Use of pesticidal proteins

By expressing the ACh1 protein in plants and utilizing its enzymatic activation and receptor binding mechanism in the insect gut, the limitations of existing technologies for thrips control have been overcome, achieving effective control of thrips and increased crop yield.

CN114304191BActive Publication Date: 2026-04-28BEIJING DABEINONG BIOTECHNOLOGY CO LTD
View PDF 2 Cites 0 Cited by

Patent Information

Application Number
CN202111516734.1
Authority / Receiving Office
CN · China
Patent Type
Patents(China)
Current Assignee / Owner
Filing Date
2021-12-13
Publication Date
2026-04-28
Estimated Expiration
2041-12-13

AI Technical Summary

Technical Problem

Existing technologies are insufficient to effectively control thrips pests, especially since Cry proteins, which are not yet toxic to thrips, have not been found in genetically modified crops, limiting the practical application of traditional control methods.

Method used

By expressing the ACh1 protein in plants, its enzymatic activation and receptor binding mechanism in the insect gut can be utilized to form oligomers that insert into the intestinal membrane, causing the insect to die, thus achieving control over thrips.

Benefits of technology

It effectively suppresses and/or kills thrips pests, reduces reliance on chemical and biological control, increases crop yield and resistance, and adapts to different planting conditions.

✦ Generated by Eureka AI based on patent content.

Smart Images

  • Figure CN114304191B_ABST
    Figure CN114304191B_ABST
Patent Text Reader

Abstract

The present application relates to the use of a pesticidal protein for controlling a thrips pest, the method comprising contacting the thrips pest with at least an ACh1 protein. The present application controls the thrips pest by producing the ACh1 protein capable of killing the thrips in bacteria and / or plants; compared with the agricultural control methods, chemical control methods, physical control and biological control methods used in the prior art, the present application protects the whole growth period and whole plant of the plant to prevent the thrips pest from invading, and has no pollution, no residue, stable and complete effect, and is simple, convenient and economical.
Need to check novelty before this filing date? Find Prior Art

Description

Technical Field

[0001] This invention relates to the use of an insecticidal protein, and more particularly to the use of an ACh1 protein expressed in plants to control thrips damage to plants. Background Technology

[0002] Adult Thysanoptera insects all have two pairs of fringed wings, meaning the edges of their wings have tassel-like fringe, hence this order is classified as "Thysanoptera". Furthermore, many species of Thysanoptera insects prefer to live among the flowers of thistles, a type of plant in the Asteraceae family, such as large thistle and small thistle, and are therefore also known as "thrips".

[0003] Thrips are a general term for insects in the order Thysanoptera, and are important economic pests. For example, the corn yellow thrips damages gramineous crops such as corn, wheat, and barley, causing discontinuous silvery-white streaks on the underside of leaves, accompanied by small stains, while the opposite side of the silvery-white streaks on the upper side of the leaves shows yellow streaks. Severe damage causes the leaves to turn yellow and wither, and may even destroy the entire crop.

[0004] The western flower thrips (Frankliniella occidentalis (Pergande)), also known as the alfalfa thrips, is an omnivorous insect native to the Americas that has invaded my country and is now found throughout the country. It damages crops such as corn, cotton, soybeans, cucumbers, and tomatoes, causing discoloration of petals, wrinkled leaves, and scarring of stems and fruits, potentially leading to plant wilting. It also transmits various viruses, including tomato spotted wilt virus. The western flower thrips have a high reproductive capacity, are small, and extremely elusive, making them difficult to control effectively in the field. Under stable greenhouse temperatures, they can have 12-15 generations per year, with females reproducing sexually and parthenogenetically. They can develop at temperatures between 15℃ and 35℃, with an egg-to-adult development time of only 14 days; the highest egg production occurs at 27.2℃, with a single female laying up to 229 eggs. On common host plants, they develop rapidly and reproduce extremely quickly.

[0005] Corn is an important food crop in China, and the annual losses caused by thrips are enormous, even affecting the survival of local populations. The main control methods commonly used to control thrips include agricultural control, chemical control, physical control, and biological control.

[0006] Agricultural pest control involves the comprehensive and coordinated management of multiple factors within the entire farmland ecosystem. This includes regulating crops, pests, and environmental factors to create a farmland ecological environment conducive to crop growth and unfavorable to thrips infestation. For example, strengthening water and fertilizer management promotes robust plant growth and reduces damage. However, this method requires significant manual labor and is not suitable for the current trend of agricultural industrialization.

[0007] Chemical control, also known as pesticide control, uses chemical insecticides to kill pests and is an important component of integrated pest management for thrips. It is characterized by its speed, convenience, simplicity, and high economic efficiency, and is an indispensable emergency measure, especially in the event of a large-scale thrips outbreak. Currently, chemical control methods mainly involve spraying with conventional agents such as imidacloprid and acetamiprid. However, due to the short reproductive cycle and high reproduction rate of thrips, resistance to pesticides develops rapidly. Furthermore, western flower thrips damage flower organs and often hide in the stamens and petal axils, making it difficult for pesticides to reach them even when applied. This results in relatively low efficacy of contact insecticides against western flower thrips.

[0008] Physical control mainly relies on the pests' responses to various physical factors in the environment. It utilizes physical factors such as light, electricity, color, temperature, and humidity, as well as mechanical equipment for methods like trapping and sterilizing pests through radiation. Most thrips are attracted to yellow, so yellow sticky traps can be used to reduce thrips damage in greenhouse cultivation; however, this method has limited effectiveness in the field.

[0009] Biological control utilizes beneficial organisms or their metabolites to control pest populations, thereby reducing or eliminating them. Examples include parasitic natural enemies, predatory natural enemies, and pathogenic natural enemies. Its advantages include safety for humans and livestock, minimal environmental pollution, and the ability to achieve long-term control of certain pests. For thrips, predatory bugs, predatory mites, parasitic wasps, and parasitic fungi are available, with predatory natural enemies being the most effective. However, regardless of the type of natural enemy, suitable environments are required for establishment and reproduction. Current farmland ecosystems are not suitable for large-scale establishment of natural enemies, leading to the need for multiple applications of biological control, increasing costs, and the control effect remains unsatisfactory.

[0010] To address the limitations of agricultural, chemical, physical, and biological pest control in practical applications, scientists have discovered that transferring insect-resistant genes encoding insecticidal proteins into plants can produce some insect-resistant transgenic plants for controlling plant pests.

[0011] By genetically engineering crops to introduce Bacillus thuringiensis (Bt) proteins, pest-resistant crops have been developed. For example, Cry1Ab has been used to develop corn resistant to the corn borer. These genetically modified crops are now widely used in agriculture, providing farmers with an environmentally friendly alternative to traditional insect control methods. While they have proven quite effective against lepidopteran pests (corn borer, bollworm, etc.), no genetically modified crops have yet been found to control thrips. This is mainly because the Cry protein, which is toxic to thrips, has not yet been discovered.

[0012] ACh1 is a novel insecticidal protein, completely different from traditional Bt proteins. Analysis of its secondary structure suggests it belongs to the β-pore-opening protein family. The mechanism of action for this type of protein generally involves enzymatic activation, receptor binding, oligomer formation, and pore opening on the membrane surface. The enzymatic activation within the insect gut, receptor binding, and the physicochemical environment of the gut determine whether the protein can open pores in the insect intestinal cell membrane. After secretion by bacteria, this type of protein needs to be enzymatically cleaved within the target organism to form an active protein. Enzymatic cleavage mainly occurs at the amino or carboxyl terminus of the protein, converting it into an active fragment. The active protein binds to receptors on the insect intestinal epithelial cell membrane, forming oligomers that insert into the intestinal membrane, causing cell membrane perforation. This disrupts osmotic pressure changes and pH balance across the cell membrane, interfering with the insect's digestive process and ultimately leading to death.

[0013] The ACh1 protein has been reported to have insecticidal effects against silkworms and potato beetles. However, there are currently no reports on controlling thrips damage to plants by producing transgenic plants expressing ACh1_1 and ACh1_4 proteins. Summary of the Invention

[0014] The purpose of this invention is to provide a use for an insecticidal protein, and for the first time provides a method for controlling thrips by producing an ACh1 protein, which effectively overcomes the technical deficiencies of existing agricultural control, chemical control, physical control and biological control technologies.

[0015] To achieve the above objectives, the present invention provides a method for controlling thrips pests, comprising contacting thrips pests with at least the ACh1 protein.

[0016] Furthermore, the ACh1 protein is present in at least the host cells that produce the ACh1 protein, and the thrips pest comes into contact with the ACh1 protein at least by ingesting the host cells.

[0017] Furthermore, the ACh1 protein is present in at least the bacteria or transgenic plants that produce the ACh1 protein, and the thrips pest comes into contact with the ACh1 protein by ingesting the tissues of the bacteria or the transgenic plants. After contact, the growth of the thrips pest is inhibited and / or it leads to death, thereby achieving control of thrips-damaged plants.

[0018] The genetically modified plant can be at any stage of growth.

[0019] The tissues of the transgenic plant are leaves, stems, fruits, male ears, female ears, anthers, or filaments.

[0020] The control of thrips-damaged plants is not affected by changes in planting location and / or planting time.

[0021] The plants mentioned are corn, soybeans, cotton, and rapeseed.

[0022] The step preceding the contact step is to plant a plant containing a polynucleotide encoding the ACh1 protein.

[0023] Based on the above technical solution, the ACh1 protein is either ACh1_1 protein or ACh1_4 protein.

[0024] Preferably, the amino acid sequence of the ACh1 protein has the amino acid sequence shown in SEQ ID NO:1 or SEQ ID NO:2.

[0025] Based on the above technical solution, the plant also includes at least one second nucleotide that is different from the nucleotide encoding the ACh1 protein.

[0026] Furthermore, the second nucleotide encodes a Cry-type insecticidal protein, a Vip-type insecticidal protein, a protease inhibitor, a lectin, an α-amylase, or a peroxidase.

[0027] Alternatively, the second nucleotide may be a dsRNA that inhibits important genes in the target insect pest.

[0028] The thrips mentioned are corn thrips, rice thrips, and western flower thrips.

[0029] To achieve the above objectives, the present invention also provides the use of ACh1 protein in controlling thrips pests.

[0030] To achieve the above objectives, the present invention also provides a method for producing a plant that controls thrips pests, comprising introducing a polynucleotide sequence encoding an ACh1 protein into the genome of said plant.

[0031] To achieve the above objectives, the present invention also provides a method for producing plant seeds for controlling thrips pests, comprising hybridizing a first plant obtained by the method with a second plant to produce seeds containing a polynucleotide sequence encoding an ACh1 protein.

[0032] To achieve the above objectives, the present invention also provides a method for cultivating plants to control thrips pests, comprising:

[0033] Plant at least one plant seed, the genome of which includes a polynucleotide sequence encoding the ACh1 protein;

[0034] To allow the plant seeds to grow into plants;

[0035] The plants are grown under conditions of artificial inoculation with thrips pests and / or natural thrips pest infestation, and the harvested plants exhibit reduced plant damage and / or increased plant yield compared to other plants that do not have a polynucleotide sequence encoding the ACh1 protein.

[0036] In this invention, "contact" refers to insects and / or pests touching, staying on, and / or feeding on plants, plant organs, plant tissues, or plant cells. The plants, plant organs, plant tissues, or plant cells may express insecticidal proteins within themselves, or they may have insecticidal proteins on their surface and / or have microorganisms that produce insecticidal proteins.

[0037] In this invention, the terms "control" and / or "prevention" refer to thrips pests coming into contact with the ACh1 protein, resulting in inhibited growth and / or death of the thrips. Further, thrips pests ingest plant tissues and come into contact with the ACh1 protein, resulting in the inhibition of growth and / or death of all or part of the thrips. Inhibition refers to sublethality, meaning it does not cause death but induces some effect on growth, development, behavior, physiology, biochemistry, and tissue aspects, such as slowed and / or stopped growth. Simultaneously, the plant should be morphologically normal and culturable under conventional methods for product consumption and / or generation. Furthermore, plants and / or seeds containing the polynucleotide sequence encoding the ACh1 protein that control thrips pests, under conditions of artificial inoculation with thrips and / or natural thrips damage, exhibit reduced plant damage compared to non-transgenic wild-type plants, specifically including but not limited to improved stem resistance, and / or increased grain weight, and / or increased yield. The "control" and / or "prevention" effect of the ACh1 protein on thrips can exist independently and is not weakened or eliminated by the presence of other substances that can "control" and / or "prevent" thrips pests. Specifically, if any tissue of a transgenic plant (containing a polynucleotide sequence encoding the ACh1 protein) simultaneously and / or asynchronously contains and / or produces the ACh1 protein and / or another substance that can control thrips pests, then the presence of the other substance neither affects the "control" and / or "prevention" effect of the ACh1 protein on thrips, nor does it cause the "control" and / or "prevention" effect to be wholly and / or partially achieved by the other substance, and is unrelated to the ACh1 protein. In the field, the feeding process of thrips on plant tissues is usually brief and difficult to observe with the naked eye. Therefore, under conditions of artificial inoculation of thrips and / or natural occurrence of thrips damage, such as the presence of dead thrips in any tissue of a transgenic plant (containing a polynucleotide sequence encoding the ACh1 protein), and / or thrips with inhibited growth remaining on it, and / or reduced plant damage compared to non-transgenic wild-type plants, the method and / or use of the present invention is achieved, namely, the method and / or use of controlling thrips by having thrips at least come into contact with the ACh1 protein.

[0038] In this invention, the expression of ACh1 protein in a transgenic plant can be accompanied by the expression of one or more Cry-type insecticidal proteins and / or Vip-type insecticidal proteins. The co-expression of more than one insecticidal toxin in the same transgenic plant can be achieved through genetic engineering to include and express the desired genes in the plant. Alternatively, one plant (the first parent) can be genetically engineered to express the ACh1 protein, and a second plant (the second parent) can be genetically engineered to express Cry-type and / or Vip-type insecticidal proteins. Offspring plants expressing all genes introduced from both the first and second parents are obtained through hybridization.

[0039] RNA interference (RNAi) refers to a highly conserved evolutionary phenomenon characterized by the efficient and specific degradation of homologous mRNA induced by double-stranded RNA (dsRNA). Therefore, in this invention, RNAi technology can be used to specifically knock out or shut down the expression of specific genes in target insect pests.

[0040] The western flower thrips (Frankliniella occidentalis (Pergande)) described in this invention belongs to the genus *Frankliniella* in the family Thripidae of the order Thysanoptera. The eggs are kidney-shaped, white, and 0.25 mm long. Under field conditions, the incubation period is 5–15 days, while at 25°C, it averages 2.6 days. Nymphs have two instars. After hatching, nymphs begin feeding. Newly hatched nymphs are white, turning yellow before molting. Second-instar nymphs are waxy yellow, very active, and consume three times the amount of food as first-instar nymphs. Near maturity, they exhibit negative phototaxis and leave the plant to burrow into the soil. The developmental threshold temperature for nymphs is 9.4°C. In the field, the developmental period for nymphs is 9–12 days, which can extend to 60 days in winter. However, under a constant temperature of 25°C, the development of first-instar and second-instar nymphs takes only 2.3 and 3.7 days, respectively. Nymphs and adults often feed in small groups. Adults are small, with an average body length of 1.5 mm. The wings are narrow, with the leading edge fringes significantly shorter than the trailing edge fringes. They can fly and jump well, and can migrate short distances using air currents. Their body color ranges from pale yellow to brown, and they have eight-segmented antennae. Females often lay their eggs in leaf tissue, inflorescences, or young fruits.

[0041] Western flower thrips are omnivorous, with over 500 known host plant species, including important crops from the Asteraceae, Cucurbitaceae, Fabaceae, and Brassicaceae families. Major host plants include plums, peaches, apples, grapes, strawberries, eggplants, peppers, lettuce, tomatoes, beans, orchids, and chrysanthemums. As the western flower thrips continues to spread, the number of host species it hosts is constantly increasing. While there are differences in its preference for different host plant species, western flower thrips can survive on all of them and possess considerable reproductive capacity. Western flower thrips uses its specialized mouthparts to pierce and suck sap from the leaves, buds, flowers, or fruit juice of host plants. Initially, infected leaves show white spots that later merge, resembling spot diseases on the upper surface, while black frass appears on the underside. Severe infestation leads to smaller, wrinkled leaves, and even yellowing, drying, and wilting of flowers. Infected flowers show white spots or turn brown, and infected fruits often leave wounds or even scars. Infected flowering plants exhibit discoloration of leaves and petals with feeding marks, affecting their appearance and commercial value. Infected buds and flowers are deformed, and in severe cases, flowers fail to open properly. Long-distance spread of western flower thrips is primarily due to human factors. The transportation of seedlings, flowers, and other agricultural products, especially cut flowers, and human handling are the main modes of long-distance dispersal. They are highly resilient and can survive even after being transported to other regions. Furthermore, this pest is easily dispersed by wind and carried by clothing and transportation vehicles. Western flower thrips readily transmit viral diseases, and my country has listed them as a quarantine pest.

[0042] The ACh1 protein described in this invention is a type of β-open-pore protein. Enzymatic activation within the insect gut, binding to receptors on the insect gut, and the physicochemical environment within the gut are key factors in the function of β-open-pore proteins. Only when β-open-pore proteins are enzymatically cleaved into active fragments and then bind to receptors on the insect intestinal epithelial cell membrane can a particular β-open-pore protein exhibit an insecticidal effect against the pest. Receptor binding requires precise matching; often, a difference of even a single amino acid in the open-pore protein or receptor protein can alter the binding to the same receptor. For example, the aerolysin protein, also a type of β-open-pore protein, exhibited a qualitative change in virulence against the CTLL-2 cell line after the R336A mutation (Osusky, Teschk et al., 2008). Similarly, changes in receptors can also lead to alterations in the virulence of the same β-open-pore protein. For example, suppressing the HAVCR1 gene in the MDCK cell line using dsRNA resulted in a hundredfold difference in the cytotoxicity of epsilon-toxin (Ivie, Fennessey et al., 2011). This fully demonstrates that the interaction between β-aporphyrin and enzymes and receptors in insects is complex and unpredictable.

[0043] The genome of a plant, plant tissue, or plant cell as described in this invention refers to any genetic material within a plant, plant tissue, or plant cell, including the nucleus and plastid genome and the mitochondrial genome.

[0044] The polynucleotides and / or nucleotides described in this invention form a complete "gene" that encodes a protein or polypeptide in the desired host cell. Those skilled in the art will readily recognize that the polynucleotides and / or nucleotides of this invention can be placed under the control of regulatory sequences in the target host.

[0045] As is well known to those skilled in the art, DNA typically exists in a double-stranded form. In this arrangement, one strand is complementary to the other, and vice versa. Because DNA replicates in plants, other complementary strands of DNA are produced. Thus, this invention includes the use of the polynucleotides and their complementary strands as exemplified in the sequence listing. The term "coding strand" as commonly used in the art refers to the strand that binds to the antisense strand. To express proteins in vivo, typically one strand of DNA is transcribed into a complementary strand of mRNA, which serves as a template for protein translation. The mRNA is actually transcribed from the "antisense" strand of DNA. The "sense" or "coding" strand has a series of codons (codons are three nucleotides, and reading three at a time produces a specific amino acid) that can be read as an open reading frame (ORF) to form the target protein or peptide. This invention also includes RNA that functions substantially similarly to the DNA of the examples.

[0046] In this invention, nucleic acid molecules or fragments thereof hybridize with the ACh1 gene of this invention under stringent conditions. Any conventional nucleic acid hybridization or amplification method can be used to identify the presence of the ACh1 gene of this invention. Nucleic acid molecules or fragments thereof can specifically hybridize with other nucleic acid molecules under certain conditions. In this invention, if two nucleic acid molecules can form antiparallel double-stranded nucleic acid structures, it can be said that these two nucleic acid molecules can specifically hybridize with each other. If two nucleic acid molecules exhibit perfect complementarity, one nucleic acid molecule is called a "complement" of the other nucleic acid molecule. In this invention, when every nucleotide of one nucleic acid molecule is complementary to the corresponding nucleotide of another nucleic acid molecule, the two nucleic acid molecules are said to exhibit "perfect complementarity". If two nucleic acid molecules can hybridize with sufficient stability to anneal and bind to each other under at least conventional "low-string" conditions, the two nucleic acid molecules are called "minimally complementary". Similarly, if two nucleic acid molecules can hybridize with sufficient stability to anneal and bind to each other under conventional "high-string" conditions, the two nucleic acid molecules are said to be "complementary". Deviations from perfect complementarity are permissible, as long as such deviations do not completely prevent the two molecules from forming a double-stranded structure. In order for a nucleic acid molecule to be used as a primer or probe, it is only necessary to ensure that it has sufficient sequence complementarity so that it can form a stable double-stranded structure under the specific solvent and salt concentration used.

[0047] In this invention, the substantially homologous sequence is a nucleic acid molecule that, under highly stringent conditions, can specifically hybridize with the complementary strand of a matching nucleic acid molecule. Suitable stringent conditions that promote DNA hybridization, such as treatment with 6.0× sodium chloride / sodium citrate (SSC) at approximately 45°C followed by washing with 2.0× SSC at 50°C, are well known to those skilled in the art. For example, the salt concentration in the washing step can be selected from approximately 2.0× SSC, 50°C for low-stringent conditions to approximately 0.2× SSC, 50°C for high-stringent conditions. Furthermore, the temperature conditions in the washing step can be increased from approximately 22°C (room temperature) for low-stringent conditions to approximately 65°C for high-stringent conditions. Both the temperature conditions and the salt concentration can be changed, or one can remain constant while the other is changed. Preferably, the stringent conditions described in this invention can be as follows: specific hybridization occurs at 65°C in a 6×SSC, 0.5% SDS solution, followed by washing the membrane once each with 2×SSC, 0.1% SDS and 1×SSC, 0.1% SDS.

[0048] Therefore, sequences possessing insecticidal activity and hybridizing with SEQ ID NO:3 or SEQ ID NO:4 of the present invention under stringent conditions are included in the present invention. These sequences are at least about 40%-50% homologous to the sequences of the present invention, about 60%, 65%, or 70% homologous, or even at least about 75%, 80%, 85%, 90%, 91%, 92%, 93%, 94%, 95%, 96%, 97%, 98%, 99%, or greater sequence homology.

[0049] The genes and proteins described in this invention include not only specific example sequences, but also portions and / or fragments (including deletions at the ends compared to the full-length protein), variants, mutants, substitutes (proteins with substituted amino acids), chimeras, and fusion proteins that preserve the insecticidal activity characteristics of the specific example proteins. The term "variant" or "mutation" refers to a nucleotide sequence encoding the same protein or an equivalent protein with insecticidal activity. The term "equivalent protein" refers to a protein having the same or substantially the same biological activity against thrips pests as the protein of the claims.

[0050] The “fragment” or “truncated” DNA molecule or protein sequence described in this invention refers to a portion of the original DNA or protein sequence (nucleotide or amino acid) involved or its artificially modified form (e.g., a sequence suitable for plant expression). The length of the aforementioned sequence may vary, but the length is sufficient to ensure that the protein (encoding) is an insect toxin.

[0051] Genes can be modified and gene variants can be easily constructed using standard techniques. For example, techniques for creating point mutations are well known in the art. U.S. Patent No. 5,605,793, for instance, describes a method for generating additional molecular diversity using DNA reassembly after random breaks. Fragments of full-length genes can be produced using commercially available restriction endonucleases, and exonucleases can be used according to standard procedures. For example, enzymes such as Bal31 or site-directed mutagenesis can be used to systematically remove nucleotides from the ends of these genes. Genes encoding active fragments can also be obtained using various restriction endonucleases. Active fragments of these toxins can be obtained directly using proteases.

[0052] This invention can derive equivalent proteins and / or genes encoding these equivalent proteins from β-open-pore protein isolates and / or DNA libraries. Various methods exist for obtaining the insecticidal proteins of this invention. For example, antibodies to the insecticidal proteins disclosed and claimed in this invention can be used to identify and isolate other proteins from a protein mixture. In particular, the antibody may be generated from the protein fraction that is most constant and most distinct from other β-open-pore proteins. These antibodies can then be used to specifically identify the characteristically active equivalent proteins by immunoprecipitation, enzyme-linked immunosorbent assay (ELISA), or Western blotting. Antibodies to the proteins, equivalent proteins, or fragments of such proteins disclosed in this invention can be readily prepared using standard procedures in the art. Genes encoding these proteins can then be obtained from microorganisms.

[0053] Due to the abundance of genetic codons, many different DNA sequences can encode the same amino acid sequence. The production of alternative DNA sequences encoding these identical or substantially identical proteins is within the skill level of those skilled in the art. These different DNA sequences are included within the scope of this invention. The term "substantially identical" means a sequence with amino acid substitutions, deletions, additions, or insertions that do not substantially affect insecticidal activity, and also includes fragments that retain insecticidal activity.

[0054] The substitution, deletion, or addition of amino acid sequences in this invention is a conventional technique in the art. Preferably, such amino acid changes are: small property changes, i.e., conserved amino acid substitutions that do not significantly affect protein folding and / or activity; small deletions, typically about 1-30 amino acid deletions; small amino or carboxyl terminus extensions, such as an amino terminus extension of one methionine residue; and small linker peptides, such as about 20-25 residues long.

[0055] Examples of conserved substitutions are those occurring within the following groups of amino acids: basic amino acids (such as arginine, lysine, and histidine), acidic amino acids (such as glutamic acid and aspartic acid), polar amino acids (such as glutamine and asparagine), hydrophobic amino acids (such as leucine, isoleucine, and valine), aromatic amino acids (such as phenylalanine, tryptophan, and tyrosine), and small-molecule amino acids (such as glycine, alanine, serine, threonine, and methionine). Those amino acid substitutions that do not typically alter specific activity are well known in the art and have been described, for example, by N. Neurath and R.L. Hill in *Protein*, published by Academic Press in New York in 1979. The most common interchanges are Ala / Ser, Val / Ile, Asp / Glu, Thu / Ser, Ala / Thr, Ser / Asn, Ala / Val, Ser / Gly, Tyr / Phe, Ala / Pro, Lys / Arg, Asp / Asn, Leu / Ile, Leu / Val, Ala / Glu, and Asp / Gly, as well as their opposite interchanges.

[0056] It will be apparent to those skilled in the art that such substitution can occur outside the region where molecular function is important, and still produce an active polypeptide. For the polypeptides of the present invention, the amino acid residues essential for their activity and therefore selected as unsubstituted can be identified according to methods known in the art, such as site-directed mutagenesis or alanine scanning mutagenesis (see, Cunningham and Wells, 1989, Science 244: 1081-1085). The latter technique involves introducing a mutation at each positively charged residue in the molecule and detecting the insecticidal activity of the resulting mutant molecule, thereby identifying the amino acid residues important for the activity of the molecule. The substrate-enzyme interaction site can also be determined by analyzing its three-dimensional structure, which can be determined by techniques such as nuclear magnetic resonance analysis, crystallography, or photoaffinity labeling (see, for example, de Vos et al., 1992, Science 255: 306-312; Smith et al., 1992, J. Mol. Biol 224: 899-904; Wlodaver et al., 1992, FEBS Letters 309: 59-64).

[0057] In this invention, the ACh1 protein includes, but is not limited to, SEQ ID NO:1 or SEQ ID NO:2, and amino acid sequences having a certain degree of homology with the amino acid sequences shown in SEQ ID NO:1 or SEQ ID NO:2 are also included in this invention. These sequences typically exhibit greater than 78% similarity / identity with the sequences of this invention, preferably greater than 85%, more preferably greater than 90%, even more preferably greater than 95%, and may be greater than 99%. Preferred polynucleotides and proteins of this invention can also be defined according to more specific ranges of similarity and / or identity. For example, sequences exhibiting 78%, 79%, 80%, 81%, 82%, 83%, 84%, 85%, 86%, 87%, 88%, 89%, 90%, 91%, 92%, 93%, 94%, 95%, 96%, 97%, 98%, or 99% similarity and / or identity with the sequences exemplified in this invention.

[0058] The regulatory sequences described in this invention include, but are not limited to, promoters, transport peptides, terminators, enhancers, leader sequences, introns, and other regulatory sequences operatively linked to the ACh1 protein.

[0059] The promoters mentioned are plant-expressible promoters, meaning promoters that ensure the expression of the coding sequence linked to them within plant cells. Plant-expressible promoters can be constitutive promoters. Examples of promoters guiding constitutive expression in plants include, but are not limited to, the 35S promoter derived from cauliflower mosaic virus, the maize Ubi promoter, and the promoter of the rice GOS2 gene. Alternatively, plant-expressible promoters can be tissue-specific promoters, meaning that the promoter guides the expression level of the coding sequence in some plant tissues, such as green tissues, to be higher than in other plant tissues (which can be determined by conventional RNA assays), such as the PEP carboxylase promoter. Alternatively, plant-expressible promoters can be wound-induced promoters. Wound-induced promoters, or promoters that guide wound-induced expression patterns, refer to promoters that significantly increase the expression of the coding sequence under their regulation compared to normal growth conditions when plants experience mechanical or insect-induced trauma. Examples of trauma-inducible promoters include, but are not limited to, promoters of the protease repressor genes (pin I and pin II) in potatoes and tomatoes and the protease repressor gene (MPI) in maize.

[0060] The transport peptide (also known as a secretory signal sequence or guide sequence) guides the transgenic product to a specific organelle or cell compartment. The transport peptide can be heterologous to the receptor protein, for example, using a sequence encoding a chloroplast transport peptide to target the chloroplast, or using the 'KDEL' reserved sequence to target the endoplasmic reticulum, or using the CTPP of the barley plant lectin gene to target the vacuoles.

[0061] The leader sequence includes, but is not limited to, small RNA virus leader sequences, such as the EMCV leader sequence (5' untranslated region of encephalomyocarditis virus); potato Y virus group leader sequences, such as the MDMV (maize dwarf mosaic virus) leader sequence; human immunoglobulin heavy chain binding protein (BiP); untranslated leader sequence of alfalfa mosaic virus capsid protein mRNA (AMVRNA4); and tobacco mosaic virus (TMV) leader sequence.

[0062] The enhancers include, but are not limited to, enhancers for cauliflower mosaic virus (CaMV), enhancers for scrophularia mosaic virus (FMV), enhancers for carnation weathering ring virus (CERV), enhancers for cassava vein mosaic virus (CsVMV), enhancers for four o'clock mosaic virus (MMV), enhancers for night-blooming jasmine yellow leaf curl virus (CmYLCV), enhancers for cotton leaf curl virus (CLCuMV), enhancers for dayflower yellow mottle virus (CoYMV), and enhancers for peanut chlorotic streak mosaic virus (PCLSV).

[0063] For monocotyledonous plant applications, the introns include, but are not limited to, the maize hsp70 intron, the maize ubiquitin intron, the Adh intron 1, the sucrose synthase intron, or the rice Act1 intron. For dicotyledonous plant applications, the introns include, but are not limited to, the CAT-1 intron, the pKANNIBAL intron, the PIV2 intron, and the "super ubiquitin" intron.

[0064] The terminator can be a suitable polyadenylation signal sequence that functions in plants, including but not limited to polyadenylation signal sequences derived from the Agrobacterium tumefaciens carmine synthase (NOS) gene, polyadenylation signal sequences derived from the protease inhibitor II (pin II) gene, polyadenylation signal sequences derived from the pea ssRUBISCO E9 gene, and polyadenylation signal sequences derived from the α-tubulin gene.

[0065] In this invention, "effective linkage" refers to the connection of nucleic acid sequences such that one sequence provides the function required for the linked sequences. In this invention, "effective linkage" can refer to linking a promoter to a sequence of interest, such that the transcription of the sequence of interest is controlled and regulated by the promoter. When the sequence of interest encodes a protein and its expression is desired, "effective linkage" means that the promoter is linked to the sequence in a manner that allows for efficient translation of the resulting transcript. If the linkage between the promoter and the coding sequence is a transcript fusion and the desired expression of the encoded protein is desired, such a linkage is created such that the first translation start codon in the resulting transcript is the start codon of the coding sequence. Alternatively, if the linkage between the promoter and the coding sequence is a translational fusion and the desired expression of the encoded protein is desired, such a linkage is created such that the first translation start codon contained in the 5' untranslated sequence is linked to the promoter, and the linkage is such that the relationship between the resulting translation product and the open reading frame encoding the desired protein conforms to the reading frame. Nucleic acid sequences that can be "effectively linked" include, but are not limited to: sequences that provide gene expression function (i.e., gene expression elements, such as promoters, 5' untranslated regions, introns, protein-coding regions, 3' untranslated regions, polyadenylation sites, and / or transcription terminators); sequences that provide DNA transfer and / or integration function (i.e., T-DNA boundary sequences, site-specific recombinase recognition sites, and integrase recognition sites); sequences that provide selective function (i.e., antibiotic resistance markers and biosynthetic genes); sequences that provide scoreable marker function; sequences that assist in sequence manipulation in vitro or in vivo (i.e., multiple adapter sequences and site-specific recombination sequences); and sequences that provide replication function (i.e., bacterial origin of replication, autonomous replication sequences, and centromere sequences).

[0066] In this invention, "insecticide" or "insect-resistant" refers to being toxic to crop pests, thereby achieving "control" and / or "prevention" of crop pests. Preferably, "insecticide" or "insect-resistant" refers to killing crop pests. More specifically, the target insect is the thrips pest.

[0067] In this invention, the ACh1 protein is toxic to thrips pests. The plants used in this invention, particularly corn, soybeans, and cotton, contain exogenous DNA in their genomes. This exogenous DNA contains a nucleotide sequence encoding the ACh1 protein. Thrips pests come into contact with this protein by ingesting plant tissues, and upon contact, their growth is inhibited and / or they die. Inhibition refers to lethality or sublethality. Simultaneously, the plants should be morphologically normal and culturable under conventional methods for product consumption and / or generation. Furthermore, this plant essentially eliminates the need for chemical or biological pesticides (specifically, pesticides targeting thrips pests targeted by the ACh1 protein).

[0068] The expression level of insecticidal protein (β-opening protein) in plant material can be detected by a variety of methods described in the art, such as quantifying the mRNA encoding insecticidal protein produced in the tissue by applying specific primers, or directly and specifically detecting the amount of insecticidal protein produced.

[0069] Different experiments can be used to determine the insecticidal effect of β-pore-opening protein in plants. The target insect in this invention is mainly thrips.

[0070] In this invention, the ACh1 protein may have the amino acid sequence shown in SEQ ID NO:1 or SEQ ID NO:2 in the sequence listing. In addition to the coding region of the ACh1 protein, it may also contain other elements, such as proteins encoding selective markers.

[0071] Furthermore, the expression cassette containing the nucleotide sequence encoding the ACh1 protein of the present invention can also be expressed in plants along with at least one protein encoding a herbicide resistance gene, including but not limited to glufosinate resistance genes (such as bar genes, pat genes), benzyladenine resistance genes (such as pmph genes), glyphosate resistance genes (such as EPSPS genes), bromooxynil resistance genes, sulfonylurea resistance genes, herbicide resistance genes, glutamine resistance genes, or glutamine synthetase inhibitor resistance genes (such as PPT), thereby obtaining transgenic plants that possess both high insecticidal activity and herbicide resistance.

[0072] In this invention, exogenous DNA is introduced into plants, such as introducing the gene encoding the ACh1 protein, expression cassette, or recombinant vector into plant cells. Conventional transformation methods include, but are not limited to, Agrobacterium-mediated transformation, microemission bombardment, direct DNA uptake into protoplasts, electroporation, or whisker-silicon-mediated DNA introduction.

[0073] This invention provides a use for an insecticidal protein, which has the following advantages:

[0074] 1. Internal control. Existing technologies mainly control thrips pests through external factors, such as agricultural control, chemical control, physical control, and biological control. However, this invention controls thrips pests by producing ACh1 protein within the plant that can kill thrips, i.e., through internal control.

[0075] 2. No pollution or residue. While existing chemical control methods have played a role in controlling thrips pests, they also cause pollution, damage, and residue to humans, livestock, and farmland ecosystems. The method for controlling thrips pests using this invention can eliminate these adverse consequences.

[0076] 3. Control throughout the entire growth cycle. Existing technologies for controlling thrips pests are all phased, while this invention provides protection for plants throughout their entire growth cycle. Transgenic plants (ACh1 protein) can avoid thrips infestation from germination and growth to flowering and fruiting.

[0077] 4. Whole-plant control. Most existing methods for controlling thrips pests are localized, such as foliar spraying; however, this invention protects the entire plant, including the roots, leaves, stems, fruits, tassels, ears, anthers, and filaments of the transgenic plant (ACh1 protein), all of which can resist thrips infestation.

[0078] 5. Stable efficacy. Existing technologies, whether agricultural or physical control methods, rely on environmental conditions for pest control, which are subject to numerous variables. This invention, by expressing the ACh1 protein within plants, effectively overcomes the instability of environmental conditions. Furthermore, the control efficacy of the transgenic plants (ACh1 protein) of this invention remains stable and consistent across different locations, times, and genetic backgrounds.

[0079] 6. Simple, convenient, and economical. This invention only requires planting transgenic plants that can express ACh1 protein, without the need for other measures, thus saving a lot of manpower, material resources, and financial resources.

[0080] 7. Thorough effect. Existing methods for controlling thrips pests are not thorough and only alleviate the symptoms; however, the transgenic plant (ACh1 protein) of this invention can cause mass mortality of thrips larvae.

[0081] The technical solution of the present invention will be further described in detail below with reference to the accompanying drawings and embodiments. Attached Figure Description

[0082] Figure 1 A flowchart illustrating the construction process of the recombinant expression vector DBN01-T containing the ACh1 nucleotide sequence for the purpose of the insecticidal protein of this invention.

[0083] Figure 2 The flowchart shows the construction process of the recombinant expression vector DBN01-B containing the ACh1 nucleotide sequence for the purpose of the insecticidal protein of the present invention. Detailed Implementation

[0084] The following specific embodiments further illustrate the technical solution for the use of the insecticidal protein of the present invention.

[0085] First embodiment: Acquisition and synthesis of genes

[0086] 1. Obtain the nucleotide sequence

[0087] The amino acid sequence (309 amino acids) of the ACh1_1 insecticidal protein is shown in SEQ ID NO:1 in the sequence listing; the ACh1_1 nucleotide sequence (930 nucleotides) encoding the amino acid sequence of the ACh1_1 insecticidal protein is shown in SEQ ID NO:3 in the sequence listing.

[0088] The amino acid sequence (309 amino acids) of the ACh1_4 insecticidal protein is shown in SEQ ID NO:2 in the sequence listing; the ACh1_4 nucleotide sequence (930 nucleotides) encoding the amino acid sequence of the ACh1_4 insecticidal protein is shown in SEQ ID NO:4 in the sequence listing.

[0089] 2. Synthesize the above nucleotide sequence

[0090] The ACh1_1 nucleotide sequence (as shown in SEQ ID NO:3 in the sequence listing) and the ACh1_4 nucleotide sequence (as shown in SEQ ID NO:4 in the sequence listing) were synthesized by Nanjing Genscript Biotech Co., Ltd.

[0091] Second embodiment: Construction of recombinant expression vector and transformation of recombinant expression vector into Agrobacterium.

[0092] 1. Construct a recombinant cloning vector containing the ACh1 gene.

[0093] The synthesized ACh1_1 nucleotide sequence was ligated into the cloning vector pGEM-T (Promega, Madison, USA, CAT: A3600). The procedure was performed according to the Promega pGEM-T vector instructions, resulting in the recombinant cloning vector DBN01-T. The construction process is as follows: Figure 1 As shown (where Amp represents the ampicillin resistance gene; f1 represents the replication origin of phage f1; LacZ is the LacZ start codon; SP6 is the SP6 RNA polymerase promoter; T7 is the T7 RNA polymerase promoter; ACh1_1 is the ACh1_1 nucleotide sequence (SEQ ID NO:3); MCS is the multiple cloning site).

[0094] The recombinant cloning vector DBN01-T was then transformed into *E. coli* T1 competent cells (Transgen, Beijing, China, CAT: CD501) using a heat shock method. White colonies were picked and cultured overnight at 37°C in LB broth (10 g / L tryptone, 5 g / L yeast extract, 10 g / L NaCl, 100 mg / L ampicillin, pH adjusted to 7.5 with NaOH). The plasmid was extracted using the alkaline method and stored at -20°C for later use.

[0095] After the extracted plasmid was identified by enzyme digestion, the positive clones were sequenced for verification. The results showed that the ACh1_1 nucleotide sequence inserted into the recombinant cloning vector DBN01-T was the nucleotide sequence shown in the sequence listing (SEQ ID NO:3), that is, the ACh1_1 nucleotide sequence was correctly inserted.

[0096] Following the method described above for constructing the recombinant cloning vector DBN01-T, the synthesized ACh1_4 nucleotide sequence was ligated into the cloning vector pGEM-T to obtain the recombinant cloning vector DBN02-T, wherein ACh1_4 is the ACh1_4 nucleotide sequence (SEQ ID NO:4). Enzyme digestion and sequencing verified the correct insertion of the ACh1_4 nucleotide sequence into the recombinant cloning vector DBN02-T.

[0097] 2. Construct a recombinant expression vector containing the ACh1 gene.

[0098] The recombinant cloning vector DBN01-T and expression vector DBNBC-01 (vector backbone: pCAMBIA2301 (available from the CAMBIA organization)) were digested with restriction endonucleases, respectively. The excised ACh1_1 nucleotide sequence fragment was inserted between the restriction endonuclease sites of the expression vector DBNBC-01. Constructing vectors using conventional digestion methods is well-known to those skilled in the art, thus constructing the recombinant expression vector DBN01-B. The construction procedure is as follows: Figure 2 As shown (Kan: kanamycin gene; RB: right border; prUbi: Ubiquitin gene promoter (SEQ ID NO:5); ACh1_1: ACh1_1 nucleotide sequence (SEQ ID NO:3); tNos: t-terminator of carmine synthase gene (SEQ ID NO:6); Hpt: hygromycin phosphotransferase gene (SEQ ID NO:7); LB: left border).

[0099] The recombinant expression vector DBN01-B was transformed into *E. coli* T1 competent cells using the heat shock method. White colonies were picked and cultured overnight at 37°C in LB broth (10 g / L tryptone, 5 g / L yeast extract, 10 g / L NaCl, 50 mg / L kanamycin, pH adjusted to 7.5 with NaOH). The plasmid was extracted using the alkaline method. The extracted plasmid was identified by restriction endonuclease digestion, and positive clones were sequenced. The results showed that the nucleotide sequence of the recombinant expression vector DBN01-B contained the nucleotide sequence shown in SEQ ID NO:3 of the sequence listing, namely the ACh1_1 nucleotide sequence.

[0100] Following the method described above for constructing the recombinant expression vector DBN01-B, the ACh1_4 nucleotide sequence cut from the recombinant cloning vector DBN02-T was inserted into the expression vector DBNBC-01 to obtain the recombinant expression vector DBN02-B. Enzyme digestion and sequencing verified that the nucleotide sequence in the recombinant expression vector DBN02-B contains the nucleotide sequence shown in SEQ ID NO:4 of the sequence listing, namely the ACh1_4 nucleotide sequence. The ACh1_4 nucleotide sequence can be linked to the Ubi promoter and the Nos terminator.

[0101] 3. Transformation of Agrobacterium with recombinant expression vector

[0102] The correctly constructed recombinant expression vectors DBN01-B and DBN02-B were transformed into Agrobacterium LBA4404 (Invitrgen, Chicago, USA, CAT: 18313-015) using liquid nitrogen. The transformation conditions were as follows: 100 μl Agrobacterium LBA4404, 3 μl plasmid DNA (recombinant expression vector); incubated in liquid nitrogen for 10 minutes, then in a 37°C water bath for 10 minutes; the transformed Agrobacterium LBA4404 was then inoculated into L... The culture was carried out in test tube B at 28℃ and 200 rpm for 2 hours. The culture was then plated on LB agar plates containing 50 mg / L rifampicin and 100 mg / L kanamycin until positive single clones grew. Single clones were picked, cultured, and their plasmids were extracted. The recombinant expression vectors DBN01-B and DBN02-B were digested with restriction endonucleases for verification. The results showed that the structures of the recombinant expression vectors DBN01-B and DBN02-B were completely correct.

[0103] Third embodiment: Obtaining transgenic maize plants

[0104] Following the conventional Agrobacterium infection method, the aseptically cultured immature embryos of maize variety Z31 were co-cultured with Agrobacterium transformed by the recombinant expression vector described in Example 3 of the second embodiment. This was to transfer the T-DNA (including the promoter sequence of the maize Ubiquitin gene, the ACh1_1 nucleotide sequence, the ACh1_4 nucleotide sequence, the Hpt gene, and the Nos terminator sequence) from the recombinant expression vectors DBN01-B and DBN02-B constructed in Example 2 into the maize chromosome set, resulting in maize plants with the ACh1_1 nucleotide sequence and maize plants with the ACh1_4 nucleotide sequence. Wild-type maize plants were used as a control.

[0105] For Agrobacterium-mediated maize transformation, briefly, immature embryos are isolated from maize and contacted with an Agrobacterium suspension, wherein Agrobacterium is capable of delivering the ACh1_1 nucleotide sequence and / or the ACh1_4 nucleotide sequence to at least one cell of one of the embryos (step 1: infection step), in which the embryos are preferably immersed in the Agrobacterium suspension (OD). 660 =0.4-0.6, inoculated in infection medium (MS salt 4.3 g / L, MS vitamins, casein 300 mg / L, sucrose 68.5 g / L, glucose 36 g / L, acetylsuccinone (AS) 40 mg / L, 2,4-dichlorophenoxyacetic acid (2,4-D) 1 mg / L, pH 5.3). The embryos are co-cultured with Agrobacterium for a period (3 days) (Step 2: Co-culture step). Preferably, after the infection step, the embryos are cultured on solid medium (MS salt 4.3 g / L, MS vitamins, casein 300 mg / L, sucrose 20 g / L, glucose 10 g / L, acetylsuccinone (AS) 100 mg / L, 2,4-dichlorophenoxyacetic acid (2,4-D) 1 mg / L, agar 8 g / L, pH 5.8). After this co-culture phase, a selective "recovery" step can be performed. In the "recovery" step, the recovery medium (MS salt 4.3 g / L, MS vitamins, casein 300 mg / L, sucrose 30 g / L, 2,4-dichlorophenoxyacetic acid (2,4-D) 1 mg / L, agar 8 g / L, pH 5.8) contains at least one known antibiotic (cephalosporin) that inhibits the growth of Agrobacterium, without the addition of a selector for plant transformants (Step 3: Recovery Step). Preferably, the immature embryos are cultured on a solid medium containing antibiotics but without a selector to eliminate Agrobacterium and provide a recovery period for infected cells. Next, the inoculated immature embryos are cultured on a medium containing a selector (hygromycin) and the growing transformed callus is selected (Step 4: Selection Step). Preferably, the immature embryos are cultured on a selective solid medium containing a selector (MS salt 4.3 g / L, MS vitamins, casein 300 mg / L, sucrose 5 g / L, hygromycin 50 mg / L, 2,4-dichlorophenoxyacetic acid (2,4-D) 1 mg / L, agar 8 g / L, pH 5.8), leading to selective growth of the transformed cells. Then, the callus regenerates into a plant (step 5: regeneration step), preferably, the callus grown on the medium containing the selector is cultured on solid media (MS differentiation medium and MS rooting medium) to regenerate the plant.

[0106] The selected resistant callus tissues were transferred to the MS differentiation medium (MS salt 4.3 g / L, MS vitamins, casein 300 mg / L, sucrose 30 g / L, 6-benzyladenine 2 mg / L, hygromycin 50 mg / L, agar 8 g / L, pH 5.8) and cultured at 25°C for differentiation. The differentiated plantlets were transferred to the MS rooting medium (MS salt 2.15 g / L, MS vitamins, casein 300 mg / L, sucrose 30 g / L, indole-3-acetic acid 1 mg / L, agar 8 g / L, pH 5.8) and cultured at 25°C until approximately 10 cm tall. They were then transferred to a greenhouse for further cultivation until fruit set. In the greenhouse, the plantlets were cultured at 28°C for 16 hours daily, followed by 8 hours at 20°C.

[0107] Fourth Example: Verification of Transgenic Maize Plants using TaqMan

[0108] Approximately 100 mg of leaves from maize plants transformed with the ACh1_1 and ACh1_4 nucleotide sequences were collected as samples. Genomic DNA was extracted using Qiagen's DNeasy Plant Maxi Kit. The copy number of the Hpt gene was determined by TaqMan probe-based quantitative PCR to confirm the copy numbers of the ACh1_1 and ACh1_4 genes. Wild-type maize plants were used as controls, and the same analysis was performed. The experiment was conducted in triplicate, and the average value was used.

[0109] The specific method for detecting the Hpt gene copy number is as follows:

[0110] Step 11: Take 100 mg of leaves from maize plants with ACh1_1 nucleotide sequence, ACh1_4 nucleotide sequence and wild-type maize plants respectively, grind them into homogenates in a mortar with liquid nitrogen, and take 3 replicates for each sample.

[0111] Step 12: Use Qiagen's DNeasy Plant Mini Kit to extract genomic DNA from the above samples. Refer to the product manual for specific methods.

[0112] Step 13: Determine the genomic DNA concentration of the above samples using NanoDrop 2000 (Thermo Scientific);

[0113] Step 14: Adjust the genomic DNA concentration of the above samples to the same concentration value, wherein the concentration value ranges from 80-100 ng / μl;

[0114] Step 15: The copy number of the samples was identified using TaqMan probe-based quantitative real-time PCR. Samples with known copy numbers were used as standards, and wild-type maize plant samples were used as controls. Each sample was tested in triplicate, and the average value was taken. The primer and probe sequences for quantitative real-time PCR were as follows:

[0115] The following primers and probes are used to detect Hpt nucleotide sequences:

[0116] Primer 1: cagggtgtcacgttgcaaga is shown in SEQ ID NO:8 in the sequence listing;

[0117] Primer 2: ccgctcgtctggctaagatc is shown in SEQ ID NO:9 in the sequence listing;

[0118] Probe 1: tgcctgaaaccgaactgcccgctg is shown in SEQ ID NO:10 in the sequence listing;

[0119] The PCR reaction system is as follows:

[0120]

[0121] The 50× primer / probe mixture contains 45 μl of each primer at a concentration of 1 mM, 50 μl of the probe at a concentration of 100 μM, and 860 μl of 1×TE buffer, and is stored in centrifuge tubes at 4°C.

[0122] The PCR reaction conditions are as follows:

[0123]

[0124] The data was analyzed using SDS2.3 software (Applied Biosystems).

[0125] The experimental results of analyzing the copy number of the Hpt gene showed that the ACh1_1 nucleotide sequence and the ACh1_4 nucleotide sequence had been integrated into the chromosome set of the maize plants tested, and the maize plants that were transformed with the ACh1_1 nucleotide sequence and the maize plants that were transformed with the ACh1_4 nucleotide sequence all obtained single-copy transgenic maize plants.

[0126] Fifth Example: Detection of Insect Resistance in Transgenic Maize Plants

[0127] The insect resistance of maize plants with ACh1_1 nucleotide sequence, maize plants with ACh1_4 nucleotide sequence, corresponding wild-type maize plants, and maize plants identified as non-GMO by Taqman were tested against western flower thrips.

[0128] Fresh leaves (heart leaves) from maize plants with ACh1_1 nucleotide sequence, maize plants with ACh1_4 nucleotide sequence, wild-type maize plants, and maize plants identified by Taqman as non-GMO (V3-V4 stage) were taken respectively. The leaves were rinsed with sterile water and dried with gauze. The veins of the maize leaves were removed and they were cut into strips of about 1cm × 4cm. One strip of leaf was placed on the moisturizing filter paper at the bottom of a round plastic petri dish. Ten western flower thrips (larvae) were placed in each petri dish. After the petri dishes were covered, they were placed at a temperature of 26±1℃, a relative humidity of 70%-80%, and a photoperiod (light / dark) of 16:8 for 5 days. The mortality rate of western flower thrips larvae and the leaf damage were counted. The mortality rate = number of dead thrips / total number of inoculated thrips × 100%. Three lines (S1, S2, and S3) were transformed with the ACh1_1 nucleotide sequence, three lines (S4, S5, and S6) were transformed with the ACh1_4 nucleotide sequence, one line was identified as non-transgenic (NGM) by TaqMan, and one line was wild-type (CK). Five strains from each line were selected for testing, with each strain tested in triplicate. The results are shown in Table 1.

[0129] Table 1. Results of insect resistance experiments on transgenic maize plants inoculated with western flower thrips.

[0130]

[0131] "+" indicates insect-resistant effect; "-" indicates no insect-resistant effect.

[0132] The results in Table 1 show that maize plants with the ACh1_1 nucleotide sequence and maize plants with the ACh1_4 nucleotide sequence both have good insecticidal effects against western flower thrips; while western flower thrips larvae in wild-type maize plants and plants identified by Taqman as non-transgenic are basically non-lethal.

[0133] The test results also showed that maize plants with the ACh1_1 nucleotide sequence and maize plants with the ACh1_4 nucleotide sequence suffered only minor damage.

[0134] This demonstrates that maize plants transformed with the ACh1_1 nucleotide sequence and those transformed with the ACh1_4 nucleotide sequence both exhibited thrips resistance, sufficient to adversely affect thrips growth and thus control them in the field. Furthermore, controlling thrips damage may also reduce the occurrence of maize diseases, significantly improving maize yield and quality.

[0135] In summary, the insecticidal protein of this invention controls thrips pests by producing ACh1 protein in the plant that can kill thrips. Compared with existing agricultural, chemical, physical, and biological control methods, this invention provides protection for the entire plant throughout its growth period to prevent thrips infestation. It is pollution-free, residue-free, and has a stable, thorough, simple, convenient, and economical effect.

[0136] Finally, it should be noted that the above embodiments are only used to illustrate the technical solutions of the present invention and are not intended to limit it. Although the present invention has been described in detail with reference to preferred embodiments, those skilled in the art should understand that modifications or equivalent substitutions can be made to the technical solutions of the present invention without departing from the spirit and scope of the technical solutions of the present invention. sequence list <110> Beijing Dabeinong Biotechnology Co., Ltd. <120> Uses of insecticidal proteins <130> DBNBC160 <160> 10 <170> SIPOSequenceListing 1.0 <210> 1 <211> 309 <212> PRT <213> Artificial Sequence – ACh1_1 Amino Acid Sequence <400> 1 Met Ile Phe Leu Ala Ile Leu Asp Leu Lys Ser Leu Val Leu Asn Ala 1 5 10 15 Ile Asn Tyr Trp Gly Pro Lys Asn Asn Asn Gly Ile Gln Gly Gly Asp 20 25 30 Phe Gly Tyr Pro Ile Ser Glu Lys Gln Ile Asp Thr Ser Ile Ile Thr 35 40 45 Ser Thr His Pro Arg Leu Ile Pro His Asp Leu Thr Ile Pro Gln Asn 50 55 60 Leu Glu Thr Ile Phe Thr Thr Thr Gln Val Leu Thr Asn Asn Thr Asp 65 70 75 80 Leu Gln Gln Ser Gln Thr Val Ser Phe Ala Lys Lys Thr Thr Thr Thr 85 90 95 Thr Ser Thr Ser Thr Thr Asn Gly Trp Thr Glu Gly Gly Lys Ile Ser 100 105 110 Asp Thr Leu Glu Glu Lys Val Ser Val Ser Ile Pro Phe Ile Gly Glu 115 120 125 Gly Gly Gly Lys Asn Ser Thr Thr Ile Glu Ala Asn Phe Ala His Asn 130 135 140 Ser Ser Thr Thr Thr Phe Gln Gln Ala Ser Thr Asp Ile Glu Trp Asn 145 150 155 160 Ile Ser Gln Pro Val Leu Val Pro Pro Arg Lys Gln Val Val Ala Thr 165 170 175 Leu Val Ile Met Gly Gly Asn Phe Thr Ile Pro Met Asp Leu Met Thr 180 185 190 Thr Ile Asp Ser Thr Glu His Tyr Ser Gly Tyr Pro Ile Leu Thr Trp 195 200 205 Ile Ser Ser Pro Asp Asn Ser Tyr Asn Gly Pro Phe Met Ser Trp Tyr 210 215 220 Phe Ala Asn Trp Pro Asn Leu Pro Ser Gly Phe Gly Pro Leu Asn Ser 225 230 235 240 Asp Asn Thr Val Thr Tyr Thr Gly Ser Val Val Ser Gln Val Ser Ala 245 250 255 Gly Val Tyr Ala Thr Val Arg Phe Asp Gln Tyr Asp Ile His Asn Leu 260 265 270 Arg Thr Ile Glu Lys Thr Trp Tyr Ala Arg His Ala Thr Leu His Asn 275 280 285 Gly Lys Lys Ile Ser Ile Asn Asn Val Thr Glu Met Ala Pro Thr Ser 290 295 300 Pro Ile Lys Thr Asn 305 <210> 2 <211> 309 <212> PRT <213> Artificial Sequence - ACh1_4 Amino Acid Sequence <400> 2 Met Ile Phe Leu Ala Ile Leu Asp Leu Lys Ser Leu Val Leu Asn Ala 1 5 10 15 Ile Asn Tyr Trp Gly Pro Lys Asn Asn Asn Gly Ile Gln Gly Gly Asp 20 25 30 Phe Gly Tyr Pro Ile Ser Glu Ala Gln Ile Asp Thr Ser Ile Ile Thr 35 40 45 Ser Thr His Pro Arg Leu Ile Pro His Asp Leu Thr Ile Pro Gln Asn 50 55 60 Leu Glu Thr Ile Phe Thr Thr Thr Gln Val Leu Thr Asn Asn Thr Asp 65 70 75 80 Leu Gln Gln Ser Gln Thr Val Ser Phe Ala Lys Lys Thr Thr Thr Thr 85 90 95 Thr Ser Thr Ser Thr Thr Asn Gly Trp Thr Glu Gly Gly Ala Ile Ser 100 105 110 Asp Thr Leu Glu Glu Lys Val Ser Val Ser Ile Pro Phe Ile Gly Glu 115 120 125 Gly Gly Gly Lys Asn Ser Thr Thr Ile Glu Ala Asn Phe Ala His Asn 130 135 140 Ser Ser Thr Thr Thr Phe Gln Gln Ala Ser Thr Asp Ile Glu Trp Asn 145 150 155 160 Ile Ser Gln Pro Val Leu Val Pro Pro Ala Lys Gln Val Val Ala Thr 165 170 175 Leu Val Ile Met Gly Gly Asn Phe Thr Ile Pro Met Asp Leu Met Thr 180 185 190 Thr Ile Asp Ser Thr Glu His Tyr Ser Gly Tyr Pro Ile Leu Thr Trp 195 200 205 Ile Ser Ser Pro Asp Asn Ser Tyr Asn Gly Pro Phe Met Ser Trp Tyr 210 215 220 Phe Ala Asn Trp Pro Asn Leu Pro Ser Gly Phe Gly Pro Leu Asn Ser 225 230 235 240 Asp Asn Thr Val Thr Tyr Thr Gly Ser Val Val Ser Gln Val Ser Ala 245 250 255 Gly Val Tyr Ala Thr Val Arg Phe Asp Gln Tyr Asp Ile His Asn Leu 260 265 270 Ala Thr Ile Glu Lys Thr Trp Tyr Ala Arg His Ala Thr Leu His Asn 275 280 285 Gly Lys Lys Ile Ser Ile Asn Asn Val Thr Glu Met Ala Pro Thr Ser 290 295 300 Pro Ile Lys Thr Asn 305 <210> 3 <211> 930 <212> DNA <213> Artificial Sequence - ACh1_1 Nucleotide Sequence <400> 3 atgatttttt tggctatact agatttaaaa tcactggtgt tgaatgcgat caactattgg 60 ggtccgaaaa acaacaacgg tattcagggt ggtgattttg gttacccgat tagcgaaaag 120 cagattgaca ccagcattat tacctctacc cacccgcgtc tgattccgca tgatcttacg 180 atcccgcaga atttggaaac catttttacc actacgcaag tcctgacgaa caacaccgac 240 ctgcagcaaa gccaaaccgt tagctttgct aaaaagacca ctaccacgac ctcgacctct 300 acgacgaacg gctggaccga gggcggcaag atctccgata ccttggagga aaaggtgtcc 360 gtgtctatcc cgttcatcgg cgaaggcggc ggtaagaact ccaccacaat cgaggcgaat 420 ttcgcgcata actcctcaac gaccacattt caacaggcaa gcaccgacat cgagtggaat 480 atttcccaac cggttctggt gccgccgcgc aaacaggttg ttgcgacctt ggttattatg 540 ggtggcaatt tcaccatccc gatggattta atgaccacga tcgacagcac tgagcactac 600 agcggttacc cgatcctgac ctggattagc agcccggata actcctacaa tggcccattc 660 atgagctggt acttcgcgaa ctggccgaat ctgccgagcg gtttcggccc actgaacagc 720 gacaacacgg ttacctatac cggtagcgtt gtctcgcaag tgagcgcggg ggtgtatgcc 780 acggtgcgtt ttgatcagta tgacatccac aatctgcgca ccatcgagaa gacctggtac 840 gcccgtcatg ctaccctgca caacggtaaa aaaatcagca tcaataacgt gaccgaaatg 900 gcaccgacct ctccgatcaa aaccaactaa 930 <210> 4 <211> 930 <212> DNA <213> Artificial Sequence - Nucleotide Sequence of ACh1_4 <400> 4 atgatttttt tggctatact agatttaaaa tccctggttt tgaatgcgat caactactgg 60 ggtccgaaga acaacaacgg catccaaggt ggtgatttcg gttatccgat cagcgaagcc 120 cagattgaca cctcaatcat cacctccacc catccgcgcc tgattccgca cgatttgacc 180 atcccgcaaa acttggaaac catctttacc acgacccagg tactgaccaa caacaccgac 240 ctgcaacaga gccaaaccgt gtcttttgct aaaaagacta ccacgacgac ctctacctct 300 acaacgaacg gctggaccga gggtggcgca atctccgaca ccctggagga aaaggtgagc 360 gtttctatcc cgttcattgg tgaaggcggc ggaaaaaaca gcactacgat tgaagcgaac 420 ttcgcgcaca acagcagcac tacgaccttt cagcaagcga gcaccgatat tgagtggaat 480 atttcccagc cggttctggt gccgcctgca aagcaggtcg tggccactct ggttattatg 540 ggtggtaatt tcaccatacc gatggattta atgaccacga ttgatagcac cgagcactac 600 agcggctacc cgatcctgac ctggattagc agcccggata atagttataa tggtccgttc 660 atgagctggt acttcgccaa ctggccaaat cttccgagcg gctttggccc actgaattct 720 gacaacaccg tgacctatac cggtagcgtg gtctcgcaag tgagcgcggg tgtttatgcg 780 accgttcgtt ttgaccagta cgacatccac aatctcgcga ccatcgagaa aacctggtac 840 gctcgtcatg ctaccctgca taacggcaaa aagatcagca ttaataacgt tacggagatg 900 gcaccgacct caccgattaa aaccaactaa 930 <210> 5 <211> 1992 <212> DNA <213> Promoter prUbi (Zea mays) <400> 5 ctgcagtgca gcgtgacccg gtcgtgcccc tctctagaga taatgagcat tgcatgtcta 60 agttataaaa aattaccaca tatttttttt gtcacacttg tttgaagtgc agtttatcta 120 tctttataca tatatttaaa ctttactcta cgaataatat aatctatagt actacaataa 180 tatcagtgtt ttagagaatc atataaatga acagttagac atggtctaaa ggacaattga 240 gtattttgac aacaggactc tacagtttta tctttttagt gtgcatgtgt tctccttttt 300 ttttgcaaat agcttcacct atataatact tcatccattt tattagtaca tccatttagg 360 gtttagggtt aatggttttt atagactaat ttttttagta catctatttt attctatttt 420 agcctctaaa ttaagaaaac taaactcta ttttagtttt tttatttaat aatttagata 480 taaatagaa taaaataaag tgactaaaaaa ttaaacaaat accctttaag aaattaaaaa 540 aactaaggaa acatttttct tgtttcgagt agataatgcc agcctgttaa acgccgtcga 600 cgagtctaac ggacaccaac cagcgaacca gcagcgtcgc gtcgggccaa gcgaagcaga 660 cggcacggca tctctgtcgc tgcctctgga cccctctcga gagtccgct ccaccgttgg 720 acttgctccg ctgtcggcat ccagaaattg cgtggcggag cggcagacgt gagccggcac 780 ggcaggcggc ctcctcctc tctcacggca ccggcagcta cgggggattc ctttcccacc 840 gctccttcgc tttcccttc tcgcccgccg tataaatag acaccccctc cacaccctct 900 ttccccaacc tcgtgttgtt cggagcgcac acacacacaa ccagatctcc cccaaatcca 960 cccgtcggca cctccgcttc aaggtacgcc gctcgtcctc cccccccccc ctctctacct 1020 tctctagatc ggcgttccgg tccatggtta gggcccggta gttctacttc tgttcatgtt 1080 tgtgttagat ccgtgtttgt gttagatccg tgctgctagc gttcgtacac ggatgcgacc 1140 tgtacgtcag acacgttctg attgctaact tgccagtgtt tctctttggg gaatcctggg 1200 atggctctag ccgttccgca gacgggatcg atttcatgat tttttttgtt tcgttgcata 1260 gggtttggtt tgcccttttc ctttatttca atatatgccg tgcacttgtt tgtcgggtca 1320 tcttttcatg cttttttttg tcttggttgt gatgatgtgg tctggttggg cggtcgttct 1380 agatcggagt agaattctgt ttcaaactac ctggtggatt tattaatttt ggatctgtat 1440 gtgtgtgcca tacatattca tagttacgaa ttgaagatga tggatggaaa tatcgatcta 1500 ggataggtat acatgttgat gcgggtttta ctgatgcata tacagagatg ctttttgttc 1560 gcttggttgt gatgatgtgg tgtggttggg cggtcgttca ttcgttctag atcggagtag 1620 aatactgttt caaactacct ggtgtattta ttaattttgg aactgtatgt gtgtgtcata 1680 catcttcata gttacgagtt taagatggat ggaaatatcg atctaggata ggtatacatg 1740 ttgatgtgggg ttttactgat gcatatacat gatggcatat gcagcatcta ttcatatgct 1800 ctaaccttga gtacctatct attataataa acaagtatgt tttataatta ttttgatctt 1860 gatatacttg gatgatggca tatgcagcag ctatatgtgg atttttttag ccctgccttc 1920 atacgctatt tatttgcttg gtactgtttc ttttgtcgat gctcaccctg ttgtttggtg 1980 ttacttctgc ag 1992 <210> 6 <211> 253 <212> DNA <213> Agrobacterium tumefaciens (Agrobacterium tumefaciens) <400> 6 gatcgttcaa acatttggca ataaagtttc ttaagattga atcctgttgc cggtcttgcg 60 atgattatca tataatttct gttgaattac gttaagcatg tataattaa catgtaatgc 120 atgacgttat ttatgagatg ggtttttatg attagagtcc cgcaattata catttaatac 180 gcgatagaaa acaaatata gcgcgcaaac taggataaat tatcgcgcgc ggtgtcatct 240 atgttactag atc 253 <210> 7 <211> 1026 <212> DNA <213> Hygromycin phosphotransferase gene (Salmonella enterica) <400> 7 atgaaaaagc ctgaactcac cgcgacgtct gtcgagaagt ttctgatcga aaagttcgac 60 agcgtctccg acctgatgca gctctcggag ggcgaagaat ctcgtgcttt cagcttcgat 120 gtaggagggc gtggatatgt cctgcgggta aatagctgcg ccgatggttt ctacaaagat 180 cgttatgttt atcggcactt tgcatcggcc gcgctcccga ttccggaagt gcttgacatt 240 ggggaattca gcgagagcct gacctattgc atctcccgcc gtgcacaggg tgtcacgttg 300 caagacctgc ctgaaaccga actgcccgct gttctgcagc cggtcgcgga ggccatggat 360 gcgatcgctg cggccgatct tagccagacg agcgggttcg gcccattcgg accgcaagga 420 atcggtcaat acactacatg gcgtgatttc atatgcgcga ttgctgatcc ccatgtgtat 480 cactggcaaa ctgtgatgga cgacaccgtc agtgcgtccg tcgcgcaggc tctcgatgag 540 ctgatgcttt gggccgagga ctgccccgaa gtccggcacc tcgtgcacgc ggatttcggc 600 tccaacaatg tcctgacgga caatggccgc ataacagcgg tcattgactg gagcgaggcg 660 atgttcgggg attcccaata cgaggtcgcc aacatcttct tctggaggcc gtggttggct 720 tgtatggagc agcagacgcg ctacttcgag cggaggcatc cggagcttgc aggatcgccg 780 cggctccggg cgtatatgct ccgcattggt cttgaccaac tctatcagag cttggttgac 840 ggcaatttcg atgatgcagc ttgggcgcag ggtcgatgcg acgcaatcgt ccgatccgga 900 gccgggactg tcgggcgtac acaaatcgcc cgcagaagcg cggccgtctg gaccgatggc 960 tgtgtagaag tactcgccga tagtggaaac cgacgcccca gcactcgtcc gagggcaaag 1020 gaatag 1026 <210> 8 <211> 20 <212> DNA <213> Artificial Sequence - Primer 1 for detecting HPT <400> 8 cagggtgtca cgttgcaaga 20 <210> 9 <211> 20 <212> DNA <213> Artificial Sequence - Primer 2 for detecting HPT <400> 9 ccgctcgtct ggctaagatc 20 <210> 10 <211> twenty four <212> DNA <213> Artificial Sequence - Probe 1 for detecting HPT <400> 10 tgcctgaaac cgaactgccc gctg 24

Claims

1. A method for controlling thrips pests, characterized in that, This includes bringing the thrips pest into contact with at least the ACh1 protein; the amino acid sequence of the ACh1 protein is shown in SEQ ID NO:1 or SEQ ID NO:2, and the thrips is the western flower thrips.

2. The method for controlling thrips pests according to claim 1, characterized in that, The ACh1 protein is present in at least the host cells that produce the ACh1 protein, and the thrips pest comes into contact with the ACh1 protein at least by ingesting the host cells.

3. The method for controlling thrips pests according to claim 2, characterized in that, The ACh1 protein is present in at least the bacteria or transgenic plants that produce the ACh1 protein. The thrips pest comes into contact with the ACh1 protein by ingesting the tissues of the bacteria or the transgenic plants. After contact, the growth of the thrips pest is inhibited and / or it leads to death, thereby achieving control of thrips-damaged plants.

4. The method for controlling thrips pests according to claim 3, characterized in that, The genetically modified plants are corn, soybeans, cotton, and rapeseed.

5. The method for controlling thrips pests according to claim 3 or 4, characterized in that, The tissues of the transgenic plant are leaves, stems, fruits, male ears, female ears, anthers, or filaments.

6. The method for controlling thrips pests according to any one of claims 1-4, characterized in that, The nucleotide sequence of the ACh1 protein is shown in SEQ ID NO:3 or SEQ ID NO:

4.

7. The method for controlling thrips pests according to claim 5, characterized in that, The nucleotide sequence of the ACh1 protein is shown in SEQ ID NO:3 or SEQ ID NO:

4.

8. The method for controlling thrips pests according to any one of claims 3, 4, and 7, characterized in that, The genetically modified plant also includes at least one second nucleotide that is different from the nucleotide encoding the ACh1 protein.

9. The method for controlling thrips pests according to claim 8, characterized in that, The second type of nucleotide encodes Cry-type insecticidal proteins, Vip-type insecticidal proteins, protease inhibitors, lectins, α-amylases, or peroxidases.

10. The method for controlling thrips pests according to claim 8, characterized in that, The second nucleotide is a dsRNA that inhibits important genes in the target insect pest.

11. The method for controlling thrips pests according to any one of claims 5, characterized in that, The genetically modified plant also includes at least one second nucleotide that is different from the nucleotide encoding the ACh1 protein.

12. The method for controlling thrips pests according to claim 11, characterized in that, The second type of nucleotide encodes Cry-type insecticidal proteins, Vip-type insecticidal proteins, protease inhibitors, lectins, α-amylases, or peroxidases.

13. The method for controlling thrips pests according to claim 11, characterized in that, The second nucleotide is a dsRNA that inhibits important genes in the target insect pest.

14. The method for controlling thrips pests according to any one of claims 3 or 4, characterized in that, The transgenic plant also includes at least one second nucleotide different from the nucleotide encoding the ACh1 protein, the nucleotide sequence of which is shown in SEQ ID NO:3 or SEQ ID NO:

4.

15. The method for controlling thrips pests according to claim 14, characterized in that, The second type of nucleotide encodes Cry-type insecticidal proteins, Vip-type insecticidal proteins, protease inhibitors, lectins, α-amylases, or peroxidases.

16. The method for controlling thrips pests according to claim 14, characterized in that, The second nucleotide is a dsRNA that inhibits important genes in the target insect pest.

17. An application of ACh1 protein in controlling thrips pests, characterized in that, The amino acid sequence of the ACh1 protein is shown in SEQ ID NO:1 or SEQ ID NO:2, and the thrips is western flower thrips.

18. A method for producing a plant to control thrips, characterized in that, This includes introducing a polynucleotide sequence encoding an ACh1 protein into the genome of the plant, the amino acid sequence of which is shown in SEQ ID NO:1 or SEQ ID NO:2, and the thrips is western flower thrips.

19. A method for producing plant seeds for controlling thrips pests, characterized in that, The method includes hybridizing a first plant obtained by the method of claim 18 with a second plant to produce seeds containing a polynucleotide sequence encoding the ACh1 protein, wherein the thrips is the western flower thrips.

20. A method for cultivating plants to control thrips pests, characterized in that, include: Plant at least one plant seed, the genome of which includes a polynucleotide sequence encoding the ACh1 protein; To allow the plant seeds to grow into plants; The plants are grown under conditions of artificial inoculation with thrips pests and / or natural occurrence of thrips pests, and the plants harvested have reduced plant damage and / or increased plant yield compared to other plants that do not have a polynucleotide sequence encoding the ACh1 protein. The amino acid sequence of the ACh1 protein is shown in SEQ ID NO:1 or SEQ ID NO:2, and the thrips is western flower thrips.

Citation Information

Patent Citations

  • Methods for in vitro recombination

    US5605793A

  • Cotton transgenic event mon 88702 and methods for detection and uses thereof

    US20170166922A1