributes to the expression of a phenotypic trait). For example, the marker locus can be used to monitor the separation of alleles at a locus (e.g., a QTL or a single gene) that are genetically or physically linked to the marker locus.

[0083] As used herein, the terms "label probe" and "probe" refer to nucleotide sequences or nucleic acid molecules that can be used to detect the presence of one or more specific alleles in a marker locus (e.g., a nucleic acid probe that is complementary to all or part of the marker or marker locus by nucleic acid hybridization). Label probes comprising about 8, 10, 15, 20, 30, 40, 50, 60, 70, 80, 90, 100 or more consecutive nucleotides can be used for nucleic acid hybridization. Alternatively, in some aspects, a label probe refers to any type of probe that can distinguish (i.e., genotype) a specific allele present at a marker locus.

[0084] As used herein, when identifying linked loci, the term "molecular marker" can be used to refer to genetic markers as defined above, or it is used as a coded product (for example, protein) of a reference point.Molecular markers can be derived from a genomic nucleotide sequence or an expressed nucleotide sequence (for example, from RNA, cDNA, etc. of splicing). The term also refers to a nucleotide sequence complementary to a marker sequence or to a nucleotide sequence located at its flank, for example, as a nucleotide sequence of a probe and / or a primer that can amplify a marker sequence. When a nucleotide sequence is specifically hybridized in a solution, these nucleotide sequences are "complementary" (for example, according to Watson-Crick (Watson-Crick) base pairing principle). When located on an indel region, some of the markers described herein are also referred to as hybridization markers. This is because, by definition, the insertion region is about the polymorphism of a plant not having the insertion. Therefore, the marker only needs to indicate whether the indel region exists. Any suitable marker detection technology can be used to identify this hybridization marker, for example, for the SNP technology in the example provided herein.

[0085] "Non-natural corn varieties" are corns of any kind not present in nature. "Non-natural corn varieties" can be produced by any method known in the art, including but not limited to transformation of corn plants or germplasm, transfection of corn plants or germplasm and hybridization of naturally occurring corn varieties with non-natural corn varieties. In some embodiments, "non-natural corn varieties" can include one or more heterologous nucleotide sequences. In some embodiments, "non-natural corn varieties" can include one or more non-natural copies of naturally occurring nucleotide sequences (i.e., foreign copies of genes naturally present in soybeans). In some embodiments, "non-natural corn varieties" can include non-natural combinations of two or more naturally occurring nucleotide sequences (i.e., two or more naturally occurring genes that do not naturally occur in the same corn).

[0086] As used herein, term " offspring " plant refers to any plant of the progeny of nutrition or sexual reproduction as one or more parental plants or its descendant.For example, offspring plant can be obtained by cloning or selfing of parental plant or by the hybridization of two parental plants, and comprises selfing body and F1 or F2 or even more distant generations.F1 is the first generation offspring (at least one of two parents is the donor used as proterties for the first time) produced from two parents, and the offspring of second generation (F2) or subsequent generation (F3, F4 etc.) is the sample produced from the selfing of F1, F2 etc.Therefore, F1 can be (and in some embodiments is) the hybrid produced from the hybridization between two pure breeding parents (pure breeding is isozygous for proterties), and F2 can be (and in some embodiments is) the offspring produced from the self-pollination of F1 hybrid.

[0087] As used herein, the terms "phenotype," "phenotypic trait," or "trait" refer to one or more traits and / or performance of an organism. A phenotype is a performance observable to the naked eye or by any other evaluation means known in the art (e.g., microscopy, biochemical analysis, or electromechanical assays). In some cases, a phenotype or trait is directly controlled by a single gene or genetic locus, i.e., a "monogenic trait." In other cases, a phenotype or trait is the result of multiple genes. It should be noted that, as used herein, the term "ear rot resistance phenotype" takes into account environmental conditions that may affect ear rot resistance so that the effect is real and repeatable.

[0088] As used herein, the term "plant" can refer to a whole plant, any part thereof, or a cell or tissue culture derived from a plant. Therefore, the term "plant" can refer to any of the following: a whole plant, a plant component or organ (e.g., root, stem, leaf, bud, flower, kernel, ear, etc.), a plant tissue, a seed, and / or a plant cell. A plant cell is a plant cell obtained from a plant, or is a plant cell derived from a cell taken from a plant by culturing. Therefore, the term "corn plant" can refer to a whole corn plant, one or more parts of a corn plant (e.g., root, root tip, stem, leaf, bud, flower, seed, cotyledon, etc.), a corn plant cell, a corn plant protoplast, and / or a corn plant callus.

[0089] As used herein, the term "polymorphism" refers to the variation in the nucleotide sequence at the locus, wherein the variation is too common, and is not merely due to spontaneous mutation. Polymorphism can be a single nucleotide polymorphism (SNP) or an insertion / deletion polymorphism (also referred to as "indel" herein). In addition, the variation can be in transcriptional profile or methylation pattern. One or more polymorphic sites of nucleotide sequence can be determined by carrying out nucleotide sequence comparison at one or more loci in two or more germplasm entries.

[0090] As used herein, the term "population" refers to a genetically heterogeneous collection of plants sharing a common genetic derivation.

[0091] As used herein, the terms "progeny" and "progeny plants" refer to plants produced by asexual or sexual reproduction of one or more parent plants. Progeny plants can be obtained by cloning or selfing of a single parent plant, or by crossing two parent plants.

[0092] As used herein, the term "reference sequence" refers to a determined nucleotide sequence used as the basis for nucleotide sequence comparison. For example, a reference sequence of a marker is obtained by genotyping multiple strains at one or more loci of interest, comparing these nucleotide sequences in a sequence alignment program, and then obtaining a consensus sequence for the comparison. Therefore, the reference sequence identifies the polymorphism in the allele at the locus. The reference sequence may not be a copy of the actual nucleic acid sequence from any particular organism; however, it is useful for designing primers and probes for the actual polymorphism in one or more loci.

[0093] As used herein, the term "parental line" refers to the line from which a given plant is derived. A "parental line" encompasses multiple generations.

[0094] As used herein, the terms "ear rot resistance" and "ear rot resistance" refer to the tolerance and / or reproductive ability of a plant despite infection with Fusarium, such as Fusarium verticillioides. When used with respect to germplasm, these terms refer to the tolerance and / or reproductive ability of a plant produced from the germplasm despite infection with Fusarium, such as Fusarium verticillioides. In some embodiments, infected ear rot resistant plants can be produced the same (or nearly the same) as uninfected soybean plants. Typically, if a plant or germplasm displays "enhanced ear rot resistance," it is labeled "ear rot resistance."

[0095] An "unfavorable allele" of a marker is a marker allele that segregates with the unfavorable plant phenotype, thus providing the benefit of identifying plants that can be eliminated from a breeding program or planting.

[0096] Genetic mapping

[0097] Genetic loci associated with a particular phenotype, such as ear rot resistance, can be located in the genome of an organism. By identifying markers or clusters of markers that co-segregate with the trait of interest, breeders can rapidly select for the desired phenotype by selecting the appropriate markers (a method known as marker-assisted selection or MAS). Breeders can also use such markers to simulate genotype design in silico and perform whole genome selection.

[0098] The present invention provides, inter alia, markers associated with enhanced ear rot resistance. Detection of these markers and / or other linked markers can be used to identify, select and / or produce ear rot resistant plants and / or eliminate plants that are not ear rot resistant from breeding programs or plantings.

[0099] Markers associated with enhanced ear rot resistance

[0100] This paper identifies the mark that is associated with enhanced ear rot resistance.Mark of the present invention can comprise a single allele or a combination of alleles at one or more genetic loci.For example, the mark can comprise one or more marker alleles positioned in the first chromosome interval and one or more marker alleles positioned in the second chromosome interval.

[0101] Markers of the invention are described herein with respect to the location of marker loci in a published construction of the maize B73 reference genome (AGPv4).

[0102] Marker-Assisted Selection

[0103] Markers can be used in a variety of plant breeding applications. See, e.g., Staub et al., Hortscience 31:729 (1996); Tanksley, Plant Molecular Biology Reporter 1:3 (1983). One of the main areas of interest is the use of marker-assisted selection (MAS) to increase the efficiency of backcrossing and gene introgression. Typically, MAS utilizes genetic markers that have been identified as having a significant probability of co-segregating with a desired trait. Such markers are presumed to be located in / near a gene that produces the desired phenotype, and their presence indicates that the plant will have the desired trait. Plants with the marker are expected to transfer the desired phenotype to their progeny.

[0104] Markers that exhibit linkage with loci that affect desired phenotypic traits provide useful tools for selecting traits in plant populations. This is especially true when the phenotype is difficult to measure or occurs in the later stages of plant development. Since DNA marker determination is more labor-saving than field phenotyping and the physical space occupied is smaller, larger populations can be measured, increasing the probability of finding recombinants with target segments that move from donor strains to recipient strains. The tighter the linkage, the more useful the marker, because recombination is unlikely to occur between the marker and the gene that causes or causes the trait. Using flanking markers reduces the probability of false positive selection. Ideally, the gene itself has a marker so that the recombination between the marker and the gene cannot occur. Such markers are called "perfect markers".

[0105] When genes are introgressed by MAS, not only the genes but also the flanking regions are introduced. Gepts, Crop Sci [Crop Science] 42: 1780 (2002). This is called "linkage drag". In the case where the donor plant is very unrelated to the recipient plant, these flanking regions carry additional genes that can encode agronomically undesirable traits. Even after multiple cycles of backcrossing with elite soybean lines, this "linkage drag" can also lead to reduced yields or other negative agronomic characteristics. This is sometimes also called "yield drag". The size of the flanking regions can be reduced by additional backcrossing, although this is not always successful because breeders cannot control the size of the region or the recombination breakpoints. Young et al., Genetics [Genetics] 120: 579 (1998). In classical breeding, it is usually only by chance that recombination that helps reduce the size of the donor segment is selected. Tanksley et al., Biotechnology [Biotechnology] 7: 257 (1989). Even after 20 backcrosses, it is possible to find a fairly large donor chromosome fragment that is still linked to the gene and is selected. However, if markers are used, rare individuals that have undergone recombination near the target gene can be selected. In 150 backcross plants, there is a 95% chance that at least one plant will experience hybridization within 1cM (based on a single meiotic map distance) of the gene. Markers allow clear identification of these individuals. Using an additional backcross of 300 plants, there is a 95% probability of hybridization within a 1cM single meiotic map distance on the other side of the gene, thereby producing a segment near the target gene less than 2cM based on a single meiotic map distance. This can be achieved in two generations with markers, while an average of 100 generations is required without markers. See Tanksley et al., supra. When the exact location of a gene is known, the flanking markers around the gene can be used to select recombination in different population sizes. For example, in smaller populations, it is expected that recombination can be further away from the gene, so more distal flanking markers are needed to detect the recombination.

[0106] The availability of an integrated linkage map of the maize genome containing density-enhanced public maize markers has facilitated maize genetic mapping and MAS.

[0107] Of all the types of molecular markers, SNPs are the most abundant and have the potential to provide the highest genetic map resolution. Bhattramakki et al., Plant Molec.Biol. [Plant Molecular Biology] 48: 539 (2002). SNPs can be determined in a so-called "ultra-high throughput" manner because they do not require large amounts of nucleic acid and the automation of the determination is direct. SNPs also have the benefit of being a relatively low-cost system. These three factors together make the use of SNPs in MAS highly attractive. Several methods can be used for SNP genotyping, including but not limited to: hybridization, primer extension, oligonucleotide ligation, nuclease cleavage, microsequencing, and coded spheres. Such methods have been reviewed in various publications: Gut, Hum. Mutat. [Human Mutation] 17:475 (2001); Shi, Clin. Chem. [Clinical Chemistry] 47:164 (2001); Kwok, Pharmacogenomics [Pharmacogenomics] 1:95 (2000); Bhattramakki and Rafalski, Discovery and application of single nucleotide polymorphism markers in plants [Plant Genotyping: The DNA Fingerprinting of Plants], CABI Publishing Company, Wallingford (2001). A wide range of commercially available technologies use these and other methods to interrogate SNPs, including Masscode TM (Qiagen, Germantown, MD), (Hologic, Madison, WI), (Applied Biosystems, Foster City, CA), (Applied Biosystems, Foster City, CA) and Beadarrays TM (Illumina, San Diego, CA).

[0108] Many SNP alleles within a sequence or across linked sequences can be used together to describe the haplotype of any particular genotype. Ching et al., BMC Genet [BMC genomics]. 3: 19 (2002); Gupta et al., (2001), Rafalski, Plant Sci. [Plant Science] 162: 329 (2002b). Haplotypes can be more informative than single SNPs and can describe any particular genotype in more detail. For example, for a specific ear rot resistant strain or variety, a single SNP may be the allele "T", but the allele "T" may also appear in a corn breeding population for a recurrent parent. In this case, a combination of alleles of linked SNPs may be more informative. Once a unique haplotype is assigned to a donor chromosome region, the haplotype can be used in the population or any subpopulation thereof to determine whether an individual has a specific gene. The use of an automated high-throughput marker detection platform known to those of ordinary skill in the art makes this method efficient and effective.

[0109] Marker of the present invention can be used in marker-assisted selection scheme to identify and / or select the progeny with enhanced ear rot resistance. Such method can include hybridizing the first corn plant or germplasm with the second corn plant or germplasm, or consisting of or consisting of it basically, wherein the first corn plant or germplasm comprises a mark associated with enhanced ear rot resistance, and selects the progeny plant with the mark. One or both of the first and second corn plants can be non-naturally occurring corn species. In certain embodiments, the second corn plant or germplasm is the second corn plant or germplasm of superior varieties. In certain embodiments, the genome of the second corn plant or germplasm is at least about 50%, 55%, 60%, 65%, 70%, 75%, 80%, 85%, 90%, 95%, 97%, 99% or 100% homogeneity with the genome of excellent corn species.

[0110] Methods for identifying and / or selecting ear rot resistant plants or germplasm may comprise, consist essentially of, or consist of detecting the presence of a marker associated with enhanced ear rot resistance. The marker may be detected in any sample obtained from a plant or germplasm, including but not limited to the entire plant or germplasm, a portion of the plant or germplasm (e.g., a seed slice, leaf punch disk, or cell from the plant or germplasm), or a nucleotide sequence from the plant or germplasm. Such samples may be obtained from a plant or germplasm using any existing or future method known in the art (including but not limited to automated methods: removing a portion of the endosperm with a sharp blade, drilling a small hole in the seed and collecting the resulting powder, cutting the seeds with a laser and punching leaf disks). The corn plant may be a non-naturally occurring variety. In some embodiments, the genome of the corn plant or germplasm is at least about 50%, 55%, 60%, 65%, 70%, 75%, 80%, 85%, 90%, 95%, 97%, 99% or 100% identical to the genome of an elite corn variety.

[0111] Suitable markers may comprise, consist essentially of or consist of one or more marker alleles located within the chromosomal interval shown in Table X (all physical positions in Tables X, XI, XII and XIII correspond to the B73 genome (AGPv4)).

[0112] In one embodiment, a method of identifying or selecting a corn plant with enhanced ear rot resistance comprises a) isolating a nucleic acid from a corn cell or plant part; b) detecting in the cell or plant part the presence of a marker associated with increased ear rot resistance, wherein the marker is located within at least one chromosomal interval selected from the group consisting of:

[0113] (aa) corresponding physical positions 3,225,079 to 4,188,653 on maize chromosome 1;

[0114] (bb) corresponding physical positions 221,604,561 to 222,599,974 on maize chromosome 1;

[0115] (cc) corresponding physical positions 8,618,657 to 9,599,938 on maize chromosome 2;

[0116] (dd) corresponding physical positions 14,511,390 to 215,165,758 on maize chromosome 3;

[0117] (ee) the corresponding physical positions 242,101,915 to 243,081,515 of maize chromosome 4;

[0118] (ff) corresponding physical positions 186,344,944 to 187,256,786 of maize chromosome 5;

[0119] (gg) corresponding physical positions 207,001,816 to 215,694,297 on maize chromosome 5;

[0120] (hh) corresponding physical positions 85,714,579 to 86,684,841 on maize chromosome 6;

[0121] (ii) corresponding physical positions 136,237,488 to 137,181,700 on maize chromosome 7;

[0122] (jj) corresponding physical positions 3,624,919 to 4,585,283 on maize chromosome 8;

[0123] (kk) corresponding physical positions 9,535,964 to 10,493,645 on maize chromosome 8;

[0124] (ll) corresponding physical positions 164,507,475 to 172,699,565 of maize chromosome 8;

[0125] (mm) corresponding physical positions 11,507,069 to 135,985,429 on maize chromosome 9;

[0126] (nn) corresponding physical positions 151,907,512 to 152,897,067 of maize chromosome 9; and

[0127] (oo) corresponding physical positions 128,310,945 to 129,283,212 of maize chromosome 10; and

[0128] c) identifying or selecting said plants based on the presence of the marker detected in b).

[0129] In many examples, the intervals also include at least one resistance allele listed in Table XII. For example, the corresponding physical positions 3,225,079 to 4,188,653 of corn chromosome 1 will contain at least one of an A allele at a position corresponding to physical position 3702462 and a C allele at a position corresponding to physical position 3702464; the corresponding physical positions 221,604,561 to 222,599,974 of corn chromosome 1 will contain a C allele at a position corresponding to physical position 222146924; the corresponding physical positions 8,618,657 to 9,599,938 of corn chromosome 2 will contain a C allele at a position corresponding to physical position 9122256; The corresponding physical positions 14,511,390 to 215,165,758 of body 3 will contain a C allele at a position corresponding to physical position 19344196, a T allele at a position corresponding to physical position 19344197, an A allele at a position corresponding to physical position 19826372, a G allele at a position corresponding to physical position 151251885, a C allele at a position corresponding to physical position 199952894, a T allele at a position corresponding to physical position 214794069, and an A allele at a position corresponding to physical position 214794170. at least one of; the corresponding physical positions 242,101,915 to 243,081,515 of corn chromosome 4 will contain an A allele at a position corresponding to physical position 242643396; the corresponding physical positions 186,344,944 to 187,256,786 of corn chromosome 5 will contain a C allele at a position corresponding to physical position 186795332; the corresponding physical positions 207,001,816 to 215,694,297 of corn chromosome 5 will contain an A allele at a position corresponding to physical position 207505420, an A allele at a position corresponding to physical position 207505421 at least one of a C allele at a position corresponding to physical position 212254755, an A allele at a position corresponding to physical position 215392749, and a C allele at a position corresponding to physical position 215500881; the corresponding physical positions 85,714,579 to 86,684,841 of corn chromosome 6 will contain a C allele at a position corresponding to physical position 86282196; the corresponding physical positions 136,237,488 to 137,181,700 of corn chromosome 7 will contain a C allele at a position corresponding to physical position 136725791;The corresponding physical positions 3,624,919 to 4,585,283 of corn chromosome 8 will contain at least one of a G allele at a position corresponding to physical position 4128809 and an A allele at a position corresponding to physical position 4128860; the corresponding physical positions 9,535,964 to 10,493,645 of corn chromosome 8 will contain at least one of an A allele at a position corresponding to physical position 10122708, a T allele at a position corresponding to physical position 10122766, and a T allele at a position corresponding to physical position 10122892; the corresponding physical positions 164,507,475 to 172,699,565 of corn chromosome 8 will contain an A allele at a position corresponding to physical position 164990912 and a C allele at a position corresponding to physical position 172218916. The corresponding physical positions 11,507,069 to 135,985,429 of maize chromosome 9 will contain at least one of a C allele at a position corresponding to physical position 11929493, a T allele at a position corresponding to physical position 135483968, and a G allele at a position corresponding to physical position 135483999; the corresponding physical positions 151,907,512 to 152,897,067 of maize chromosome 9 will contain at least one of a C allele at a position corresponding to physical position 152415102 and a T allele at a position corresponding to physical position 152415196; and the corresponding physical positions 128,310,945 to 129,283,212 of maize chromosome 10 will contain an A allele at a position corresponding to physical position 128812208. ;

[0130] It should be clear that multiple resistance alleles may exist in the above intervals. For example, the interval corresponding to physical positions 3,225,079 to 4,188,653 of corn chromosome 1 will include an A allele at a position corresponding to physical position 3702462 and a C allele at a position corresponding to physical position 3702464; the corresponding physical positions 14,511,390 to 215,165,758 of corn chromosome 3 will include two or three or more of a C allele at a position corresponding to physical position 19344196, a T allele at a position corresponding to physical position 19344197, an A allele at a position corresponding to physical position 19826372, a G allele at a position corresponding to physical position 151251885, a C allele at a position corresponding to physical position 199952894, a T allele at a position corresponding to physical position 214794069, and an A allele at a position corresponding to physical position 214794170; etc.

[0131] Detection of reference markers and / or interval boundaries can be determined by PCR amplification, for example using at least one probe or primer listed in Table XI, Table XII or Table XIII.

[0132] In addition, some people may prefer to test in a subset of the above reference intervals. In some such examples, testing in interval (aa) includes testing within 400K bp upstream or downstream of the A allele at the position corresponding to physical position 3702462 or the C allele at the position corresponding to physical position 3702464 on chromosome 1; testing in interval (cc) includes testing within 300K bp upstream or downstream of the C allele at the position corresponding to physical position 9122256 on chromosome 2. bp; in interval (dd), detection includes at least one of the C allele at the position corresponding to physical position 19344196 on chromosome 3, the T allele at the position corresponding to physical position 19344197, the A allele at the position corresponding to physical position 19826372, the G allele at the position corresponding to physical position 151251885, the C allele at the position corresponding to physical position 199952894, the T allele at the position corresponding to physical position 214794069, and the A allele at the position corresponding to physical position 214794170 on chromosome 3; detection includes at least one of the 300K bp upstream or downstream of the A allele at the position corresponding to physical position 242643396 on chromosome 4 in interval (ee). Detection is performed within 100K bp upstream or downstream of at least one of the A allele at the position corresponding to the physical position 207505420, the C allele at the position corresponding to the physical position 207505421, the A allele at the position corresponding to the physical position 212254755, the A allele at the position corresponding to the physical position 215392749, and the C allele at the position corresponding to the physical position 215500881 on chromosome 5 in interval (gg); Detection is performed within 100K bp upstream or downstream of at least one of the C allele at the position corresponding to the physical position 86282196 on chromosome 6 in interval (hh). bp; detection in interval (ii) includes detection within 400Kbp upstream or downstream of the C allele at the position corresponding to the physical position 136725791 on chromosome 7; detection in interval (jj) includes detection within 300K bp upstream or downstream of at least one of the G allele at the position corresponding to the physical position 4128809 and the A allele at the position corresponding to the physical position 4128860 on chromosome 8;Detection in interval (kk) includes detection within 300K bp upstream or downstream of at least one of the A allele at the position corresponding to physical position 10122708, the T allele at the position corresponding to physical position 10122766, and the T allele at the position corresponding to physical position 10122892 on chromosome 8; detection in interval (ll) includes detection within 400K bp upstream or downstream of at least one of the A allele at the position corresponding to physical position 164990912 and the C allele at the position corresponding to physical position 172218916 on chromosome 8; detection in interval (mm) includes detection within 300K bp upstream or downstream of at least one of the C allele at the position corresponding to physical position 11929493, the T allele at the position corresponding to physical position 135483968, and the G allele at the position corresponding to physical position 135483999 on chromosome 9. bp; detection in interval (nn) includes detection within 300K bp upstream or downstream of at least one of the C allele at the position corresponding to physical position 152415102 and the T allele at the position corresponding to physical position 152415196 on chromosome 9; and detection in interval (oo) includes detection within 300K bp upstream or downstream of the A allele at the position corresponding to physical position 128812208 on chromosome 10. Additional intervals may be further defined by any marker identified in Table XI. ;

[0133] The method may also include additional steps. For example, the method disclosed herein may further include (a) hybridizing a progeny corn plant comprising the marker in its genome with itself or another corn plant to produce an additional progeny corn plant comprising the marker in its genome. Additional hybridization may be performed, for example, (b) repeating the hybridization step of (a) at least 2 times to produce other progeny corn plants comprising the marker in their genome.

[0134]

[0135] Exemplary markers and assays within the interval are listed below in Table XI:

[0136]

[0137]

[0138]

[0139]

[0140]

[0141]

[0142]

[0143]

[0144]

[0145]

[0146]

[0147]

[0148]

[0149]

[0150]

[0151]

[0152]

[0153]

[0154]

[0155]

[0156]

[0157]

[0158]

[0159] Preferred markers and assays are listed below in Table XII:

[0160]

[0161]

[0162]

[0163]

[0164] (R / S = Resistant / Susceptible)

[0165] Table XIII lists probes and primers that can be used to identify the positions of the intervals of Table X.

[0166]

[0167]

[0168]

[0169] Using the teachings contained herein, one of ordinary skill in the art will be able to locate other marker alleles within the intervals of Table X.

[0170] The method for producing ear rot resistant plants may include, consist essentially of, or consist of detecting a marker associated with enhanced ear rot resistance in germplasm, and producing corn plants from the germplasm. The marker may be detected in any sample obtained from the germplasm, including but not limited to a portion of the germplasm (e.g., a seed slice or cell from the germplasm) or a nucleotide sequence from the germplasm. Such a sample may be obtained from the germplasm using any existing or future method known in the art (including but not limited to automated methods: removing a portion of the endosperm with a sharp blade, drilling a small hole in the seed and collecting the resulting powder, cutting the seeds with a laser and punching leaf discs). The germplasm may be a non-naturally occurring corn variety. In some embodiments, the genome of the germplasm has at least about 50%, 55%, 60%, 65%, 70%, 75%, 80%, 85%, 90%, 95%, 97%, 99% or 100% identity to the genome of an elite corn variety. Ear rot resistant plants are then produced from germplasm identified as having a marker associated with enhanced ear rot resistance according to methods well known in the art for breeding and producing plants from germplasm.

[0171] The method for producing and / or selecting ear rot resistant corn plant or germplasm may include hybridizing a first corn plant or germplasm with a second corn plant or germplasm, wherein the first soybean plant or germplasm comprises a mark associated with enhanced ear rot resistance, and selects a progeny plant or germplasm comprising the mark associated with enhanced ear rot resistance. One or both of the first or second corn plant or germplasm can be a non-naturally occurring soybean variety. In certain embodiments, the second corn plant or germplasm is a second corn plant or germplasm of an elite corn variety. In certain embodiments, the genome of the second corn plant or germplasm is at least about 50%, 55%, 60%, 65%, 70%, 75%, 80%, 85%, 90%, 95%, 97%, 99% or 100% homogeneity with the genome of an elite corn variety.

[0172] In one example, a method for producing a corn plant with enhanced ear rot resistance comprises the following steps: a) isolating a nucleic acid from a corn cell or plant part; b) detecting in the cell or plant part the presence of a marker associated with increased ear rot resistance, wherein the marker is located within at least one chromosomal interval selected from the group consisting of: (aa) corresponding physical positions 3,225,079 to 4,188,653 of corn chromosome 1; (bb) corresponding physical positions 221,604,561 to 222,599,974 of corn chromosome 1; (c c) the corresponding physical positions of maize chromosome 2 are 8,618,657 to 9,599,938; (dd) the corresponding physical positions of maize chromosome 3 are 14,511,390 to 215,165,758; (ee) the corresponding physical positions of maize chromosome 4 are 242,101,915 to 243,081,515; (ff) the corresponding physical positions of maize chromosome 5 are 186,344,944 to 187,256,786; (gg) the corresponding physical positions of maize chromosome 5 are 207,001,816 to 215,694, 297; (hh) the corresponding physical positions of maize chromosome 6 are 85,714,579 to 86,684,841; (ii) the corresponding physical positions of maize chromosome 7 are 136,237,488 to 137,181,700; (jj) the corresponding physical positions of maize chromosome 8 are 3,624,919 to 4,585,283; (kk) the corresponding physical positions of maize chromosome 8 are 9,535,964 to 10,493,645; (ll) the corresponding physical positions of maize chromosome 8 are 164,507,475 to 172,69 9,565; (mm) the corresponding physical position 11,507,069 to 135,985,429 of corn chromosome 9; (nn) the corresponding physical position 151,907,512 to 152,897,067 of corn chromosome 9; and (oo) the corresponding physical position 128,310,945 to 129,283,212 of corn chromosome 10; and c) crossing a corn plant comprising the marker within its genome with another corn plant that does not comprise the marker to produce a progeny corn plant comprising the marker within its genome.

[0173] In several of these examples, the corresponding physical positions 3,225,079 to 4,188,653 of maize chromosome 1 contain at least one of an A allele at a position corresponding to physical position 3702462 and a C allele at a position corresponding to physical position 3702464; the corresponding physical positions 221,604,561 to 222,599,974 of maize chromosome 1 contain a C allele at a position corresponding to physical position 222146924; the corresponding physical positions 8,618,657 to 9,599,938 of maize chromosome 2 contain a C allele at a position corresponding to physical position 9122256; The corresponding physical positions 14,511,390 to 215,165,758 of maize chromosome 3 contain a C allele at a position corresponding to physical position 19344196, a T allele at a position corresponding to physical position 19344197, an A allele at a position corresponding to physical position 19826372, a G allele at a position corresponding to physical position 151251885, a C allele at a position corresponding to physical position 199952894, a T allele at a position corresponding to physical position 214794069, and an A allele at a position corresponding to physical position 214794170. at least one of the genes; the corresponding physical positions 242,101,915 to 243,081,515 of maize chromosome 4 contain an A allele at a position corresponding to physical position 242643396; the corresponding physical positions 186,344,944 to 187,256,786 of maize chromosome 5 contain a C allele at a position corresponding to physical position 186795332; the corresponding physical positions 207,001,816 to 215,694,297 of maize chromosome 5 contain an A allele at a position corresponding to physical position 207505420, a C allele at a position corresponding to physical position 207505421 at least one of a C allele at a position corresponding to physical position 212254755, an A allele at a position corresponding to physical position 215392749, and a C allele at a position corresponding to physical position 215500881; corresponding physical positions 85,714,579 to 86,684,841 of maize chromosome 6 contain a C allele at a position corresponding to physical position 86282196; corresponding physical positions 136,237,488 to 137,181,700 of maize chromosome 7 contain a C allele at a position corresponding to physical position 136725791;The corresponding physical positions 3,624,919 to 4,585,283 of corn chromosome 8 contain at least one of a G allele at a position corresponding to physical position 4128809 and an A allele at a position corresponding to physical position 4128860; the corresponding physical positions 9,535,964 to 10,493,645 of corn chromosome 8 contain at least one of an A allele at a position corresponding to physical position 10122708, a T allele at a position corresponding to physical position 10122766, and a T allele at a position corresponding to physical position 10122892; the corresponding physical positions 164,507,475 to 172,699,565 of corn chromosome 8 contain at least one of an A allele at a position corresponding to physical position 164990912 and a C allele at a position corresponding to physical position 172218916. at least one of the C alleles at the position corresponding to the physical position 11929493, the T allele at the position corresponding to the physical position 135483968, and the G allele at the position corresponding to the physical position 135483999; at least one of the C alleles at the position corresponding to the physical position 152415102 and the T allele at the position corresponding to the physical position 152415196 of the corresponding physical position 151,907,512 to 152,897,067 of the corresponding physical position of the maize chromosome 9; and at least one of the A alleles at the position corresponding to the physical position 128,310,945 to 129,283,212 of the maize chromosome 10. ;

[0174] The method may further include detecting any of the above alleles using, for example, PCR. For example, the detection may include: detecting at least one of the A allele at a position corresponding to physical position 3702462 and the C allele at a position corresponding to physical position 3702464 in the corresponding physical positions 3,225,079 to 4,188,653 of the maize chromosome 1; detecting at least one of the C allele at a position corresponding to physical position 222146924 in the corresponding physical positions 221,604,561 to 222,599,974 of the maize chromosome 1; detecting at least one of the C allele at a position corresponding to physical position 9122256 in the corresponding physical positions 8,618,657 to 9,599,938 of the maize chromosome 2; alleles; in the corresponding physical positions 14,511,390 to 215,165,758 of the corn chromosome 3, a C allele at a position corresponding to physical position 19344196, a T allele at a position corresponding to physical position 19344197, an A allele at a position corresponding to physical position 19826372, a G allele at a position corresponding to physical position 151251885, a C allele at a position corresponding to physical position 199952894, a T allele at a position corresponding to physical position 214794069, and an A allele at a position corresponding to physical position 214794170 are detected. at least one of; in the corresponding physical positions 242,101,915 to 243,081,515 of the maize chromosome 4, detecting the A allele at the position corresponding to the physical position 242643396; in the corresponding physical positions 186,344,944 to 187,256,786 of the maize chromosome 5, detecting the C allele at the position corresponding to the physical position 186795332; in the corresponding physical positions 207,001,816 to 215,694,297 of the maize chromosome 5, detecting the A allele at the position corresponding to the physical position 207505420, the A allele at the position corresponding to the physical position 207505421, the A allele at the position corresponding to the physical position 207505422, the A allele at the position corresponding to the physical position 207505423, the A allele at the position corresponding to the physical position 207505424, the A allele at the position corresponding to the physical position 207505425, the A allele at the position corresponding to the physical position 207505427, the A allele at the position corresponding to the physical position 207505428, the A allele at the position corresponding to the physical position 207505429, the A allele at the position corresponding to the physical position 207505420, the A allele at the position corresponding to the physical position 207505421, the A allele at the position corresponding to the physical position 207505427 at least one of a C allele at a position corresponding to physical position 212254755, an A allele at a position corresponding to physical position 215392749, and a C allele at a position corresponding to physical position 215500881; in the corresponding physical positions 85,714,579 to 86,684,841 of said maize chromosome 6, a C allele at a position corresponding to physical position 86282196 is detected; in the corresponding physical positions 136,237,488 to 137,181,700 of said maize chromosome 7, a C allele at a position corresponding to physical position 136725791 is detected;In the corresponding physical positions 3,624,919 to 4,585,283 of the corn chromosome 8, at least one of the G allele at the position corresponding to the physical position 4128809 and the A allele at the position corresponding to the physical position 4128860 is detected; in the corresponding physical positions 9,535,964 to 10,493,645 of the corn chromosome 8, at least one of the A allele at the position corresponding to the physical position 10122708, the T allele at the position corresponding to the physical position 10122766, and the T allele at the position corresponding to the physical position 10122892 is detected; in the corresponding physical positions 164,507,475 to 172,699,565 of the corn chromosome 8, the A allele at the position corresponding to the physical position 164990912 and the C allele at the position corresponding to the physical position 172218916 are detected. at least one of the C allele at the position corresponding to the physical position 11929493, the T allele at the position corresponding to the physical position 135483968, and the G allele at the position corresponding to the physical position 135483999 in the corresponding physical positions 11,507,069 to 135,985,429 of the corn chromosome 9; at least one of the C allele at the position corresponding to the physical position 152415102 and the T allele at the position corresponding to the physical position 152415196 in the corresponding physical positions 151,907,512 to 152,897,067 of the corn chromosome 9; and the A allele at the position corresponding to the physical position 128,310,945 to 129,283,212 of the corn chromosome 10. Exemplary probes and primers for detecting these alleles are listed in Table XII. ;

[0175] This paper also provides a method for infiltrating corn plants with alleles associated with enhanced ear rot resistance. Such methods for infiltrating corn plants or germplasm with alleles associated with enhanced ear rot resistance may include the following, essentially consisting of or consisting of: hybridizing a first corn plant or germplasm (donor) comprising the allele with a second corn plant or germplasm (recurrent parent) lacking the allele, and repeatedly backcrossing the progeny comprising the allele with the recurrent parent. The progeny comprising the allele can be identified by monitoring the presence of a mark associated with enhanced ear rot resistance in its genome. The mark can be detected in any sample obtained from the progeny, including but not limited to a part of the progeny (e.g., seed slices, leaf punches or cells from the plant or germplasm) or a nucleotide sequence from the progeny. Such a sample can be obtained from the progeny using any existing or future method known in the art (including but not limited to automated methods: removing a portion of the endosperm with a sharp blade, drilling a small hole in the seed and collecting the resulting powder, cutting the seeds with a laser and punching leaf discs). One or both of the donor or recurrent parents can be a non-naturally occurring corn variety. In some embodiments, the recurrent parent is an elite corn variety. In some embodiments, the genome of the recurrent parent is at least about 50%, 55%, 60%, 65%, 70%, 75%, 80%, 85%, 90%, 95%, 97%, 99% or 100% identical to the genome of the elite corn variety.

[0176] In some embodiments, markers used to identify progeny comprising alleles associated with enhanced ear rot resistance may comprise, consist essentially of, or consist of one or more marker alleles located within a chromosomal interval selected from the group consisting of those in Table X. For example, at least one marker on chromosome 1 between physical positions 3,225,079 and 4,188,653; at least one marker on chromosome 1 between physical positions 221,604,561 and 222,599,974; at least one marker on chromosome 2 between physical positions 8,618,657 and 9,599,938; at least one marker on chromosome 3 between physical positions 14,511,390 and 215,165,758; at least one marker on chromosome 4 between physical positions 242,101,915 and 243,081,515; at least one marker on chromosome 5 between physical positions 186,344,944 and 187,256,786; at least one marker on chromosome 5 between physical positions 207,001,816 and 215,694,297; at least one marker on chromosome 6 between physical positions 85,714,57 at least one marker on chromosome 7 between physical positions 136,237,488 and 137,181,700; at least one marker on chromosome 8 between physical positions 3,624,919 and 4,585,283; at least one marker on chromosome 8 between physical positions 9,535,964 and 10,493,645; at least one marker on chromosome 8 between physical positions 164,507,475 and 172,699,565; at least one marker on chromosome 9 between physical positions 11,507,069 and 135,985,429; at least one marker on chromosome 9 between physical positions 151,907,512 and 152,897,067; at least one marker on chromosome 10 between physical positions 128,310,945 and 129,283,212. Tags may also include any of the other tags listed above.

[0177] In certain embodiments, the marker can include, be essentially composed of, or be composed of: marker alleles located at at least two different chromosome intervals. For example, the marker can include one or more alleles located at a chromosome interval of chromosome 2 located at physical position 8,618,657 to 9,599,938, and one or more alleles located at a chromosome interval defined by at least one or more marker alleles on chromosome 8 located at physical position 3,624,919 to 4,585,283 and including them (interval boundaries include the alleles listed in, for example, Table XIII). In other embodiments, the marker may comprise, consist essentially of, or consist of marker alleles located in at least three different chromosome intervals of Table X, at least four different chromosome intervals of Table X, at least five different chromosome intervals of Table X, at least six different chromosome intervals of Table X, at least seven different chromosome intervals of Table X, at least eight different chromosome intervals of Table X, at least nine different chromosome intervals of Table X, at least ten different chromosome intervals of Table X, at least eleven different chromosome intervals of Table X, at least twelve different chromosome intervals of Table X, at least thirteen different chromosome intervals of Table X, at least fourteen different chromosome intervals of Table X, or all intervals of Table X.

[0178] In some embodiments, markers for identifying progeny comprising an allele associated with enhanced ear rot resistance may comprise, consist essentially of, or consist of one or more marker alleles within any interval of Table XI, Table XII, or Table X.

[0179] Ear rot resistant corn plants and germplasm

[0180] The present invention provides ear rot resistant corn plants and germplasm. The methods of the present invention as described above can be used to identify, produce and / or select ear rot resistant corn plants and germplasm. In addition to the above methods, ear rot resistant corn plants or germplasm can be produced by any method, whereby markers associated with enhanced ear rot resistance are introduced into the corn plant or germplasm, including but not limited to transformation, protoplast transformation or fusion, doubled haploid technology, embryo rescue, and / or produced by any other nucleic acid transfer system.

[0181] In some embodiments, the corn plant or germplasm comprises a non-naturally occurring corn variety. In some embodiments, the corn plant or germplasm has at least about 50%, 55%, 60%, 65%, 70%, 75%, 80%, 85%, 90%, 95%, 97%, 99% or 100% identity to the genome of an elite corn variety.

[0182] The ear rot resistant corn plant or germplasm can be the progeny of a cross between an elite corn variety and a corn variety containing alleles associated with enhanced ear rot resistance.

[0183] The ear rot resistant corn plant or germplasm can be the progeny of an introgression where the recurrent parent is an elite corn variety and the donor contains alleles associated with enhanced ear rot resistance.

[0184] The ear rot resistant corn plants or germplasm can be the progeny of a cross between a first elite corn variety (e.g., a test line), and the progeny of a cross between a second elite corn variety (e.g., a recurrent parent) and a corn variety (e.g., a donor) containing alleles associated with enhanced ear rot resistance.

[0185] The ear rot resistant plant or germplasm can be the progeny of a cross between a first elite corn variety and a progeny of an introgression, wherein the recurrent parent is a second elite corn variety and the donor comprises an allele associated with enhanced ear rot resistance.

[0186] The ear rot resistant corn plants and germplasm of the invention can comprise one or more markers of the invention.

[0187] In some embodiments, the ear rot resistant corn plant or germplasm may comprise within its genome a marker associated with enhanced ear rot resistance, wherein the marker is located within a chromosomal interval of Table X. Exemplary markers include those of Table XI or those of Table XII.

[0188] In some embodiments, an ear rot resistant corn plant or germplasm may comprise within its genome a marker comprising, consisting essentially of, or consisting of marker alleles located in at least two different chromosomal intervals.

[0189] Embodiments also include corn plants having plants selected in their parental pedigrees based on the presence of a marker associated with increased ear rot resistance, wherein the marker is located within at least one chromosomal interval selected from the group consisting of: (aa) corresponding physical positions 3,225,079 to 4,188,653 of corn chromosome 1; (bb) corresponding physical positions 221,604,561 to 222,599,974 of corn chromosome 1; (cc) corresponding physical positions 221,604,561 to 222,599,974 of corn chromosome 2; (dd) the corresponding physical positions of maize chromosome 3 are 14,511,390 to 215,165,758; (ee) the corresponding physical positions of maize chromosome 4 are 242,101,915 to 243,081,515; (ff) the corresponding physical positions of maize chromosome 5 are 186,344,944 to 187,256,786; (gg) the corresponding physical position of maize chromosome 5 is 207,001 ,816 to 215,694,297; (hh) the corresponding physical positions of maize chromosome 6 are 85,714,579 to 86,684,841; (ii) the corresponding physical positions of maize chromosome 7 are 136,237,488 to 137,181,700; (jj) the corresponding physical positions of maize chromosome 8 are 3,624,919 to 4,585,283; (kk) the corresponding physical positions of maize chromosome 8 are 9,535,964 to 10,493,6 45; (ll) the corresponding physical position of corn chromosome 8 is 164,507,475 to 172,699,565; (mm) the corresponding physical position of corn chromosome 9 is 11,507,069 to 135,985,429; (nn) the corresponding physical position of corn chromosome 9 is 151,907,512 to 152,897,067; and (oo) the corresponding physical position of corn chromosome 10 is 128,310,945 to 129,283,212. In some embodiments, the corresponding physical position 3,225,079 to 4,188,653 of the corn chromosome 1 contains at least one of an A allele at a position corresponding to physical position 3702462 and a C allele at a position corresponding to physical position 3702464; the corresponding physical position 221,604,561 to 222,599,974 of the corn chromosome 1 contains a C allele at a position corresponding to physical position 222146924; the corresponding physical position 8,618,657 to 9,599,938 of the corn chromosome 2 contains a C allele at a position corresponding to physical position 9122256;The corresponding physical positions 14,511,390 to 215,165,758 of the maize chromosome 3 include a C allele at a position corresponding to physical position 19344196, a T allele at a position corresponding to physical position 19344197, an A allele at a position corresponding to physical position 19826372, a G allele at a position corresponding to physical position 151251885, a C allele at a position corresponding to physical position 199952894, a T allele at a position corresponding to physical position 214794069, and an A allele at a position corresponding to physical position 214794170. at least one of the alleles; the corresponding physical position 242,101,915 to 243,081,515 of the maize chromosome 4 comprises an A allele at a position corresponding to the physical position 242643396; the corresponding physical position 186,344,944 to 187,256,786 of the maize chromosome 5 comprises a C allele at a position corresponding to the physical position 186795332; the corresponding physical position 207,001,816 to 215,694,297 of the maize chromosome 5 comprises an A allele at a position corresponding to the physical position 207505420, an A allele at a position corresponding to the physical position 20750 at least one of a C allele at a position corresponding to physical position 212254755, an A allele at a position corresponding to physical position 215392749, and a C allele at a position corresponding to physical position 215500881; the corresponding physical positions 85,714,579 to 86,684,841 of the maize chromosome 6 contain the C allele at the position corresponding to physical position 86282196; the corresponding physical positions 136,237,488 to 137,181,700 of the maize chromosome 7 contain the C allele at the position corresponding to physical position 136725791 The corresponding physical positions 3,624,919 to 4,585,283 of the maize chromosome 8 contain at least one of a G allele at a position corresponding to physical position 4128809 and an A allele at a position corresponding to physical position 4128860; the corresponding physical positions 9,535,964 to 10,493,645 of the maize chromosome 8 contain at least one of an A allele at a position corresponding to physical position 10122708, a T allele at a position corresponding to physical position 10122766, and a T allele at a position corresponding to physical position 10122892;The corresponding physical positions 164,507,475 to 172,699,565 of the corn chromosome 8 include at least one of an A allele at a position corresponding to physical position 164990912 and a C allele at a position corresponding to physical position 172218916; the corresponding physical positions 11,507,069 to 135,985,429 of the corn chromosome 9 include a C allele at a position corresponding to physical position 11929493, a T allele at a position corresponding to physical position 135483968, and a T allele at a position corresponding to physical position 135483969. at least one of the G alleles at the position corresponding to the physical position 135483999; the corresponding physical positions 151,907,512 to 152,897,067 of the corn chromosome 9 contain at least one of the C alleles at the position corresponding to the physical position 152415102 and the T alleles at the position corresponding to the physical position 152415196; and the corresponding physical positions 128,310,945 to 129,283,212 of the corn chromosome 10 contain the A alleles at the position corresponding to the physical position 128812208. In some embodiments, the corresponding physical positions 3,225,079 to 4,188,653 of the maize chromosome 1 include all of the A allele at the position corresponding to the physical position 3702462 and the C allele at the position corresponding to the physical position 3702464; the corresponding physical positions 14,511,390 to 215,165,758 of the maize chromosome 3 include the C allele at the position corresponding to the physical position 19344196, the T allele at the position corresponding to the physical position 19344197, the A allele at the position corresponding to the physical position 19826372, the G allele at the position corresponding to the physical position 151251885, and the C allele at the position corresponding to the physical position 19995 all of the C allele at the position corresponding to physical position 207,001,816 to 215,694,297 of the maize chromosome 5 including the A allele at the position corresponding to physical position 207505420, the C allele at the position corresponding to physical position 207505421, the A allele at the position corresponding to physical position 212254755, the A allele at the position corresponding to physical position 215392749, and the C allele at the position corresponding to physical position 215500881;The corresponding physical positions 3,624,919 to 4,585,283 of the maize chromosome 8 include all of the G allele at the position corresponding to the physical position 4128809 and the A allele at the position corresponding to the physical position 4128860; the corresponding physical positions 9,535,964 to 10,493,645 of the maize chromosome 8 include all of the A allele at the position corresponding to the physical position 10122708, the T allele at the position corresponding to the physical position 10122766, and the T allele at the position corresponding to the physical position 10122892; the corresponding physical positions 164,507,475 to 172,699,565 of the maize chromosome 8 include the A allele at the position corresponding to the physical position 164990912 and the C allele at the position corresponding to the physical position 172218916 alleles; the corresponding physical positions 11,507,069 to 135,985,429 of the maize chromosome 9 contain all of the C allele at the position corresponding to the physical position 11929493, the T allele at the position corresponding to the physical position 135483968, and the G allele at the position corresponding to the physical position 135483999; the corresponding physical positions 151,907,512 to 152,897,067 of the maize chromosome 9 contain all of the C allele at the position corresponding to the physical position 152415102 and the T allele at the position corresponding to the physical position 152415196; and the corresponding physical positions 128,310,945 to 129,283,212 of the maize chromosome 10 contain the A allele at the position corresponding to the physical position 128812208. ;

[0190] In some embodiments, the selection includes: detecting at least one of an A allele at a position corresponding to physical position 3702462 and a C allele at a position corresponding to physical position 3702464 in the corresponding physical positions 3,225,079 to 4,188,653 of the corn chromosome 1; detecting at least one of an A allele at a position corresponding to physical position 3702462 and a C allele at a position corresponding to physical position 3702464 in the corresponding physical positions 221,604,561 to 222,599,974 of the corn chromosome 1; detecting at least one of an A allele at a position corresponding to physical position 222146924 in the corresponding physical positions 8,618,657 to 9,599,938 of the corn chromosome 2; C allele; in the corresponding physical positions 14,511,390 to 215,165,758 of the corn chromosome 3, a C allele at a position corresponding to physical position 19344196, a T allele at a position corresponding to physical position 19344197, an A allele at a position corresponding to physical position 19826372, a G allele at a position corresponding to physical position 151251885, a C allele at a position corresponding to physical position 199952894, a T allele at a position corresponding to physical position 214794069, and an A allele at a position corresponding to physical position 214794170 are detected. at least one of the genes; in the corresponding physical positions 242,101,915 to 243,081,515 of the maize chromosome 4, detecting the A allele at the position corresponding to the physical position 242643396; in the corresponding physical positions 186,344,944 to 187,256,786 of the maize chromosome 5, detecting the C allele at the position corresponding to the physical position 186795332; in the corresponding physical positions 207,001,816 to 215,694,297 of the maize chromosome 5, detecting the A allele at the position corresponding to the physical position 207505420, the C allele at the position corresponding to the physical position 207505421 at least one of a C allele at a position corresponding to physical position 212254755, an A allele at a position corresponding to physical position 215392749, and a C allele at a position corresponding to physical position 215500881; in the corresponding physical positions 85,714,579 to 86,684,841 of said maize chromosome 6, a C allele at a position corresponding to physical position 86282196 is detected; in the corresponding physical positions 136,237,488 to 137,181,700 of said maize chromosome 7, a C allele at a position corresponding to physical position 136725791 is detected;In the corresponding physical positions 3,624,919 to 4,585,283 of the corn chromosome 8, at least one of the G allele at the position corresponding to the physical position 4128809 and the A allele at the position corresponding to the physical position 4128860 is detected; in the corresponding physical positions 9,535,964 to 10,493,645 of the corn chromosome 8, at least one of the A allele at the position corresponding to the physical position 10122708, the T allele at the position corresponding to the physical position 10122766, and the T allele at the position corresponding to the physical position 10122892 is detected; in the corresponding physical positions 164,507,475 to 172,699,565 of the corn chromosome 8, the A allele at the position corresponding to the physical position 164990912 and the C allele at the position corresponding to the physical position 172218916 are detected. at least one of the C allele at the position corresponding to the physical position 11929493, the T allele at the position corresponding to the physical position 135483968, and the G allele at the position corresponding to the physical position 135483999 in the corresponding physical positions 11,507,069 to 135,985,429 of the corn chromosome 9; at least one of the C allele at the position corresponding to the physical position 152415102 and the T allele at the position corresponding to the physical position 152415196 in the corresponding physical positions 151,907,512 to 152,897,067 of the corn chromosome 9; and the A allele at the position corresponding to the physical position 128,310,945 to 129,283,212 of the corn chromosome 10. In various embodiments, the detection may include at least one probe or primer listed in Table XI, Table XII, or Table XIII. ;

[0191] Ear rot resistant seeds

[0192] The present invention provides ear rot resistant corn seeds. The methods of the present invention as described above can be used to identify, produce and / or select ear rot resistant corn seeds. In addition to the above methods, ear rot resistant seeds can be produced by any method whereby markers associated with enhanced ear rot resistance are introduced into corn seeds, including but not limited to transformation, protoplast transformation or fusion, doubled haploid technology, collagen rescue, and / or produced by any other nucleic acid transfer system.

[0193] In some embodiments, the ear rot resistant corn seed comprises a non-naturally occurring corn variety. In some embodiments, the corn seed is at least about 50%, 55%, 60%, 65%, 70%, 75%, 80%, 85%, 90%, 95%, 97%, 99% or 100% identical to the genome of an elite corn variety.

[0194] Ear rot resistant corn seeds can be produced from ear rot resistant corn plants identified, produced or selected by the methods of the invention. In some embodiments, ear rot resistant corn seeds are produced from ear rot resistant corn plants of the invention.

[0195] The ear rot resistant seeds of the present invention may comprise one or more markers of the present invention. For example, the ear rot resistant seeds may comprise any marker in Table XI, Table XII or at least one marker within the interval of Table X.

[0196] In some embodiments, the ear rot resistant seed or germplasm may comprise within its genome a marker comprising, consisting essentially of, or consisting of marker alleles located in at least two different chromosomal intervals.

[0197] Examples

[0198] GWAS to identify potential resistance genes to Fusarium ear rot

[0199] A panel of 508 maize lines was grown in Beijing (2017 and 2018) and Hainan (2017) to investigate their resistance to Fusarium ear rot. Most of the tropical lines had severe delays in flowering under long-day conditions in Beijing and were then removed for further analysis. From the three field trials, we selected the same panel of 309 lines for GWAS analysis. The filtered GWAS population showed a normal distribution of the disease severity index (DSI) to Fusarium ear rot in Beijing, while Hainan showed a left-skewed distribution of resistance ( Figure S1 ). This is consistent with the fact that ear rot may be affected by environmental conditions. We then performed a best linear unbiased prediction (BLUP) on the data from the three field trials to obtain the joint distribution of ear rot severity ( Figure 1 ). According to their pedigrees, the entire GWAS population can be divided into TSPT, SS, NSS, and mixed heterosis groups (Mixed), and no significant difference in DSI was detected between any two of them (Table 1). In the GWAS population, the resistant inbred lines were CIMBL4, CML225, DAN599, CML304, and CIMBL47; while the susceptible inbred lines were RY737, CIMBL55, Ye478, GEMS45, and GEMS39.

[0200] Table 1. Average DSI of the four heterosis groups in the GWAS population

[0201]

[0202] We performed GWAS using a mixed linear model. As a result, dozens of SNPs were found to be significantly associated with ear rot resistance, including 6 in Beijing (2017), 20 in Hainan (2017), 7 in Beijing (2018), and 1 in the BLUP data, as shown in the quantile-quantile and Manhattan plots (Figure 2). After comparing the SNPs detected from three different environments, we found that four chromosomal regions, bins 3.04, 5.05 / 09, 8.01 / 02, and 8.06 / 08, were enriched in significant SNPs, each of which could explain 7.73-11.22% of the total phenotypic variation. The highest significance (P=1.65X10 -7 )'s SNPchr8.S_4128809, which can account for 11.22% of the total phenotypic variation.

[0203] Based on the B73 genome (AGPv4), genes covering or located near the significant SNPs were identified, which revealed 4 in Beijing (2017), 40 in Hainan (2017), 24 in Beijing (2018), and 2 in the BLUP data (Table S1). These genes were divided into different categories according to their functions, and most of them were related to defense response signaling pathways, binding activity, plant growth and development, enzymes related to catabolism, transport activity, and drug metabolism ( Figure S2 ).

[0204] Table S1. List of significant SNPs and their corresponding genes identified by GWAS under three field trials

[0205]

[0206]

[0207]

[0208]

[0209] Comparison of transcriptomes between resistant CIMBL47 and susceptible SY1035 lines

[0210] Of the 309 lines tested in three field trials, CIMBL47 (DSI = 7.5%) and SY1035 (DSI = 83.4%) were shown to be the most resistant and most susceptible lines, respectively. It is speculated that in the GWAS population, CIMBL47 has the largest number of resistance alleles, while SY1035 has the least number of resistance alleles. In order to identify those genes that may be involved in resistance to ear rot, we used two lines to perform RNA-seq on 15-day-old kernels to reveal the reprogramming of the transcriptome at 0, 0.5, 1.5, 3, and 6 hours after inoculation (hpi). A total of 1,020,525,460 clear reads were obtained, and an average of 76.6% of the reads were mapped to the B73 reference genome (AGPv4) (Table S2). The identification criteria for differentially expressed genes (DEGs) were q≤0.05 and log2 fold change≥1c. Surprisingly, many DEGs appeared as early as 0hpi (5 minutes after pathogen attack) (Table 2). The resistant strain CIMBL47 showed a total of 645 DEGs, of which nearly two-thirds were upregulated. In contrast, the susceptible strain SY1035 only showed 364 DEGs, and the number of upregulated and downregulated DEGs was close to each other. The resistant CIMBL47 and susceptible SY1035 strains did show great differences in the basal transcriptome, because it was observed in RC and SC that thousands of DEGs appeared when the water control was treated. When attacked with pathogens, CIMBL47 showed even more upregulated DEGs and fewer downregulated DEGs (R and S) compared with SY1035. Compared with SY1035, CIMBL47 seems to be very strongly responsive to pathogen attack. We assume that CIMBL47 may have many resistance-related genes that are triggered to produce a rapid response to pathogen infection. For other sampling times after inoculation, CIMBL47 still had more up-regulated DEGs than down-regulated DEGs at 0.5 hpi, however, this trend did not continue thereafter (Table 2). The susceptible line SY1035 had far more down-regulated DEGs than the resistant line CIMBL47, reaching a peak at 1.5 hpi.

[0211] Table S2. Clean reads and their mapping percentages for RNA-Seq data

[0212]

[0213] Table 2. Number of up-regulated and down-regulated DEGs at different time points after inoculation

[0214]

[0215] R and RC: resistant line CIMBL47 challenged with the pathogen (R) and treated with water (RC);

[0216] S and SC: Susceptible line SY1035 was challenged with the pathogen (S) and treated with water (SC).

[0217] Gene ontology (GO) analysis revealed that DEGs were significantly enriched in several functional categories, including catalytic activity, binding activity, metabolic process, cellular process, biological regulation, response to stimulus, developmental process, etc. (Fig. S3). KEGG analysis showed that pathways enriched with DEGs were closely related to stress and pathogen defense, such as plant hormone signaling, phenylpropanoid biosynthesis, drug metabolism via cytochrome P450, platinum drug resistance, and starch / sucrose metabolism (Fig. S4; Scatter plot of enriched pathway terms of R vs. S at 0 (A), 0.5 (B), 1.5 (C), 3 (D), and 6 (E) h after inoculation. The vertical axis represents pathway terms and the horizontal axis represents enrichment factor. The size of the dot indicates the number of DEGs in the corresponding pathway, and the color of the dot corresponds to different Q value ranges. KEGG: Kyoto Encyclopedia of Genes and Genomes.) Within 6 h after pathogen infection, plant hormone signaling was ranked as the top pathway enriched with DEGs, followed by phenylpropanoid biosynthesis (Fig. S5). At 3 and 6 hpi, other pathways, such as glutathione metabolism, drug metabolism via cytochrome P450, and glyoxylate and dicarboxylic acid metabolism, also appeared as major pathways enriched with DEGs.

[0218] Integration of GWAS and transcriptome data

[0219] We evaluated candidate genes detected in GWAS and showed differential expression levels after pathogen inoculation. Of the 70 genes detected in GWAS, 59 were found to be expressed in 15-day-old kernels from transcriptome data, of which 22 showed differential expression after pathogen inoculation and were therefore more likely to be involved in maize resistance to Fusarium ear rot. For more details on the dynamic changes of DEGs, we calculated the ratio of up-regulated and down-regulated DEGs at 0, 0.5, 1.5, 3, and 6 hpi. At the same time, we estimated the ratio of up-regulated and down-regulated DEGs genome-wide at the same time points after pathogen inoculation. Obviously, in the very early response to pathogen invasion, genes covering or located near important SNPs showed much higher DEG ratios than genes genome-wide. (Table 3).

[0220] Table 3. Ratios of up-regulated and down-regulated DEGs at different time points after inoculation

[0221]

[0222] R and RC: resistant line CIMBL47 challenged with the pathogen (R) and treated with water (RC);

[0223] S and SC: Susceptible line SY1035 was challenged with the pathogen (S) and treated with water (SC).

[0224] A: The ratio of genome-wide DEGs estimated from RNA-seq data; B: The ratio of DEGs of 70 potential resistance genes detected by GWAS.

[0225] Of the 22 DEGs, 12 were found to be highly induced in the resistant line CIMBL47 shortly after inoculation, but not in the susceptible line SY1035, and reached their highest expression levels at 0.5 hpi (6 genes) or 1.5 hpi (6 genes) (Fig. 3). Interestingly, 5 of them were located in bin 3.04 / 05, a hotspot where many resistance genes are clustered. These 5 genes encode 2 heat shock proteins, 1 PR-like receptor kinase, 1 DUF 789 family protein, and 1 regulatory protein NPR5. The other seven genes were scattered in bins 1.01, 5.08, 5.09, 9.05 / 07 and 10.04, among which three genes encoding peroxisomal membrane protein homolog (bin 1.01), inositol-3-phosphate synthase isozyme (bin 9.07) and endoglucanase 7 (bin 10.04) were reported to be associated with disease resistance (Table 4).

[0226] Five of the 22 DEGs showed different expression profiles, with the alleles in the susceptible line SY1035 being downregulated by the pathogen, reaching the lowest point at 1.5 hpi, and then upregulated to a high expression level at 6 hpi (Figure S6). To date, two of the genes encoding auxin component-related proteins and pentapeptide repeat-containing proteins are known to be involved in biotic or abiotic stresses (Table S3).

[0227] Table S3. List of genes that were minimally reduced by the pathogen at 1.5 hpi in the susceptible line SY1035.

[0228]

[0229] Compared with the susceptible line SY1035, 3 of the 22 DEGs were highly expressed in the resistant line CIMBL47 and could also be induced by pathogen inoculation ( Figure S7 The first gene, GRMZM2G050325, encodes the phenazine biosynthesis PhzC / PhzF proteins involved in phenylalanine synthesis, and the remaining two genes, GRMZM2G0505384 and GRMZM2G148998, encode proteins with unknown functions (Table S4).

[0230] Table S4. List of genes with high expression after inoculation in the resistant line CIMBL47 compared to the susceptible line SY1035.

[0231]

[0232] The last two of the 22 DEGs showed higher expression in the susceptible line rather than the resistant line after inoculation ( Figure S8 The first gene in bin 2.02 was highly induced in the susceptible line SY1035 during 0.5-1.5 hpi and encoded the peroxisomal (S)-2-hydroxyacid oxidase GLO1 that may be involved in the defense response signaling pathway. The second gene in bin 8.08 was highly expressed in susceptible SY1035 at 0.5 hpi and thereafter compared with resistant CIMBL47, which was associated with carbohydrate binding activity (Table S5).

[0233] Table S5. List of genes with high expression after inoculation in the susceptible line SY1035 compared to the resistant line CIMBL47.

[0234]

[0235] In total, 22 genes showed an immediate response to pathogen attack by modulating their gene expression levels. We hypothesized that these genes may form the first layer of defense against Fusarium ear rot and that allelic differences in these genes may lead to differential resistance among different maize lines.

[0236] Analysis of plant hormone signal transduction and phenylpropanoid biosynthesis

[0237] The analysis of transcriptome reprogramming clearly showed that phytohormone signaling and phenylpropanoid biosynthesis are among the most important pathways in the defense against Fusarium ear rot. Therefore, we investigated the expression levels of those genes involved in both pathways. In general, most of the genes involved in both pathways showed differential expression upon pathogen attack ( Figure 4 , 5).

[0238] Genes involved in the signal transduction pathways of plant growth (auxin, cytokinin, gibberellin, and brassinosteroid) or ripening (ethylene) hormones were mostly down-regulated, such as the AUX1 gene in auxin, B-ARR in cytokinin, BRI in brassinosteroid, and EIN2 / 3 genes in ethylene. In contrast, genes related to stress response hormones such as abscisic acid and jasmonic acid were up-regulated, such as the SnRK2 and PYL genes in abscisic acid. Interestingly, the NPR1 encoding gene, which plays a role in the signal transduction of salicylic acid (a key defense hormone against biotrophic pathogens), showed a complex expression pattern, being up-regulated during 0 to 3 hpi and down-regulated thereafter (Fig. S9). These findings suggest that plants will alter the balance of growth and defense in early defense against ear rot by modulating various hormone signal transduction pathways.

[0239] Among the 70 genes detected in the GWAS, some were found to be involved in hormone signal transduction pathways, such as GRMZM2G039867, GRMZM2G004528, GRMZM2G074267, and GRMZM2G116557. The first two genes, GRMZM2G039867 and GRMZM2G004528, encoding NPR1 regulatory protein and inositol-3-phosphate synthase, respectively, were highly induced in the resistant line CIMBL47 at very early times after pathogen attack. The last two genes, GRMZM2G074267 and GRMZM2G116557, encoding auxin efflux carrier components and auxin response factors involved in the auxin signaling pathway, were down-regulated to the lowest point at 1.5 hpi in the susceptible line SY1035 (Figure 3).

[0240] Phenylpropanoids are considered to be core crosstalk substances in many development- and defense-related genes, serving as precursors of a variety of defense compounds in plants, including phytoalexins and lignin (Alessandra et al. 2017). The biosynthesis of phenylpropanoids was significantly promoted under early pathogen attack. Taking 1.5 hpi as an example, compared with the susceptible line SY1035, almost all the key genes for the biosynthesis of defense metabolites in the resistant line CIMBL47 were highly induced ( Figure 5 Interestingly, some of the potential resistance genes detected in GWAS are also involved in phenylpropanoid biosynthesis. For example, the gene GRMZM2G050325 encoding the PhzC / PhzF protein for phenazine biosynthesis was highly induced in the resistant line CIMBL47 compared with the susceptible line SY1035 after pathogen inoculation.

[0241] Materials and Methods

[0242] Plant materials

[0243] Genome-wide association analysis was performed on a panel of 508 different inbred lines (CAM508) at China Agricultural University. All CAM508 lines were evaluated for resistance to maize ear rot in Beijing in 2016, Hainan in 2016-2017, and Beijing in 2018. A completely randomized plot design was used with three replicates for each of the three environmental conditions. Each RIL was planted with 17 kernels in 4.0-m rows, with a distance of 0.25 m between two adjacent plants and a row spacing of 0.50 m. For RNA-seq, we selected the most resistant line CIMBL47 and the most susceptible line SY1035 from the GWAS population.

[0244] Field artificial inoculation and phenotyping

[0245] Sterilized corn kernels were used as substrate for Fusarium verticillioides. Corn kernels were boiled until the grains were slightly cracked and then placed in 1L jars (1 / 3-1 / 2 filled). The kernels were autoclaved at 121°C for 20 minutes. After cooling to room temperature, the kernels were inoculated with a piece of Fusarium verticillioides about 1 cm in diameter in a sterile bench and then incubated in a constant temperature incubator at 28°C for about 2 weeks. The day before inoculation, Fusarium verticillioides spores were washed off the grains with sterile water and the concentration was adjusted to 5×10 6 Spores ml -1 . Just before field inoculation, 2 μL / mL Tween-80 surfactant was added to the Fusarium verticillata spores and mixed thoroughly. Each plant was artificially inoculated on its kernel by the nail puncture method approximately 15 days after flowering, in which 1 ml of spores were injected into the kernel each time, and each ear was injected twice. After injection, the perforation points were sealed with waterproof tape to prevent leakage of the spore suspension. At maturity, approximately 45 days after flowering, the disease symptoms of each plant were evaluated. The disease severity of each ear was defined as 5 levels based on the percentage of infected kernel area showing visual symptoms: 0 = 0-1%, 0.25 = 2%-10%, 0.5 = 11%-25%, 0.75 = 26%-50% and 1 = 50%-100%, and then converted into a disease severity index (DSI) (Grau et al. 1982).

[0246] DSI (%) = Σ(class × number of plants in the class) × 100 / (5 × total number of plants).

[0247] Genome-wide association study

[0248] GWAS was performed using a mixed linear model (MLM), which takes into account the effects of population structure and kinship coefficients. The high-quality SNPs used in the GWAS were the same as those described by Li (Li et al. 2013). A total of approximately 560,000 polymorphic SNPs were selected and filtered according to the minor allele frequency (MAF) ≥ 0.05. The software TASSEL 5.2.43 was used for analysis. Significant associations were identified using a false discovery rate (FDR) ≤ 0.05, and the threshold P value was determined by the QQ plot of the model. The candidate resistance genes located in 100 kb intervals 50 kb upstream and downstream of the significant SNPs were retrieved from the GWAS using the maizeGDB genome browser.

[0249] RNA-seq and differentially expressed genes ( Detection of DEGs

[0250] Both the resistant CIMBL47 and susceptible SY1035 lines were grown in the field, and the panicles were collected in the field 15 days after anthesis. The kernels were cut in the middle, half was soaked in sterile water, and the other half was placed in 5 × 10 6 Spore ml -1The spore suspension was immersed in water for 5 minutes. After that, all half kernels were transferred to PDA medium and cultured in an incubator at 28°C. Kernel samples were collected in a sterile bench at 0, 0.5, 1.5, 3 and 6 hours after culture. Figure S10 ) and immediately frozen in liquid nitrogen and stored at -80 °C until RNA extraction. The total RNA extraction protocol was performed according to the manufacturer's instructions of Invitrogen. The procedure for RNA-seq is described by Zhong (Zhong et al. 2018). 100 ng of Poly(A) RNA from each sample was fragmented for RNA-seq library construction and sequenced on Illumina Hiseq3000 according to the manufacturer's recommendations (Illumina). Three biological replicates were performed for each sample in the RNA-seq experiment. Clean reads were used for mapping, calculation, and normalization of gene expression. The reads were aligned to the masked maize genome database EnsembleZea_mays.AGPv3.26 (http: / / plants.ensembl.org / Zea_mays / Info / Index). Calculation and normalization of gene expression were based on FPKM (fragments / kilobase of exon model / million mapped reads) using Cufflinks version 2.1.1. Differentially expressed genes (DEGs) were identified using the false discovery rate (FDR) (1 × 10 -10 ) definition, as determined using the Benjamini and Hochberg procedure. The parameter used to screen DEGs was the fold change (FC) of expression levels compared to the expression levels in the control transcriptome (FC ≥ 2 or FC ≤ 0.5, P value ≤ 0.05, FDR ≤ 0.05). The obtained DEGs were used for GO enrichment and KEGG enrichment (KEGG enrichment pathway map). According to GO and KEGG enrichment, the histogram distribution of differentially expressed genes, KEGG scatter plots, and KEGG enrichment pathway maps were plotted.

[0251] Integration of GWAS and transcriptome data

[0252] Based on RNA-seq data, we calculated the ratio of genome-wide up-regulated and down-regulated DEGs at each time point after inoculation. Meanwhile, we calculated the ratio of up-regulated and down-regulated DEGs within 100-kb intervals corresponding to significant SNPs in GWAS. Then, we compared the ratio of DEGs of genome-wide genes and potential resistance genes detected in GWAS between resistant CIMBL47 and susceptible SY1035 lines and between pathogen-inoculated and water-treated controls. For those DEGs of potential resistance genes detected in GWAS, we divided them into several groups according to their unique expression patterns.

[0253] result

[0254] In the GWAS analysis, we found a total of 70 genes covering or located near SNPs significantly associated with ear rot resistance. As expected, many candidate resistance genes are located in regions where disease resistance QTLs have been detected in previous linkage mapping studies. For example, we found that bin 3.04 contains a large number of candidate genes encoding cytochrome P450 family (GRMZM2G169152), PR5-like receptor kinase (GRMZM2G467671), leaf rust 10 resistance locus receptor-like kinase (GRMZM2G013790), two heat shock proteins (GRMZM2G437100 and GRMZM2G422240), etc. Bin 3.04 has been identified as a hotspot for many disease resistance QTLs in maize, such as Fusarium ear rot (Ding et al. 2008; Pérez et al. 2001), Fusarium stalk rot (Pe′ et al. 1993), sugarcane mosaic virus (Xi et al. 2008; Wang et al. 2003), smut (Chen 2006; Liu et al. 2016), northern corn leaf blight (Ma et al. 2014; WANG et al. 2010), etc. In addition to bin 3.04, other chromosomal regions carrying important SNPs were detected to cover previously identified resistance QTLs. In bin 5.05, a resistance QTL to Fusarium ear rot could explain 13% of the total phenotypic variation (Robertson et al. 2006). In bin 7.03, QTLs were found to confer resistance to Fusarium ear rot and fumonisin B1 (Maschietto et al. 2017). Bin 9.07 also covers significant SNPs detected in other GWAS studies (Zila et al. 2013; Ju et al. 2017) and resistance QTLs in mapping studies (Maschietto et al. 2017, Aida et al. 2016). We detected several genes encoding enzymatically active proteins in bin 9.07, including two U-box superfamily proteins that may be involved in PCD progression ( Figure S7 ).

[0255] Given that resistance-associated genes may play a role in defense against ear rot very early, we performed an improved RNA-seq analysis to try to reveal all potential candidate genes. We selected extremely resistant (CIMBL47) and susceptible (SY1035) lines from the GWAS population. Fifteen-day-old kernels, which were most susceptible to Fusarium ear rot, were sampled for pathogen inoculation. Each kernel was cut in half in the middle, one half was treated with sterile water, and the other half was treated with spore suspension for 5 min and then transferred to PDA medium and cultured at 28°C. This method enables direct contact of the pathogen with the embryo / endosperm with maximum exposure, ensuring that resistance-associated genes can be uniformly and rapidly induced in response to pathogen invasion. In addition, we sampled kernels very early at 0, 0.5, 1.5, 3, and 6 hpi. As expected, the number of candidate resistance genes in the GWAS showed differential gene expression levels between CIMBL47 and SY1035 and between control and pathogen inoculation, even as early as 0 hpi (sampling immediately 5 minutes after pathogen inoculation), and reached peak expression as early as 0.5 or 1.5 hpi (Figure 3). This is consistent with the ear rot resistance gene ZmAuxRP1, which showed its highest expression level 3 hours after pathogen inoculation (Ye et al. 2018).

[0256] Compared with the susceptible line SY1035, the resistant line CIMBL47 showed more up-regulated genes at the early stage after inoculation, reaching a peak at 0.5 hpi or 1.5 hpi (Table 2; Figure 3). Most of the DEGs were enriched in the plant hormone signal transduction pathway, phenylpropanoid biosynthesis, glutathione metabolism, drug metabolism by cytochrome P450, and glyoxylate and dicarboxylic acid metabolism. Interestingly, plant hormone signal transduction was ranked as the top pathway enriched with DEGs at all sampling points, among which genes related to growth hormones were mostly down-regulated or had a downward trend in the resistant line CIMBL47 compared with the susceptible line SY1035, such as EIN3, AUX-related genes; while genes related to defense hormones such as abscisic acid and jasmonic acid were up-regulated, including SnRK2 genes. It has been reported that the plant growth hormone auxin makes plants more susceptible to pathogen attack by negatively regulating the SA signaling pathway and promoting the production of expansins and extensins (Catalá et al., 2000; Wang et al., 2007).

[0257] These findings strongly suggest that the balance between growth and defense plays a key role in maize resistance to Fusarium ear rot. Coincidentally, the ear rot resistance gene ZmAuxRP1 is also involved in the growth-defense trade-off (Ye et al. 2018). Phenylpropanoid biosynthesis was classified as the second pathway enriched in DEGs, and almost all genes in the biosynthetic pathway were upregulated after pathogen attack. This suggests that secondary defense metabolites also play an important role in early ear rot resistance. We noticed that the cytochrome P450 gene family was also enriched in DEGs. The P450 gene family is involved in plant disease resistance by regulating lipid metabolism and affecting the synthesis and activity of jasmonic acid (JA). In addition, as multifunctional oxidases, cytochrome P450 plays a key role in the defense response to pathogen invasion by manipulating the biosynthesis of secondary metabolites, including phenylpropanoids, flavonoids, alkaloids, anthraquinones, glycosides, phytohormones, etc. (Narusaka et al. 2004; Takemoto et al. 1999; Hemm et al. 2003; Koo et al. 2011). Therefore, this study suggests that maize resistance to Fusarium ear rot may rely on multiple defense pathways.

[0258] Integration of GWAS and transcriptome data revealed many candidate genes in GWAS that were differentially expressed after pathogen inoculation, such as cytochrome P450 family genes (GRMZM2G169152), PR5-like receptor kinase genes (GRMZM2G467671), leaf rust locus receptor-like kinase genes (GRMZM2G013790), heat shock protein genes (GRMZM2G437100 and GRMZM2G422240), plant hormone signal transduction genes (GRMZM2G039867, GRMZM5G004528, GRMZM2G074267, and GRMZM2G116557), etc. In the resistant CIMBL47 line, candidate genes related to cytochrome P450, phenylpropanoid and phytohormone signaling pathways, such as GRMZM2G169152, GRMZM2G467671, GRMZM2G039867 and GRMZM2G050325, were highly induced by pathogen invasion. Although we are currently unsure of the exact role played by these genes in ear rot resistance, we believe that they can be used to identify, select and / or generate plants with increased resistance to ear rot.

[0259] In summary, changes in phytohormones upon challenge with Fusarium rotundum suggest that plants will make growth-defense trade-offs to optimize their fitness in the face of pathogen attack. The burst of phenylpropanoid biosynthesis is reinforced by promoting the biosynthesis of defense compounds. The induction of the cytochrome P450 gene family can cause changes in a series of defense metabolites, including phenylpropanoids, flavonoids, alkaloids, anthraquinones, glycosides, phytohormones, etc. After these very early changes, other plant immune responses, such as glutathione metabolism as well as glyoxylate and dicarboxylic acid metabolism, are sequentially activated to jointly fight against the attack of Fusarium rotundum invasion. Sequence Listing <110> CHINA AGRICULTURAL UNIVERSITY SYNGENTA <120> Novel genetic loci associated with ear rot resistance in maize <130> 81918-WO-REG-ORG-P-2 <150> PCT / CN2019 / 100801 <151> 2019-08-15 <160> 1392 <170> PatentIn version 3.5 <210> 1 <211> twenty one <212> DNA <213> corn; <400> 1 agaccaattc gttctttttc t 21 <210> 2 <211> 19 <212> DNA <213> corn; <400> 2 accaattcgt tccttttct 19 <210> 3 <211> 25 <212> DNA <213> corn; <400> 3 tttgtacatg tttcgcggag atttc 25 <210> 4 <211> 19 <212> DNA <213> corn; <400> 4 tggctggtac acgcagaag 19 <210> 5 <211> 16 <212> DNA <213> corn; <400> 5 caggtccagt tctgca 16 <210> 6 <211> 16 <212> DNA <213> corn; <400> 6 caggtccagt cctgca 16 <210> 7 <211> twenty four <212> DNA <213> corn; <400> 7 gcatgatgct gatgggaaag atta 24 <210> 8 <211> 20 <212> DNA <213> corn; <400> 8 gcccctttca gtcatcgaac 20 <210> 9 <211> 14 <212> DNA <213> corn; <400> 9 tcccgcaacc aaat 14 <210> 10 <211> 14 <212> DNA <213> corn; <400> 10 tcccgcaacc aaac 14 <210> 11 <211> twenty four <212> DNA <213> corn; <400> 11 tccccagtta tccctcaaaa ttgg 24 <210> 12 <211> twenty one <212> DNA <213> corn; <400> 12 tgaagccacg caaccactta g 21 <210> 13 <211> 18 <212> DNA <213> corn; <400> 13 tcaacttgaa tggattgg 18 <210> 14 <211> 17 <212> DNA <213> corn; <400> 14 caacttgaat ggactgg 17 <210> 15 <211> twenty two <212> DNA <213> corn; <400> 15 tttatctgaa tttggaagtc ct 22 <210> 16 <211> 19 <212> DNA <213> corn; <400> 16 catgggtcct agtattcgt 19 <210> 17 <211> 17 <212> DNA <213> corn; <400> 17 agcgggaaat gccacat 17 <210> 18 <211> 18 <212> DNA <213> corn; <400> 18 tagcgggaaa agccacat 18 <210> 19 <211> 25 <212> DNA <213> corn; <400> 19 gaatcaggta gtccaatagt agagc 25 <210> 20 <211> 17 <212> DNA <213> corn; <400> 20 tctgcagtcg ccttccg 17 <210> twenty one <211> 18 <212> DNA <213> corn; <400> twenty one catcatgtgc ctagaaag 18 <210> twenty two <211> 18 <212> DNA <213> corn; <400> twenty two catcatgtgc ctagaaaa 18 <210> twenty three <211> 27 <212> DNA <213> corn; <400> twenty three gcatgataga gatatgccta ggagaag 27 <210> twenty four <211> twenty one <212> DNA <213> corn; <400> twenty four tgcccctaat ttcctagcaa c 21 <210> 25 <211> 17 <212> DNA <213> corn; <400> 25 tcattgtata tctcggc 17 <210> 26 <211> twenty one <212> DNA <213> corn; <400> 26 catattcatt gtagatctcg g 21 <210> 27 <211> twenty four <212> DNA <213> corn; <400> 27 acctagaatg ctcaaaaggg aaca 24 <210> 28 <211> twenty three <212> DNA <213> corn; <400> 28 catgctgcgt catcaatcat ctg 23 <210> 29 <211> 15 <212> DNA <213> corn; <400> 29 cggcgctagc tgcag 15 <210> 30 <211> 13 <212> DNA <213> corn; <400> 30 ccggcgccag ctg 13 <210> 31 <211> 18 <212> DNA <213> corn; <400> 31 aggtcgcagg acgcgaag 18 <210> 32 <211> 20 <212> DNA <213> corn; <400> 32 ggcgactcca tctgtaagca 20 <210> 33 <211> 14 <212> DNA <213> corn; <400> 33 ctgatgttca ggcc 14 <210> 34 <211> 15 <212> DNA <213> corn; <400> 34 ctgatgttca agcct 15 <210> 35 <211> twenty one <212> DNA <213> corn; <400> 35 ccacgaggaa cattcgacca t 21 <210> 36 <211> twenty three <212> DNA <213> corn; <400> 36 tctcgtcaag tccgctctta ttg 23 <210> 37 <211> 13 <212> DNA <213> corn; <400> 37 actcctcgcc tgc 13 <210> 38 <211> 15 <212> DNA <213> corn; <400> 38 aagtactccc cgcct 15 <210> 39 <211> 18 <212> DNA <213> corn; <400> 39 tcctgactcc ggatccac 18 <210> 40 <211> 18 <212> DNA <213> corn; <400> 40 aggcacaggc tggcagtg 18 <210> 41 <211> 13 <212> DNA <213> corn; <400> 41 ccgaacacgc cct 13 <210> 42 <211> 12 <212> DNA <213> corn; <400> 42 cgaacacgcc cc 12 <210> 43 <211> twenty two <212> DNA <213> corn; <400> 43 ctgcaacagt gtcggcttgt ag 22 <210> 44 <211> 20 <212> DNA <213> corn; <400> 44 gctccaagag cgagggatac 20 <210> 45 <211> twenty one <212> DNA <213> corn; <400> 45 aagtttcaaa ttataatggt a 21 <210> 46 <211> twenty two <212> DNA <213> corn; <400> 46 tttcaaatta taatgataga gt 22 <210> 47 <211> twenty three <212> DNA <213> corn; <400> 47 tgactgatgg aggttcgaag ttg 23 <210> 48 <211> 28 <212> DNA <213> corn; <400> 48 cgactaataa aaagaaacgg agggagta 28 <210> 49 <211> 19 <212> DNA <213> corn; <400> 49 tgggtaattt ctaggaaac 19 <210> 50 <211> 19 <212> DNA <213> corn; <400> 50 tggtgggtaa tttctaaga 19 <210> 51 <211> twenty three <212> DNA <213> corn; <400> 51 cgattcggtg gattataatg gca 23 <210> 52 <211> twenty one <212> DNA <213> corn; <400> 52 gctttcgtta gggcctgttt g 21 <210> 53 <211> 19 <212> DNA <213> corn; <400> 53 atagaactcc tagcaggca 19 <210> 54 <211> 16 <212> DNA <213> corn; <400> 54 aactccttgc aggcaa 16 <210> 55 <211> twenty one <212> DNA <213> corn; <400> 55 gggatgttgc aagcaagaga a 21 <210> 56 <211> 18 <212> DNA <213> corn; <400> 56 gtcacgagcc gtgtgaaa 18 <210> 57 <211> 20 <212> DNA <213> corn; <400> 57 catcttgagt gatgtaaatg 20 <210> 58 <211> 19 <212> DNA <213> corn; <400> 58 catcttgagt gatgtacat 19 <210> 59 <211> twenty one <212> DNA <213> corn; <400> 59 ggcagggcta aatcaacttg c 21 <210> 60 <211> 26 <212> DNA <213> corn; <400> 60 caacagattg gtgagatcaa gagctg 26 <210> 61 <211> 14 <212> DNA <213> corn; <400> 61 acggacccac cttg 14 <210> 62 <211> 15 <212> DNA <213> corn; <400> 62 acggacccac cttaa 15 <210> 63 <211> twenty three <212> DNA <213> corn; <400> 63 acggtcctgt atatgacaag cag 23 <210> 64 <211> 18 <212> DNA <213> corn; <400> 64 tgggctgagt ggtgaagc 18 <210> 65 <211> 16 <212> DNA <213> corn; <400> 65 tgcagttgca ggtacg 16 <210> 66 <211> 18 <212> DNA <213> corn; <400> 66 attgcagttg caggtacc 18 <210> 67 <211> 20 <212> DNA <213> corn; <400> 67 acagccactg gtggttggtc 20 <210> 68 <211> twenty four <212> DNA <213> corn; <400> 68 ggcgtacgtg ccacttatat agtc 24 <210> 69 <211> 15 <212> DNA <213> corn; <400> 69 tggagcgtct acacc 15 <210> 70 <211> 17 <212> DNA <213> corn; <400> 70 catggagcat ctacacc 17 <210> 71 <211> twenty two <212> DNA <213> corn; <400> 71 cttgttctaa gcgcctcctg at 22 <210> 72 <211> twenty two <212> DNA <213> corn; <400> 72 tggtgactct tgatggagtt ca 22 <210> 73 <211> 19 <212> DNA <213> corn; <400> 73 ttctgtaatt ttatcaatt 19 <210> 74 <211> 16 <212> DNA <213> corn; <400> 74 ttctgtaatt ttacca 16 <210> 75 <211> 17 <212> DNA <213> corn; <400> 75 ctgcctacat gcagttt 17 <210> 76 <211> 17 <212> DNA <213> corn; <400> 76 tgccacgata agaaagg 17 <210> 77 <211> 16 <212> DNA <213> corn; <400> 77 tctccaggag ttcgag 16 <210> 78 <211> 16 <212> DNA <213> corn; <400> 78 ctccaggagt tcaagg 16 <210> 79 <211> 25 <212> DNA <213> corn; <400> 79 cctttggtgc aatctatgat caggt 25 <210> 80 <211> twenty four <212> DNA <213> corn; <400> 80 cgaaacgtag ccaacgtaaa caac 24 <210> 81 <211> 17 <212> DNA <213> corn; <400> 81 cgcggaaatc cgagtag 17 <210> 82 <211> 15 <212> DNA <213> corn; <400> 82 cggaaatccg agcag 15 <210> 83 <211> 20 <212> DNA <213> corn; <400> 83 gggtggactc actccgaatg 20 <210> 84 <211> 19 <212> DNA <213> corn; <400> 84 gagcccctct ctcctcgtt 19 <210> 85 <211> 11 <212> DNA <213> corn; <400> 85 ctgcgccgcg t 11 <210> 86 <211> 12 <212> DNA <213> corn; <400> 86 ctgcgccgca tg 12 <210> 87 <211> 17 <212> DNA <213> corn; <400> 87 cgtcgccctg agcctac 17 <210> 88 <211> 20 <212> DNA <213> corn; <400> 88 tgcgacggtg atagacgatg 20 <210> 89 <211> 16 <212> DNA <213> corn; <400> 89 ccctataccc cactac 16 <210> 90 <211> 15 <212> DNA <213> corn; <400> 90 cctatacccc acaac 15 <210> 91 <211> twenty one <212> DNA <213> corn; <400> 91 tccaccctgt acaatggttc c 21 <210> 92 <211> twenty four <212> DNA <213> corn; <400> 92 gcgtacacca gtatttgtca gttc 24 <210> 93 <211> 17 <212> DNA <213> corn; <400> 93 tccttgtcag gatcatc 17 <210> 94 <211> 17 <212> DNA <213> corn; <400> 94 tccttgtcag catcatc 17 <210> 95 <211> 25 <212> DNA <213> corn; <400> 95 cgccattaat tcatgcttgt ctctg 25 <210> 96 <211> twenty one <212> DNA <213> corn; <400> 96 acacgctgcg ttggagaatc c 21 <210> 97 <211> 17 <212> DNA <213> corn; <400> 97 cagccaaaat cgaacca 17 <210> 98 <211> 16 <212> DNA <213> corn; <400> 98 cagccaaaac cgaacc 16 <210> 99 <211> 15 <212> DNA <213> corn; <400> 99 gagcgagccg cctga 15 <210> 100 <211> 18 <212> DNA <213> corn; <400> 100 ccgtggcaac tggtcctg 18 <210> 101 <211> 13 <212> DNA <213> corn; <400> 101 ccctgcgaac gcc 13 <210> 102 <211> 13 <212> DNA <213> corn; <400> 102 ccctgccaac gcc 13 <210> 103 <211> 18 <212> DNA <213> corn; <400> 103 tggaggccaa gtcgaacg 18 <210> 104 <211> 15 <212> DNA <213> corn; <400> 104 ggctcgggtc cagca 15 <210> 105 <211> 20 <212> DNA <213> corn; <400> 105 ctgcttgtga tagaaataaa 20 <210> 106 <211> twenty one <212> DNA <213> corn; <400> 106 cttgtgatag aaacaaagat g 21 <210> 107 <211> 18 <212> DNA <213> corn; <400> 107 atgaagggaa gaccgcat 18 <210> 108 <211> 19 <212> DNA <213> corn; <400> 108 tgggacatat tagaccatc 19 <210> 109 <211> 18 <212> DNA <213> corn; <400> 109 ctttctctag ccgtacta 18 <210> 110 <211> 18 <212> DNA <213> corn; <400> 110 ctttctctag ccctacta 18 <210> 111 <211> twenty one <212> DNA <213> corn; <400> 111 agctttgctt cctgggtgct t 21 <210> 112 <211> 20 <212> DNA <213> corn; <400> 112 tcggcatcac ctgtatcaga 20 <210> 113 <211> 19 <212> DNA <213> corn; <400> 113 catgaaagtt aatcctcaa 19 <210> 114 <211> 20 <212> DNA <213> corn; <400> 114 ttcatgaaag ttaatcatca 20 <210> 115 <211> 28 <212> DNA <213> corn; <400> 115 cagctttttg gtcgtttttc tttgattg 28 <210> 116 <211> twenty three <212> DNA <213> corn; <400> 116 ggtgagcttg tgttatgttc tca 23 <210> 117 <211> 17 <212> DNA <213> corn; <400> 117 cgctagaccg tgatggt 17 <210> 118 <211> 17 <212> DNA <213> corn; <400> 118 cgctagaccc tgatggt 17 <210> 119 <211> twenty one <212> DNA <213> corn; <400> 119 tgcaaccagt gaatgtcctt g 21 <210> 120 <211> twenty three <212> DNA <213> corn; <400> 120 gtcgtttgga gctagtagtt gac 23 <210> 121 <211> 18 <212> DNA <213> corn; <400> 121 atggctgctg cttcatac 18 <210> 122 <211> 17 <212> DNA <213> corn; <400> 122 atggctgctg cgtcata 17 <210> 123 <211> twenty four <212> DNA <213> corn; <400> 123 gttggacctt ctctctgtaa gtca 24 <210> 124 <211> 18 <212> DNA <213> corn; <400> 124 tgcttgcctc gctgtgat 18 <210> 125 <211> twenty one <212> DNA <213> corn; <400> 125 attttattat tcgtccgtct a 21 <210> 126 <211> 17 <212> DNA <213> corn; <400> 126 tattattcgc ccgtcta 17 <210> 127 <211> twenty two <212> DNA <213> corn; <400> 127 tccaaggtta cctgaaccct aa 22 <210> 128 <211> twenty four <212> DNA <213> corn; <400> 128 gagcatggac attacatggac ataa 24 <210> 129 <211> 16 <212> DNA <213> corn; <400> 129 aattgatcac gcacta 16 <210> 130 <211> 18 <212> DNA <213> corn; <400> 130 aattgatcac acactatc 18 <210> 131 <211> 20 <212> DNA <213> corn; <400> 131 aggcaagctc gatggttcac 20 <210> 132 <211> twenty one <212> DNA <213> corn; <400> 132 ccatgtggtc gtgggttcaa g 21 <210> 133 <211> 15 <212> DNA <213> corn; <400> 133 cgcaaagggc gtgtg 15 <210> 134 <211> 17 <212> DNA <213> corn; <400> 134 acgcaaagag cgtgtgg 17 <210> 135 <211> 18 <212> DNA <213> corn; <400> 135 acccgcggca accgtaaa 18 <210> 136 <211> 17 <212> DNA <213> corn; <400> 136 cgtcgtcgtc ggagaca 17 <210> 137 <211> 19 <212> DNA <213> corn; <400> 137 tctttcaaga ttaatgaag 19 <210> 138 <211> 19 <212> DNA <213> corn; <400> 138 ctttcaagat taaagaagg 19 <210> 139 <211> twenty three <212> DNA <213> corn; <400> 139 gcagtgggtt gacatcaaca atg 23 <210> 140 <211> twenty two <212> DNA <213> corn; <400> 140 gtttagcaag ctgaaagggt ga 22 <210> 141 <211> 18 <212> DNA <213> corn; <400> 141 caggtattcg tgtgcatc 18 <210> 142 <211> 17 <212> DNA <213> corn; <400> 142 caggtattcg cgtgcat 17 <210> 143 <211> 20 <212> DNA <213> corn; <400> 143 agggcactca ggcacatgat 20 <210> 144 <211> 20 <212> DNA <213> corn; <400> 144 ccaccactcg cactaggaaa 20 <210> 145 <211> twenty one <212> DNA <213> corn; <400> 145 aggttagtcg ttcgaattgg a 21 <210> 146 <211> twenty one <212> DNA <213> corn; <400> 146 aaggttagtc gttcaaattg g 21 <210> 147 <211> twenty three <212> DNA <213> corn; <400> 147 gtttggtttg tggctaaatg tgc 23 <210> 148 <211> twenty one <212> DNA <213> corn; <400> 148 aggtgagtgt gacgtgcata g 21 <210> 149 <211> 14 <212> DNA <213> corn; <400> 149 catgctgcgg tcgc 14 <210> 150 <211> 13 <212> DNA <213> corn; <400> 150 atgcggcggt cgc 13 <210> 151 <211> twenty two <212> DNA <213> corn; <400> 151 acatgtagat gatgcggtcg tg 22 <210> 152 <211> 18 <212> DNA <213> corn; <400> 152 accagctccc gtttctgc 18 <210> 153 <211> 13 <212> DNA <213> corn; <400> 153 ccccgccttc gaa 13 <210> 154 <211> 13 <212> DNA <213> corn; <400> 154 tgccccacct tcg 13 <210> 155 <211> 18 <212> DNA <213> corn; <400> 155 gggccatcag cgttcgtc 18 <210> 156 <211> 20 <212> DNA <213> corn; <400> 156 agatggcgtg ctcggtgttc 20 <210> 157 <211> 19 <212> DNA <213> corn; <400> 157 ccatccaatg tatcaattg 19 <210> 158 <211> 19 <212> DNA <213> corn; <400> 158 catccaatgt atcaactga 19 <210> 159 <211> twenty three <212> DNA <213> corn; <400> 159 gaacttgata tgtagctaaa gac 23 <210> 160 <211> twenty one <212> DNA <213> corn; <400> 160 tcatgttgaa gttgaattgg t 21 <210> 161 <211> 19 <212> DNA <213> corn; <400> 161 cgagaggatg acactataa 19 <210> 162 <211> 19 <212> DNA <213> corn; <400> 162 agaggatgac actacaagt 19 <210> 163 <211> twenty two <212> DNA <213> corn; <400> 163 gctatcgccc accaataaag tg 22 <210> 164 <211> twenty three <212> DNA <213> corn; <400> 164 atgtgtcctc aacccttaga tga 23 <210> 165 <211> 17 <212> DNA <213> corn; <400> 165 tcaactggac taaataa 17 <210> 166 <211> 16 <212> DNA <213> corn; <400> 166 aagtcaactg gacaaa 16 <210> 167 <211> twenty one <212> DNA <213> corn; <400> 167 tccaagcagc tatcagatcc a 21 <210> 168 <211> twenty two <212> DNA <213> corn; <400> 168 gctcttgcct tctgttcttc ac 22 <210> 169 <211> twenty one <212> DNA <213> corn; <400> 169 aacaggacta ctcagattat a 21 <210> 170 <211> 17 <212> DNA <213> corn; <400> 170 caggactact cagacta 17 <210> 171 <211> 25 <212> DNA <213> corn; <400> 171 gagggcattc ttgtcttcct catac 25 <210> 172 <211> twenty one <212> DNA <213> corn; <400> 172 gcttcgggcc tgtttgttta c 21 <210> 173 <211> 14 <212> DNA <213> corn; <400> 173 cccgatgcga cgtc 14 <210> 174 <211> 14 <212> DNA <213> corn; <400> 174 cccgaggcga cgtc 14 <210> 175 <211> 15 <212> DNA <213> corn; <400> 175 cgccttggcg gcctt 15 <210> 176 <211> 20 <212> DNA <213> corn; <400> 176 ccgcgtcaag tgtttcatca 20 <210> 177 <211> 20 <212> DNA <213> corn; <400> 177 agcatggaaa tcttgtcttc 20 <210> 178 <211> 20 <212> DNA <213> corn; <400> 178 tagcatggaa atcctgtctt 20 <210> 179 <211> twenty three <212> DNA <213> corn; <400> 179 tccacccaaa agatatcatc cga 23 <210> 180 <211> twenty one <212> DNA <213> corn; <400> 180 ccacctggga atgcaaggaa t 21 <210> 181 <211> 19 <212> DNA <213> corn; <400> 181 caaagcatgt accattaat 19 <210> 182 <211> 18 <212> DNA <213> corn; <400> 182 aaagcatgta ccatcaat 18 <210> 183 <211> 19 <212> DNA <213> corn; <400> 183 acgtatcccg gccgtctac 19 <210> 184 <211> twenty two <212> DNA <213> corn; <400> 184 gcggtgaagg aagatcatgg tt 22 <210> 185 <211> 17 <212> DNA <213> corn; <400> 185 tccaggaagg gccaaag 17 <210> 186 <211> 18 <212> DNA <213> corn; <400> 186 ccaggaaggc ccaaagat 18 <210> 187 <211> 20 <212> DNA <213> corn; <400> 187 gcagacgtga tcctgaagca 20 <210> 188 <211> 17 <212> DNA <213> corn; <400> 188 tcaggcacgg gctgaac 17 <210> 189 <211> 15 <212> DNA <213> corn; <400> 189 ccccggttgt cacat 15 <210> 190 <211> 16 <212> DNA <213> corn; <400> 190 cccggttatc acatgc 16 <210> 191 <211> twenty three <212> DNA <213> corn; <400> 191 ggcaaagagg gattgctaca ctt 23 <210> 192 <211> 25 <212> DNA <213> corn; <400> 192 catccacaac acaaacactg acatc 25 <210> 193 <211> 20 <212> DNA <213> corn; <400> 193 tcttcgtaga gaaagtatgt 20 <210> 194 <211> 20 <212> DNA <213> corn; <400> 194 cgtagagaaa gataccgtat 20 <210> 195 <211> 17 <212> DNA <213> corn; <400> 195 tgttcaggta acacgag 17 <210> 196 <211> 20 <212> DNA <213> corn; <400> 196 cactcaatac tccaaacagt 20 <210> 197 <211> 19 <212> DNA <213> corn; <400> 197 tccaatttct ggttcacat 19 <210> 198 <211> 17 <212> DNA <213> corn; <400> 198 ccaatttctg gctcaca 17 <210> 199 <211> twenty one <212> DNA <213> corn; <400> 199 cctccaggcc aaagatgcaa t 21 <210> 200 <211> twenty three <212> DNA <213> corn; <400> 200 cccgctctat ccgttacact tct 23 <210> 201 <211> 16 <212> DNA <213> corn; <400> 201 taactaatag caatgc 16 <210> 202 <211> 19 <212> DNA <213> corn; <400> 202 taataactaa tagcaatac 19 <210> 203 <211> twenty one <212> DNA <213> corn; <400> 203 atgaaccata tatcctagga a 21 <210> 204 <211> 17 <212> DNA <213> corn; <400> 204 gaggtgctcc aatcttc 17 <210> 205 <211> 16 <212> DNA <213> corn; <400> 205 cagtaggttg ggcaac 16 <210> 206 <211> 14 <212> DNA <213> corn; <400> 206 ccagtaggtt gcgc 14 <210> 207 <211> twenty three <212> DNA <213> corn; <400> 207 tgttagtcca ggccttctga atc ​​23 <210> 208 <211> 25 <212> DNA <213> corn; <400> 208 acagcagagg ttaaagtagc atagc 25 <210> 209 <211> 16 <212> DNA <213> corn; <400> 209 tggctttgga tcgggt 16 <210> 210 <211> 18 <212> DNA <213> corn; <400> 210 ttggctttgg atcgagtt 18 <210> 211 <211> 20 <212> DNA <213> corn; <400> 211 ttgacgtatc gggtcggatt 20 <210> 212 <211> twenty two <212> DNA <213> corn; <400> 212 cgggctaagt acaagccatg at 22 <210> 213 <211> 15 <212> DNA <213> corn; <400> 213 tccgacggct agaga 15 <210> 214 <211> 18 <212> DNA <213> corn; <400> 214 caatatccga cagctaga 18 <210> 215 <211> 25 <212> DNA <213> corn; <400> 215 cagactacca tgaagagagt tgtga 25 <210> 216 <211> 25 <212> DNA <213> corn; <400> 216 ggtagttgatttcttgtccgctgat 25 <210> 217 <211> 17 <212> DNA <213> corn; <400> 217 cgtttaggaa tctctgg 17 <210> 218 <211> 18 <212> DNA <213> corn; <400> 218 cgtttaggaa tatctggg 18 <210> 219 <211> 15 <212> DNA <213> corn; <400> 219 ggcgagaatg actgc 15 <210> 220 <211> twenty one <212> DNA <213> corn; <400> 220 aatgacatgt gatctttgtt t 21 <210> 221 <211> 19 <212> DNA <213> corn; <400> 221 cgagagtgta ttatggtag 19 <210> 222 <211> 19 <212> DNA <213> corn; <400> 222 cgagagtgta ttatgggag 19 <210> 223 <211> 17 <212> DNA <213> corn; <400> 223 tcctggcaac cgagacc 17 <210> 224 <211> 20 <212> DNA <213> corn; <400> 224 acaggccagc aggcagatag 20 <210> 225 <211> 16 <212> DNA <213> corn; <400> 225 tgttggtctg cgaggt 16 <210> 226 <211> 18 <212> DNA <213> corn; <400> 226 tgtgttggtc tacgaggt 18 <210> 227 <211> 18 <212> DNA <213> corn; <400> 227 cgtcaggtgc ttcaccga 18 <210> 228 <211> twenty one <212> DNA <213> corn; <400> 228 gagggtggag acgcaagata c 21 <210> 229 <211> 18 <212> DNA <213> corn; <400> 229 tcacattcca ttggttgg 18 <210> 230 <211> 17 <212> DNA <213> corn; <400> 230 cacattccat cggttgg 17 <210> 231 <211> 18 <212> DNA <213> corn; <400> 231 ggtggaggcg cataggtt 18 <210> 232 <211> 19 <212> DNA <213> corn; <400> 232 acggcaggag aggaaggaa 19 <210> 233 <211> 18 <212> DNA <213> corn; <400> 233 atactatcct ctccggga 18 <210> 234 <211> 14 <212> DNA <213> corn; <400> 234 tatcccctcc ggga 14 <210> 235 <211> twenty three <212> DNA <213> corn; <400> 235 tgatttggat ttgggaattgga 23 <210> 236 <211> twenty one <212> DNA <213> corn; <400> 236 aaacgagcag gtgtttagcc a 21 <210> 237 <211> 16 <212> DNA <213> corn; <400> 237 aatgacaccc ccttcc 16 <210> 238 <211> 15 <212> DNA <213> corn; <400> 238 atgacacccc ctccc 15 <210> 239 <211> 20 <212> DNA <213> corn; <400> 239 ccaaccattt cttgctgcca 20 <210> 240 <211> twenty one <212> DNA <213> corn; <400> 240 ttgagagctc cgcgaaatga g 21 <210> 241 <211> 17 <212> DNA <213> corn; <400> 241 tcaccaagta ctcccta 17 <210> 242 <211> 16 <212> DNA <213> corn; <400> 242 caccaagtac tcccca 16 <210> 243 <211> twenty one <212> DNA <213> corn; <400> 243 agcaaaggtg cggatgccat t 21 <210> 244 <211> twenty four <212> DNA <213> corn; <400> 244 gcttccaaat cgctaccttg tttc 24 <210> 245 <211> 18 <212> DNA <213> corn; <400> 245 ctcgtatgcc gttttgtt 18 <210> 246 <211> 18 <212> DNA <213> corn; <400> 246 tcgtatgcca ttttgttc 18 <210> 247 <211> 25 <212> DNA <213> corn; <400> 247 tccatcatca aaccctaaac accag 25 <210> 248 <211> twenty four <212> DNA <213> corn; <400> 248 gaatgccaac catcagaagt caac 24 <210> 249 <211> twenty four <212> DNA <213> corn; <400> 249 ccatgtatgt tgataatttc taaa 24 <210> 250 <211> twenty three <212> DNA <213> corn; <400> 250 accatgtatg ttgataactt cta 23 <210> 251 <211> twenty three <212> DNA <213> corn; <400> 251 gcagtatggc ctatgtttgt tgc 23 <210> 252 <211> 19 <212> DNA <213> corn; <400> 252 ccggtaccct ggtgtcgtt 19 <210> 253 <211> 19 <212> DNA <213> corn; <400> 253 ttgaaggaga gaggacaga 19 <210> 254 <211> 20 <212> DNA <213> corn; <400> 254 tttgaaggag agaggacaaa 20 <210> 255 <211> twenty four <212> DNA <213> corn; <400> 255 aggagcacct catttggtta gaaa 24 <210> 256 <211> 19 <212> DNA <213> corn; <400> 256 ccgagcgaag tcgagaacc 19 <210> 257 <211> 18 <212> DNA <213> corn; <400> 257 ctgaggaacg atcgattc 18 <210> 258 <211> 18 <212> DNA <213> corn; <400> 258 tgaggaacga ccgattct 18 <210> 259 <211> twenty three <212> DNA <213> corn; <400> 259 gctagtcaac acacacccac aag 23 <210> 260 <211> twenty one <212> DNA <213> corn; <400> 260 ggagccaggc tcatcacata c 21 <210> 261 <211> 13 <212> DNA <213> corn; <400> 261 cagtcggagc ggg 13 <210> 262 <211> 14 <212> DNA <213> corn; <400> 262 agtcggagca gggc 14 <210> 263 <211> twenty four <212> DNA <213> corn; <400> 263 aactcggttg ttgtcagtct tacc 24 <210> 264 <211> 20 <212> DNA <213> corn; <400> 264 ctgaccgacc tgacaggaaa 20 <210> 265 <211> 20 <212> DNA <213> corn; <400> 265 cggattctct ctgaatgatg 20 <210> 266 <211> 19 <212> DNA <213> corn; <400> 266 acggattctc tccgaatga 19 <210> 267 <211> twenty three <212> DNA <213> corn; <400> 267 gatttgtgtt cgacagtggg atg 23 <210> 268 <211> 25 <212> DNA <213> corn; <400> 268 gcaagcccga accaatataa taacc 25 <210> 269 <211> 16 <212> DNA <213> corn; <400> 269 cagtgctttg acctcg 16 <210> 270 <211> 16 <212> DNA <213> corn; <400> 270 cagtgctttc acctcg 16 <210> 271 <211> twenty four <212> DNA <213> corn; <400> 271 gccaagatga caagatccaa caac 24 <210> 272 <211> 19 <212> DNA <213> corn; <400> 272 tgtccgccat ctccagcat 19 <210> 273 <211> 18 <212> DNA <213> corn; <400> 273 cacattgacg ttgatgac 18 <210> 274 <211> 17 <212> DNA <213> corn; <400> 274 cattgacgtt gaggaca 17 <210> 275 <211> 18 <212> DNA <213> corn; <400> 275 gttgacaatg gaaggaga 18 <210> 276 <211> twenty one <212> DNA <213> corn; <400> 276 ccggatatgt atatgatgct g 21 <210> 277 <211> twenty two <212> DNA <213> corn; <400> 277 agtattatag ctaaaaatag ac 22 <210> 278 <211> twenty two <212> DNA <213> corn; <400> 278 cataagtatt atagctaaaa aa 22 <210> 279 <211> 25 <212> DNA <213> corn; <400> 279 acacatatca caagtcagaa tgctc 25 <210> 280 <211> twenty four <212> DNA <213> corn; <400> 280 acggttaatt ggtaggcacg gtaa 24 <210> 281 <211> 15 <212> DNA <213> corn; <400> 281 cgacattgtg cgctt 15 <210> 282 <211> 17 <212> DNA <213> corn; <400> 282 ttcgacattg tacgctt 17 <210> 283 <211> twenty three <212> DNA <213> corn; <400> 283 tttatgtcag aaagcttgag gca 23 <210> 284 <211> twenty two <212> DNA <213> corn; <400> 284 tgtcggctaa tcatctcaag ga 22 <210> 285 <211> 18 <212> DNA <213> corn; <400> 285 ttcactaacg atgtaatt 18 <210> 286 <211> 16 <212> DNA <213> corn; <400> 286 tcactaacga tggaat 16 <210> 287 <211> 19 <212> DNA <213> corn; <400> 287 agtccctatg ggtttccaa 19 <210> 288 <211> 18 <212> DNA <213> corn; <400> 288 cctcttccca tgagaact 18 <210> 289 <211> 19 <212> DNA <213> corn; <400> 289 tttatgctag tcaaacttt 19 <210> 290 <211> 19 <212> DNA <213> corn; <400> 290 tttatgctag tcaaacatt 19 <210> 291 <211> twenty three <212> DNA <213> corn; <400> 291 tcagttaagt atcgtctaga ttt 23 <210> 292 <211> 18 <212> DNA <213> corn; <400> 292 accgcgatac atcattgg 18 <210> 293 <211> 17 <212> DNA <213> corn; <400> 293 ttgagaacct tcagtac 17 <210> 294 <211> 17 <212> DNA <213> corn; <400> 294 ttgagaacca tcagtac 17 <210> 295 <211> 20 <212> DNA <213> corn; <400> 295 cgttgtcagc attggtggac 20 <210> 296 <211> 20 <212> DNA <213> corn; <400> 296 gatcgtcgca cggatgtcta 20 <210> 297 <211> 20 <212> DNA <213> corn; <400> 297 caaaccatcg aatctgtaac 20 <210> 298 <211> 19 <212> DNA <213> corn; <400> 298 accatcgaat ccgtaacaa 19 <210> 299 <211> twenty three <212> DNA <213> corn; <400> 299 ttgccagagt tgattccacc taa 23 <210> 300 <211> twenty one <212> DNA <213> corn; <400> 300 ctgcgacatt gcctctaacc a 21 <210> 301 <211> 15 <212> DNA <213> corn; <400> 301 atcggactct cggct 15 <210> 302 <211> 15 <212> DNA <213> corn; <400> 302 aatcggactc tcagc 15 <210> 303 <211> twenty one <212> DNA <213> corn; <400> 303 caatccggtc tcagtggttg g 21 <210> 304 <211> 20 <212> DNA <213> corn; <400> 304 cctgagctgg ctactgatga 20 <210> 305 <211> twenty two <212> DNA <213> corn; <400> 305 atagcattag attctgagca tt 22 <210> 306 <211> 20 <212> DNA <213> corn; <400> 306 agcattagat tctgagcata 20 <210> 307 <211> twenty two <212> DNA <213> corn; <400> 307 ttcggcgtct acttcctgta tc 22 <210> 308 <211> 25 <212> DNA <213> corn; <400> 308 tgctttgtgt tcgtatgcat gaata 25 <210> 309 <211> 15 <212> DNA <213> corn; <400> 309 ctgctgctgt ttgca 15 <210> 310 <211> 16 <212> DNA <213> corn; <400> 310 tgctgctgct atttgc 16 <210> 311 <211> twenty four <212> DNA <213> corn; <400> 311 ccaagacaaa ctctccctgt atgc 24 <210> 312 <211> twenty two <212> DNA <213> corn; <400> 312 ggctcggaag gtctcaaaga ag 22 <210> 313 <211> 17 <212> DNA <213> corn; <400> 313 tggttgtagt attgcaa 17 <210> 314 <211> 19 <212> DNA <213> corn; <400> 314 ttggttgtag tattgaaaa 19 <210> 315 <211> 25 <212> DNA <213> corn; <400> 315 ggtttgctct tgctgatcga tatgt 25 <210> 316 <211> twenty one <212> DNA <213> corn; <400> 316 gctcagctac tccctctgtt c 21 <210> 317 <211> 17 <212> DNA <213> corn; <400> 317 cgaggtggtg acgatgt 17 <210> 318 <211> 17 <212> DNA <213> corn; <400> 318 cgaggtggtc acgatgt 17 <210> 319 <211> 20 <212> DNA <213> corn; <400> 319 cgggtcaagt tctgctgtga 20 <210> 320 <211> twenty two <212> DNA <213> corn; <400> 320 atcatacggc ggaagtagtt ca 22 <210> 321 <211> twenty one <212> DNA <213> corn; <400> 321 aaacatgaat actcgatctg c 21 <210> 322 <211> 20 <212> DNA <213> corn; <400> 322 caaacatgaa tacccgatct 20 <210> 323 <211> twenty one <212> DNA <213> corn; <400> 323 tggcttgagc cattacctga t 21 <210> 324 <211> twenty two <212> DNA <213> corn; <400> 324 gaaactgcaa gaggcatgaa ac 22 <210> 325 <211> 19 <212> DNA <213> corn; <400> 325 tgatgcgatt tcgttgaat 19 <210> 326 <211> 20 <212> DNA <213> corn; <400> 326 cgtgatgcga tttagttgaa 20 <210> 327 <211> twenty two <212> DNA <213> corn; <400> 327 cggattacaa ctctctgttg cc 22 <210> 328 <211> twenty four <212> DNA <213> corn; <400> 328 cacactcaag gtgacttaga ccaa 24 <210> 329 <211> 18 <212> DNA <213> corn; <400> 329 cagttgtttg tatagaca 18 <210> 330 <211> 20 <212> DNA <213> corn; <400> 330 atacagttgt ttgtataaac 20 <210> 331 <211> 17 <212> DNA <213> corn; <400> 331 ggattggacc agcagat 17 <210> 332 <211> 19 <212> DNA <213> corn; <400> 332 gtgagacaag gctacatac 19 <210> 333 <211> 11 <212> DNA <213> corn; <400> 333 ccggccgcag t 11 <210> 334 <211> 13 <212> DNA <213> corn; <400> 334 ccgcagcggt gat 13 <210> 335 <211> 19 <212> DNA <213> corn; <400> 335 cgtcgcggtc ctctctgat 19 <210> 336 <211> twenty one <212> DNA <213> corn; <400> 336 ctgcgaatcg tccatcctgt a 21 <210> 337 <211> 18 <212> DNA <213> corn; <400> 337 ccttgtgaga aaactcta 18 <210> 338 <211> 18 <212> DNA <213> corn; <400> 338 cttgtgagaa aaccctag 18 <210> 339 <211> 16 <212> DNA <213> corn; <400> 339 gtgcaatggc tgactc 16 <210> 340 <211> 20 <212> DNA <213> corn; <400> 340 gcacgattat gcatgattag 20 <210> 341 <211> 18 <212> DNA <213> corn; <400> 341 tcaaagctag gtttatgc 18 <210> 342 <211> 18 <212> DNA <213> corn; <400> 342 tcaaagctag gtttaggc 18 <210> 343 <211> twenty one <212> DNA <213> corn; <400> 343 agggttaggg tttcacttcc a 21 <210> 344 <211> 19 <212> DNA <213> corn; <400> 344 agcactggcg aggctacag 19 <210> 345 <211> twenty one <212> DNA <213> corn; <400> 345 agatctgatt ggtatagggc a 21 <210> 346 <211> 17 <212> DNA <213> corn; <400> 346 ctgattggta cagggca 17 <210> 347 <211> 19 <212> DNA <213> corn; <400> 347 aaggcagagg tgcttcggt 19 <210> 348 <211> twenty four <212> DNA <213> corn; <400> 348 gtgctgcatt tctaaggtgt caag 24 <210> 349 <211> twenty two <212> DNA <213> corn; <400> 349 ctagggaagt tgtcgtttga aa 22 <210> 350 <211> 19 <212> DNA <213> corn; <400> 350 agggaagttg tcgcttgaa 19 <210> 351 <211> twenty one <212> DNA <213> corn; <400> 351 ggtgcaggca agagagcatt t 21 <210> 352 <211> 25 <212> DNA <213> corn; <400> 352 tggattatat ggaaggtccg aaggt 25 <210> 353 <211> 15 <212> DNA <213> corn; <400> 353 aggcggcgac caact 15 <210> 354 <211> 15 <212> DNA <213> corn; <400> 354 aggcggccac caact 15 <210> 355 <211> 18 <212> DNA <213> corn; <400> 355 acgttcgccg acgaggag 18 <210> 356 <211> 20 <212> DNA <213> corn; <400> 356 cgcagcatgt cgacgatctc 20 <210> 357 <211> 19 <212> DNA <213> corn; <400> 357 agcggagcaa tgactactt 19 <210> 358 <211> 17 <212> DNA <213> corn; <400> 358 cggagcaacg actactt 17 <210> 359 <211> 17 <212> DNA <213> corn; <400> 359 ggtgcacacc ggactgt 17 <210> 360 <211> 19 <212> DNA <213> corn; <400> 360 caactgcgcg tcctctgtc 19 <210> 361 <211> 19 <212> DNA <213> corn; <400> 361 ccagtttctt ctgtgagtg 19 <210> 362 <211> 18 <212> DNA <213> corn; <400> 362 cagtttcttc cgtgagtg 18 <210> 363 <211> twenty three <212> DNA <213> corn; <400> 363 tgcatctgag ttcctgattg ttg 23 <210> 364 <211> 18 <212> DNA <213> corn; <400> 364 ccgcagcacg acatcctt 18 <210> 365 <211> twenty three <212> DNA <213> corn; <400> 365 ccatatatag gttagttgat cga 23 <210> 366 <211> twenty four <212> DNA <213> corn; <400> 366 ccatatatag gttagttcat cgat 24 <210> 367 <211> twenty three <212> DNA <213> corn; <400> 367 gcggtgagta caagttaatc caa 23 <210> 368 <211> twenty three <212> DNA <213> corn; <400> 368 gccgtcactt gacttgattc ttc 23 <210> 369 <211> 12 <212> DNA <213> corn; <400> 369 acccagcccc ct 12 <210> 370 <211> 12 <212> DNA <213> corn; <400> 370 acccagcccc cg 12 <210> 371 <211> twenty one <212> DNA <213> corn; <400> 371 tgatctggct cacgtgggta g 21 <210> 372 <211> 20 <212> DNA <213> corn; <400> 372 cgcatgaacg tccatggaag 20 <210> 373 <211> 18 <212> DNA <213> corn; <400> 373 cacatgcaca gtgctata 18 <210> 374 <211> 19 <212> DNA <213> corn; <400> 374 ccacatgcac agtactata 19 <210> 375 <211> twenty two <212> DNA <213> corn; <400> 375 gagacccagc tagagagttg ac 22 <210> 376 <211> 19 <212> DNA <213> corn; <400> 376 tgggcacata ggccagtag 19 <210> 377 <211> 16 <212> DNA <213> corn; <400> 377 tgcaaacagg agcatg 16 <210> 378 <211> 19 <212> DNA <213> corn; <400> 378 aaatgcaaac aggaacatg 19 <210> 379 <211> 19 <212> DNA <213> corn; <400> 379 gttgctgaaa tgctaatgg 19 <210> 380 <211> 16 <212> DNA <213> corn; <400> 380 gtgtcgtcgt cttctc 16 <210> 381 <211> 14 <212> DNA <213> corn; <400> 381 ccaccaccgg aatt 14 <210> 382 <211> 14 <212> DNA <213> corn; <400> 382 caccaccgca attg 14 <210> 383 <211> 20 <212> DNA <213> corn; <400> 383 gagttcatca agtagctcgt 20 <210> 384 <211> 17 <212> DNA <213> corn; <400> 384 tgcacatcag cattctc 17 <210> 385 <211> 19 <212> DNA <213> corn; <400> 385 cggttaccat tgttgtgta 19 <210> 386 <211> 20 <212> DNA <213> corn; <400> 386 tcggttacca ttattgtgta 20 <210> 387 <211> 25 <212> DNA <213> corn; <400> 387 ccttgtttga aacctccttg tgttg 25 <210> 388 <211> 19 <212> DNA <213> corn; <400> 388 gtccaggtcg ccttactga 19 <210> 389 <211> 15 <212> DNA <213> corn; <400> 389 tacaaagccg ggttg 15 <210> 390 <211> 16 <212> DNA <213> corn; <400> 390 tacaaagccg ggatgt 16 <210> 391 <211> 20 <212> DNA <213> corn; <400> 391 gaactgattc atctgggtaa 20 <210> 392 <211> 16 <212> DNA <213> corn; <400> 392 ctcctgctgt ggtcac 16 <210> 393 <211> twenty two <212> DNA <213> corn; <400> 393 caagtgaaat ggtatataat ac 22 <210> 394 <211> twenty one <212> DNA <213> corn; <400> 394 aagtgaaatg gtatataaca c 21 <210> 395 <211> twenty one <212> DNA <213> corn; <400> 395 catgccacaa ttgcagaagc a 21 <210> 396 <211> twenty three <212> DNA <213> corn; <400> 396 gcatagctca acatgtgaac tca 23 <210> 397 <211> 14 <212> DNA <213> corn; <400> 397 ccggctcaag ccta 14 <210> 398 <211> 14 <212> DNA <213> corn; <400> 398 ccggcacaag ccta 14 <210> 399 <211> 19 <212> DNA <213> corn; <400> 399 cgccctagtg ctgggaatc 19 <210> 400 <211> twenty two <212> DNA <213> corn; <400> 400 ggaccgacac gatccaataa ag 22 <210> 401 <211> 15 <212> DNA <213> corn; <400> 401 cgggcggagt acgtg 15 <210> 402 <211> 14 <212> DNA <213> corn; <400> 402 cgggcggact acgt 14 <210> 403 <211> 16 <212> DNA <213> corn; <400> 403 agagggcgcg gtctga 16 <210> 404 <211> 19 <212> DNA <213> corn; <400> 404 tggtcgcact tccttcttc 19 <210> 405 <211> 14 <212> DNA <213> corn; <400> 405 cgacagcgga ggag 14 <210> 406 <211> 15 <212> DNA <213> corn; <400> 406 cgacagcgga agagg 15 <210> 407 <211> 17 <212> DNA <213> corn; <400> 407 ctcgtgcttg ctttacg 17 <210> 408 <211> 17 <212> DNA <213> corn; <400> 408 cgcaagaggt tgatagg 17 <210> 409 <211> 15 <212> DNA <213> corn; <400> 409 accagctact gcagc 15 <210> 410 <211> 14 <212> DNA <213> corn; <400> 410 ccagcgactg cagc 14 <210> 411 <211> 19 <212> DNA <213> corn; <400> 411 gtccctgccc gttttgtct 19 <210> 412 <211> twenty one <212> DNA <213> corn; <400> 412 acacctctcc gtcgtatcaa g 21 <210> 413 <211> twenty one <212> DNA <213> corn; <400> 413 tcattgtaat ccatattacg t 21 <210> 414 <211> 20 <212> DNA <213> corn; <400> 414 cattgtaatc catactacgt 20 <210> 415 <211> twenty one <212> DNA <213> corn; <400> 415 gccaacagtt cactcccagt a 21 <210> 416 <211> 25 <212> DNA <213> corn; <400> 416 acttgttacc tttccttgct agaca 25 <210> 417 <211> twenty one <212> DNA <213> corn; <400> 417 ttactggtac ttagatatat g 21 <210> 418 <211> 20 <212> DNA <213> corn; <400> 418 tactggtact tagatagatg 20 <210> 419 <211> twenty one <212> DNA <213> corn; <400> 419 agatacatga agtaacatgc t 21 <210> 420 <211> twenty one <212> DNA <213> corn; <400> 420 ggtactcaag aacaattaac c 21 <210> 421 <211> 18 <212> DNA <213> corn; <400> 421 tcaaagaatc tccggtca 18 <210> 422 <211> 17 <212> DNA <213> corn; <400> 422 caaagaatcc ccggtca 17 <210> 423 <211> 20 <212> DNA <213> corn; <400> 423 ggactgtgcg tagtatgagc 20 <210> 424 <211> twenty two <212> DNA <213> corn; <400> 424 gtcacgtcta tcctccagtt ca 22 <210> 425 <211> 14 <212> DNA <213> corn; <400> 425 accccgacac tgct 14 <210> 426 <211> 14 <212> DNA <213> corn; <400> 426 caccccaaca ctgc 14 <210> 427 <211> 17 <212> DNA <213> corn; <400> 427 gtcgacgacg gtgaagc 17 <210> 428 <211> 18 <212> DNA <213> corn; <400> 428 cacgctcgag gtgatcca 18 <210> 429 <211> twenty one <212> DNA <213> corn; <400> 429 aagttatctt ccattgtagt g 21 <210> 430 <211> 18 <212> DNA <213> corn; <400> 430 agttatcttc cattgcag 18 <210> 431 <211> 20 <212> DNA <213> corn; <400> 431 catgtttatt ttgagagcca 20 <210> 432 <211> 17 <212> DNA <213> corn; <400> 432 gaaacgtgtt gctgaag 17 <210> 433 <211> 14 <212> DNA <213> corn; <400> 433 cgacagcctt cgat 14 <210> 434 <211> 14 <212> DNA <213> corn; <400> 434 cgacagcctt caat 14 <210> 435 <211> 17 <212> DNA <213> corn; <400> 435 ctagccgaac tgtccta 17 <210> 436 <211> 17 <212> DNA <213> corn; <400> 436 cacaccaacg gatcaag 17 <210> 437 <211> 17 <212> DNA <213> corn; <400> 437 cggtgacgaa tactgat 17 <210> 438 <211> 17 <212> DNA <213> corn; <400> 438 cggtgacgaa tactgac 17 <210> 439 <211> 19 <212> DNA <213> corn; <400> 439 gaaacatccc aacaacatc 19 <210> 440 <211> 16 <212> DNA <213> corn; <400> 440 agccttgcta gtgctg 16 <210> 441 <211> 20 <212> DNA <213> corn; <400> 441 catcagaggg aatataattt 20 <210> 442 <211> 19 <212> DNA <213> corn; <400> 442 catcagaggg aatagaatt 19 <210> 443 <211> twenty three <212> DNA <213> corn; <400> 443 agctatattt tagagaccgt gtt 23 <210> 444 <211> 15 <212> DNA <213> corn; <400> 444 gcacgatgac gatga 15 <210> 445 <211> 19 <212> DNA <213> corn; <400> 445 cggtaacatg tagaatgca 19 <210> 446 <211> 18 <212> DNA <213> corn; <400> 446 cggtaacatg tagaacgc 18 <210> 447 <211> twenty two <212> DNA <213> corn; <400> 447 tgaatgctct cagatgccac at 22 <210> 448 <211> twenty two <212> DNA <213> corn; <400> 448 agcagcttca agaaacaaag ga 22 <210> 449 <211> 14 <212> DNA <213> corn; <400> 449 ACTGCGCGTTT GCAA 14 <210> 450 <211> 16 <212> DNA <213> corn; <400> 450 ctactgcgca ttgcaa 16 <210> 451 <211> 15 <212> DNA <213> corn; <400> 451 ggccgccaag gtgct 15 <210> 452 <211> 20 <212> DNA <213> corn; <400> 452 gcctggtcga tcctgatgac 20 <210> 453 <211> 15 <212> DNA <213> corn; <400> 453 catgggccgt gacct 15 <210> 454 <211> 14 <212> DNA <213> corn; <400> 454 atgggccgcg acct 14 <210> 455 <211> twenty four <212> DNA <213> corn; <400> 455 cctttaacag gttgtactca tgcc 24 <210> 456 <211> 18 <212> DNA <213> corn; <400> 456 tcgagtcagc acggttcg 18 <210> 457 <211> 15 <212> DNA <213> corn; <400> 457 caacctcacg aacct 15 <210> 458 <211> 15 <212> DNA <213> corn; <400> 458 cggcaacctc acaaa 15 <210> 459 <211> twenty one <212> DNA <213> corn; <400> 459 caacctgagc ttcaacagcc t 21 <210> 460 <211> 15 <212> DNA <213> corn; <400> 460 ggcggttgct ggaca 15 <210> 461 <211> 17 <212> DNA <213> corn; <400> 461 attctcaaag ccgtaga 17 <210> 462 <211> 19 <212> DNA <213> corn; <400> 462 agattctcaa aaccgtaga 19 <210> 463 <211> 20 <212> DNA <213> corn; <400> 463 ggcagtttcc gatgtccaga 20 <210> 464 <211> 20 <212> DNA <213> corn; <400> 464 gaacctgacc acgcttcttc 20 <210> 465 <211> 17 <212> DNA <213> corn; <400> 465 cacacaccga gagagag 17 <210> 466 <211> 16 <212> DNA <213> corn; <400> 466 ccacacaccg agaaag 16 <210> 467 <211> 20 <212> DNA <213> corn; <400> 467 agcacacgtt ctcttccaaa 20 <210> 468 <211> twenty one <212> DNA <213> corn; <400> 468 cgggttcatc ctcttcgtgg t 21 <210> 469 <211> 15 <212> DNA <213> corn; <400> 469 ctgaagctgc ctcaa 15 <210> 470 <211> 13 <212> DNA <213> corn; <400> 470 tgaagctgcccca 13 <210> 471 <211> twenty three <212> DNA <213> corn; <400> 471 agcaaataaa tttagatgga aca 23 <210> 472 <211> 20 <212> DNA <213> corn; <400> 472 gtcaaggtga atatgtccta 20 <210> 473 <211> 16 <212> DNA <213> corn; <400> 473 agccagaaaa cgggca 16 <210> 474 <211> 19 <212> DNA <213> corn; <400> 474 acaagccaga aaacggaca 19 <210> 475 <211> 18 <212> DNA <213> corn; <400> 475 gcgcgtacct gattcaca 18 <210> 476 <211> twenty two <212> DNA <213> corn; <400> 476 agccagcagc tgaagagaag ac 22 <210> 477 <211> 14 <212> DNA <213> corn; <400> 477 ccgccaggtc cgat 14 <210> 478 <211> 14 <212> DNA <213> corn; <400> 478 cgccacgtcc gatg 14 <210> 479 <211> 16 <212> DNA <213> corn; <400> 479 tgggcagcct caccgt 16 <210> 480 <211> 19 <212> DNA <213> corn; <400> 480 cggagctgga aaggatgga 19 <210> 481 <211> twenty one <212> DNA <213> corn; <400> 481 caatagtgaa tattgtagtt t 21 <210> 482 <211> twenty one <212> DNA <213> corn; <400> 482 caatagtgaa tattgtaatt t 21 <210> 483 <211> twenty four <212> DNA <213> corn; <400> 483 agcagaaaaa cattgggact gtac 24 <210> 484 <211> twenty one <212> DNA <213> corn; <400> 484 agcctgaagc tgtggatctt c 21 <210> 485 <211> 14 <212> DNA <213> corn; <400> 485 ctcaccgtgg accg 14 <210> 486 <211> 15 <212> DNA <213> corn; <400> 486 cctcacagtg gaccg 15 <210> 487 <211> 19 <212> DNA <213> corn; <400> 487 catccgcaag gtcctgctc 19 <210> 488 <211> twenty one <212> DNA <213> corn; <400> 488 gggcgatcga gttgtgcttt g 21 <210> 489 <211> twenty one <212> DNA <213> corn; <400> 489 cctaaacaga tgtattatat a 21 <210> 490 <211> 19 <212> DNA <213> corn; <400> 490 cctaaacaga tgtactata 19 <210> 491 <211> twenty one <212> DNA <213> corn; <400> 491 agttgtgcca agggctagtt g 21 <210> 492 <211> 26 <212> DNA <213> corn; <400> 492 ggagtcatgc acatttgaga agaaac 26 <210> 493 <211> 14 <212> DNA <213> corn; <400> 493 aatggcacca ttag 14 <210> 494 <211> 15 <212> DNA <213> corn; <400> 494 taatggcacc atcag 15 <210> 495 <211> 20 <212> DNA <213> corn; <400> 495 tggttgcttc ggaagagttc 20 <210> 496 <211> 20 <212> DNA <213> corn; <400> 496 agggttgcgc tcctagttct 20 <210> 497 <211> 20 <212> DNA <213> corn; <400> 497 cctaaagaaa ggtgtagcct 20 <210> 498 <211> twenty two <212> DNA <213> corn; <400> 498 ttcctaaaga aaggtatagc ct 22 <210> 499 <211> twenty four <212> DNA <213> corn; <400> 499 caagaccagg tctaacagag cata 24 <210> 500 <211> 25 <212> DNA <213> corn; <400> 500 ggacccgtaa attatcattg cttca 25 <210> 501 <211> 19 <212> DNA <213> corn; <400> 501 acgtctaaga gattaaaag 19 <210> 502 <211> twenty one <212> DNA <213> corn; <400> 502 aaatacgtct aagagataaa a 21 <210> 503 <211> twenty three <212> DNA <213> corn; <400> 503 gtctgcaaat aaattatctt ggt 23 <210> 504 <211> 18 <212> DNA <213> corn; <400> 504 gacacaagat ggtctcaa 18 <210> 505 <211> 19 <212> DNA <213> corn; <400> 505 ctgggagtca atttcattg 19 <210> 506 <211> 19 <212> DNA <213> corn; <400> 506 ctgggagtca attccattg 19 <210> 507 <211> twenty two <212> DNA <213> corn; <400> 507 tggccggtaa acaaacaaag tc 22 <210> 508 <211> 20 <212> DNA <213> corn; <400> 508 tcagtgggtg atccggtaac 20 <210> 509 <211> 15 <212> DNA <213> corn; <400> 509 ctgcaggtga agacc 15 <210> 510 <211> 15 <212> DNA <213> corn; <400> 510 ctgcaggtga aaacc 15 <210> 511 <211> 16 <212> DNA <213> corn; <400> 511 gggcgcagcc gtgtag 16 <210> 512 <211> twenty one <212> DNA <213> corn; <400> 512 cacgactcca tcaggcactc t 21 <210> 513 <211> 17 <212> DNA <213> corn; <400> 513 agcaagagaa gcagctg 17 <210> 514 <211> 18 <212> DNA <213> corn; <400> 514 tgagcaagag aagcaact 18 <210> 515 <211> 18 <212> DNA <213> corn; <400> 515 gtagtagcct cagtagga 18 <210> 516 <211> twenty three <212> DNA <213> corn; <400> 516 tttgatagtt tcatgataga tac 23 <210> 517 <211> 16 <212> DNA <213> corn; <400> 517 cgcgtatctc gattcc 16 <210> 518 <211> 17 <212> DNA <213> corn; <400> 518 cgcgtatctc aattcca 17 <210> 519 <211> twenty two <212> DNA <213> corn; <400> 519 cattacaaac gcagccaagg ta 22 <210> 520 <211> 17 <212> DNA <213> corn; <400> 520 gcgcccatct ccagcaa 17 <210> 521 <211> twenty two <212> DNA <213> corn; <400> 521 tacaacaaag gtcaataagt aa 22 <210> 522 <211> 20 <212> DNA <213> corn; <400> 522 caacaaaggt caacaagtaa 20 <210> 523 <211> twenty four <212> DNA <213> corn; <400> 523 gcaagtggag agaagaacta agga 24 <210> 524 <211> twenty one <212> DNA <213> corn; <400> 524 cctgggcata tcagtggtgt t 21 <210> 525 <211> 18 <212> DNA <213> corn; <400> 525 ttcagcagta cttgacgt 18 <210> 526 <211> 16 <212> DNA <213> corn; <400> 526 tcagcagtac ctgacg 16 <210> 527 <211> twenty two <212> DNA <213> corn; <400> 527 ccgcaggaaa tcaaacatgg gt 22 <210> 528 <211> 20 <212> DNA <213> corn; <400> 528 acgtggtctc cgtcgatgag 20 <210> 529 <211> 15 <212> DNA <213> corn; <400> 529 cgaggcgatg gtgcc 15 <210> 530 <211> 14 <212> DNA <213> corn; <400> 530 aggcgacggt gcca 14 <210> 531 <211> 17 <212> DNA <213> corn; <400> 531 gacgtcaggt ccagggt 17 <210> 532 <211> twenty four <212> DNA <213> corn; <400> 532 agcctcatct cctacactta ctac 24 <210> 533 <211> 18 <212> DNA <213> corn; <400> 533 tcagtattag taaggtgc 18 <210> 534 <211> twenty one <212> DNA <213> corn; <400> 534 aaatcagtat tagtaagatg c 21 <210> 535 <211> twenty four <212> DNA <213> corn; <400> 535 gatgtagtta acaagcgagc gtct 24 <210> 536 <211> twenty one <212> DNA <213> corn; <400> 536 gcctgcactc tttatgcttc a 21 <210> 537 <211> 16 <212> DNA <213> corn; <400> 537 agccggttcg ggtact 16 <210> 538 <211> 16 <212> DNA <213> corn; <400> 538 agccggttcc ggtact 16 <210> 539 <211> 16 <212> DNA <213> corn; <400> 539 cgtcgggcct gtgctg 16 <210> 540 <211> 18 <212> DNA <213> corn; <400> 540 cacggacgcg ttgttggt 18 <210> 541 <211> 19 <212> DNA <213> corn; <400> 541 cagatccgat ctctgttag 19 <210> 542 <211> 19 <212> DNA <213> corn; <400> 542 agatccgatc gctgttagt 19 <210> 543 <211> twenty two <212> DNA <213> corn; <400> 543 gggaggatac atcccttcat ca 22 <210> 544 <211> twenty one <212> DNA <213> corn; <400> 544 aacaacgact gtgagggttc a 21 <210> 545 <211> 18 <212> DNA <213> corn; <400> 545 cagccatagt gtgtggaa 18 <210> 546 <211> 18 <212> DNA <213> corn; <400> 546 agccatagtg cgtggaaa 18 <210> 547 <211> 16 <212> DNA <213> corn; <400> 547 gggcactgct ggcgtt 16 <210> 548 <211> twenty one <212> DNA <213> corn; <400> 548 ccctcaccta tgcaacagaa c 21 <210> 549 <211> 19 <212> DNA <213> corn; <400> 549 tggctacact ttaatcgaa 19 <210> 550 <211> 17 <212> DNA <213> corn; <400> 550 tggctacact tcaatcg 17 <210> 551 <211> twenty three <212> DNA <213> corn; <400> 551 gacagctctc atcactgcat cag 23 <210> 552 <211> twenty two <212> DNA <213> corn; <400> 552 gcactgcttt cagagttctg gt 22 <210> 553 <211> twenty one <212> DNA <213> corn; <400> 553 aaaggtttgt tttatttatt g 21 <210> 554 <211> twenty one <212> DNA <213> corn; <400> 554 taaaggtttg ttttatttat c 21 <210> 555 <211> twenty one <212> DNA <213> corn; <400> 555 cacgtcagga aaggatgcaa a 21 <210> 556 <211> twenty two <212> DNA <213> corn; <400> 556 gcggatcatc actcccatct tc 22 <210> 557 <211> 17 <212> DNA <213> corn; <400> 557 cagccatctt gctgata 17 <210> 558 <211> 16 <212> DNA <213> corn; <400> 558 cagccatcgt gctgat 16 <210> 559 <211> twenty four <212> DNA <213> corn; <400> 559 cgtgtcgttg aaatatgcat ggtt 24 <210> 560 <211> twenty two <212> DNA <213> corn; <400> 560 tcacggtcct ccatcatcta ac 22 <210> 561 <211> twenty one <212> DNA <213> corn; <400> 561 ctaaaagtga ctaactaaag t 21 <210> 562 <211> twenty two <212> DNA <213> corn; <400> 562 ctaaaagtga ctaactaaaa tt 22 <210> 563 <211> twenty two <212> DNA <213> corn; <400> 563 gtcactctct taaactctag tc 22 <210> 564 <211> twenty one <212> DNA <213> corn; <400> 564 gctatcgcat tgtactagta g 21 <210> 565 <211> 18 <212> DNA <213> corn; <400> 565 tcataagctg tctccaaa 18 <210> 566 <211> 19 <212> DNA <213> corn; <400> 566 ttcataagct gactccaaa 19 <210> 567 <211> twenty four <212> DNA <213> corn; <400> 567 tgtgggtgtt tgattcaatg gatg 24 <210> 568 <211> 19 <212> DNA <213> corn; <400> 568 tccaaggctc agctcgaaa 19 <210> 569 <211> 19 <212> DNA <213> corn; <400> 569 catcgatgta cttcaaaag 19 <210> 570 <211> 19 <212> DNA <213> corn; <400> 570 catcgatgta cttcaaaaa 19 <210> 571 <211> 26 <212> DNA <213> corn; <400> 571 gcccaagtga tccagaacta atacac 26 <210> 572 <211> 26 <212> DNA <213> corn; <400> 572 tgcagttcat ttttgcacta tttgac 26 <210> 573 <211> 16 <212> DNA <213> corn; <400> 573 tggtggcagt ttaggt 16 <210> 574 <211> 15 <212> DNA <213> corn; <400> 574 tggtggcagt tcagg 15 <210> 575 <211> twenty four <212> DNA <213> corn; <400> 575 ccttgaggct tggtttagat tggt 24 <210> 576 <211> twenty four <212> DNA <213> corn; <400> 576 ctcacccaca tctttcgcac tatt 24 <210> 577 <211> 16 <212> DNA <213> corn; <400> 577 ttaaacgctt tgttga 16 <210> 578 <211> 15 <212> DNA <213> corn; <400> 578 aaacgctttg ctgat 15 <210> 579 <211> 18 <212> DNA <213> corn; <400> 579 tggaactctt cagtcttg 18 <210> 580 <211> 16 <212> DNA <213> corn; <400> 580 gaacggtgtt ctaggg 16 <210> 581 <211> 18 <212> DNA <213> corn; <400> 581 tgatgtccat attgaagc 18 <210> 582 <211> 19 <212> DNA <213> corn; <400> 582 ttgatgtcca tatagaagc 19 <210> 583 <211> twenty four <212> DNA <213> corn; <400> 583 tgaagtgtta gaagaagttg caca 24 <210> 584 <211> 18 <212> DNA <213> corn; <400> 584 aagcaccctt gaggcagt 18 <210> 585 <211> 14 <212> DNA <213> corn; <400> 585 cggctgggcg actt 14 <210> 586 <211> 14 <212> DNA <213> corn; <400> 586 cggctcggcg actt 14 <210> 587 <211> 20 <212> DNA <213> corn; <400> 587 tcatgctgga ctcgtcgttc 20 <210> 588 <211> twenty one <212> DNA <213> corn; <400> 588 gtccgtgtag gaggtcttgt c 21 <210> 589 <211> 17 <212> DNA <213> corn; <400> 589 cagtagctgt gatagac 17 <210> 590 <211> 16 <212> DNA <213> corn; <400> 590 cagtagctgt gacaga 16 <210> 591 <211> 19 <212> DNA <213> corn; <400> 591 ttgcaaggaa aatggaaga 19 <210> 592 <211> 16 <212> DNA <213> corn; <400> 592 atcgtgatgg gctgct 16 <210> 593 <211> 19 <212> DNA <213> corn; <400> 593 catgttagtt tacccgaaa 19 <210> 594 <211> 19 <212> DNA <213> corn; <400> 594 agcatgttag tttaccaga 19 <210> 595 <211> twenty two <212> DNA <213> corn; <400> 595 tgtgccagtg ttatccaagg aa 22 <210> 596 <211> twenty one <212> DNA <213> corn; <400> 596 tccatgcttc agtcacacag t 21 <210> 597 <211> 20 <212> DNA <213> corn; <400> 597 aagagtcaac actggagttg 20 <210> 598 <211> twenty three <212> DNA <213> corn; <400> 598 agggaagagt caacactaga gtt 23 <210> 599 <211> twenty two <212> DNA <213> corn; <400> 599 ccatgaaggc agagagcatg tg 22 <210> 600 <211> 20 <212> DNA <213> corn; <400> 600 tctcggttgt gtggatggaa 20 <210> 601 <211> 15 <212> DNA <213> corn; <400> 601 tactccctcc gtttt 15 <210> 602 <211> 14 <212> DNA <213> corn; <400> 602 actccctccg tttc 14 <210> 603 <211> twenty one <212> DNA <213> corn; <400> 603 ggtcgaggag agtgaacctt g 21 <210> 604 <211> twenty one <212> DNA <213> corn; <400> 604 ggcagattgc caggatgaga t 21 <210> 605 <211> twenty two <212> DNA <213> corn; <400> 605 attctctatt atagaaagaa at 22 <210> 606 <211> twenty two <212> DNA <213> corn; <400> 606 attctctatt atagaaagaa ac 22 <210> 607 <211> 27 <212> DNA <213> corn; <400> 607 ggtagcagat gaagttccaa tagtaaa 27 <210> 608 <211> twenty four <212> DNA <213> corn; <400> 608 gctatctagc cacttgttcc attc 24 <210> 609 <211> 17 <212> DNA <213> corn; <400> 609 cacaacgtgg aagtagg 17 <210> 610 <211> 18 <212> DNA <213> corn; <400> 610 ccacaacgtg gaagtaga 18 <210> 611 <211> twenty three <212> DNA <213> corn; <400> 611 gatcatcgga tcacttgaaa ggg 23 <210> 612 <211> 19 <212> DNA <213> corn; <400> 612 tggttcggcc aagtaacac 19 <210> 613 <211> 13 <212> DNA <213> corn; <400> 613 accgctgctg cca 13 <210> 614 <211> 14 <212> DNA <213> corn; <400> 614 aagaccgccg ctgc 14 <210> 615 <211> 17 <212> DNA <213> corn; <400> 615 tcctgctcgg cctgtga 17 <210> 616 <211> 19 <212> DNA <213> corn; <400> 616 gcgccaagca aatgtcgta 19 <210> 617 <211> 16 <212> DNA <213> corn; <400> 617 cgcggaacct tggatg 16 <210> 618 <211> 16 <212> DNA <213> corn; <400> 618 cgcggaagcc ttggat 16 <210> 619 <211> 18 <212> DNA <213> corn; <400> 619 aagaccgtcg cggactcg 18 <210> 620 <211> twenty one <212> DNA <213> corn; <400> 620 gggcaaactc atgcgtagat g 21 <210> 621 <211> 17 <212> DNA <213> corn; <400> 621 atcaaccatc tgtccat 17 <210> 622 <211> 15 <212> DNA <213> corn; <400> 622 caaccatctg cccat 15 <210> 623 <211> 18 <212> DNA <213> corn; <400> 623 cttcctaaac tcgtccct 18 <210> 624 <211> twenty four <212> DNA <213> corn; <400> 624 tcaaatctaa gttattgagt gtta 24 <210> 625 <211> 20 <212> DNA <213> corn; <400> 625 tgatagtcag tagtatggtt 20 <210> 626 <211> 18 <212> DNA <213> corn; <400> 626 agtcagtagt atggcttg 18 <210> 627 <211> twenty four <212> DNA <213> corn; <400> 627 ggtcaattgg tagtcagagg acaa 24 <210> 628 <211> twenty one <212> DNA <213> corn; <400> 628 gtgctccaac gaggactagt g 21 <210> 629 <211> 16 <212> DNA <213> corn; <400> 629 acccaagggc tcaaca 16 <210> 630 <211> 16 <212> DNA <213> corn; <400> 630 cacccaagag ctcaac 16 <210> 631 <211> 19 <212> DNA <213> corn; <400> 631 acagctcaaa gggcaggtt 19 <210> 632 <211> twenty two <212> DNA <213> corn; <400> 632 ggcttgaaca gtgccaatag tc 22 <210> 633 <211> 19 <212> DNA <213> corn; <400> 633 attgcgtctc gataaatca 19 <210> 634 <211> 18 <212> DNA <213> corn; <400> 634 ttgcgtctca ataaatca 18 <210> 635 <211> 17 <212> DNA <213> corn; <400> 635 tccgagttcg ctgtcca 17 <210> 636 <211> twenty three <212> DNA <213> corn; <400> 636 cgttggcatt gaagggaagt cta 23 <210> 637 <211> 15 <212> DNA <213> corn; <400> 637 attggcaatg ccgca 15 <210> 638 <211> 16 <212> DNA <213> corn; <400> 638 cattggcaat gccaca 16 <210> 639 <211> twenty three <212> DNA <213> corn; <400> 639 tgcctgatct tttccttcac cat 23 <210> 640 <211> 20 <212> DNA <213> corn; <400> 640 tgtaggccac ctaggattgg 20 <210> 641 <211> 17 <212> DNA <213> corn; <400> 641 tttccattgt ttccatc 17 <210> 642 <211> 18 <212> DNA <213> corn; <400> 642 agtttccatt gtttccac 18 <210> 643 <211> 29 <212> DNA <213> corn; <400> 643 agttcctttt ctctactcct ataaagcac 29 <210> 644 <211> twenty three <212> DNA <213> corn; <400> 644 ggatgggatc atagccacag ttc 23 <210> 645 <211> 14 <212> DNA <213> corn; <400> 645 cctccttgcg cgtg 14 <210> 646 <211> 13 <212> DNA <213> corn; <400> 646 ctcctcgcgc gtg 13 <210> 647 <211> 16 <212> DNA <213> corn; <400> 647 gcctgggacc gggaag 16 <210> 648 <211> 18 <212> DNA <213> corn; <400> 648 caccgacacc gacgaaga 18 <210> 649 <211> 19 <212> DNA <213> corn; <400> 649 tcacaaatca ataaagccc 19 <210> 650 <211> 19 <212> DNA <213> corn; <400> 650 ttcacaaatc aacaaagcc 19 <210> 651 <211> twenty two <212> DNA <213> corn; <400> 651 atggtacaag tcacaggtag gg 22 <210> 652 <211> twenty two <212> DNA <213> corn; <400> 652 gtcaagttag ggccggatca ta 22 <210> 653 <211> twenty two <212> DNA <213> corn; <400> 653 agtatggaac taatttgaca aa 22 <210> 654 <211> twenty four <212> DNA <213> corn; <400> 654 agagtatgga actaatttaa caaa 24 <210> 655 <211> twenty three <212> DNA <213> corn; <400> 655 aaacagttgg tgttggagtt gga 23 <210> 656 <211> 19 <212> DNA <213> corn; <400> 656 tgtggatggc gtgttagca 19 <210> 657 <211> 20 <212> DNA <213> corn; <400> 657 tccattactt attgaaacac 20 <210> 658 <211> 19 <212> DNA <213> corn; <400> 658 ccattactta ctgaaacac 19 <210> 659 <211> twenty one <212> DNA <213> corn; <400> 659 accacctcgg tctacacctt a 21 <210> 660 <211> twenty one <212> DNA <213> corn; <400> 660 tgccagaaag catgggaagt c 21 <210> 661 <211> 15 <212> DNA <213> corn; <400> 661 taggcactga ccgga 15 <210> 662 <211> 15 <212> DNA <213> corn; <400> 662 taggcactga cccga 15 <210> 663 <211> 17 <212> DNA <213> corn; <400> 663 tggcgagacg aagcaga 17 <210> 664 <211> 20 <212> DNA <213> corn; <400> 664 gaccgaaccg aaccattagc 20 <210> 665 <211> 17 <212> DNA <213> corn; <400> 665 cttctgtgca tggatca 17 <210> 666 <211> 16 <212> DNA <213> corn; <400> 666 tctgtgcacg gatcat 16 <210> 667 <211> twenty two <212> DNA <213> corn; <400> 667 cgagaagttc ccatcagctc aa 22 <210> 668 <211> twenty two <212> DNA <213> corn; <400> 668 tggtgaacat tggttgcttg tg 22 <210> 669 <211> twenty one <212> DNA <213> corn; <400> 669 aaacaacaga atctttttag a 21 <210> 670 <211> twenty two <212> DNA <213> corn; <400> 670 aaacaacaga atctttttaa aa 22 <210> 671 <211> twenty four <212> DNA <213> corn; <400> 671 cagctctaaa ctcacagacg tttg 24 <210> 672 <211> twenty two <212> DNA <213> corn; <400> 672 agcgctctac catctgagct ac 22 <210> 673 <211> twenty two <212> DNA <213> corn; <400> 673 tcaaaataat gatatgaggg aa 22 <210> 674 <211> twenty two <212> DNA <213> corn; <400> 674 tcaaaataat gatatgagga aa 22 <210> 675 <211> 25 <212> DNA <213> corn; <400> 675 aagactgaaa gcatgaataa acggt 25 <210> 676 <211> 20 <212> DNA <213> corn; <400> 676 caggcgatct tgaccttggt 20 <210> 677 <211> 19 <212> DNA <213> corn; <400> 677 ctaaatttaa gtgctgttg 19 <210> 678 <211> twenty two <212> DNA <213> corn; <400> 678 aagatctaaa tttaagtact gt 22 <210> 679 <211> twenty four <212> DNA <213> corn; <400> 679 ttctggataa agcaatgacc aaca 24 <210> 680 <211> twenty two <212> DNA <213> corn; <400> 680 gtgagtctgc ttcctctcca tt 22 <210> 681 <211> 18 <212> DNA <213> corn; <400> 681 tggttgctct gcatgtat 18 <210> 682 <211> 18 <212> DNA <213> corn; <400> 682 ttggttgctc tgcatata 18 <210> 683 <211> twenty two <212> DNA <213> corn; <400> 683 gcctttgcga aggttttagc ag 22 <210> 684 <211> 19 <212> DNA <213> corn; <400> 684 aactccgtgg cagcatgtg 19 <210> 685 <211> 15 <212> DNA <213> corn; <400> 685 tgatctgggg catct 15 <210> 686 <211> 17 <212> DNA <213> corn; <400> 686 tgagtgatct gggacat 17 <210> 687 <211> twenty two <212> DNA <213> corn; <400> 687 caccggtgcc aaggatatag ag 22 <210> 688 <211> 20 <212> DNA <213> corn; <400> 688 aggccgtcta acgaagtgtg 20 <210> 689 <211> 18 <212> DNA <213> corn; <400> 689 ttcatctatc cactagaa 18 <210> 690 <211> 17 <212> DNA <213> corn; <400> 690 tcatctatcc actacaa 17 <210> 691 <211> twenty two <212> DNA <213> corn; <400> 691 gtatgtaaaa caaggttcaa aa 22 <210> 692 <211> twenty one <212> DNA <213> corn; <400> 692 agggacaact atggatgaag t 21 <210> 693 <211> 17 <212> DNA <213> corn; <400> 693 ccgtcctagt taagtgc 17 <210> 694 <211> 17 <212> DNA <213> corn; <400> 694 tccgtcctag ctaagtg 17 <210> 695 <211> 20 <212> DNA <213> corn; <400> 695 agtcggttct cttcgtctgc 20 <210> 696 <211> twenty three <212> DNA <213> corn; <400> 696 cgcatgcccg tgatttattt ctc 23 <210> 697 <211> 19 <212> DNA <213> corn; <400> 697 ctgagagaat ggacacgaa 19 <210> 698 <211> 17 <212> DNA <213> corn; <400> 698 ctgagagaat gggcaca 17 <210> 699 <211> 20 <212> DNA <213> corn; <400> 699 gtgttactag gatacagtga 20 <210> 700 <211> 18 <212> DNA <213> corn; <400> 700 tgcccttacc tgaagtct 18 <210> 701 <211> 15 <212> DNA <213> corn; <400> 701 tgctctgctt accgt 15 <210> 702 <211> 14 <212> DNA <213> corn; <400> 702 tgctctgcct accg 14 <210> 703 <211> 18 <212> DNA <213> corn; <400> 703 gtgagcacca gccacttc 18 <210> 704 <211> 19 <212> DNA <213> corn; <400> 704 gaacacgacgcattccaa 19 <210> 705 <211> twenty one <212> DNA <213> corn; <400> 705 ataacacaag aatttgagca t 21 <210> 706 <211> twenty one <212> DNA <213> corn; <400> 706 caataacaca agaatttaag c 21 <210> 707 <211> 18 <212> DNA <213> corn; <400> 707 cctgctacag atttcaac 18 <210> 708 <211> 19 <212> DNA <213> corn; <400> 708 ctgtttagga gccagatta 19 <210> 709 <211> 14 <212> DNA <213> corn; <400> 709 cgacgggagt tggc 14 <210> 710 <211> 14 <212> DNA <213> corn; <400> 710 cgacgggagt aggc 14 <210> 711 <211> 15 <212> DNA <213> corn; <400> 711 agagccggga gccat 15 <210> 712 <211> 15 <212> DNA <213> corn; <400> 712 actcctccgc cttgg 15 <210> 713 <211> 15 <212> DNA <213> corn; <400> 713 cggcgccttc ttctg 15 <210> 714 <211> 14 <212> DNA <213> corn; <400> 714 cggcgcctcc ttct 14 <210> 715 <211> twenty three <212> DNA <213> corn; <400> 715 gccgtgtcca tcaaacttca tct 23 <210> 716 <211> 19 <212> DNA <213> corn; <400> 716 gggcttcttg cgcagagag 19 <210> 717 <211> twenty two <212> DNA <213> corn; <400> 717 tattccaaga agtttatctt gt 22 <210> 718 <211> 19 <212> DNA <213> corn; <400> 718 tccaagaagt ttaccttgt 19 <210> 719 <211> 18 <212> DNA <213> corn; <400> 719 agcacccagt cctccact 18 <210> 720 <211> 18 <212> DNA <213> corn; <400> 720 gctgcccagg atcgaact 18 <210> 721 <211> 19 <212> DNA <213> corn; <400> 721 ttccccagag aagggagtt 19 <210> 722 <211> 20 <212> DNA <213> corn; <400> 722 ttccccagag aaaggagtta 20 <210> 723 <211> 20 <212> DNA <213> corn; <400> 723 caggtagctt gccaaacgga 20 <210> 724 <211> twenty three <212> DNA <213> corn; <400> 724 tgtctacacg aaggcaattg ttg 23 <210> 725 <211> 14 <212> DNA <213> corn; <400> 725 tgttcgccgc agtc 14 <210> 726 <211> 15 <212> DNA <213> corn; <400> 726 tgttcgcagc agtcc 15 <210> 727 <211> 16 <212> DNA <213> corn; <400> 727 tgcccgggaa gatcca 16 <210> 728 <211> 20 <212> DNA <213> corn; <400> 728 ttaaccctga aggagacgga 20 <210> 729 <211> 18 <212> DNA <213> corn; <400> 729 acctccattc gcataaaa 18 <210> 730 <211> 20 <212> DNA <213> corn; <400> 730 atgacctcca ttcacataaa 20 <210> 731 <211> twenty two <212> DNA <213> corn; <400> 731 ctggaacatg tcgaccattc ac 22 <210> 732 <211> twenty one <212> DNA <213> corn; <400> 732 ccctgaccac atgcatacac a 21 <210> 733 <211> twenty one <212> DNA <213> corn; <400> 733 ctagtaacca aatatgaatt a 21 <210> 734 <211> twenty one <212> DNA <213> corn; <400> 734 ctagtaacca aatatgaaat a 21 <210> 735 <211> 20 <212> DNA <213> corn; <400> 735 ctgttatgat acctggtctt 20 <210> 736 <211> 17 <212> DNA <213> corn; <400> 736 gactatgggc gtcttta 17 <210> 737 <211> 19 <212> DNA <213> corn; <400> 737 aggcccattt taggatttt 19 <210> 738 <211> 19 <212> DNA <213> corn; <400> 738 aggcccattt taggatatt 19 <210> 739 <211> 20 <212> DNA <213> corn; <400> 739 agagcagtcc caccttggtt 20 <210> 740 <211> 20 <212> DNA <213> corn; <400> 740 tgcttgaccg gagtgagaag 20 <210> 741 <211> 20 <212> DNA <213> corn; <400> 741 aacaaatagg agaatcagat 20 <210> 742 <211> 18 <212> DNA <213> corn; <400> 742 caaataggag aaccagat 18 <210> 743 <211> twenty three <212> DNA <213> corn; <400> 743 ggtggtgcct gcatataagt aaa 23 <210> 744 <211> 20 <212> DNA <213> corn; <400> 744 atgtgccatg ctgcactaag 20 <210> 745 <211> 19 <212> DNA <213> corn; <400> 745 tcgtaagatg ggaatgtgg 19 <210> 746 <211> twenty one <212> DNA <213> corn; <400> 746 tttcgtaaga tgagaatgtg g 21 <210> 747 <211> twenty four <212> DNA <213> corn; <400> 747 acctttggtg tgtgctatgg tatg 24 <210> 748 <211> 20 <212> DNA <213> corn; <400> 748 accgtcccct gctcaaaacc 20 <210> 749 <211> 19 <212> DNA <213> corn; <400> 749 acatatttat agccctagg 19 <210> 750 <211> 19 <212> DNA <213> corn; <400> 750 acatatttat agcccaagg 19 <210> 751 <211> 25 <212> DNA <213> corn; <400> 751 caaacactac acaatgtcat accct 25 <210> 752 <211> 25 <212> DNA <213> corn; <400> 752 actgtcctct gtagtctctt tagca 25 <210> 753 <211> 16 <212> DNA <213> corn; <400> 753 accagcccta gtcatc 16 <210> 754 <211> 17 <212> DNA <213> corn; <400> 754 cagccctact catcaaa 17 <210> 755 <211> twenty one <212> DNA <213> corn; <400> 755 ttgtccacaa cctcctactg a 21 <210> 756 <211> twenty one <212> DNA <213> corn; <400> 756 aaggctcaat tgcaacccat a 21 <210> 757 <211> 18 <212> DNA <213> corn; <400> 757 ccacctcgaa tcagtata 18 <210> 758 <211> 18 <212> DNA <213> corn; <400> 758 ccacctcgaa acagtata 18 <210> 759 <211> 25 <212> DNA <213> corn; <400> 759 tctctattgg ctgagaacaa ttcac 25 <210> 760 <211> twenty one <212> DNA <213> corn; <400> 760 tcgttggatc aatcgcaact c 21 <210> 761 <211> 19 <212> DNA <213> corn; <400> 761 ttggttgaac tttagtatc 19 <210> 762 <211> 19 <212> DNA <213> corn; <400> 762 ttggttgaac tttagaatc 19 <210> 763 <211> 20 <212> DNA <213> corn; <400> 763 ttgacactca ttactgtttg 20 <210> 764 <211> twenty one <212> DNA <213> corn; <400> 764 ggagaatgac ttagaactta g 21 <210> 765 <211> 13 <212> DNA <213> corn; <400> 765 agcagcagcg ggg 13 <210> 766 <211> 13 <212> DNA <213> corn; <400> 766 cagcagcagg ggc 13 <210> 767 <211> 18 <212> DNA <213> corn; <400> 767 cacgcggtgg tggacatg 18 <210> 768 <211> 20 <212> DNA <213> corn; <400> 768 tccacgctca tctccttgtg 20 <210> 769 <211> 20 <212> DNA <213> corn; <400> 769 atgatgccag gagaggcaag 20 <210> 770 <211> 16 <212> DNA <213> corn; <400> 770 tgccaggaga cgcaag 16 <210> 771 <211> 25 <212> DNA <213> corn; <400> 771 gaacaagaag catgagcatt ctgac 25 <210> 772 <211> twenty one <212> DNA <213> corn; <400> 772 tcacggttgc tctcatcact t 21 <210> 773 <211> 18 <212> DNA <213> corn; <400> 773 cattcctatt caaggtta 18 <210> 774 <211> 17 <212> DNA <213> corn; <400> 774 ttcctattca aggctaa 17 <210> 775 <211> 17 <212> DNA <213> corn; <400> 775 aggcacgtgg atatctg 17 <210> 776 <211> 15 <212> DNA <213> corn; <400> 776 gtgtggagca accaa 15 <210> 777 <211> 16 <212> DNA <213> corn; <400> 777 ctgatagcgc gcagtg 16 <210> 778 <211> 18 <212> DNA <213> corn; <400> 778 ctgatagcga gcagtgac 18 <210> 779 <211> twenty one <212> DNA <213> corn; <400> 779 gcacctcagt gaaacgacaa g 21 <210> 780 <211> twenty one <212> DNA <213> corn; <400> 780 tgaggaaggt gagtgatttg c 21 <210> 781 <211> 19 <212> DNA <213> corn; <400> 781 cgatgcacac taagatgac 19 <210> 782 <211> 17 <212> DNA <213> corn; <400> 782 cgatgcacac caagatg 17 <210> 783 <211> 20 <212> DNA <213> corn; <400> 783 gaagggccaa actgaggcat 20 <210> 784 <211> 19 <212> DNA <213> corn; <400> 784 acttcccggt tgagcaaga 19 <210> 785 <211> 18 <212> DNA <213> corn; <400> 785 cctagttagg gttatgtg 18 <210> 786 <211> 19 <212> DNA <213> corn; <400> 786 cctagttagg gttatatgg 19 <210> 787 <211> twenty two <212> DNA <213> corn; <400> 787 tgcgtttacg tctgcaatta ga 22 <210> 788 <211> twenty three <212> DNA <213> corn; <400> 788 ctggcctctt tctcttctct gta 23 <210> 789 <211> 17 <212> DNA <213> corn; <400> 789 ccttgtgcct gattcaa 17 <210> 790 <211> 16 <212> DNA <213> corn; <400> 790 ttgtgcccga ttcaac 16 <210> 791 <211> twenty three <212> DNA <213> corn; <400> 791 cgcaagtcat tgttcgctgt ttg 23 <210> 792 <211> twenty three <212> DNA <213> corn; <400> 792 gtcgtcaccg tctttctttc aac 23 <210> 793 <211> 19 <212> DNA <213> corn; <400> 793 agcaggctat gttttagtt 19 <210> 794 <211> 17 <212> DNA <213> corn; <400> 794 agcaggctat gtttcag 17 <210> 795 <211> 19 <212> DNA <213> corn; <400> 795 acttctcaag aggctaaac 19 <210> 796 <211> 18 <212> DNA <213> corn; <400> 796 gctgtaacct gtggtcta 18 <210> 797 <211> 20 <212> DNA <213> corn; <400> 797 ctgaggtagt atataagaag 20 <210> 798 <211> 20 <212> DNA <213> corn; <400> 798 tctgaggtag tatataaaaa 20 <210> 799 <211> 20 <212> DNA <213> corn; <400> 799 agagaatact tgagaaggct 20 <210> 800 <211> 18 <212> DNA <213> corn; <400> 800 gtactgatgg gactggat 18 <210> 801 <211> 20 <212> DNA <213> corn; <400> 801 atattttatt cctcgtttca 20 <210> 802 <211> 20 <212> DNA <213> corn; <400> 802 atattttatt cctcatttca 20 <210> 803 <211> twenty one <212> DNA <213> corn; <400> 803 gaaactctac atttgggaga t 21 <210> 804 <211> twenty two <212> DNA <213> corn; <400> 804 ggacacaatt atatgacctc tt 22 <210> 805 <211> 16 <212> DNA <213> corn; <400> 805 tttgggcggt caatgg 16 <210> 806 <211> 13 <212> DNA <213> corn; <400> 806 tgggcggcca atg 13 <210> 807 <211> 18 <212> DNA <213> corn; <400> 807 tgcgttccgg ccttactc 18 <210> 808 <211> twenty one <212> DNA <213> corn; <400> 808 actgcgtttc tccctttgct t 21 <210> 809 <211> 14 <212> DNA <213> corn; <400> 809 ccgcgatgcc cttg 14 <210> 810 <211> 13 <212> DNA <213> corn; <400> 810 cgcgacgccc ttg 13 <210> 811 <211> 20 <212> DNA <213> corn; <400> 811 ggcaggtttc gtaccacatc 20 <210> 812 <211> twenty one <212> DNA <213> corn; <400> 812 cgaggatccg tgctcttcta a 21 <210> 813 <211> 17 <212> DNA <213> corn; <400> 813 cagcagcctt gatctgt 17 <210> 814 <211> 15 <212> DNA <213> corn; <400> 814 cagcagcctc gatct 15 <210> 815 <211> twenty two <212> DNA <213> corn; <400> 815 cctccaagat gtgctccatg at 22 <210> 816 <211> 17 <212> DNA <213> corn; <400> 816 tcgccgaggt cctgtct 17 <210> 817 <211> 14 <212> DNA <213> corn; <400> 817 cggcggtggg atga 14 <210> 818 <211> 13 <212> DNA <213> corn; <400> 818 cggcggcggg atg 13 <210> 819 <211> 20 <212> DNA <213> corn; <400> 819 gcgtgtgaga gggacaaagg 20 <210> 820 <211> 18 <212> DNA <213> corn; <400> 820 gtgcacaacg cactgttc 18 <210> 821 <211> 13 <212> DNA <213> corn; <400> 821 ccttggtgcc tgc 13 <210> 822 <211> 14 <212> DNA <213> corn; <400> 822 cccttggtgc ctac 14 <210> 823 <211> 28 <212> DNA <213> corn; <400> 823 cccaagatcc aagaagcgat atatatgc 28 <210> 824 <211> 19 <212> DNA <213> corn; <400> 824 ggcgatcggg tgcaatttg 19 <210> 825 <211> 16 <212> DNA <213> corn; <400> 825 ttaggccttg tttgtt 16 <210> 826 <211> 14 <212> DNA <213> corn; <400> 826 aggccttgtt cgtt 14 <210> 827 <211> 18 <212> DNA <213> corn; <400> 827 cagtggcagt aactgata 18 <210> 828 <211> 19 <212> DNA <213> corn; <400> 828 aagcaatccg gttaggaat 19 <210> 829 <211> 18 <212> DNA <213> corn; <400> 829 ccgacgatca tattcgta 18 <210> 830 <211> 17 <212> DNA <213> corn; <400> 830 cgacgatcac attcgta 17 <210> 831 <211> twenty one <212> DNA <213> corn; <400> 831 ctgctgctgc aagcaattgt a 21 <210> 832 <211> twenty four <212> DNA <213> corn; <400> 832 tggcactgac taacagtcta acag 24 <210> 833 <211> 14 <212> DNA <213> corn; <400> 833 ctgcagatcc ccag 14 <210> 834 <211> 13 <212> DNA <213> corn; <400> 834 tgcagacccc cag 13 <210> 835 <211> 15 <212> DNA <213> corn; <400> 835 ctgctccgac gactg 15 <210> 836 <211> 16 <212> DNA <213> corn; <400> 836 ctgagctgct caaggt 16 <210> 837 <211> 20 <212> DNA <213> corn; <400> 837 aaacgttacc tgataaatct 20 <210> 838 <211> 19 <212> DNA <213> corn; <400> 838 aacgttacct gataaacct 19 <210> 839 <211> 19 <212> DNA <213> corn; <400> 839 tgtttgcagc ccctctcaa 19 <210> 840 <211> 17 <212> DNA <213> corn; <400> 840 ttctggcccg tgttgct 17 <210> 841 <211> 16 <212> DNA <213> corn; <400> 841 tcattctggt gctcat 16 <210> 842 <211> 16 <212> DNA <213> corn; <400> 842 tcattctggt gcacat 16 <210> 843 <211> twenty two <212> DNA <213> corn; <400> 843 tctaggtttc ggctagtggt ta 22 <210> 844 <211> 25 <212> DNA <213> corn; <400> 844 actattacac ttcgtctctg ggttt 25 <210> 845 <211> 20 <212> DNA <213> corn; <400> 845 agctctcctt gatatgaacc 20 <210> 846 <211> 17 <212> DNA <213> corn; <400> 846 ctccttgata cgaaccc 17 <210> 847 <211> twenty four <212> DNA <213> corn; <400> 847 tctcctaaac ccattgcaaa cagt 24 <210> 848 <211> twenty two <212> DNA <213> corn; <400> 848 tcaagacttg cacttgctca gt 22 <210> 849 <211> 19 <212> DNA <213> corn; <400> 849 caagaaccga gattttact 19 <210> 850 <211> 20 <212> DNA <213> corn; <400> 850 caagaaccga gagtttactt 20 <210> 851 <211> twenty two <212> DNA <213> corn; <400> 851 aggttgcatt gatgttggtt gt 22 <210> 852 <211> 20 <212> DNA <213> corn; <400> 852 cagcactcct ggaattcaca 20 <210> 853 <211> 13 <212> DNA <213> corn; <400> 853 tgggcctctg gtc 13 <210> 854 <211> 14 <212> DNA <213> corn; <400> 854 ctgggcctct gatc 14 <210> 855 <211> 18 <212> DNA <213> corn; <400> 855 acaggactgt atctggtg 18 <210> 856 <211> 17 <212> DNA <213> corn; <400> 856 tgcagggtag ttagcat 17 <210> 857 <211> 20 <212> DNA <213> corn; <400> 857 ttagtctctt ggatgcataa 20 <210> 858 <211> 18 <212> DNA <213> corn; <400> 858 agtctcttgg acgcataa 18 <210> 859 <211> twenty four <212> DNA <213> corn; <400> 859 gaagctagta ttgtccacct cctt 24 <210> 860 <211> 25 <212> DNA <213> corn; <400> 860 tcgagagt tagatgagac agtga 25 <210> 861 <211> 16 <212> DNA <213> corn; <400> 861 ataaatcccc atcggg 16 <210> 862 <211> 16 <212> DNA <213> corn; <400> 862 ataaatcccc aacggg 16 <210> 863 <211> 19 <212> DNA <213> corn; <400> 863 ggatccccac gaacgcttg 19 <210> 864 <211> twenty one <212> DNA <213> corn; <400> 864 gcacggacac tcagctagtt a 21 <210> 865 <211> 13 <212> DNA <213> corn; <400> 865 cggctacggc gag 13 <210> 866 <211> 14 <212> DNA <213> corn; <400> 866 agcggctacg acga 14 <210> 867 <211> 20 <212> DNA <213> corn; <400> 867 aggcacgagt caactaggga 20 <210> 868 <211> twenty one <212> DNA <213> corn; <400> 868 cagcccatct gcatcctcat c 21 <210> 869 <211> twenty one <212> DNA <213> corn; <400> 869 cttgtttgaa aggaaatgac c 21 <210> 870 <211> 19 <212> DNA <213> corn; <400> 870 tgtttgaaag caaatgacc 19 <210> 871 <211> twenty four <212> DNA <213> corn; <400> 871 gtgtccgctt gaccctatat cttc 24 <210> 872 <211> 20 <212> DNA <213> corn; <400> 872 gcagcagcct ttccgttcag 20 <210> 873 <211> 14 <212> DNA <213> corn; <400> 873 cttcggcagg cacg 14 <210> 874 <211> 15 <212> DNA <213> corn; <400> 874 acgcttcgac aggca 15 <210> 875 <211> 18 <212> DNA <213> corn; <400> 875 acacggccac acggacac 18 <210> 876 <211> 16 <212> DNA <213> corn; <400> 876 tcgcgctccc gacaag 16 <210> 877 <211> 18 <212> DNA <213> corn; <400> 877 aaagggcgct atagtgga 18 <210> 878 <211> 17 <212> DNA <213> corn; <400> 878 agggcgctac agtggac 17 <210> 879 <211> 25 <212> DNA <213> corn; <400> 879 cttctaaatt ctgacgagca cgaaa 25 <210> 880 <211> twenty two <212> DNA <213> corn; <400> 880 ggctgcagtg attcagtttg ac 22 <210> 881 <211> 15 <212> DNA <213> corn; <400> 881 acggtgtgtc cgtct 15 <210> 882 <211> 15 <212> DNA <213> corn; <400> 882 acggtgtgtc cgtca 15 <210> 883 <211> 20 <212> DNA <213> corn; <400> 883 gctctgccac tctgttgcat 20 <210> 884 <211> 19 <212> DNA <213> corn; <400> 884 ccacggtgtg gagtgtgag 19 <210> 885 <211> 19 <212> DNA <213> corn; <400> 885 cctcaatcga tatggatta 19 <210> 886 <211> 18 <212> DNA <213> corn; <400> 886 cacctcaatc gatatgaa 18 <210> 887 <211> 15 <212> DNA <213> corn; <400> 887 ctcactacgc ggcag 15 <210> 888 <211> 19 <212> DNA <213> corn; <400> 888 tcatgactgg atacgtatg 19 <210> 889 <211> 14 <212> DNA <213> corn; <400> 889 aggcactggt cgtt 14 <210> 890 <211> 16 <212> DNA <213> corn; <400> 890 taggcactgg tcattg 16 <210> 891 <211> 20 <212> DNA <213> corn; <400> 891 gccagtacca ggtacaccat 20 <210> 892 <211> 25 <212> DNA <213> corn; <400> 892 cctaagtcat taccttgcag ggata 25 <210> 893 <211> twenty one <212> DNA <213> corn; <400> 893 cttagtatgt ttttgtcatg a 21 <210> 894 <211> twenty three <212> DNA <213> corn; <400> 894 tacttagtat gtttttatca tga 23 <210> 895 <211> 25 <212> DNA <213> corn; <400> 895 gtttaacttc tctttgctag ccgat 25 <210> 896 <211> twenty two <212> DNA <213> corn; <400> 896 ccggaatgct actgaacaac ac 22 <210> 897 <211> 15 <212> DNA <213> corn; <400> 897 tgtcacacgg ctatc 15 <210> 898 <211> 17 <212> DNA <213> corn; <400> 898 caaatgtcac acagcta 17 <210> 899 <211> 19 <212> DNA <213> corn; <400> 899 gaactgatac gctactctt 19 <210> 900 <211> twenty two <212> DNA <213> corn; <400> 900 accatattgg ataaaactct tg 22 <210> 901 <211> 15 <212> DNA <213> corn; <400> 901 catgctttgc gcggt 15 <210> 902 <211> 16 <212> DNA <213> corn; <400> 902 tcatgctatg cgcggt 16 <210> 903 <211> 16 <212> DNA <213> corn; <400> 903 atcgtcgccg ccgtgt 16 <210> 904 <211> twenty one <212> DNA <213> corn; <400> 904 agctcccggt gtgatatcct t 21 <210> 905 <211> 16 <212> DNA <213> corn; <400> 905 agtgtggcga tctcct 16 <210> 906 <211> 16 <212> DNA <213> corn; <400> 906 agtgtggcga tctccc 16 <210> 907 <211> 20 <212> DNA <213> corn; <400> 907 cgacactgct ctgctgaatc 20 <210> 908 <211> twenty three <212> DNA <213> corn; <400> 908 acggtcattc atctcatcga aca 23 <210> 909 <211> 20 <212> DNA <213> corn; <400> 909 atttattaat aggctacgtt 20 <210> 910 <211> twenty one <212> DNA <213> corn; <400> 910 tgtatttatt aataggctac a 21 <210> 911 <211> 20 <212> DNA <213> corn; <400> 911 agcaacagac gcctcacttc 20 <210> 912 <211> twenty three <212> DNA <213> corn; <400> 912 tccaagcaca ggagacaact aag 23 <210> 913 <211> 18 <212> DNA <213> corn; <400> 913 tgagaacagt catgcctt 18 <210> 914 <211> 18 <212> DNA <213> corn; <400> 914 agaacagtca cgcctttg 18 <210> 915 <211> twenty three <212> DNA <213> corn; <400> 915 tgttgaaata cgatgcgcta tgg 23 <210> 916 <211> twenty three <212> DNA <213> corn; <400> 916 gccaatgttg acaaccaaac agc 23 <210> 917 <211> 17 <212> DNA <213> corn; <400> 917 aggtgtagtc gtcgtgt 17 <210> 918 <211> 17 <212> DNA <213> corn; <400> 918 aggtgtagtc gtcctgt 17 <210> 919 <211> twenty four <212> DNA <213> corn; <400> 919 ctcaatcgat gttaaataag tatc 24 <210> 920 <211> 17 <212> DNA <213> corn; <400> 920 gagattggcg tagtcaa 17 <210> 921 <211> 18 <212> DNA <213> corn; <400> 921 ctatggccgg tatgtcat 18 <210> 922 <211> 15 <212> DNA <213> corn; <400> 922 tggccggtat gccat 15 <210> 923 <211> twenty one <212> DNA <213> corn; <400> 923 tgcaggattt gttcaatcta t 21 <210> 924 <211> 16 <212> DNA <213> corn; <400> 924 gacgacgact tcatca 16 <210> 925 <211> 16 <212> DNA <213> corn; <400> 925 ttctcactcc ttactt 16 <210> 926 <211> 15 <212> DNA <213> corn; <400> 926 ctcactcctt acctt 15 <210> 927 <211> 20 <212> DNA <213> corn; <400> 927 agcgtgtttg gtttgaggaa 20 <210> 928 <211> 25 <212> DNA <213> corn; <400> 928 gtggagtcac tttatgcttc atgag 25 <210> 929 <211> 17 <212> DNA <213> corn; <400> 929 ctagctcctg tgggatg 17 <210> 930 <211> 16 <212> DNA <213> corn; <400> 930 ctagctcccg tgggat 16 <210> 931 <211> 17 <212> DNA <213> corn; <400> 931 cgagctgtgg gtcgtga 17 <210> 932 <211> 20 <212> DNA <213> corn; <400> 932 gaaggcaacc gtctcggtat 20 <210> 933 <211> 13 <212> DNA <213> corn; <400> 933 acttccgcct gct 13 <210> 934 <211> 13 <212> DNA <213> corn; <400> 934 acttccgcct gcc 13 <210> 935 <211> 19 <212> DNA <213> corn; <400> 935 ccttcgccgc gttacactg 19 <210> 936 <211> twenty one <212> DNA <213> corn; <400> 936 ggtgtggagt ggacgtgata c 21 <210> 937 <211> 15 <212> DNA <213> corn; <400> 937 tggcccgaca tcagg 15 <210> 938 <211> 16 <212> DNA <213> corn; <400> 938 tgtggcccaa catcag 16 <210> 939 <211> 18 <212> DNA <213> corn; <400> 939 cggactgctc gactggaa 18 <210> 940 <211> twenty one <212> DNA <213> corn; <400> 940 gtcgagggtg agccaatact c 21 <210> 941 <211> 19 <212> DNA <213> corn; <400> 941 tttggcaaaa cggtttata 19 <210> 942 <211> 19 <212> DNA <213> corn; <400> 942 tttggcaaaa cggcttata 19 <210> 943 <211> twenty two <212> DNA <213> corn; <400> 943 ggtgcagcca cttctttaga tg 22 <210> 944 <211> twenty two <212> DNA <213> corn; <400> 944 cctagccacg tacaggagag at 22 <210> 945 <211> 18 <212> DNA <213> corn; <400> 945 cagtgaccca tttctttt 18 <210> 946 <211> 19 <212> DNA <213> corn; <400> 946 agtgacccat ttctttctt 19 <210> 947 <211> twenty four <212> DNA <213> corn; <400> 947 aaggacgaag tagcagctgg aaag 24 <210> 948 <211> 25 <212> DNA <213> corn; <400> 948 agggctactttgggaacctc aaatc 25 <210> 949 <211> 17 <212> DNA <213> corn; <400> 949 tacaactcag cgagcta 17 <210> 950 <211> 18 <212> DNA <213> corn; <400> 950 atgtacaact caccgagc 18 <210> 951 <211> twenty two <212> DNA <213> corn; <400> 951 agtgggcagt gcacatatga tg 22 <210> 952 <211> twenty two <212> DNA <213> corn; <400> 952 caactccaac cgccaataat gc 22 <210> 953 <211> 18 <212> DNA <213> corn; <400> 953 ccttttggat tacttcac 18 <210> 954 <211> 17 <212> DNA <213> corn; <400> 954 ttttggatca cttcaca 17 <210> 955 <211> 20 <212> DNA <213> corn; <400> 955 gccgcagtaa agtacacgaa 20 <210> 956 <211> 25 <212> DNA <213> corn; <400> 956 atgggcctaa agaacaaatg cacaa 25 <210> 957 <211> 17 <212> DNA <213> corn; <400> 957 actttggcta tgctttg 17 <210> 958 <211> 19 <212> DNA <213> corn; <400> 958 tgttactttg gctatgatt 19 <210> 959 <211> twenty four <212> DNA <213> corn; <400> 959 acaatgaacg actcctgtca gaat 24 <210> 960 <211> 20 <212> DNA <213> corn; <400> 960 ggctctaggg accatgaaca 20 <210> 961 <211> 18 <212> DNA <213> corn; <400> 961 ttaaattgtc gagcttgt 18 <210> 962 <211> 16 <212> DNA <213> corn; <400> 962 aaattgtcga gcctgt 16 <210> 963 <211> 25 <212> DNA <213> corn; <400> 963 actcatgttt atccttagca gcaaa 25 <210> 964 <211> 25 <212> DNA <213> corn; <400> 964 gcacattgat aatctcagctccatt 25 <210> 965 <211> 18 <212> DNA <213> corn; <400> 965 caactgagag actgtatg 18 <210> 966 <211> 16 <212> DNA <213> corn; <400> 966 ctgagagact gcatga 16 <210> 967 <211> 27 <212> DNA <213> corn; <400> 967 gatggtgaat aattggcatg tataacc 27 <210> 968 <211> twenty three <212> DNA <213> corn; <400> 968 gtgcttggag aaccgaaaca tag 23 <210> 969 <211> 15 <212> DNA <213> corn; <400> 969 ctgggcattc ggttt 15 <210> 970 <211> 16 <212> DNA <213> corn; <400> 970 ctgggcattc gatttt 16 <210> 971 <211> 20 <212> DNA <213> corn; <400> 971 acaactgtat cttactgcta 20 <210> 972 <211> 16 <212> DNA <213> corn; <400> 972 ccgaagttct cggttt 16 <210> 973 <211> 18 <212> DNA <213> corn; <400> 973 agcagtcagt tgtccaac 18 <210> 974 <211> 18 <212> DNA <213> corn; <400> 974 agcagtcagt agtccaac 18 <210> 975 <211> twenty three <212> DNA <213> corn; <400> 975 ggatgaagtt atcaagcctg tga 23 <210> 976 <211> twenty four <212> DNA <213> corn; <400> 976 tttgcaagag attctgtgaa ctgt 24 <210> 977 <211> 17 <212> DNA <213> corn; <400> 977 ccgttccttc aatgcta 17 <210> 978 <211> 19 <212> DNA <213> corn; <400> 978 tccgttcctt aaatgctac 19 <210> 979 <211> twenty one <212> DNA <213> corn; <400> 979 gtctgccagt ggttcctaac g 21 <210> 980 <211> twenty three <212> DNA <213> corn; <400> 980 tcaccccggg aattaggatg atg 23 <210> 981 <211> 17 <212> DNA <213> corn; <400> 981 atcaccgagc cagatat 17 <210> 982 <211> 16 <212> DNA <213> corn; <400> 982 accgagccag acatta 16 <210> 983 <211> twenty two <212> DNA <213> corn; <400> 983 ttgtttcctc ccccaagtac ag 22 <210> 984 <211> twenty one <212> DNA <213> corn; <400> 984 cgcaggcatg tctatgacaa c 21 <210> 985 <211> 19 <212> DNA <213> corn; <400> 985 ttctggtttt gtatgtatg 19 <210> 986 <211> 20 <212> DNA <213> corn; <400> 986 tagagttctg gttttgtata 20 <210> 987 <211> twenty four <212> DNA <213> corn; <400> 987 tgtttcctga tgttttggtt gaca 24 <210> 988 <211> twenty two <212> DNA <213> corn; <400> 988 ccactcatgt gggagttgtc tc 22 <210> 989 <211> 17 <212> DNA <213> corn; <400> 989 aggaacaagg cctttcg 17 <210> 990 <211> 18 <212> DNA <213> corn; <400> 990 aaggaacaag gccttacg 18 <210> 991 <211> twenty four <212> DNA <213> corn; <400> 991 cacctgaaat cgttccaccc aatt 24 <210> 992 <211> twenty two <212> DNA <213> corn; <400> 992 ttggcggaat cactagctgt tc 22 <210> 993 <211> 20 <212> DNA <213> corn; <400> 993 ccacaattga aggaaatgga 20 <210> 994 <211> 20 <212> DNA <213> corn; <400> 994 tgccacaatt gaaagaaatg 20 <210> 995 <211> twenty four <212> DNA <213> corn; <400> 995 gggatttata gagggttcga gacg 24 <210> 996 <211> 17 <212> DNA <213> corn; <400> 996 tcctatgctg cggtcca 17 <210> 997 <211> 14 <212> DNA <213> corn; <400> 997 cggactcggc tctc 14 <210> 998 <211> 14 <212> DNA <213> corn; <400> 998 cggactccgc tctc 14 <210> 999 <211> twenty one <212> DNA <213> corn; <400> 999 ggtttggaag gagcccgttc t 21 <210> 1000 <211> 17 <212> DNA <213> corn; <400> 1000 agcttgccgc cggagta 17 <210> 1001 <211> 15 <212> DNA <213> corn; <400> 1001 accctaccct accct 15 <210> 1002 <211> 15 <212> DNA <213> corn; <400> 1002 caccctacac taccc 15 <210> 1003 <211> 20 <212> DNA <213> corn; <400> 1003 gatcttggca ggaccaacac 20 <210> 1004 <211> twenty one <212> DNA <213> corn; <400> 1004 gcgaagcgat aagcacacat c 21 <210> 1005 <211> 18 <212> DNA <213> corn; <400> 1005 tgttagtggg tatgggta 18 <210> 1006 <211> 18 <212> DNA <213> corn; <400> 1006 ttagtgggta tggatacc 18 <210> 1007 <211> 20 <212> DNA <213> corn; <400> 1007 ggtacttaca tttgcgattc 20 <210> 1008 <211> 15 <212> DNA <213> corn; <400> 1008 cacgggtagc aggta 15 <210> 1009 <211> twenty two <212> DNA <213> corn; <400> 1009 tattgagaat taatgtctaa gc 22 <210> 1010 <211> 19 <212> DNA <213> corn; <400> 1010 tgagaattaa tggctaagc 19 <210> 1011 <211> twenty one <212> DNA <213> corn; <400> 1011 gtgtctgaga cagcagatcg a 21 <210> 1012 <211> twenty three <212> DNA <213> corn; <400> 1012 ggaggcttag atcgtcatat tgc 23 <210> 1013 <211> 15 <212> DNA <213> corn; <400> 1013 tgggtggtct gctac 15 <210> 1014 <211> 13 <212> DNA <213> corn; <400> 1014 tggtccgctacca 13 <210> 1015 <211> twenty two <212> DNA <213> corn; <400> 1015 acattgcatt cttgaattta ga 22 <210> 1016 <211> 17 <212> DNA <213> corn; <400> 1016 acttggtcgg acgtaag 17 <210> 1017 <211> twenty one <212> DNA <213> corn; <400> 1017 aaattctggt atttatatat c 21 <210> 1018 <211> 18 <212> DNA <213> corn; <400> 1018 ttctggtatt tagatatc 18 <210> 1019 <211> twenty four <212> DNA <213> corn; <400> 1019 tgtacaatta tgccattcgg gttt 24 <210> 1020 <211> twenty two <212> DNA <213> corn; <400> 1020 ccgagacaat tcgagtgacc ta 22 <210> 1021 <211> 20 <212> DNA <213> corn; <400> 1021 cttgcttatg gattatcata 20 <210> 1022 <211> 20 <212> DNA <213> corn; <400> 1022 cacttgctta tggattataa 20 <210> 1023 <211> 20 <212> DNA <213> corn; <400> 1023 gaaaacttga aagggtagtg 20 <210> 1024 <211> twenty one <212> DNA <213> corn; <400> 1024 acaaacagtc cagcttattt g 21 <210> 1025 <211> 16 <212> DNA <213> corn; <400> 1025 taggagggca tgggca 16 <210> 1026 <211> 15 <212> DNA <213> corn; <400> 1026 agggcacggg caact 15 <210> 1027 <211> twenty two <212> DNA <213> corn; <400> 1027 tgtagcgggt atcttaccga ca 22 <210> 1028 <211> twenty four <212> DNA <213> corn; <400> 1028 tcacttcttt ctctgcacaa atcc 24 <210> 1029 <211> 13 <212> DNA <213> corn; <400> 1029 ccgaacaggc agc 13 <210> 1030 <211> 13 <212> DNA <213> corn; <400> 1030 cgaacagcca gca 13 <210> 1031 <211> 18 <212> DNA <213> corn; <400> 1031 ttccagatat cgagagga 18 <210> 1032 <211> 18 <212> DNA <213> corn; <400> 1032 acttgcgaag gtagacag 18 <210> 1033 <211> 13 <212> DNA <213> corn; <400> 1033 tctcggccct ccg 13 <210> 1034 <211> 15 <212> DNA <213> corn; <400> 1034 cttctcgacc ctccg 15 <210> 1035 <211> 16 <212> DNA <213> corn; <400> 1035 tccgtcgcgc acatcg 16 <210> 1036 <211> 25 <212> DNA <213> corn; <400> 1036 gctgttgtta cagtgggaatttacc 25 <210> 1037 <211> twenty one <212> DNA <213> corn; <400> 1037 taaattatta gtatctacta t 21 <210> 1038 <211> twenty one <212> DNA <213> corn; <400> 1038 ttttaaatta ttagtatata c 21 <210> 1039 <211> 25 <212> DNA <213> corn; <400> 1039 tgcgacgttt attgaaacac agtta 25 <210> 1040 <211> 19 <212> DNA <213> corn; <400> 1040 ccgcacggct tatgtacac 19 <210> 1041 <211> 18 <212> DNA <213> corn; <400> 1041 ttgtgaattg accggtat 18 <210> 1042 <211> 16 <212> DNA <213> corn; <400> 1042 tgaattgacc ggcatg 16 <210> 1043 <211> 25 <212> DNA <213> corn; <400> 1043 acccttgatg tttctcatacgatgc 25 <210> 1044 <211> 20 <212> DNA <213> corn; <400> 1044 cgcggatatt cagcgtctac 20 <210> 1045 <211> 13 <212> DNA <213> corn; <400> 1045 cgatcccacc ggc 13 <210> 1046 <211> 13 <212> DNA <213> corn; <400> 1046 cgatcccacc cgc 13 <210> 1047 <211> 17 <212> DNA <213> corn; <400> 1047 aaaacagccg agtatcc 17 <210> 1048 <211> 16 <212> DNA <213> corn; <400> 1048 gggtggtttt gttcgt 16 <210> 1049 <211> 16 <212> DNA <213> corn; <400> 1049 tgtttccaga ctagtc 16 <210> 1050 <211> 15 <212> DNA <213> corn; <400> 1050 ttccagacta gcctt 15 <210> 1051 <211> 28 <212> DNA <213> corn; <400> 1051 acaagggatt ctaatttttc caatgaaa 28 <210> 1052 <211> 26 <212> DNA <213> corn; <400> 1052 cgctaatcat atataggcga ctcttc 26 <210> 1053 <211> 19 <212> DNA <213> corn; <400> 1053 tgtggtccaa attttgtat 19 <210> 1054 <211> 17 <212> DNA <213> corn; <400> 1054 tggtccaaat tttgcat 17 <210> 1055 <211> twenty one <212> DNA <213> corn; <400> 1055 acacgtcatg cttacctacg a 21 <210> 1056 <211> twenty one <212> DNA <213> corn; <400> 1056 gcttcactcg caagacagtt g 21 <210> 1057 <211> 16 <212> DNA <213> corn; <400> 1057 cggttgccat tatcat 16 <210> 1058 <211> 14 <212> DNA <213> corn; <400> 1058 cggttgccat tacc 14 <210> 1059 <211> 16 <212> DNA <213> corn; <400> 1059 ggtggtcccc ctgacc 16 <210> 1060 <211> twenty two <212> DNA <213> corn; <400> 1060 gtggtcgacg tcgttcaatt tc 22 <210> 1061 <211> 15 <212> DNA <213> corn; <400> 1061 cggccagttc acctt 15 <210> 1062 <211> 14 <212> DNA <213> corn; <400> 1062 ccggccaatt cacc 14 <210> 1063 <211> 16 <212> DNA <213> corn; <400> 1063 ggttcgccga atgcca 16 <210> 1064 <211> 19 <212> DNA <213> corn; <400> 1064 gcatggattc cgcactgaa 19 <210> 1065 <211> 20 <212> DNA <213> corn; <400> 1065 cagaggacag aaagtatagg 20 <210> 1066 <211> 19 <212> DNA <213> corn; <400> 1066 cagaggacag aaagtacag 19 <210> 1067 <211> 18 <212> DNA <213> corn; <400> 1067 ccctggaggc tggagcag 18 <210> 1068 <211> twenty one <212> DNA <213> corn; <400> 1068 atctgttggc gcccctaaac c 21 <210> 1069 <211> 18 <212> DNA <213> corn; <400> 1069 actagttgtg tgcgaatt 18 <210> 1070 <211> 17 <212> DNA <213> corn; <400> 1070 actagttgtg tgccaat 17 <210> 1071 <211> 18 <212> DNA <213> corn; <400> 1071 ctactggttc ggtgtttc 18 <210> 1072 <211> twenty one <212> DNA <213> corn; <400> 1072 acctttgagg gaattatttc a 21 <210> 1073 <211> 20 <212> DNA <213> corn; <400> 1073 atgtactaca gacatttgaa 20 <210> 1074 <211> 19 <212> DNA <213> corn; <400> 1074 tgtactacag acatttcaa 19 <210> 1075 <211> twenty two <212> DNA <213> corn; <400> 1075 ggtgctacta caggtttgga ct 22 <210> 1076 <211> twenty two <212> DNA <213> corn; <400> 1076 actagcctag ctgcttccaa ct 22 <210> 1077 <211> 20 <212> DNA <213> corn; <400> 1077 ctttctatta tacttgcatg 20 <210> 1078 <211> 18 <212> DNA <213> corn; <400> 1078 ttctattata cttgcacg 18 <210> 1079 <211> 18 <212> DNA <213> corn; <400> 1079 ccctgcgtat gggctctg 18 <210> 1080 <211> twenty one <212> DNA <213> corn; <400> 1080 gcgtgaacta cacggtgaaa g 21 <210> 1081 <211> 13 <212> DNA <213> corn; <400> 1081 cacgtcgggg ccg 13 <210> 1082 <211> 14 <212> DNA <213> corn; <400> 1082 acgtcggggc cacg 14 <210> 1083 <211> 16 <212> DNA <213> corn; <400> 1083 gcacgcgccg tgaact 16 <210> 1084 <211> 16 <212> DNA <213> corn; <400> 1084 ggcccagcgt gcctat 16 <210> 1085 <211> 19 <212> DNA <213> corn; <400> 1085 aatctcaagt ttgtacatc 19 <210> 1086 <211> 19 <212> DNA <213> corn; <400> 1086 aatctcaagt ttctacatc 19 <210> 1087 <211> twenty two <212> DNA <213> corn; <400> 1087 tgatagatct taggaaagtg at 22 <210> 1088 <211> 16 <212> DNA <213> corn; <400> 1088 caaccacaag ggtgtc 16 <210> 1089 <211> 18 <212> DNA <213> corn; <400> 1089 atcgaaccag ttctgtgc 18 <210> 1090 <211> 16 <212> DNA <213> corn; <400> 1090 aaccagtcct gtgcac 16 <210> 1091 <211> twenty four <212> DNA <213> corn; <400> 1091 ggcgtagagg atatgtgaga acag 24 <210> 1092 <211> 20 <212> DNA <213> corn; <400> 1092 gtgggaagga agccgacttt 20 <210> 1093 <211> twenty two <212> DNA <213> corn; <400> 1093 ccataatctc ctaatctaag aa 22 <210> 1094 <211> 20 <212> DNA <213> corn; <400> 1094 ccataatctc ctaacctaag 20 <210> 1095 <211> twenty three <212> DNA <213> corn; <400> 1095 tgcaatggtg tttataggca agt 23 <210> 1096 <211> twenty four <212> DNA <213> corn; <400> 1096 tggtgagccc tactgtattg ttac 24 <210> 1097 <211> 19 <212> DNA <213> corn; <400> 1097 aagtttgtga tttctgttg 19 <210> 1098 <211> 15 <212> DNA <213> corn; <400> 1098 tgtgatttcc gttgg 15 <210> 1099 <211> twenty one <212> DNA <213> corn; <400> 1099 aaattattgt catgcataca c 21 <210> 1100 <211> 20 <212> DNA <213> corn; <400> 1100 ctcaaggcct atgaactatc 20 <210> 1101 <211> 14 <212> DNA <213> corn; <400> 1101 atccggcgga gtgg 14 <210> 1102 <211> 13 <212> DNA <213> corn; <400> 1102 atccggcgga gcg 13 <210> 1103 <211> 15 <212> DNA <213> corn; <400> 1103 tccgactccg ccagc 15 <210> 1104 <211> 18 <212> DNA <213> corn; <400> 1104 gttcgtggtg gacgagga 18 <210> 1105 <211> 20 <212> DNA <213> corn; <400> 1105 agtactacat agcatattac 20 <210> 1106 <211> 19 <212> DNA <213> corn; <400> 1106 agtactacat agcacatta 19 <210> 1107 <211> 24 <212> DNA <213> Maize; <400> 1107 aaccatccat tcaacacacc aaag 24 <210> 1108 <211> 19 <212> DNA <213> Maize; <400> 1108 cccgctaacc cgtgggtat 19 <210> 1109 <211> 13 <212> DNA <213> Maize; <400> 1109 ccgcagcgaa ggc 13 <210> 1110 <211> 13 <212> DNA <213> Maize; <400> 1110 ccgcagccaa ggc 13 <210> 1111 <211> 19 <212> DNA <213> Maize; <400> 1111 tcccttccaa gagcacacg 19 <210> 1112 <211> 21 <212> DNA <213> Maize; <400> 1112 gtgctcaggt actacgccta c 21 <210> 1113 <211> 18 <212> DNA <213> corn; <400> 1113 ccttcatact gggccaat 18 <210> 1114 <211> 17 <212> DNA <213> corn; <400> 1114 cttcataccg ggccaat 17 <210> 1115 <211> twenty two <212> DNA <213> corn; <400> 1115 ggcctcttga caaatagcac aa 22 <210> 1116 <211> twenty three <212> DNA <213> corn; <400> 1116 cggagtacca gcaacatata gca 23 <210> 1117 <211> 14 <212> DNA <213> corn; <400> 1117 cgggtacagg tggc 14 <210> 1118 <211> 15 <212> DNA <213> corn; <400> 1118 cgggtacaga tggcg 15 <210> 1119 <211> 17 <212> DNA <213> corn; <400> 1119 gcacagccgc gtcaagt 17 <210> 1120 <211> 18 <212> DNA <213> corn; <400> 1120 cgttgcccac cagagtcg 18 <210> 1121 <211> 13 <212> DNA <213> corn; <400> 1121 cgacgccgct gct 13 <210> 1122 <211> 15 <212> DNA <213> corn; <400> 1122 agagcgacac cgctg 15 <210> 1123 <211> 19 <212> DNA <213> corn; <400> 1123 gagctcgtca cagccttcc 19 <210> 1124 <211> 19 <212> DNA <213> corn; <400> 1124 aacccgagcc tcgccgatt 19 <210> 1125 <211> 19 <212> DNA <213> corn; <400> 1125 tgctgatact actcataca 19 <210> 1126 <211> 19 <212> DNA <213> corn; <400> 1126 ctgatactgc tactcatac 19 <210> 1127 <211> twenty one <212> DNA <213> corn; <400> 1127 gaatctttgg ttgcagcttg c 21 <210> 1128 <211> twenty one <212> DNA <213> corn; <400> 1128 tctgtgtcga tcccatgtgt a 21 <210> 1129 <211> 18 <212> DNA <213> corn; <400> 1129 accttttgat gagttcca 18 <210> 1130 <211> 17 <212> DNA <213> corn; <400> 1130 accttttgat gagctcc 17 <210> 1131 <211> 19 <212> DNA <213> corn; <400> 1131 aaacttgaat tggtggagc 19 <210> 1132 <211> 18 <212> DNA <213> corn; <400> 1132 gtgcacgtgt ctctatac 18 <210> 1133 <211> 17 <212> DNA <213> corn; <400> 1133 ttcatcagga aacaact 17 <210> 1134 <211> 17 <212> DNA <213> corn; <400> 1134 ttcatcagga aacaaca 17 <210> 1135 <211> 17 <212> DNA <213> corn; <400> 1135 ctcttgccaa ggctgca 17 <210> 1136 <211> twenty two <212> DNA <213> corn; <400> 1136 ttcaagcatt cgctgacttc tg 22 <210> 1137 <211> 20 <212> DNA <213> corn; <400> 1137 agtggtgaac cttgtgttat 20 <210> 1138 <211> 18 <212> DNA <213> corn; <400> 1138 tggtgaacct cgtgttat 18 <210> 1139 <211> 20 <212> DNA <213> corn; <400> 1139 gcgcacttga ttggcattct 20 <210> 1140 <211> 20 <212> DNA <213> corn; <400> 1140 cgcacacaca caaccaagac 20 <210> 1141 <211> 20 <212> DNA <213> corn; <400> 1141 acaacgttca ccactaacac 20 <210> 1142 <211> 20 <212> DNA <213> corn; <400> 1142 acaaggttca ccactaacac 20 <210> 1143 <211> 20 <212> DNA <213> corn; <400> 1143 agagtgcgaa gagcaacaca 20 <210> 1144 <211> 20 <212> DNA <213> corn; <400> 1144 tagctgcctt ggggctataa 20 <210> 1145 <211> 17 <212> DNA <213> corn; <400> 1145 tgccccccag gcggggt 17 <210> 1146 <211> 17 <212> DNA <213> corn; <400> 1146 tgctccccag gcggggt 17 <210> 1147 <211> 20 <212> DNA <213> corn; <400> 1147 agcagtgctc aatcggtctt 20 <210> 1148 <211> 20 <212> DNA <213> corn; <400> 1148 gacccctcca cctccttatc 20 <210> 1149 <211> 16 <212> DNA <213> corn; <400> 1149 ctcaagcctg ctggta 16 <210> 1150 <211> 17 <212> DNA <213> corn; <400> 1150 tcaagcctga tggtaca 17 <210> 1151 <211> twenty two <212> DNA <213> corn; <400> 1151 gtgggttgta agtgggtgtt ta 22 <210> 1152 <211> 25 <212> DNA <213> corn; <400> 1152 ttctccttct ttctgagtat agcct 25 <210> 1153 <211> twenty three <212> DNA <213> corn; <400> 1153 tccaaaaact tgttgttctc cca 23 <210> 1154 <211> twenty three <212> DNA <213> corn; <400> 1154 tccaaaaaat tgttgttctc cca 23 <210> 1155 <211> 20 <212> DNA <213> corn; <400> 1155 tcgtcttctc gtatgcatgg 20 <210> 1156 <211> 20 <212> DNA <213> corn; <400> 1156 tgcgacaaaa ttgacgaaga 20 <210> 1157 <211> twenty one <212> DNA <213> corn; <400> 1157 aatgggagaa caacaagttt t 21 <210> 1158 <211> 19 <212> DNA <213> corn; <400> 1158 tgggagaaca acacgtttt 19 <210> 1159 <211> 19 <212> DNA <213> corn; <400> 1159 cagtgcatcc acggtggtc 19 <210> 1160 <211> 25 <212> DNA <213> corn; <400> 1160 ctttgctttc ttgaacagac ttggt 25 <210> 1161 <211> 17 <212> DNA <213> corn; <400> 1161 attcgtaaca ccagcct 17 <210> 1162 <211> 14 <212> DNA <213> corn; <400> 1162 cgtaacccca gcct 14 <210> 1163 <211> 15 <212> DNA <213> corn; <400> 1163 tgcgcatcgc agcag 15 <210> 1164 <211> 19 <212> DNA <213> corn; <400> 1164 acagacagca ggcctcaac 19 <210> 1165 <211> 19 <212> DNA <213> corn; <400> 1165 tgattaattc gtctgacca 19 <210> 1166 <211> 20 <212> DNA <213> corn; <400> 1166 ttgattaatt catctgacca 20 <210> 1167 <211> twenty four <212> DNA <213> corn; <400> 1167 tgagatggtt gtgttatgac tcca 24 <210> 1168 <211> twenty two <212> DNA <213> corn; <400> 1168 tccgacaccc agaatcaaat gg 22 <210> 1169 <211> 17 <212> DNA <213> corn; <400> 1169 cccgacacct gtccttc 17 <210> 1170 <211> 17 <212> DNA <213> corn; <400> 1170 cccgacagct gtccttc 17 <210> 1171 <211> 20 <212> DNA <213> corn; <400> 1171 ggagacgtca gcaaggactc 20 <210> 1172 <211> 20 <212> DNA <213> corn; <400> 1172 agccctggac cttcctttta 20 <210> 1173 <211> twenty four <212> DNA <213> corn; <400> 1173 aaagatgaag aaacaatcaa tgta 24 <210> 1174 <211> twenty one <212> DNA <213> corn; <400> 1174 tgaagaaaca atccatgtat a 21 <210> 1175 <211> 17 <212> DNA <213> corn; <400> 1175 gtggtgcaag cgtggtc 17 <210> 1176 <211> twenty four <212> DNA <213> corn; <400> 1176 gtgcaaaggt tgcttggaat tgag 24 <210> 1177 <211> twenty one <212> DNA <213> corn; <400> 1177 ttcaaggttt ttttgcaaat a 21 <210> 1178 <211> twenty one <212> DNA <213> corn; <400> 1178 ttcaaggttc ttttgcaaat a 21 <210> 1179 <211> 20 <212> DNA <213> corn; <400> 1179 gtgcaaaggt tgcttggaat 20 <210> 1180 <211> 20 <212> DNA <213> corn; <400> 1180 ccaaaggaaa ggcatttgaa 20 <210> 1181 <211> twenty one <212> DNA <213> corn; <400> 1181 catttacctt tgattatttg c 21 <210> 1182 <211> 19 <212> DNA <213> corn; <400> 1182 ttacctttga ctatttgca 19 <210> 1183 <211> 25 <212> DNA <213> corn; <400> 1183 ccaaaggaaa ggcatttgaa acagg 25 <210> 1184 <211> 19 <212> DNA <213> corn; <400> 1184 gaccacgctt gcaccacat 19 <210> 1185 <211> 18 <212> DNA <213> corn; <400> 1185 tcagggcgag atgaaacg 18 <210> 1186 <211> 18 <212> DNA <213> corn; <400> 1186 atcagggcga gacgaaac 18 <210> 1187 <211> twenty three <212> DNA <213> corn; <400> 1187 gggtagcttt gttcccaagg att 23 <210> 1188 <211> twenty two <212> DNA <213> corn; <400> 1188 tggagaggtg gacaggtagt ag 22 <210> 1189 <211> 17 <212> DNA <213> corn; <400> 1189 cgactggatc agcgaag 17 <210> 1190 <211> 18 <212> DNA <213> corn; <400> 1190 cacgactgga ttagcgaa 18 <210> 1191 <211> 17 <212> DNA <213> corn; <400> 1191 gcgcacaagc cgtctac 17 <210> 1192 <211> twenty one <212> DNA <213> corn; <400> 1192 gacgcccttg ctgtatgtat g 21 <210> 1193 <211> 17 <212> DNA <213> corn; <400> 1193 tcttggagtt gcttgac 17 <210> 1194 <211> 17 <212> DNA <213> corn; <400> 1194 ctcttggagt ggcttga 17 <210> 1195 <211> twenty four <212> DNA <213> corn; <400> 1195 tgagtgtact tcgtttggct aatg 24 <210> 1196 <211> 25 <212> DNA <213> corn; <400> 1196 aggatcatga cacagaaatt cgaga 25 <210> 1197 <211> 17 <212> DNA <213> corn; <400> 1197 tcttggagtt gcttgac 17 <210> 1198 <211> 17 <212> DNA <213> corn; <400> 1198 ctcttggagg tgcttga 17 <210> 1199 <211> twenty four <212> DNA <213> corn; <400> 1199 tgagtgtact tcgtttggct aatg 24 <210> 1200 <211> 25 <212> DNA <213> corn; <400> 1200 aggatcatga cacagaaatt cgaga 25 <210> 1201 <211> 27 <212> DNA <213> corn; <400> 1201 acttctagag aaaaaaaaaa aaataga 27 <210> 1202 <211> 27 <212> DNA <213> corn; <400> 1202 acttctagag aaaaaataaa aaataga 27 <210> 1203 <211> 20 <212> DNA <213> corn; <400> 1203 acctcctttt ggtccgtttt 20 <210> 1204 <211> 20 <212> DNA <213> corn; <400> 1204 ggaggcaagt gaggagactg 20 <210> 1205 <211> 19 <212> DNA <213> corn; <400> 1205 attaggttgt ttccagcaa 19 <210> 1206 <211> 16 <212> DNA <213> corn; <400> 1206 aggttgttcc cagcaa 16 <210> 1207 <211> twenty two <212> DNA <213> corn; <400> 1207 tgttgggcaa tcaaacttca gg 22 <210> 1208 <211> twenty one <212> DNA <213> corn; <400> 1208 aggccacggt gaccatgtaa g 21 <210> 1209 <211> 19 <212> DNA <213> corn; <400> 1209 tctactctga ggctgtatt 19 <210> 1210 <211> twenty one <212> DNA <213> corn; <400> 1210 tctactctga ggttgtattt g 21 <210> 1211 <211> twenty four <212> DNA <213> corn; <400> 1211 gcaacatgat ctcttcacca atga 24 <210> 1212 <211> twenty two <212> DNA <213> corn; <400> 1212 caaccagctc accagaacaa tg 22 <210> 1213 <211> 17 <212> DNA <213> corn; <400> 1213 cgtcgagatc ctcattc 17 <210> 1214 <211> 19 <212> DNA <213> corn; <400> 1214 acgtcgagat cttcattca 19 <210> 1215 <211> 19 <212> DNA <213> corn; <400> 1215 tcggagcctt ggatcatca 19 <210> 1216 <211> twenty one <212> DNA <213> corn; <400> 1216 gccccgatctt ccgtgagata c 21 <210> 1217 <211> 15 <212> DNA <213> corn; <400> 1217 accctccctc cgaaa 15 <210> 1218 <211> 15 <212> DNA <213> corn; <400> 1218 accctcgctc cgaaa 15 <210> 1219 <211> twenty one <212> DNA <213> corn; <400> 1219 cgccttccag tccacaatct c 21 <210> 1220 <211> twenty one <212> DNA <213> corn; <400> 1220 gcggtctctc tctctctctc t 21 <210> 1221 <211> 20 <212> DNA <213> corn; <400> 1221 aacagtagta tcttgtgcat 20 <210> 1222 <211> 20 <212> DNA <213> corn; <400> 1222 aacagtagta ttttgtgcat 20 <210> 1223 <211> 25 <212> DNA <213> corn; <400> 1223 agccgctcac tttgtggtat tcatc 25 <210> 1224 <211> twenty two <212> DNA <213> corn; <400> 1224 agtacggata gtcccatgtt ca 22 <210> 1225 <211> 17 <212> DNA <213> corn; <400> 1225 cacaaagtga gcggctt 17 <210> 1226 <211> 17 <212> DNA <213> corn; <400> 1226 cacaaagtgt gcggctt 17 <210> 1227 <211> twenty three <212> DNA <213> corn; <400> 1227 tctagcttca ttgtgcaggg atg 23 <210> 1228 <211> twenty two <212> DNA <213> corn; <400> 1228 gagatcttga gggtgtccca aa 22 <210> 1229 <211> 20 <212> DNA <213> corn; <400> 1229 ccattgctca ggagttagaa 20 <210> 1230 <211> 18 <212> DNA <213> corn; <400> 1230 tgctcaggag ctagaaac 18 <210> 1231 <211> twenty two <212> DNA <213> corn; <400> 1231 catcaaggga ctccgagctt ct 22 <210> 1232 <211> twenty four <212> DNA <213> corn; <400> 1232 cagcttcctc ggcaacttta acag 24 <210> 1233 <211> 18 <212> DNA <213> corn; <400> 1233 catcctttgc tgatagca 18 <210> 1234 <211> 16 <212> DNA <213> corn; <400> 1234 tcctttgccg atagca 16 <210> 1235 <211> twenty one <212> DNA <213> corn; <400> 1235 agctcggagt cccttgatgg t 21 <210> 1236 <211> 20 <212> DNA <213> corn; <400> 1236 cgaagtgacc cgccttacac 20 <210> 1237 <211> 18 <212> DNA <213> corn; <400> 1237 tgttggaatc tcggtaca 18 <210> 1238 <211> 17 <212> DNA <213> corn; <400> 1238 tgttggaatc ccggtac 17 <210> 1239 <211> 19 <212> DNA <213> corn; <400> 1239 tccaagatgg tcagcgagt 19 <210> 1240 <211> 19 <212> DNA <213> corn; <400> 1240 cgcgacaacc tggacagat 19 <210> 1241 <211> 20 <212> DNA <213> corn; <400> 1241 tcaggtactc tacaaactct 20 <210> 1242 <211> 19 <212> DNA <213> corn; <400> 1242 caggtactct accaactct 19 <210> 1243 <211> twenty one <212> DNA <213> corn; <400> 1243 gaccagagag ctgacaggaa c 21 <210> 1244 <211> twenty two <212> DNA <213> corn; <400> 1244 gctctgtggc gtgagataga tg 22 <210> 1245 <211> 16 <212> DNA <213> corn; <400> 1245 catatccggg cagtcc 16 <210> 1246 <211> 17 <212> DNA <213> corn; <400> 1246 ccatatccgg acagtcc 17 <210> 1247 <211> 20 <212> DNA <213> corn; <400> 1247 gagttggatg gtccagcgta 20 <210> 1248 <211> 19 <212> DNA <213> corn; <400> 1248 ggaccgtccg ccatcttac 19 <210> 1249 <211> 20 <212> DNA <213> corn; <400> 1249 aagccttttt cacctctttt 20 <210> 1250 <211> 20 <212> DNA <213> corn; <400> 1250 aagccttttt cacttctttt 20 <210> 1251 <211> twenty one <212> DNA <213> corn; <400> 1251 gctgagtctt ggctgtacac a 21 <210> 1252 <211> twenty one <212> DNA <213> corn; <400> 1252 gagtgccaac acaagtgctt a 21 <210> 1253 <211> twenty one <212> DNA <213> corn; <400> 1253 aataatgtgt ggtgaatgcg a 21 <210> 1254 <211> twenty one <212> DNA <213> corn; <400> 1254 aataatgcgt ggtgaatgcg a 21 <210> 1255 <211> 20 <212> DNA <213> corn; <400> 1255 aaatgcaatc gaggctgaac 20 <210> 1256 <211> 20 <212> DNA <213> corn; <400> 1256 ttcatgccat ttgccagata 20 <210> 1257 <211> 16 <212> DNA <213> corn; <400> 1257 tcttgtggga gaccca 16 <210> 1258 <211> 19 <212> DNA <213> corn; <400> 1258 caaggtcttg tgagagacc 19 <210> 1259 <211> 25 <212> DNA <213> corn; <400> 1259 gttcggacat ttatgggcac tattg 25 <210> 1260 <211> 25 <212> DNA <213> corn; <400> 1260 cctaggatct catgatggat cttca 25 <210> 1261 <211> 16 <212> DNA <213> corn; <400> 1261 agcaaagtgg gcgtcc 16 <210> 1262 <211> 17 <212> DNA <213> corn; <400> 1262 agcaaagtag gcgtcca 17 <210> 1263 <211> 25 <212> DNA <213> corn; <400> 1263 gctatctcaa ttctttggtc acatc 25 <210> 1264 <211> twenty one <212> DNA <213> corn; <400> 1264 aggtggcaac cagttgttag g 21 <210> 1265 <211> twenty one <212> DNA <213> corn; <400> 1265 ttggtatctt attattgtca a 21 <210> 1266 <211> 20 <212> DNA <213> corn; <400> 1266 tggtatctta ttcttgtcaa 20 <210> 1267 <211> twenty two <212> DNA <213> corn; <400> 1267 ctttgagtag tgcggcagtg at 22 <210> 1268 <211> 20 <212> DNA <213> corn; <400> 1268 ggtggtggac gcctactttg 20 <210> 1269 <211> 15 <212> DNA <213> corn; <400> 1269 cctcgggggc taaaa 15 <210> 1270 <211> 15 <212> DNA <213> corn; <400> 1270 cctcgggggc tcaaa 15 <210> 1271 <211> 20 <212> DNA <213> corn; <400> 1271 cagctacgtc gcttctaccc 20 <210> 1272 <211> 20 <212> DNA <213> corn; <400> 1272 acgtgtacct cgtcgtttcc 20 <210> 1273 <211> 17 <212> DNA <213> corn; <400> 1273 tgtaaaatct ggccgta 17 <210> 1274 <211> 19 <212> DNA <213> corn; <400> 1274 tgtaaaatct ggctgtaag 19 <210> 1275 <211> 20 <212> DNA <213> corn; <400> 1275 caccagtttc gtgtcaagga 20 <210> 1276 <211> twenty two <212> DNA <213> corn; <400> 1276 ttccgcccga gagatttaga ag 22 <210> 1277 <211> 18 <212> DNA <213> corn; <400> 1277 ttaccaggaa cagtaaac 18 <210> 1278 <211> 18 <212> DNA <213> corn; <400> 1278 taccaggaac aataaaca 18 <210> 1279 <211> 17 <212> DNA <213> corn; <400> 1279 ttccactatc gaccgaa 17 <210> 1280 <211> 20 <212> DNA <213> corn; <400> 1280 gggatttgag gttatgttct 20 <210> 1281 <211> 17 <212> DNA <213> corn; <400> 1281 ccgagcgtga gttactt 17 <210> 1282 <211> 18 <212> DNA <213> corn; <400> 1282 ccgagcgtga attacttt 18 <210> 1283 <211> twenty one <212> DNA <213> corn; <400> 1283 ttcgtcggta gcagaatcac t 21 <210> 1284 <211> twenty three <212> DNA <213> corn; <400> 1284 acggatacct cactcatcac ctt 23 <210> 1285 <211> 19 <212> DNA <213> corn; <400> 1285 tcacatcttg cataaataa 19 <210> 1286 <211> 19 <212> DNA <213> corn; <400> 1286 cacatcttgc ataaagaat 19 <210> 1287 <211> twenty two <212> DNA <213> corn; <400> 1287 atgggacaaa gagtctagca tt 22 <210> 1288 <211> 19 <212> DNA <213> corn; <400> 1288 ggttcaatca acaatcaca 19 <210> 1289 <211> 19 <212> DNA <213> corn; <400> 1289 cttgattcag tccgagaag 19 <210> 1290 <211> 16 <212> DNA <213> corn; <400> 1290 ttgattcagc ccgaga 16 <210> 1291 <211> twenty two <212> DNA <213> corn; <400> 1291 cagtatagct cggtgttgct ca 22 <210> 1292 <211> 19 <212> DNA <213> corn; <400> 1292 cgcgtggaac agggtagag 19 <210> 1293 <211> 19 <212> DNA <213> corn; <400> 1293 cctccataat gattagatc 19 <210> 1294 <211> 19 <212> DNA <213> corn; <400> 1294 cctccataat gagtagatc 19 <210> 1295 <211> 25 <212> DNA <213> corn; <400> 1295 cctacgatcg atttctaagc gtcta 25 <210> 1296 <211> twenty two <212> DNA <213> corn; <400> 1296 gcgacaactc tccaacaaca ac 22 <210> 1297 <211> 17 <212> DNA <213> corn; <400> 1297 agtccattgg aggttcg 17 <210> 1298 <211> 17 <212> DNA <213> corn; <400> 1298 agtccattgg agattcg 17 <210> 1299 <211> twenty one <212> DNA <213> corn; <400> 1299 tttgggcatc acttgtctca a 21 <210> 1300 <211> 19 <212> DNA <213> corn; <400> 1300 gcgatgccac ggaacataa 19 <210> 1301 <211> 15 <212> DNA <213> corn; <400> 1301 acgatcatgg cctgg 15 <210> 1302 <211> 15 <212> DNA <213> corn; <400> 1302 acgatcatgg cgtgg 15 <210> 1303 <211> 18 <212> DNA <213> corn; <400> 1303 cggcgtggca tacaagga 18 <210> 1304 <211> 20 <212> DNA <213> corn; <400> 1304 caacgcggct cgttcatcag 20 <210> 1305 <211> 16 <212> DNA <213> corn; <400> 1305 tgatgaccct gttggg 16 <210> 1306 <211> 15 <212> DNA <213> corn; <400> 1306 tgatgacccc gttgg 15 <210> 1307 <211> 18 <212> DNA <213> corn; <400> 1307 gcgtgtcggt acgtggat 18 <210> 1308 <211> 20 <212> DNA <213> corn; <400> 1308 accatgctac gccaagttca 20 <210> 1309 <211> 20 <212> DNA <213> corn; <400> 1309 ttttcaggca gcttttataa 20 <210> 1310 <211> 19 <212> DNA <213> corn; <400> 1310 ttcaggcagc ttctataaa 19 <210> 1311 <211> twenty one <212> DNA <213> corn; <400> 1311 gcagactgca aaacacttag c 21 <210> 1312 <211> 25 <212> DNA <213> corn; <400> 1312 ggtttgaccc tatttctctt tcaca 25 <210> 1313 <211> 13 <212> DNA <213> corn; <400> 1313 cccggcggtg gaa 13 <210> 1314 <211> 13 <212> DNA <213> corn; <400> 1314 tcgcccgacg gtg 13 <210> 1315 <211> 16 <212> DNA <213> corn; <400> 1315 tgtcggccgc cattgt 16 <210> 1316 <211> twenty two <212> DNA <213> corn; <400> 1316 gacgacagct acgacatgat ac 22 <210> 1317 <211> 18 <212> DNA <213> corn; <400> 1317 attggatggc ctggaggc 18 <210> 1318 <211> 16 <212> DNA <213> corn; <400> 1318 ttggatggcc cggagg 16 <210> 1319 <211> 25 <212> DNA <213> corn; <400> 1319 gacgttagag accttgaagt tagga 25 <210> 1320 <211> twenty one <212> DNA <213> corn; <400> 1320 gtcgcgaaca tcgacaagaa g 21 <210> 1321 <211> 15 <212> DNA <213> corn; <400> 1321 cttttcgcta cagct 15 <210> 1322 <211> 17 <212> DNA <213> corn; <400> 1322 ttcttttcgc tacaact 17 <210> 1323 <211> 18 <212> DNA <213> corn; <400> 1323 ggtagcacat tgcatagg 18 <210> 1324 <211> twenty two <212> DNA <213> corn; <400> 1324 gctcaataca gtaattcctc at 22 <210> 1325 <211> 15 <212> DNA <213> corn; <400> 1325 caacgctcac ttacc 15 <210> 1326 <211> 14 <212> DNA <213> corn; <400> 1326 aacgctcgct tacc 14 <210> 1327 <211> twenty three <212> DNA <213> corn; <400> 1327 caagcagagg aagggacatt cat 23 <210> 1328 <211> 27 <212> DNA <213> corn; <400> 1328 gggtagctgt ccgaatttaa tagaaga 27 <210> 1329 <211> 18 <212> DNA <213> corn; <400> 1329 tttatttgaa tggctata 18 <210> 1330 <211> 20 <212> DNA <213> corn; <400> 1330 tttatttgaa tgactatata 20 <210> 1331 <211> twenty four <212> DNA <213> corn; <400> 1331 agggcagtca gcacaagtta gaag 24 <210> 1332 <211> 18 <212> DNA <213> corn; <400> 1332 atgtggccgg tgaagtgt 18 <210> 1333 <211> 15 <212> DNA <213> corn; <400> 1333 ctgccgtcat cgtcg 15 <210> 1334 <211> 13 <212> DNA <213> corn; <400> 1334 ccgtcaccgt cgc 13 <210> 1335 <211> 18 <212> DNA <213> corn; <400> 1335 ccggtcgtca ccgtcatc 18 <210> 1336 <211> twenty two <212> DNA <213> corn; <400> 1336 tggactctcc gactcctcta ag 22 <210> 1337 <211> 17 <212> DNA <213> corn; <400> 1337 ctaaggtccg tcaaagc 17 <210> 1338 <211> 19 <212> DNA <213> corn; <400> 1338 aactaaggtc catcaaagc 19 <210> 1339 <211> 25 <212> DNA <213> corn; <400> 1339 cgaggcccac taaatatagactcag 25 <210> 1340 <211> twenty four <212> DNA <213> corn; <400> 1340 aggtattggt tctcgaaggc ttat 24 <210> 1341 <211> twenty three <212> DNA <213> corn; <400> 1341 taaatgagac aacgatagat ata 23 <210> 1342 <211> 20 <212> DNA <213> corn; <400> 1342 tgagacaacg acagatataa 20 <210> 1343 <211> 20 <212> DNA <213> corn; <400> 1343 accatagctc ttgctcacga 20 <210> 1344 <211> twenty two <212> DNA <213> corn; <400> 1344 ccacttgtta tgaggcaggt ca 22 <210> 1345 <211> 12 <212> DNA <213> corn; <400> 1345 cggcagacgc gc 12 <210> 1346 <211> 13 <212> DNA <213> corn; <400> 1346 cggcagacgc acc 13 <210> 1347 <211> 16 <212> DNA <213> corn; <400> 1347 cgggttcggc gagacg 16 <210> 1348 <211> 18 <212> DNA <213> corn; <400> 1348 tggcctcacg gttctgaa 18 <210> 1349 <211> 17 <212> DNA <213> corn; <400> 1349 agagttcttt gggtctc 17 <210> 1350 <211> 20 <212> DNA <213> corn; <400> 1350 agagttcttt gagtctcttt 20 <210> 1351 <211> 25 <212> DNA <213> corn; <400> 1351 tgtcagtatt gttccatgca cagtt 25 <210> 1352 <211> twenty two <212> DNA <213> corn; <400> 1352 tgatgccact accacgattg tc 22 <210> 1353 <211> 18 <212> DNA <213> corn; <400> 1353 agaggtaccg tccgtttc 18 <210> 1354 <211> 18 <212> DNA <213> corn; <400> 1354 caagaggtac catccgtt 18 <210> 1355 <211> 19 <212> DNA <213> corn; <400> 1355 gacgcgactt cgtcaccat 19 <210> 1356 <211> 18 <212> DNA <213> corn; <400> 1356 gcgggtcgaa gctgaatc 18 <210> 1357 <211> twenty three <212> DNA <213> corn; <400> 1357 cgaataacag aatagttgag aac 23 <210> 1358 <211> twenty three <212> DNA <213> corn; <400> 1358 cgaataacag aatacttgag aac 23 <210> 1359 <211> twenty four <212> DNA <213> corn; <400> 1359 gggcaactga atatacaacc ttga 24 <210> 1360 <211> twenty one <212> DNA <213> corn; <400> 1360 gacacctttg ggcatattgg a 21 <210> 1361 <211> 19 <212> DNA <213> corn; <400> 1361 tgcgttaagg tttatttct 19 <210> 1362 <211> 18 <212> DNA <213> corn; <400> 1362 tgcgttaagg tttagttc 18 <210> 1363 <211> 25 <212> DNA <213> corn; <400> 1363 tcacgatttt gaagtagtcg agtca 25 <210> 1364 <211> 18 <212> DNA <213> corn; <400> 1364 tgcagcccaa aacagcaa 18 <210> 1365 <211> 15 <212> DNA <213> corn; <400> 1365 cacagccctg ccttg 15 <210> 1366 <211> 14 <212> DNA <213> corn; <400> 1366 acagccccgc cttg 14 <210> 1367 <211> 19 <212> DNA <213> corn; <400> 1367 atagacggcc tccggtcac 19 <210> 1368 <211> twenty four <212> DNA <213> corn; <400> 1368 tgctacggca caataaatga atga 24 <210> 1369 <211> 19 <212> DNA <213> corn; <400> 1369 aatcccttaa tgtgtcttc 19 <210> 1370 <211> 18 <212> DNA <213> corn; <400> 1370 aatcccttaa tgcgtctt 18 <210> 1371 <211> 18 <212> DNA <213> corn; <400> 1371 ttgcatcgcc aataccca 18 <210> 1372 <211> 25 <212> DNA <213> corn; <400> 1372 tttgtgaaca ttactccttt gtgtc 25 <210> 1373 <211> 20 <212> DNA <213> corn; <400> 1373 cattgtttat tacagttcct 20 <210> 1374 <211> twenty one <212> DNA <213> corn; <400> 1374 cattgtttat taaagttcct a 21 <210> 1375 <211> 20 <212> DNA <213> corn; <400> 1375 agccgagcaa gggtaatggt 20 <210> 1376 <211> 25 <212> DNA <213> corn; <400> 1376 ggaagtaaaggaccctctgaaatgt 25 <210> 1377 <211> 18 <212> DNA <213> corn; <400> 1377 aatccgtgtc ttctctgt 18 <210> 1378 <211> 19 <212> DNA <213> corn; <400> 1378 aaatccgtgt attctctgt 19 <210> 1379 <211> 15 <212> DNA <213> corn; <400> 1379 cggcgcccgt ggttt 15 <210> 1380 <211> 25 <212> DNA <213> corn; <400> 1380 gagagataga gggagtcagg gagat 25 <210> 1381 <211> 14 <212> DNA <213> corn; <400> 1381 cgtctgcagc tgac 14 <210> 1382 <211> 13 <212> DNA <213> corn; <400> 1382 cgtctgcagc cga 13 <210> 1383 <211> 20 <212> DNA <213> corn; <400> 1383 acactcgaca aggcgtcgtc 20 <210> 1384 <211> twenty two <212> DNA <213> corn; <400> 1384 ctcgagactc acaagctatc ac 22 <210> 1385 <211> 14 <212> DNA <213> corn; <400> 1385 acagtccggt gcac 14 <210> 1386 <211> 14 <212> DNA <213> corn; <400> 1386 cggacagtcc gctg 14 <210> 1387 <211> 16 <212> DNA <213> corn; <400> 1387 cgagagcagc aagttc 16 <210> 1388 <211> 18 <212> DNA <213> corn; <400> 1388 gaagagatgg ccttgttc 18 <210> 1389 <211> 18 <212> DNA <213> corn; <400> 1389 ccaaaaggta ctgtccgt 18 <210> 1390 <211> 17 <212> DNA <213> corn; <400> 1390 caaaaggtac cgtccgt 17 <210> 1391 <211> 18 <212> DNA <213> corn; <400> 1391 acgcgacttc accaccgt 18 <210> 1392 <211> twenty one <212> DNA <213> corn; <400> 1392 ttggtggatc gaagctgaat c 21

Claims

1. A method for identifying or selecting corn plants having enhanced ear rot resistance, the method comprising the steps of: a) isolating nucleic acids from corn cells or plant parts; b) detecting in said cell or plant part the presence of at least one marker associated with increased ear rot resistance, wherein said at least one marker comprises an A allele on maize chromosome 8 at a position corresponding to physical position 164990912 of the maize B73 reference genome AGPv4; and c) identifying or selecting said plants based on the presence of the marker detected in b).

2. The method of claim 1, wherein the at least one marker further comprises a C allele on maize chromosome 8 at a position corresponding to physical position 172218916 of the maize B73 reference genome AGPv4.

3. The method of claim 1, wherein detecting comprises detecting within 400K bp upstream or downstream of the A allele on maize chromosome 8 at a position corresponding to physical position 164990912 of the maize B73 reference genome AGPv4. The method according to claim 3 , wherein the detection is performed by PCR amplification.

5. The method according to claim 4, wherein the PCR comprises a probe having a nucleotide sequence of SEQ ID NO: 1241 or 1242 or a primer having a nucleotide sequence of SEQ ID NO: 1243 or 1244.

6. The method of claim 2, wherein detecting further comprises detecting within 400K bp upstream or downstream of the C allele on maize chromosome 8 at a position corresponding to physical position 172218916 of the maize B73 reference genome AGPv4.

7. The method of claim 6, wherein the detection is performed by PCR amplification.

8. The method according to claim 7, wherein the PCR comprises a probe having a nucleotide sequence of SEQ ID NO: 1245 or 1246 or a primer having a nucleotide sequence of SEQ ID NO: 1247 or 1248.

9. The method according to any one of the preceding claims, further comprising: (a) crossing a corn plant comprising the marker within its genome with itself or another corn plant to produce a progeny corn plant comprising the marker within its genome.

10. The method of claim 9, further comprising (b) repeating the crossing step of (a) at least twice to produce additional progeny corn plants comprising the marker within their genome.

11. A method of producing a corn plant having enhanced ear rot resistance, the method comprising the steps of: a) isolating nucleic acids from corn cells or plant parts; b) detecting in said cell or plant part the presence of at least one marker associated with increased ear rot resistance, wherein said at least one marker comprises an A allele on maize chromosome 8 at a position corresponding to physical position 164990912 of the maize B73 reference genome AGPv4; as well as c) crossing a corn plant comprising the marker within its genome with another corn plant that does not comprise the marker to produce a progeny corn plant comprising the marker within its genome.

12. The method of claim 11, wherein the at least one marker further comprises a C allele on maize chromosome 8 at a position corresponding to physical position 172218916 of the maize B73 reference genome AGPv4.

13. The method of claim 11, wherein detecting comprises detecting within 400K bp upstream or downstream of the A allele on maize chromosome 8 at a position corresponding to physical position 164990912 of the maize B73 reference genome AGPv4.

14. The method of claim 13, wherein the detection is performed by PCR amplification.

15. The method according to claim 14, wherein the detection comprises a probe having a nucleotide sequence of SEQ ID NO: 1241 or 1242 or a primer having a nucleotide sequence of SEQ ID NO: 1243 or 1244.

16. The method of claim 12, wherein detecting further comprises detecting within 400K bp upstream or downstream of the C allele on maize chromosome 8 at a position corresponding to physical position 172218916 of the maize B73 reference genome AGPv4.

17. The method of claim 16, wherein the detection is performed by PCR amplification.

18. The method according to claim 17, wherein the detection comprises a probe having a nucleotide sequence of SEQ ID NO: 1245 or 1246 or a primer having a nucleotide sequence of SEQ ID NO: 1247 or 1248.

Images