Virus-like particle and preparation method and application thereof

Abstract

The present invention provides a virus-like particle and a preparation method and application thereof, belonging to the field of agricultural science, animal husbandry and veterinary science and technology. The present invention uses a small ubiquitin-like modified protein as a tag protein to promote the correct folding of viral structural proteins VP0, VP1 and VP3, while ensuring the structural stability of the protein, achieving a large amount of expression of the structural protein, and obtaining a large number of virus-like particles with similar performance to natural viruses after the three structural proteins self-assemble in vitro. After immunogenicity testing, the virus-like particles prepared by the present invention have high immunogenicity and can be used as a reserve vaccine in the prevention and control of the spread of swine vesicular disease or foot-and-mouth disease virus.

Description

Technical Field

[0001] The invention belongs to the field of agricultural science, animal husbandry and veterinary science and technology, and specifically relates to a virus-like particle and a preparation method and application thereof. Background Art

[0002] With the increasing frequency of international exchanges and cooperation, the world is becoming a "global village". In this environment, diseases such as SARS (2002) and the new coronavirus (2019) can easily develop into global pandemics. As a major pig-raising country, my country has a heavy responsibility for the prevention and control of livestock diseases such as pigs, cattle, and sheep. In order to avoid the introduction of diseases from other epidemic areas and countries, or the re-emergence of old diseases, it is imperative to conduct research and vaccine development on epidemic diseases in neighboring countries. There are seven main serotypes of foot-and-mouth disease (FMD). At present, type A and type O FMD are mainly prevalent in my country. In recent years, South African type (SAT) FMD has not only caused economic losses to sub-Saharan African countries, but has also gradually spread to Europe and other countries, threatening the development of local animal husbandry. Swine vesicular disease virus (SVDV) is a contagious viral disease of pigs. It causes vesicular lesions that are difficult to distinguish from observed foot-and-mouth disease. Infection with SVDV can lead to viremia within 1 day, and clinical symptoms can appear 2 days after pigs come into contact with infected pigs or virus-contaminated environments. The virus can be detected by immunohistochemistry 3 to 5 hours after infection. Physical and chemical analysis of the virus showed that it is different from foot-and-mouth disease, vesicular stomatitis and vesicular exanthema viruses, and is very similar to viruses of the genus Enterovirus of the Picornaviridae family. In the context of international exchanges in the "global village", the development of vaccines to prevent the introduction of epidemic diseases or reserve vaccines is essential. Virus-like particles (VLPs) are a new type of genetically engineered subunit that has emerged in recent years. Their advantages include not containing the genetic material necessary for viral replication and superior biosafety; they can simulate the natural structure of the virus so that conformation-dependent antigenic epitopes can be correctly presented; they can bind to cell surface receptors and enter cells like natural virus particles, thereby inducing a strong immune response; they can be artificially modified by inserting or deleting certain amino acid sequences as needed without affecting the structure of VLPs, thereby achieving the multi-effect characteristics of simultaneous immunity to multiple viruses, etc. Therefore, VLPs are considered to be the best candidate vaccine form that can replace whole virus vaccines. However, there are no reports on methods for preparing virus-like particles. Summary of the invention

[0003] In view of this, the object of the present invention is to provide a virus-like particle and a preparation method and application thereof, which have the advantages of high yield and good immunogenicity.

[0004] The present invention provides a method for preparing virus-like particles, comprising the following steps:

[0005] 1) The viral structural protein genes VP0, VP1 and VP3 were fused with the small ubiquitin-like modifier protein gene sequence, and the resulting fusion genes were cloned into the pET-28a vector to obtain pET / VP0-VP1 and pET / VP3;

[0006] The viruses include swine vesicular disease virus and / or South African foot-and-mouth disease virus;

[0007] 2) replacing the kanamycin resistance gene in the pET / VP3 described in step 1) with the ampicillin resistance gene to obtain pETa / VP3;

[0008] 3) co-transforming the pET / VP0-VP1 described in step 1) and the pETa / VP3 described in step 2) into a prokaryotic expression system, and isolating and obtaining three small ubiquitination-modified protease-cleaved fusion proteins through recombinant expression;

[0009] 4) The three small ubiquitination-modified proteases described in step 3) are enzymatically cleaved from the fusion proteins to remove the small ubiquitination-modified tag proteins, and VP0, VP1 and VP3 recombinant proteins are collected and assembled in vitro to obtain virus-like particles.

[0010] Preferably, the nucleotide sequence of the small ubiquitin-like modifier protein gene in step 1) is as shown in SEQ ID NO:1.

[0011] Preferably, the multiple cloning sites of the pET-28a vector in step 1) are Sal I / BamHI and HindIII / XhoI restriction sites.

[0012] The invention provides virus-like particles prepared by the preparation method, wherein the virus-like particles are composed of virus structural proteins VP1, VP0 and VP3.

[0013] Preferably, when the virus is swine vesicular disease virus, the amino acid sequence of VP0 is shown in SEQ ID NO:18; the amino acid sequence of VP1 is shown in SEQ ID NO:19; and the amino acid sequence of VP3 is shown in SEQ ID NO:20.

[0014] Preferably, the virus is South African foot-and-mouth disease virus;

[0015] The South African foot-and-mouth disease virus includes one or more of the following serotypes of foot-and-mouth disease virus: SAT1 foot-and-mouth disease virus, SAT2 foot-and-mouth disease virus and SAT3 foot-and-mouth disease virus;

[0016] Preferably, the amino acid sequence of VP0 of the SAT1 type foot-and-mouth disease virus is shown in SEQ ID NO: 21; the amino acid sequence of VP1 is shown in SEQ ID NO: 22; the amino acid sequence of VP3 is shown in SEQ ID NO: 23;

[0017] The amino acid sequence of VP0 of the SAT2 type foot-and-mouth disease virus is shown in SEQ ID NO: 24; the amino acid sequence of VP1 is shown in SEQ ID NO: 25; and the amino acid sequence of VP3 is shown in SEQ ID NO: 26;

[0018] The amino acid sequence of VP0 of the SAT3 type foot-and-mouth disease virus is shown in SEQ ID NO:27; the amino acid sequence of VP1 is shown in SEQ ID NO:28; and the amino acid sequence of VP3 is shown in SEQ ID NO:29.

[0019] The present invention provides the use of the virus-like particles in preparing vaccines for preventing and controlling viral diseases, wherein the viral diseases include swine vesicular disease and / or foot-and-mouth disease.

[0020] The present invention provides a virus-like particle vaccine for preventing and controlling viral diseases, comprising the virus-like particles and an adjuvant.

[0021] The preparation method of the virus-like particles provided by the present invention uses small ubiquitin-like modified protein as a tag protein to promote the correct folding of swine vesicular disease virus structural proteins VP0, VP1 and VP3, while ensuring the structural stability of the protein, achieving a large amount of expression of the structural protein, and obtaining a large number of virus-like particles with similar performance to natural swine vesicular disease virus after in vitro self-assembly of the three structural proteins. After immunogenicity testing, the virus-like particles prepared by the present invention have high immunogenicity and can be used as a reserve vaccine in the prevention and control of the spread of swine vesicular disease virus. BRIEF DESCRIPTION OF THE DRAWINGS

[0022] Figure 1 The results of SDS-PAGE detection of SVDV recombinant capsid protein, lane 1: fusion tag protein, lane 2: SVDV capsid protein;

[0023] Figure 2 The electron microscopic photograph of the SVDV recombinant virus reported in the literature (a) and the electron microscopic photograph of the SVDV virus-like particles prepared by the present invention (b);

[0024] Figure 3 The particle size distribution of the SVDV virus-like particles prepared by the present invention;

[0025] Figure 4 This is a fluorescence signal image of virus-like particles identified by IFA method;

[0026] Figure 5 The results of ELISA antibody level test in the serum of pigs immunized with SVDV virus-like particles;

[0027] Figure 6 The results of SDS-PAGE detection of SAT1, SAT2, and SAT3 foot-and-mouth disease capsid proteins;

[0028] Figure 7 The particle size distribution of the SAT-type foot-and-mouth disease virus-like particles prepared by the present invention;

[0029] Figure 8 This is an electron microscope photo of the SAT-type foot-and-mouth disease virus-like particles prepared by the present invention;

[0030] Fig. 9 The method adopts IFA to detect the guinea pig immune serum antibody of SAT type foot-and-mouth disease virus-like particles prepared by the present invention. DETAILED DESCRIPTION

[0031] The present invention provides a method for preparing virus-like particles, comprising the following steps:

[0032] 1) The viral structural protein genes VP0, VP1 and VP3 were fused with the small ubiquitin-like modifier protein gene, respectively, and the resulting fusion genes were cloned into the pET-28a vector to obtain pET / VP0-VP1 and pET / VP3;

[0033] The viruses include swine vesicular disease virus and / or South African foot-and-mouth disease virus;

[0034] 2) replacing the kanamycin resistance gene in the pET / VP3 with the ampicillin resistance gene to obtain pETa / VP3;

[0035] 3) co-transforming the pET / VP0-VP1 described in step 1) and the pETa / VP3 described in step 3) into a prokaryotic expression system, and isolating and obtaining three small ubiquitination-modified protease-cleaved fusion proteins through recombinant expression;

[0036] 4) The three small ubiquitination-modified proteases described in step 3) are enzymatically cleaved from the fusion proteins to remove the small ubiquitination-modified tag proteins, and VP0, VP1 and VP3 recombinant proteins are collected and assembled in vitro to obtain virus-like particles.

[0037] The present invention fuses viral structural protein genes VP0 gene, VP1 gene and VP3 gene with small ubiquitin-like modified protein sequences respectively, and clones them into pET-28a vectors respectively to obtain pET / VP0-VP1 and pET / VP3; the viruses include swine vesicular disease virus and / or South African foot-and-mouth disease virus.

[0038] In the present invention, the fusion is preferably a seamless fusion, and the fusion gene is formed in the order of small ubiquitin-like modifier protein gene sequence-structural protein gene. The nucleotide sequence of the small ubiquitin-like modifier protein is shown in SEQ ID NO: 1, and the amino acid sequence of the small ubiquitin-like modifier protein is shown in SEQ ID NO: 30. The multiple cloning site of the pET-28a vector is preferably SalI / BamHI (VP0 or VP3) and HindIII / Xho I (VP1) restriction site. The present invention has no special restrictions on the cloning method, and the cloning method well known in the art can be used. After cloning, the obtained vector is verified. The present invention has no special restrictions on the verification method of the vector, and the verification method of the recombinant vector well known in the art can be used. The present invention has no special restrictions on the source of the pET-28a vector, and the pET-28a vector well known in the art can be used. In an embodiment of the present invention, the pET-28a vector is purchased from Qingke Biotechnology Co., Ltd.

[0039] In the present invention, the multiple cloning sites of VP0 gene and VP3 gene in pET-28a vector are preferably Sal I / BamHI, and the multiple cloning site of VP1 gene fragment in pET-28a vector is preferably Hind III / Xho I. The present invention has no special restrictions on the cloning method, and the method well known in the art can be used. After cloning, the obtained vector is preferably verified. The present invention has no special restrictions on the verification method of the vector, and the verification method of the recombinant vector well known in the art can be used.

[0040] After obtaining pET / VP3, the present invention replaces the kanamycin resistance gene in the pET / VP3 with the ampicillin resistance gene to obtain the vector pETa / VP3.

[0041] In the present invention, the method for replacing the kanamycin resistance gene in the pET / VP3 with the ampicillin resistance gene is preferably as follows: design two pairs of homologous recombination primers, wherein the ampicillin resistance gene primer: F: CAGTAATACAAGGGGTGTTATGTTACCAATGCTTAATCAGTGA GG (SEQ ID NO: 14); R: ATCCGCTCATGAATTAATTCTTAATGAGTATT CAACATTTCCGTG (SEQ ID NO: 15); PET28a linearization primer: F: CGGAAA TGTTGAATACTCATTAAGAATTAATTCATGAGCGGATAC (SEQ ID NO: 16), R: CCTCACTGATTAAGCATTGGTAACATAACACCCCTTGTAT TACTG (SEQ ID NO: 17). The role of replacing the resistance gene is to perform double resistance screening to ensure uniform expression of capsid proteins VP0, VP1, and VP3.

[0042] After obtaining pET / VP0-VP1 and pETa / VP3, the present invention co-transforms the pET / VP0-VP1 and the pETa / VP3 into a prokaryotic expression system, and separates and obtains three small ubiquitination-modified protease-cleaved fusion proteins through recombinant expression.

[0043] The present invention has no special limitation on the prokaryotic expression system, and the methods of the prokaryotic expression system well known in the art can be used. For example, in the embodiment of the present invention, the prokaryotic expression system is BL21 (DE3). During the co-transformation, the copy number ratio of the pET / VP0-VP1 and pETa / VP3 is preferably 1-3:1-3, and more preferably 1.5:1. In the recombinant expression method, the transformed prokaryotic expression system is preferably screened for positive clones by kanamycin and ampicillin, and the positive clones are picked for double-antibody culture. The two bacterial solutions after culture are mixed and then high-density fermentation culture and induced expression are carried out. The culture temperature is preferably 36-38°C, and more preferably 37°C; the shaking speed of the culture is preferably 800rpm. The OD of the bacterial solution before inducing expression 600nm When the temperature is about 40, the expression is induced. The temperature of the induced expression is preferably 20-37°C, more preferably 30°C. The final concentration of IPTG during the induced expression is preferably 1mM. The separation is preferably centrifuged to break the bacterial cells, collect the supernatant and mix it with Ni-NTAHis·Bind Resins, and obtain the small ubiquitinated protease fusion expression protein after elution.

[0044] After obtaining the small ubiquitinated protease-cleaved fusion expression protein, the present invention uses the three small ubiquitinated proteases to remove the small ubiquitinated tag protein, collects VP0, VP1 and VP3 recombinant proteins, and assembles them in vitro to obtain virus-like particles.

[0045] In the present invention, the method for removing small ubiquitinated modified tag proteins preferably includes enzymatic cleavage with small ubiquitinated modified protease. The enzymatic cleavage system is preferably a mixture of 100 ml of enzymatic cleavage buffer per 1 mg of the fusion protein. The solution after enzymatic cleavage preferably uses a HisTrap HP chromatographic column to remove small ubiquitinated modified tag proteins. The composition of the elution solution is preferably 20 mM Tris-HCl, 300 mM NaCl, pH 8.0. During the in vitro assembly, the mass ratio of VP0, VP1 and VP3 recombinant proteins is 1:1:1. The assembly buffer used is preferably 20 mM Tris-HCl, 500 mM NaCl, pH 8.0. The temperature of the in vitro assembly is preferably 3 to 5 ° C, more preferably 4 ° C. The time of the in vitro assembly is preferably 10 to 14 h, more preferably 12 h. After the in vitro assembly is completed, it is preferred to use an ultrafiltration tube to concentrate the assembled solution and collect the retentate. The molecular weight cutoff of the ultrafiltration tube is preferably 100 KD.

[0046] In the present invention, sucrose density gradient separation is used to separate virus-like particles: 1.0 ml of liquid containing virus-like particles (mutated and unmutated) is placed on the top layer of a sucrose gradient with a concentration of 15% to 45%, and centrifuged at 38,000 rpm and 4°C for 3.5 hours. Samples from 20 layers are collected for detection. The collected samples are detected in a UV detector (259 nm) by a continuous sampling method, and the 13th tube sample is taken for DLS detection to obtain the particle size of the virus-like particles.

[0047] The virus-like particles prepared by the preparation method provided by the present invention are composed of swine vesicular disease virus structural proteins VP1, VP0 and VP3, with a diameter mainly distributed between 20 and 30 nm, a complete morphology, and a size similar to that of natural virus particles. When the virus is swine vesicular disease virus, the amino acid sequence of VP0 is shown in SEQ ID NO: 18; the amino acid sequence of VP1 is shown in SEQ ID NO: 19; and the amino acid sequence of VP3 is shown in SEQ ID NO: 20. The virus is a South African foot-and-mouth disease virus; the South African foot-and-mouth disease virus includes one or more of the following serotypes of foot-and-mouth disease virus: SAT1 foot-and-mouth disease virus, SAT2 foot-and-mouth disease virus, and SAT3 foot-and-mouth disease virus. The amino acid sequence of VP0 of the SAT1 type foot-and-mouth disease virus is shown in SEQ ID NO:21; the amino acid sequence of VP1 is shown in SEQ ID NO:22; the amino acid sequence of VP3 is shown in SEQ ID NO:23; the amino acid sequence of VP0 of the SAT2 type foot-and-mouth disease virus is shown in SEQ ID NO:24; the amino acid sequence of VP1 is shown in SEQ ID NO:25; the amino acid sequence of VP3 is shown in SEQ ID NO:26; the amino acid sequence of VP0 of the SAT3 type foot-and-mouth disease virus is shown in SEQ ID NO:27; the amino acid sequence of VP1 is shown in SEQ ID NO:28; the amino acid sequence of VP3 is shown in SEQ ID NO:29.

[0048] In view of the high immunogenicity of virus-like particles, the present invention provides the use of the virus-like particles in the preparation of vaccines for preventing and controlling viral diseases. The viral diseases preferably include foot-and-mouth disease or swine vesicular disease.

[0049] The present invention provides a virus-like particle vaccine for preventing and controlling viral diseases, comprising the virus-like particles and an adjuvant. The content of the adjuvant is preferably 50% V / V. The swine vesicular virus-like particle antigen content is 100 μg / head portion. The present invention has no special restrictions on the preparation method of the vaccine, and the preparation method of the vaccine known in the art can be adopted. The vaccine is used for immunogenicity detection of various viruses. The viral disease preferably includes foot-and-mouth disease or swine vesicular disease.

[0050] The virus-like particles and the preparation method and application thereof provided by the present invention are described in detail below in conjunction with the embodiments, but they should not be construed as limiting the protection scope of the present invention.

[0051] Example 1

[0052] (1) Construction of recombinant vector of swine vesicular virus VP0, VP1, and VP3 genes fused with small ubiquitinated proteins:

[0053] a. According to the published sequence of SVDV (GenBank accession number: D16364.1), the nucleotide sequence of the SVDV structural protein VP0 gene (SEQ ID NO: 2), the nucleotide sequence of the VP1 gene (SEQ ID NO: 3), and the nucleotide sequence of the VP3 gene (SEQ ID NO: 4) were codon optimized with reference to the method of Hoover et al. (Hoover DM1, Lubkowski J. DNA Works: an automated method for designing oligonucleotides for PCR-based genesynthesis. Nucl. Acids Res. (2002) 30 (10): e43.), and the optimized gene sequences were seamlessly fused with the small ubiquitination modified protein gene (SEQ ID NO: 1) by GenScript, and cloned into the pET-28a vector using Sal I / BamHI and Hind III / Xho I endonucleases, respectively, to obtain pET / VP0-VP1 and pET / VP3;

[0054] (2) Expression and purification of SVDV antigen protein:

[0055] a. The constructed pET / VP0-VP1 and pETa / VP3 plasmids were co-transformed into BL21(DE3) E. coli competent cells, and single colonies were obtained by double resistance screening of ampicillin and kanamycin. Single clones were selected into double resistance LB culture concentrate, cultured at 37°C and 230rpm for 12h, aliquoted, added with glycerol LB culture medium and frozen at -80°C to obtain seed bank.

[0056] b. Inoculate the strain containing the SVDV plasmid in step a into 50 ml of LB medium containing dual resistance to kanamycin and ampicillin, culture at 37°C and 230 rpm for 12 h, then transfer to 500 ml of LB medium containing the same resistance and culture at 37°C to prepare seeds for fermentation.

[0057] c. Use a 30L fermenter, prepare 10L culture medium in the fermenter, sterilize at 121℃ for 30min, wait for the culture medium temperature to drop to 37℃, inoculate 500ml of seeds into the fermenter, and wait until the bacterial solution concentration reaches OD 600 When the value was about 40, 0.5 g IPTG was added to induce the culture for 6 h, and the culture was terminated and the bacteria were collected by centrifugation.

[0058] d. Resuspend the cells in ice bath lysis solution (20mM Tris-HCl, 500mM NaCl, 20mM imidazole, pH7.4), crush them 4 times with a high pressure homogenizer at 1000bar pressure, centrifuge at 10,000×g for 30min, take the supernatant, discard the precipitate, purify the supernatant by chromatography, detect the target protein by SDS-PAGE electrophoresis, and store at -70℃ ( Figure 1 ).

[0059] (3) In vitro assembly of SVDV virus-like particles

[0060] a. The fusion protein was cleaved by small ubiquitination-modified protease according to the following method and ratio: 1 mg of the above-purified fusion protein, 100 mL of cleavage buffer (50 mM Tris-HCl, 150 mM NaCl, pH 8.0, 0.2% Igepal (NP-40), 1 mM DTT), 10 μL of small ubiquitination-modified protease (1 U / μL), and cleavage at 37°C for 30 min. The cleavage mixture was removed by HisTrap HP to remove the small ubiquitination-modified tag protein, and the flow-through containing VP0, VP1 and VP3 was collected and assembled in assembly buffer (20 mM Tris-HCl, 500 mM NaCl, pH 8.0) at 4°C overnight to assemble VLPs. The samples were detected by SDS-PAGE electrophoresis ( Figure 1 ).

[0061] b. Place 1 ml of the sample containing virus-like particles prepared above on the top layer of a 15% to 45% linear sucrose gradient, centrifuge at 38,000 rpm and 4°C for 3.5 h, collect 20 samples, 500 μl / sample, and then use a continuous sampling method to detect them with an ultraviolet detector (280 nm), draw a spectrum, and then take the peak sample for DLS to detect water and particle size. The results are as follows Figure 3 As shown, the particle size of the virus-like particles prepared by the present invention is mainly distributed in the range of 10 to 30 nm.

[0062] c. Add 10 μL of the peak sample in step b to a 200-mesh copper grid and adsorb at room temperature for 10 min. Use filter paper to absorb the remaining liquid on the copper grid and then stain with 3% phosphotungstic acid. Use Hitachi, H-7100FA transmission electron microscope to observe the morphology of VLPs. Figure 2 As shown, the diameter of virus-like particles assembled under this condition is mainly distributed between 20 and 30 nm ( Figure 2 b), its morphology and size are similar to those of the SVDV recombinant virus reported in the literature ( Figure 2 a).

[0063] Example 2

[0064] Analysis of immunogenicity of SVDV virus-like particles

[0065] Eight healthy pigs weighing about 20 kg and negative for SVDV, FMDV, and SVA antibodies were selected and randomly divided into three groups, with 3 pigs / group in the experimental group and 2 pigs in the control group, wherein Group 1 was the immunization group of the porcine vesicular virus-like particle vaccine prepared in Example 1 of the present invention, Group 2 was the immunization group of the porcine vesicular virus VP1 protein, and Group 3 was the PBS control group. 100 μg of antigen was emulsified with an equal volume of 206 adjuvant and injected intramuscularly into the neck for immunization, and blood was collected before immunization and on the 7th, 14th, 21st, and 28th days after immunization, and serum was separated.

[0066] Since there is no SVDV positive serum and antigen in China, the present invention uses the IFA method to identify whether specific antibodies against VP1 are produced. The specific operation is as follows: The SVDVVP1 capsid protein gene is synthesized into the pCMV-N-Flag vector by gene synthesis, and named pCMV-N-Flag-VP1. The plasmid is then transfected into BHK cells, and the cell samples are collected after 36 hours, fixed with 4% paraformaldehyde (PFA) at room temperature for 15 minutes; washed 3 times with PBST (PBS + 0.1% Tween-20); treated with 0.1% TritonX-100 (PBS + 0.1% TritonX-100) at room temperature for 15 minutes to destroy the cell membrane; washed 3 times with PBST (PBS + 0.1% Tween-20); incubated in a 37°C constant temperature incubator with 5% NBS (PBS + 5% NBS) for 1 hour to block nonspecific binding; diluted in 5% The cells were incubated with the primary antibody (1:100 or 1:200, the specific dilution concentration is to be explored) in NBS (SVDVVLPs polyclonal antibody was used as the primary antibody) at 37°C for 1 h (or 4°C overnight); washed 5 times with PBST (PBS + 0.1% Tween-20); the cells were incubated with the fluorescently labeled secondary antibody (1:400 or 1:500, the specific dilution concentration is to be explored) diluted in 5% NBS (anti-mouse FITC antibody) at 37°C for 1 h (or 4°C overnight); washed 5 times with PBST (PBS + 0.1% Tween-20); the fluorescence intensity was observed under a fluorescence microscope.

[0067] Specific test results such as Figure 4 The cells transfected with pCMV-N-Flag-VP1 (containing SVDVVP1 gene) plasmid had obvious fluorescence signals, indicating that SVDV VLPs-immunized pigs produced SVDV-specific antibodies.

[0068] Antibody levels were tested using the ELISA kit for swine vesicular disease virus antibodies produced by Shinuoda Biotechnology. Figure 5 As shown: The serum antibody level of pigs in the virus-like particle immunization group was significantly higher than that in the VP1 protein immunization group, and the antibody level was the highest 28 days after immunization. This result shows that the assembly of capsid protein is more conducive to antigen presentation and enhances immune response.

[0069] Example 3

[0070] Preparation method of SAT1, SAT2 and SAT3 type foot-and-mouth disease virus-like particles

[0071] (1) Based on the published sequences of SAT (1, 2, 3) foot-and-mouth disease virus (GenBank accession numbers: SAT1: KR108962.1; SAT2: AJ251473; SAT3: MK415736.1), the nucleotide sequences of SAT1 and SAT3 foot-and-mouth disease virus VP0, VP1, and VP3 are as follows:

[0072] The VP0 nucleotide sequence of SAT1 type foot-and-mouth disease is shown in the sequence listing as SEQ ID NO:5;

[0073] The nucleotide sequence of VP1 of SAT1 type foot-and-mouth disease is shown in the sequence listing as SEQ ID NO:6;

[0074] The nucleotide sequence of VP3 of SAT1 type foot-and-mouth disease is shown in the sequence listing as SEQ ID NO:7;

[0075] The VP0 nucleotide sequence of SAT3 type foot-and-mouth disease is shown in the sequence listing as SEQ ID NO: 11;

[0076] The nucleotide sequence of VP1 of SAT3 type foot-and-mouth disease is shown in the sequence listing as SEQ ID NO: 12;

[0077] The VP3 nucleotide sequence of SAT3 type foot-and-mouth disease is shown in the sequence listing SEQ ID NO:13.

[0078] Codon optimization was performed on the structural protein genes VP0, VP3 and VP1 respectively.

[0079] According to the method described in Example 1, a recombinant vector of three foot-and-mouth disease virus VP0, VP1, and VP3 genes fused with small ubiquitinated modified proteins was constructed.

[0080] The nucleotide sequences of SAT2-type foot-and-mouth disease VP0, VP1, and VP3 are as follows:

[0081] The VP0 nucleotide sequence of SAT2 foot-and-mouth disease is shown in the sequence listing as SEQ ID NO:8;

[0082] The nucleotide sequence of VP1 of SAT2 type foot-and-mouth disease is shown in the sequence listing as SEQ ID NO:9;

[0083] The VP3 nucleotide sequence of SAT2 type foot-and-mouth disease virus is shown in the sequence listing as SEQ ID NO:10.

[0084] (2) Expression and purification of SAT1, SAT2 and SAT3 foot-and-mouth disease capsid proteins

[0085] a. The expression vector pET / VP0-VP1 and pETa / VP3 plasmids of SAT foot-and-mouth disease were co-transformed into BL21 (DE3) E. coli competent cells, and single colonies were obtained by double resistance screening of ampicillin and kanamycin. Single clones were selected into double resistance LB culture concentrate, cultured at 37°C and 230rpm for 12h, and then aliquoted and added to glycerol LB culture base and frozen at -80°C to obtain SAT1, SAT2, and SAT3 glycerol bacterial seed banks.

[0086] b. Inoculate the strain containing the SAT plasmid in step a into 50 ml of LB medium containing dual resistance to kanamycin and ampicillin, culture at 37°C and 230 rpm for 12 h, then transfer to 500 ml of LB medium containing the same resistance and culture at 37°C to prepare seeds for fermentation.

[0087] c. Use a 30L fermenter, prepare 10L culture medium in the fermenter, sterilize at 121℃ for 30min, wait for the culture medium temperature to drop to 37℃, inoculate 500ml of seeds into the fermenter, and wait until the bacterial solution concentration reaches OD 600 When the value was about 40, 0.5 g IPTG was added to induce the culture for 6 h, and the culture was terminated and the bacteria were collected by centrifugation.

[0088] d. Resuspend the cells in ice-bath lysis solution (20 mM Tris-HCl, 500 mM NaCl, 20 mM imidazole, pH 7.4), break them four times with a high-pressure homogenizer at 1000 bar, centrifuge at 10,000 × g for 30 min, take the supernatant, discard the precipitate, purify the supernatant by chromatography, detect the target protein by SDS-PAGE electrophoresis, and store at -70°C.

[0089] (3) In vitro assembly of SAT1, SAT2, and SAT3 FMDV-like particles

[0090] a. The fusion protein was cleaved by small ubiquitination-modified protease according to the following method and ratio: 1 mg of the above-purified fusion protein, 100 mL of cleavage buffer (50 mM Tris-HCl, 150 mM NaCl, pH 8.0, 0.2% Igepal (NP-40), 1 mM DTT), 10 μL of small ubiquitination-modified protease (1 U / μL), and cleavage at 37°C for 30 min. The cleavage mixture was removed by HisTrap HP to remove the small ubiquitination-modified tag protein, and the flow-through containing VP0, VP1 and VP3 was collected and assembled in assembly buffer (20 mM Tris-HCl, 500 mM NaCl, pH 8.0) at 4°C overnight to assemble VLPs. The samples were detected by SDS-PAGE electrophoresis ( Figure 6 ).

[0091] b. Place 1 ml of the sample containing virus-like particles prepared above on the top layer of a 15% to 45% linear sucrose gradient, centrifuge at 38,000 rpm and 4°C for 3.5 h, collect 20 samples, 500 μl / sample, and then use a continuous sampling method to detect them with an ultraviolet detector (280 nm), draw a spectrum, and then take the peak sample for DLS to detect water and particle size. The results are as follows Figure 7 As shown, the particle size of the virus-like particles prepared by the present invention is mainly distributed in the range of 10 to 30 nm.

[0092] c. Add 10 μL of the peak sample in step b to a 200-mesh copper grid and adsorb at room temperature for 10 min. Use filter paper to absorb the remaining liquid on the copper grid and then stain with 3% phosphotungstic acid. Use Hitachi, H-7100FA transmission electron microscope to observe the morphology of VLPs. Figure 8 As shown, the diameters of virus-like particles assembled under this condition are mainly distributed between 20 and 30 nm.

[0093] (4) Identification of SAT1, SAT2, and SAT3 foot-and-mouth disease virus-like particles in mouse sera

[0094] (a) The obtained SAT1, SAT2, and SAT3 FMDV VLPs were used to immunize Babl / c mice, and the immunization was boosted two weeks later. The blood of the mice was collected 28 days after immunization, and the serum was separated and frozen in a -20°C refrigerator for later use. They were named SAT1, SAT2, and SAT3 FMDV VLPs polyclonal antibodies, respectively.

[0095] (b) Since there are no SAT1, SAT2, and SAT3 foot-and-mouth disease pathogens in China, the IFA method was used to identify whether specific antibodies were produced. The specific operation was as follows: The VP1 capsid protein gene of SAT1, SAT2, and SAT3 FMDV was synthesized into the pCMV-N-Flag vector by gene synthesis, named pCMV-N-Flag-VP1. The plasmid was then transfected into BHK cells. After 36 hours, the cell samples were collected and fixed with 4% paraformaldehyde (PFA) at room temperature for 15 minutes; washed three times with PBST (PBS + 0.1% Tween-20); treated with 0.1% TritonX-100 (PBS + 0.1% TritonX-100) at room temperature for 15 minutes to destroy the cell membrane; washed three times with PBST (PBS + 0.1% Tween-20); incubated in a 37°C constant temperature incubator with 5% NBS (PBS + 5% NBS) for 1 hour to block nonspecific binding; incubated with the primary antibody diluted in 5% NBS (1:100 or 1:200, the specific dilution concentration is to be explored) (the primary antibody used is SAT1, SAT2, SAT3FMDV VLPs polyclonal antibody), treated at 37℃ for 1h (or 4℃ overnight); washed 5 times with PBST (PBS+0.1% Tween-20); incubated with fluorescent labeled secondary antibody (1:400 or 1:500, the specific dilution concentration is to be explored) diluted in 5% NBS (anti-mouse FITC antibody), 37℃ for 1h (or 4℃ overnight); washed 5 times with PBST (PBS+0.1% Tween-20); and then observed the fluorescence quantity under a fluorescence microscope.

[0096] The results are as follows Fig. 9 The results showed that cells transfected with pCMV-N-Flag-VP1 (containing SAT1, SAT2 or SAT3 FMDV VP1 gene) plasmids had obvious fluorescence signals, indicating that the corresponding VLPs-immunized mice produced SAT1, SAT2, SAT3 FMDV-specific antibodies.

[0097] The above is only a preferred embodiment of the present invention. It should be pointed out that for ordinary technicians in this technical field, several improvements and modifications can be made without departing from the principle of the present invention. These improvements and modifications should also be regarded as the scope of protection of the present invention. Sequence Listing <110> Lanzhou Veterinary Research Institute, Chinese Academy of Agricultural Sciences <120> Virus-like particle and preparation method and application thereof <160> 30 <170> SIPOSequenceListing 1.0 <210> 1 <211> 291 <212> DNA <213> Artificial Sequence <400> 1 60. atgggtcatc accatcatca tcattctgac gaaaagaagg gaggtgac cgagcacatc aacctgaagg tcctcggcca ggacaacgcc gtcgtccagt tcaagatcaa gaagcacaca cccttgagga agctgatgaa cgcctactgc gaccgtgccg gactctccat gcaggtggtg cgcttccgtt tcgacggaca gcccatcaac gagacgaca ctccgacctc gctggagatg 240 gaggagggcg acaccatcga ggtttaccag cagcagactg gtggcgctcc a <210> 2 <211> 990 <212> DNA <213> Artificial Sequence <400> 2 atgggagctc aggtgtcaac acaaaagacc ggtgctcatg agaccagctt gagtgcagcg ggcaactcag tcattcatta cacaaacata aactactaca aggatgctgc ttcaaattca gcaatagac aagacttcgc acaggacccg gggaagttca ccgaacctgt gaaagacatc atggtcaaat ctatgcctgc cctcaattcc ccatcagcag aggagtgtgg ctacagcgac agggtagat ccatcacctt agggaattca accatacaa ctcaagaatg tgcaacgtg 300 gtggttggat atggggtgtg gccaacttac ttgaaggatg agaggcaac agcagaggat 360 caacccactc aaccagatgt ggccacgtgc aggttttaca cgctcgaatc tgtgatgtgg 420 cacagagtt caccaggctg gtggtggaag ttccctgacg cgttgtccaa catggggcta 480 ttgggcaaa atatgcagta ccactacctt gggagagccg ggtacacgat acacgtgcag 540 tgcaacgcgt ccaatttca ccaagggtgt ctgctggtgg tatgtgtgcc agaagcagaa 600 atggggtgtg ccacgttggc caataagcct gaccaaaa gcctgagtaa agggaaata 660 gccaacatgt ttgaatccca aaactccacc ggggaaacgg ccgtgcaagc taatgtgatc 720 aatgctggca tgggtgttgg tgttggtaat ctaactatct tcccatca gtggatcac 780 ttgcgcacta acacagcgc tacgattgtc atgccatata taacagcgt gcccatggac 840 aacatgttca gatacacaa ttttacactc atggccatcc cgttcgcccc actgagctac 900 agcacagggg ctaccacgta cgtaccaatc actgtgacag tggcgccaat gtgcgctgaa 960 tataatgggc tgcgtctagc cggtaaacaa 990 <210> 3 <211> 849 <212> DNA <213> Artificial Sequence <400> 3 gggcccccag gagaggtgat ggaaagagcc attgcccgcg tcgctgatac tactgggagc 60 ggaccagtta actcggaatc cattccagct ctaaccgccg cagagacagg gcacacgtca 120 caagttgtac catcagacac aatgcaaact aggcacgtga agaattacca ttcaaggtca 180 gagtcgacag tggagaactt cctgtgcaga tctgcatgcg ttttctacac cacatacaag 240 aaccatgact ctgatggcga caacttcgcc tactgggtga tcaacacacg gcaagttgct 300 caactgcgtc ggaagctcga aatgttcacg tacgcaagat ttgatctgga gttgaccttc 360 gtgatcacta gcactcagga acagtccacc gttcaaggtc aagatacacc agtgctcacc 420 caccaaataa tgtatgtacc tccaggtggc ccagtgccca caaaggtaaa cagctacagc 480 tggcaaacgt ccaccaaccc gagtgtgttc tggacggaag ggagcgcacc gcctcgaatg 540 tcgataccat tcattggcat aggcaacgca tacagcatgt tctatgacgg gtgggccagg 600 tttgacaagc aagggacata cggcatcagc acactaaaca acatggggac actatatatg 660 agacatgtga atgatggggg tcccggtccc attgtgagca cagtacgaat ttacttcaag 720 ccaaagcacg tcaaaacgtg ggtcccaaga ccgcccagac tatgtcaata tcaaaaggct 780 ggcaacgtga attttaaacc cactggtgtg actgagggta ggacagatat aacaaccatg 840 aaaaccact 849 <210> 4 <211> 714 <212> DNA <213> Artificial Sequence <400> 4 ggtttaccaa cgctgtcgac acccgggagc aaccagtttc tcacgtccga tgacttccag 60 tcaccatcag ccatgccaca attcgatgtc actcctgaga tggatattcc aggacaagtc 120 aacaacttga tggagattgc agaagtagat tctgtggtgc cagtaaacaa cacagaaggg 180 aaagtgatgt caattgaggc gtaccagata cctgtgcaat cgaatccaac caacggttct 240 caggtttttg ggttcccatt gaccccaggg gccaatagtg tgttaaacag gactttgctg 300 ggagaaatct taaactacta tgcccattgg tcaggcagca tcaaactaac atttatgttt 360 tgcgggtcag cgatggctac aggaaaattc ttactggcat actcaccacc gggagctggg 420 gcaccgacca cacgcaagga ggcgatgcta ggtactcacg tgatctggga tgtgggtcta 480 caatcgagct gcgtattgtg tataccatgg attagtcaaa cgcactacag gtatgtagta 540 atggatgaat acaccgctgg tggatacata acatgctggt atcaaacaaa tattgtggtg 600 cctgcagatg cacagagtga ctgtaagatc ttgtgttttg tgtcggcatg taacgatttt 660 tcagttagga tgctcaagga cacacccttt ataaaacagg ataatttctt ccaa 714 <210> 5 <211> 752 <212> DNA <213> Artificial Sequence <400> 5 caacctccac ccacacaacc aacacccaga acaatgactg gttctccaaa cttgccagct 60 ctgctttcag cggtcttttc ggcgctctgc tagccgacaa gaagactgag gaaaccacac 120 tcctcgagga tcgcatcctc acgaccagtc acggcacaac cacctcgacc acacaaagtt 180 cagtgggcat aacctacggt tacgccgact cggaccgttt cctccccggc ccaaacacca 240 acgggctgga gacacgtgtg gaacaagcag agaggttttt caaacacaaa ttatttgatt 300 ggacacttga acaacgattt ggaacaacac acgttttgga actgcccaca gaccacaaag 360 gcatctatgg acaacttgtt gactcccact catacattcg caatgggtgg gacgttgagg 420 tctccgcgac cgcaacgcag ttcaacgggg gctgcctcct ggtagcgatg gtgcccgaat 480 tgtgcaaact gtcggaaaga gagaaatacc aactcactct cttccctcat caatttctca 540 acccaaggac caacaccacg gcacacatcc aggtacccta cctgggcgtg gatcgccacg 600 accaaggaac acgccacaaa gcgtggaccc tggttgtcat ggtggtggca ccctacacaa 660 acgatcagac gattggctcg aacaaagccg aggtgtacgt gaacattgct cccacaaacg 720 tttacgtcgc cggtgagaag cccgcaaaac ag 752 <210> 6 <211> 657 <212> DNA <213> Artificial Sequence <400> 6 accacatccg ctggcgaagg agcggagcct gtcacgactg atgcttccca acacggaggc 60 gacagacgga caactcgtag gcatcacact gatgtgagct tcttgctcga ccggttcaca 120 ctggttggta aaacacagga caacaaactg acactagacc tgctccaaac caaggaaaaa 180 gcactggttg gcgcaatcct gcgcgcagcc acgtactact tctctgactt ggaggttgcg 240 tgtgtgggtg acaacaaatg ggtcggctgg actcccaacg gagctccaga acttgcggaa 300 gtgggcgaca acccagtcgt cttttccaaa ggtagaacca cccgttttgc actgccctac 360 accgctccac acaggtgctt ggcgacagcc tacaacggtg actgcaagta caaacccact 420 ggcacagctc cacgcgaaaa cattcgtgga gacctcgcaa ctctcgcggc gaggattgca 480 agtgagacac acattccaac caccttcaac tatggcagga tttacacaga cactgaggtc 540 gacgtgtacg tcaggatgaa gcgcgcggag ctctactgcc cgcgacccgt tctcacgcac 600 tacgaccacg gtggcaggga tcgctacaga actgcgataa ccaaacctgt caaacag 657 <210> 7 <211> 663 <212> DNA <213> Artificial Sequence <400> 7 ggcattctcc ccgtggccgt ctccaatggc tatggtggct tccaaaatac agatcccaaa 60 acatcggacc ccgtatacgg gcacgtgtac aacccggctc gcaccggcct acctgggagg 120 ttcacaaacc tcttggatgt ggctgaagcg tgccctacac tgcttgactt caacggagtt 180 ccgtacgtga ccacccaggc aaactctgga tctaaagtgt taacttgttt tgatttggct 240 tttggtcaca aaaatttgaa aaatacattt atgtctggtc ttgcccagta ctacacccag 300 tacagtggca cactcaacct gcacttcatg tacacaggcc caaccaacaa caaggctaag 360 tacatggtgg cctacatccc acctgggaca caccctctcc cggaaacacc ggagatggcg 420 tcccactgtt accacgccga gtgggacaca ggcctgaact caaccttcac attcaccgtg 480 ccgtacgtgt cggctgccga cttcgcgtac acctactctg acgagcctga acaggcttcg 540 gttcagggtt gggtgggcgt ataccaggtg actgacacac acgagaagga cggtgcagtt 600 gttgtgtccg tcagtgctgg acccgacttc gagttcagga tgcccatcag cccctcgcgc 660 cag 663 <210> 8 <211> 912 <212> DNA <213> Artificial Sequence <400> 8 ggcgcaggtc aatccagtcc ggcaacgggc tcgcagaacc aaagcggcaa cacgggctct 60 atcatcaata actactacat gcagcaatat tggataccca actgggtgac 120 aacgcgatta gtggcggttc caatgaaggc tcaacggaca ccacgtcgac gcataccaac 180 aatacccaga acaatgattg gttctccaaa ctggcgcaat cagccatctc gggcctgttt 240 ggtgcactgc tggctgacaa aaagaccgaa gaaaccacgc tgctggaaga tcgtattctg 300 accacgcgcc acggtaccac gaccagtacg acccagagct ctgtgggcat cacctatggt 360 tacgcggata gcgactcttt tcgtagcggc ccgaatacgt ctggtctgga aacccgtgtt 420 gaacaagccg aacgcttttt caaagaaaag ctgttcgatt ggacgagtga caaaccgttt 480 ggtaccctgt atgtgctgga actgccgcgt gatcataaag gcatttacgg caagctgacg 540 gactcctata cctacatgcg caacggctgg gatgtccaag tgagcgccac gtctacccaa 600 ttcaatggcg gttgcctgct ggttgcgatg gttccggaac tgtgtagcct gaaagcccgt 660 gaagaatatc agctgaccct gtacccgcat caatttatca acccgcgcac caatacgacc 720 gcacacctgc aggtcccgta tctgggcgtg aaccgtcatg atcagggtaa acgccaccaa 780 agttggtccc tggtggttat ggtgctgacc ccgccgacga ccgaagcaca gatgaatagc 840 ggtaccgttg aagtctatgc gaacattgcc ccgaccaatg tgtacgttgc gggtgaactg 900 ccgggcaaac ag 912 <210> 9 <211> 651 <212> DNA <213> Artificial Sequence <400> 9 atgacgacca gcgcaggtga aggtgccgaa gttgtcacga ccgatccgac gacccatggc 60 ggtaaagtta cgaccccgcg tcgcgtgcac accgatgttg ccttcctgct ggaccgtagc 120 acgcatgtgc acaccaataa gaccacattt gaggttgatc tgatggacac caaagaaaag 180 gcactggttg gtgctatcct gcgctctgcg acctattact tctgcgatct ggaagttgcc 240 tgtgtcggca aacataagca cgtgttttgg cagccgaacg gtgcgccgcg tacgacccaa 300 ctgggtgata atccgatggt ttacagccgt aacaatgtca cgcgcttcgc gattccgttt 360 accgccccgc atcgcctgct gtctaccgtt tataacggtg aatgcgaata caccaaaacg 420 gtgaccgcca tccgtggcga tcgcgaagtt ctggcacaga aatattcatc ggctaagcac 480 agtctgccgt ccacgtttaa tttcggcttt gtgaccgcag ataaaccggt tgacgtctat 540 taccgtatga agcgcgctga actgtattgt ccgcgcgcgc tgctgccggc ctatacgcac 600 gcaggtcggg accgctttga tgctccgatt ggtgtggaga aacaactgct g 651 <210> 10 <211> 666 <212> DNA <213> Artificial Sequence <400> 10 ggtatcgtcc cggtggcatg cgctgatggc tatggcggtt ttcaaaacac cgatccgaag 60 tctgcggacc cgatttatgg tcatgtttac aacccgtcac gtaatgactg ccacggccgc 120 ttctcgaatc tgctggatgt cgcggaagcc tgtccgaccc tgctggattt tgacggcaaa 180 ccgtatgtcg tgaccaaaaa caatggtgat aaggttatgg cggccttcga cgtcgccttt 240 acgcataaag tgcacaagaa cacctatctg gcaggcctgg ctgattatta cacccagtac 300 tcaggttcgc tgaattatca tttcatgtac acgggcccga cccatcacaa agcaaagttt 360 atggtcgctt atgtgccgcc gggcatcgaa gttgaagaac tgccgaaaac cccggaagac 420 gcagctcatt gttaccacag tgaatgggat acgggtctga actccaattt taccttcgcg 480 gtgccgtatc tgagttccgg cgatttttca tacacgcata ccgacacgcc ggcaatggct 540 acgaccaacg gttgggttgt cgtgctgcag gtcaccgata cgcactcggc agaagcggcc 600 gttgtcgtga gcgtgtctgc tggcccggat ctggaatttc gtttcccgat tgacccggtg 660 cgtcag 666 <210> 11 <211> 915 <212> DNA <213> Artificial Sequence <400> 11 atgggcgcag gccagtcctc accggccaca gggtctcaga atcaatctgg caacactggt 60 agcataatta acaactacta catgcaacag taccaaaact ccatggacac ccaactcgga 120 gacaacgcca tctccggtgg gtcaaatgag ggatcgaccg acaccacgtc gacccacacc 180 aacaacaccc aaaacaatga ctggttctcc aaattggcac aatctgccat ctcagggctt 240 ttcggagccc ttttggcaga caaaaagacc gaagagacaa ctcttctgga ggaccggatc 300 ctcaccacac gccacaacac aaccacctcc acaacacaaa gttctgttgg cgtgacatac 360 ggttacgctt cggctgaccg tttcttgcct ggaccaaaca ccagcgggct tgagacacgc 420 gtcgaacaag ctgagagatt cttcaaggag aaactcttta cttggactgc atctcaggaa 480 tacgcacatg tgcacctgtt ggaactgcca gtggaccaca aaggcatcta cggtgccatg 540 ctggccagcc acacatacgt gcgcaatggc tgggacgtgc aggtttcagc aaccagcacg 600 caattcaacg gcggcaccct tcttgtcgcc atggtccctg agctacacaa attggacaag 660 cgtgacgttt cacaactcac acttttcccg caccagttca tcaacccacg caccaacacc 720 accgcccaca ttgtggtgcc ttacgtgggt gtcaacaggc acgatcaggc aaagatgcac 780 aaagcatgga cacttgtggt agcagtgctt gcaccgctca ccacctccaa catgggacag 840 gacaacgttg aggtgtatgc gaacatcgca ccgacaaacg tttacgtagc cggtgagagg 900 ccaacaaagc agtaa 915 <210> 12 <211> 969 <212> DNA <213> Artificial Sequence <400> 12 atgggtcatc accatcatca tcacgggtcg gactcagaag tcaatcaaga agctaagcca 60 gaggtcaagc cagaagtcaa gcctgagact cacatcaatt taaaggtgtc cgatggatct 120 tcagagatct tcttcaagat caaaaagacc actcctttaa gaaggctgat ggaagcgttc 180 gctaaaagac agggtaagga aatggactcc ttaagattct tgtacgacgg tattagaatt 240 caagctgatc aggcccctga agatttggac atggaggata acgatattat tgaggctcac 300 cgcgaacaga ttggaggtac aaccagtgca ggtgagggtg gtgatattgt gacagcagac 360 gtcaccacac acggcgggac cgtggactcc ccacgacgcc aacacaccaa cgtggagttc 420 ctgctggaca ggttcacaca cattggtcaa atcaccaact caaaaacaat tgacctcatg 480 gacacgaaag aacacacgtt ggtgggcgca atcctgcgct cagctacgta ctacttttgt 540 gaccttgaag ttgctgtctt aggcacaggg caatggaccg gatgggttcc caacggtttgc 600 ccgcacaccg aacgcgtgga ggacaaccca gttgttcacg cgaaaaacgg tgtcgcccgt 660 ttcgccctgc cttacacagc accacacagt gttcttgcaa cagtctacaa tggcaactgc 720 aaatactcca aaacccaaca cgtcacatca cgtcgcggtg atctggcgac gctacaacaa 780 cgtgttgaga atgaaaccac aagatgcagg cccacgacat tcaacttcgg gagattgttg 840 tgtgacaccg gtgaggtcta ctaccggatg aagagagccg agctgtactg ccctcgaccc 900 ctgaaggtaa gatacactca caccaccgac cggtacaaga ccaagctgga ggcacctgat 960 aaacaataa 969 <210> 13 <211> 666 <212> DNA <213> Artificial Sequence <400> 13 ggcattgtcc ctgtggcctg ccacgacggt tatggtggtt tccagaacac tgatcccaag 60 accgcagacc caatctacgg tctggtgtcc aacccaccac gcacggcgtt tcccggcagg 120 ttcaccaatc tgctggacgt cgctgaggcg tgtccaacct tcctggactt tgacggtaca 180 ccttacgtca ggaccggaca caacagtgga agcaaaacac tggcccacat tgacttggct 240 tttggacaca agagttttaa gaacacttac ttggctggac tcgctcagta ctacgcccag 300 tacagtggat ctcttaacct gcatttcatg tacactggtc ccacgcaatc gaaggcacgc 360 ttcatggttg cgtacatacc accagggact gaacccgtcc ccaaaactcc tgaggaggca 420 gcacactgtt accactcaga gtgggacact ggactgaact ccaagttcac gttcacggtt 480 ccgtacatgt cagcagcaga ttttgcctac acatactgtg atgagcccga acaggcctcc 540 gcacagggat gggtgacact gtaccagatt acagacacac atgaccctga ctcagcggtg 600 cttgtctcgg tcagcgctgg cgctgacctt gagtttcggc tcccaataaa ccctgcaaca 660 cagtaa 666 <210> 14 <211> 45 <212> DNA <213> Artificial Sequence <400> 14 cagtaataca aggggtgtta tgttaccaat gcttaatcag tgagg 45 <210> 15 <211> 45 <212> DNA <213> Artificial Sequence <400> 15 atccgctcat gaattaattc ttaatgagta ttcaacattt ccgtg 45 <210> 16 <211> 45 <212> DNA <213> Artificial Sequence <400> 16 cggaaatgtt gaatactcat taagaattaa ttcatgagcg gatac 45 <210> 17 <211> 45 <212> DNA <213> Artificial Sequence <400> 17 cctcactgat taagcattgg taacataaca ccccttgtat tactg 45 <210> 18 <211> 329 <212> PRT <213> Artificial Sequence <400> 18 Gly Ala Gln Val Ser Thr Gln Lys Thr Gly Ala His Glu Thr Ser Leu 1 5 10 15 Ser Ala Ala Gly Asn Ser Val Ile His Tyr Thr Asn Ile Asn Tyr Tyr 20 25 30 Lys Asp Ala Ala Ser Asn Ser Ala Asn Arg Gln Asp Phe Ala Gln Asp 35 40 45 Pro Gly Lys Phe Thr Glu Pro Val Lys Asp Ile Met Val Lys Ser Met 50 55 60 Pro Ala Leu Asn Ser Pro Ser Ala Glu Glu Cys Gly Tyr Ser Asp Arg 65 70 75 80 Val Arg Ser Ile Thr Leu Gly Asn Ser Thr Ile Thr Thr Gln Glu Cys 85 90 95 Ala Asn Val Val Val Gly Tyr Gly Val Trp Pro Thr Tyr Leu Lys Asp 100 105 110 Glu Glu Ala Thr Ala Glu Asp Gln Pro Thr Gln Pro Asp Val Ala Thr 115 120 125 Cys Arg Phe Tyr Thr Leu Glu Ser Val Met Trp Gln Gln Ser Ser Pro 130 135 140 Gly Trp Trp Trp Lys Phe Pro Asp Ala Leu Ser Asn Met Gly Leu Phe 145 150 155 160 Gly Gln Asn Met Gln Tyr His Tyr Leu Gly Arg Ala Gly Tyr Thr Ile 165 170 175 His Val Gln Cys Asn Ala Ser Lys Phe His Gln Gly Cys Leu Leu Val 180 185 190 Val Cys Val Pro Glu Ala Glu Met Gly Cys Ala Thr Leu Ala Asn Lys 195 200 205 Pro Asp Pro Lys Ser Leu Ser Lys Gly Glu Ile Ala Asn Met Phe Glu 210 215 220 Ser Gln Asn Ser Thr Gly Glu Thr Ala Val Gln Ala Asn Val Ile Asn 225 230 235 240 Ala Gly Met Gly Val Gly Val Gly Asn Leu Thr Ile Phe Pro His Gln 245 250 255 Trp Ile Asn Leu Arg Thr Asn Asn Ser Ala Thr Ile Val Met Pro Tyr 260 265 270 Ile Asn Ser Val Pro Met Asp Asn Met Phe Arg His Asn Asn Phe Thr 275 280 285 Leu Met Ala Ile Pro Phe Ala Pro Leu Ser Tyr Ser Thr Gly Ala Thr 290 295 300 Thr Tyr Val Pro Ile Thr Val Thr Val Ala Pro Met Cys Ala Glu Tyr 305 310 315 320 Asn Gly Leu Arg Leu Ala Gly Lys Gln 325 <210> 19 <211> 283 <212> PRT <213> Artificial Sequence <400> 19 Gly Pro Pro Gly Glu Val Met Glu Arg Ala Ile Ala Arg Val Ala Asp 1 5 10 15 Thr Thr Gly Ser Gly Pro Val Asn Ser Glu Ser Ile Pro Ala Leu Thr 20 25 30 Ala Ala Glu Thr Gly His Thr Ser Gln Val Val Pro Ser Asp Thr Met 35 40 45 Gln Thr Arg His Val Lys Asn Tyr His Ser Arg Ser Glu Ser Thr Val 50 55 60 Glu Asn Phe Leu Cys Arg Ser Ala Cys Val Phe Tyr Thr Thr Tyr Lys 65 70 75 80 Asn His Asp Ser Asp Gly Asp Asn Phe Ala Tyr Trp Val Ile Asn Thr 85 90 95 Arg Gln Val Ala Gln Leu Arg Arg Lys Leu Glu Met Phe Thr Tyr Ala 100 105 110 Arg Phe Asp Leu Glu Leu Thr Phe Val Ile Thr Ser Thr Gln Glu Gln 115 120 125 Ser Thr Val Gln Gly Gln Asp Thr Pro Val Leu Thr His Gln Ile Met 130 135 140 Tyr Val Pro Pro Gly Gly Pro Val Pro Thr Lys Val Asn Ser Tyr Ser 145 150 155 160 Trp Gln Thr Ser Thr Asn Pro Ser Val Phe Trp Thr Glu Gly Ser Ala 165 170 175 Pro Pro Arg Met Ser Ile Pro Phe Ile Gly Ile Gly Asn Ala Tyr Ser 180 185 190 Met Phe Tyr Asp Gly Trp Ala Arg Phe Asp Lys Gln Gly Thr Tyr Gly 195 200 205 Ile Ser Thr Leu Asn Asn Met Gly Thr Leu Tyr Met Arg His Val Asn 210 215 220 Asp Gly Gly Pro Gly Pro Ile Val Ser Thr Val Arg Ile Tyr Phe Lys 225 230 235 240 Pro Lys His Val Lys Thr Trp Val Pro Arg Pro Pro Arg Leu Cys Gln 245 250 255 Tyr Gln Lys Ala Gly Asn Val Asn Phe Lys Pro Thr Gly Val Thr Glu 260 265 270 Gly Arg Thr Asp Ile Thr Thr Met Lys Thr Thr 275 280 <210> 20 <211> 238 <212> PRT <213> Artificial Sequence <400> 20 Gly Leu Pro Thr Leu Ser Thr Pro Gly Ser Asn Gln Phe Leu Thr Ser 1 5 10 15 Asp Asp Phe Gln Ser Pro Ser Ala Met Pro Gln Phe Asp Val Thr Pro 20 25 30 Glu Met Asp Ile Pro Gly Gln Val Asn Asn Leu Met Glu Ile Ala Glu 35 40 45 Val Asp Ser Val Val Pro Val Asn Asn Thr Glu Gly Lys Val Met Ser 50 55 60 Ile Glu Ala Tyr Gln Ile Pro Val Gln Ser Asn Pro Thr Asn Gly Ser 65 70 75 80 Gln Val Phe Gly Phe Pro Leu Thr Pro Gly Ala Asn Ser Val Leu Asn 85 90 95 Arg Thr Leu Leu Gly Glu Ile Leu Asn Tyr Tyr Ala His Trp Ser Gly 100 105 110 Ser Ile Lys Leu Thr Phe Met Phe Cys Gly Ser Ala Met Ala Thr Gly 115 120 125 Lys Phe Leu Leu Ala Tyr Ser Pro Pro Gly Ala Gly Ala Pro Thr Thr 130 135 140 Arg Lys Glu Ala Met Leu Gly Thr His Val Ile Trp Asp Val Gly Leu 145 150 155 160 Gln Ser Ser Cys Val Leu Cys Ile Pro Trp Ile Ser Gln Thr His Tyr 165 170 175 Arg Tyr Val Val Met Asp Glu Tyr Thr Ala Gly Gly Tyr Ile Thr Cys 180 185 190 Trp Tyr Gln Thr Asn Ile Val Val Pro Ala Asp Ala Gln Ser Asp Cys 195 200 205 Lys Ile Leu Cys Phe Val Ser Ala Cys Asn Asp Phe Ser Val Arg Met 210 215 220 Leu Lys Asp Thr Pro Phe Ile Lys Gln Asp Asn Phe Phe Gln 225 230 235 <210> 21 <211> 304 <212> PRT <213> Artificial Sequence <400> 21 Gly Ala Gly Gln Ser Ser Pro Ala Thr Gly Ser Gln Asn Gln Ser Gly 1 5 10 15 Asn Thr Gly Ser Ile Ile Asn Asn Tyr Tyr Met Gln Gln Tyr Gln Asn 20 25 30 Ser Met Asp Thr Gln Leu Gly Asp Asn Ala Ile Ser Gly Gly Ser Asn 35 40 45 Glu Gly Ser Thr Asp Thr Thr Ser Thr His Thr Asn Asn Thr Gln Asn 50 55 60 Asn Asp Trp Phe Ser Gln Leu Ala Gln Ser Ala Phe Ser Gly Leu Val 65 70 75 80 Gly Ala Leu Leu Ala Asp Lys Lys Thr Glu Glu Thr Thr Leu Leu Glu 85 90 95 Asp Arg Ile Leu Thr Thr Ser His Gly Thr Thr Thr Ser Thr Thr Gln 100 105 110 Ser Ser Val Gly Ile Thr Tyr Gly Tyr Ala Glu Ala Asp Tyr Tyr Met 115 120 125 Pro Gly Pro Asn Thr Asn Gly Leu Glu Thr Arg Val Glu Gln Ala Glu 130 135 140 Arg Phe Phe Lys His Lys Leu Phe Asp Trp Thr Leu Asp Gln Gln Phe 145 150 155 160 Gly Thr Thr His Val Leu Glu Leu Pro Thr Asp His Lys Gly Ile Tyr 165 170 175 Gly Gln Leu Val Asp Ser His Ser Tyr Ile Arg Asn Gly Trp Asp Val 180 185 190 Glu Val Ser Ala Thr Ala Thr Gln Phe Asn Gly Gly Cys Leu Leu Val 195 200 205 Ala Met Val Pro Glu Leu Cys Lys Leu Ser Asp Arg Glu Lys Tyr Gln 210 215 220 Leu Thr Leu Phe Pro His Gln Phe Leu Asn Pro Arg Thr Asn Thr Thr 225 230 235 240 Ala His Ile Gln Val Pro Tyr Leu Gly Val Asp Arg His Asp Gln Gly 245 250 255 Thr Arg His Lys Ala Trp Thr Leu Val Val Met Val Val Ala Pro Tyr 260 265 270 Thr Asn Asp Gln Thr Ile Gly Ser Thr Lys Ala Glu Val Tyr Val Asn 275 280 285 Ile Ala Pro Thr Asn Val Tyr Val Ala Gly Glu Lys Pro Ala Lys Gln 290 295 300 <210> 22 <211> 219 <212> PRT <213> Artificial Sequence <400> 22 Thr Thr Ser Ala Gly Glu Gly Ala Glu Pro Val Thr Thr Asp Ala Ser 1 5 10 15 Gln His Gly Gly Asp Arg Arg Thr Thr Arg Arg His His Thr Asp Val 20 25 30 Ser Phe Leu Leu Asp Arg Phe Thr Leu Val Gly Lys Thr Gln Asp Asn 35 40 45 Lys Leu Thr Leu Asp Leu Leu Gln Thr Lys Glu Lys Ala Leu Val Gly 50 55 60 Ala Ile Leu Arg Ala Ala Thr Tyr Tyr Phe Ser Asp Leu Glu Val Ala 65 70 75 80 Cys Val Gly Asp Asn Lys Trp Val Gly Trp Thr Pro Asn Gly Ala Pro 85 90 95 Glu Leu Ala Glu Val Gly Asp Asn Pro Val Val Phe Ser Lys Gly Arg 100 105 110 Thr Thr Arg Phe Ala Leu Pro Tyr Thr Ala Pro His Arg Cys Leu Ala 115 120 125 Thr Ala Tyr Asn Gly Asp Cys Lys Tyr Lys Pro Thr Gly Thr Ala Pro 130 135 140 Arg Glu Asn Ile Arg Gly Asp Leu Ala Thr Leu Ala Ala Arg Ile Ala 145 150 155 160 Ser Glu Thr His Ile Pro Thr Thr Phe Asn Tyr Gly Arg Ile Tyr Thr 165 170 175 Asp Thr Glu Val Asp Val Tyr Val Arg Met Lys Arg Ala Glu Leu Tyr 180 185 190 Cys Pro Arg Pro Val Leu Thr His Tyr Asp His Gly Gly Arg Asp Arg 195 200 205 Tyr Arg Thr Ala Ile Thr Lys Pro Val Lys Gln 210 215 <210> 23 <211> 221 <212> PRT <213> Artificial Sequence <400> 23 Gly Ile Leu Pro Val Ala Val Ser Asn Gly Tyr Gly Gly Phe Gln Asn 1 5 10 15 Thr Asp Pro Lys Thr Ser Asp Pro Val Tyr Gly His Val Tyr Asn Pro 20 25 30 Ala Arg Thr Gly Leu Pro Gly Arg Phe Thr Asn Leu Leu Asp Val Ala 35 40 45 Glu Ala Cys Pro Thr Leu Leu Asp Phe Asn Gly Val Pro Tyr Val Thr 50 55 60 Thr Gln Ala Asn Ser Gly Ser Lys Val Leu Thr Cys Phe Asp Leu Ala 65 70 75 80 Phe Gly His Lys Asn Leu Lys Asn Thr Phe Met Ser Gly Leu Ala Gln 85 90 95 Tyr Tyr Thr Gln Tyr Ser Gly Thr Leu Asn Leu His Phe Met Tyr Thr 100 105 110 Gly Pro Thr Asn Asn Lys Ala Lys Tyr Met Val Ala Tyr Ile Pro Pro 115 120 125 Gly Thr His Pro Leu Pro Glu Thr Pro Glu Met Ala Ser His Cys Tyr 130 135 140 His Ala Glu Trp Asp Thr Gly Leu Asn Ser Thr Phe Thr Phe Thr Val 145 150 155 160 Pro Tyr Val Ser Ala Ala Asp Phe Ala Tyr Thr Tyr Ser Asp Glu Pro 165 170 175 Glu Gln Ala Ser Val Gln Gly Trp Val Gly Val Tyr Gln Val Thr Asp 180 185 190 Thr His Glu Lys Asp Gly Ala Val Val Val Ser Val Ser Ala Gly Pro 195 200 205 Asp Phe Glu Phe Arg Met Pro Ile Ser Pro Ser Arg Gln 210 215 220 <210> 24 <211> 304 <212> PRT <213> Artificial Sequence <400> 24 Gly Ala Gly Gln Ser Ser Pro Ala Thr Gly Ser Gln Asn Gln Ser Gly 1 5 10 15 Asn Thr Gly Ser Ile Ile Asn Asn Tyr Tyr Met Gln Gln Tyr Gln Asn 20 25 30 Ser Met Asp Thr Gln Leu Gly Asp Asn Ala Ile Ser Gly Gly Ser Asn 35 40 45 Glu Gly Ser Thr Asp Thr Thr Ser Thr His Thr Asn Asn Thr Gln Asn 50 55 60 Asn Asp Trp Phe Ser Lys Leu Ala Gln Ser Ala Ile Ser Gly Leu Phe 65 70 75 80 Gly Ala Leu Leu Ala Asp Lys Lys Thr Glu Glu Thr Thr Leu Leu Glu 85 90 95 Asp Arg Ile Leu Thr Thr Arg His Gly Thr Thr Thr Ser Thr Thr Gln 100 105 110 Ser Ser Val Gly Ile Thr Tyr Gly Tyr Ala Asp Ser Asp Ser Phe Arg 115 120 125 Ser Gly Pro Asn Thr Ser Gly Leu Glu Thr Arg Val Glu Gln Ala Glu 130 135 140 Arg Phe Phe Lys Glu Lys Leu Phe Asp Trp Thr Ser Asp Lys Pro Phe 145 150 155 160 Gly Thr Leu Tyr Val Leu Glu Leu Pro Arg Asp His Lys Gly Ile Tyr 165 170 175 Gly Lys Leu Thr Asp Ser Tyr Thr Tyr Met Arg Asn Gly Trp Asp Val 180 185 190 Gln Val Ser Ala Thr Ser Thr Gln Phe Asn Gly Gly Cys Leu Leu Val 195 200 205 Ala Met Val Pro Glu Leu Cys Ser Leu Lys Ala Arg Glu Glu Tyr Gln 210 215 220 Leu Thr Leu Tyr Pro His Gln Phe Ile Asn Pro Arg Thr Asn Thr Thr 225 230 235 240 Ala His Leu Gln Val Pro Tyr Leu Gly Val Asn Arg His Asp Gln Gly 245 250 255 Lys Arg His Gln Ser Trp Ser Leu Val Val Met Val Leu Thr Pro Pro 260 265 270 Thr Thr Glu Ala Gln Met Asn Ser Gly Thr Val Glu Val Tyr Ala Asn 275 280 285 Ile Ala Pro Thr Asn Val Tyr Val Ala Gly Glu Leu Pro Gly Lys Gln 290 295 300 <210> 25 <211> 216 <212> PRT <213> Artificial Sequence <400> 25 Thr Thr Ser Ala Gly Glu Gly Ala Glu Val Val Thr Thr Asp Pro Thr 1 5 10 15 Thr His Gly Gly Lys Val Thr Thr Pro Arg Arg Val His Thr Asp Val 20 25 30 Ala Phe Leu Leu Asp Arg Ser Thr His Val His Thr Asn Lys Thr Thr 35 40 45 Phe Glu Val Asp Leu Met Asp Thr Lys Glu Lys Ala Leu Val Gly Ala 50 55 60 Ile Leu Arg Ser Ala Thr Tyr Tyr Phe Cys Asp Leu Glu Val Ala Cys 65 70 75 80 Val Gly Lys His Lys His Val Phe Trp Gln Pro Asn Gly Ala Pro Arg 85 90 95 Thr Thr Gln Leu Gly Asp Asn Pro Met Val Tyr Ser Arg Asn Asn Val 100 105 110 Thr Arg Phe Ala Ile Pro Phe Thr Ala Pro His Arg Leu Leu Ser Thr 115 120 125 Val Tyr Asn Gly Glu Cys Glu Tyr Thr Lys Thr Val Thr Ala Ile Arg 130 135 140 Gly Asp Arg Glu Val Leu Ala Gln Lys Tyr Ser Ser Ala Lys His Ser 145 150 155 160 Leu Pro Ser Thr Phe Asn Phe Gly Phe Val Thr Ala Asp Lys Pro Val 165 170 175 Asp Val Tyr Tyr Arg Met Lys Arg Ala Glu Leu Tyr Cys Pro Arg Ala 180 185 190 Leu Leu Pro Ala Tyr Thr His Ala Gly Arg Asp Arg Phe Asp Ala Pro 195 200 205 Ile Gly Val Glu Lys Gln Leu Leu 210 215 <210> 26 <211> 222 <212> PRT <213> Artificial Sequence <400> 26 Gly Ile Val Pro Val Ala Cys Ala Asp Gly Tyr Gly Gly Phe Gln Asn 1 5 10 15 Thr Asp Pro Lys Ser Ala Asp Pro Ile Tyr Gly His Val Tyr Asn Pro 20 25 30 Ser Arg Asn Asp Cys His Gly Arg Phe Ser Asn Leu Leu Asp Val Ala 35 40 45 Glu Ala Cys Pro Thr Leu Leu Asp Phe Asp Gly Lys Pro Tyr Val Val 50 55 60 Thr Lys Asn Asn Gly Asp Lys Val Met Ala Ala Phe Asp Val Ala Phe 65 70 75 80 Thr His Lys Val His Lys Asn Thr Tyr Leu Ala Gly Leu Ala Asp Tyr 85 90 95 Tyr Thr Gln Tyr Ser Gly Ser Leu Asn Tyr His Phe Met Tyr Thr Gly 100 105 110 Pro Thr His His Lys Ala Lys Phe Met Val Ala Tyr Val Pro Pro Gly 115 120 125 Ile Glu Val Glu Glu Leu Pro Lys Thr Pro Glu Asp Ala Ala His Cys 130 135 140 Tyr His Ser Glu Trp Asp Thr Gly Leu Asn Ser Asn Phe Thr Phe Ala 145 150 155 160 Val Pro Tyr Leu Ser Ser Gly Asp Phe Ser Tyr Thr His Thr Asp Thr 165 170 175 Pro Ala Met Ala Thr Thr Asn Gly Trp Val Val Val Leu Gln Val Thr 180 185 190 Asp Thr His Ser Ala Glu Ala Ala Val Val Val Ser Val Ser Ala Gly 195 200 205 Pro Asp Leu Glu Phe Arg Phe Pro Ile Asp Pro Val Arg Gln 210 215 220 <210> 27 <211> 303 <212> PRT <213> Artificial Sequence <400> 27 Gly Ala Gly Gln Ser Ser Pro Ala Thr Gly Ser Gln Asn Gln Ser Gly 1 5 10 15 Asn Thr Gly Ser Ile Ile Asn Asn Tyr Tyr Met Gln Gln Tyr Gln Asn 20 25 30 Ser Met Asp Thr Gln Leu Gly Asp Asn Ala Ile Ser Gly Gly Ser Asn 35 40 45 Glu Gly Ser Thr Asp Thr Thr Ser Thr His Thr Asn Asn Thr Gln Asn 50 55 60 Asn Asp Trp Phe Ser Lys Leu Ala Gln Ser Ala Ile Ser Gly Leu Phe 65 70 75 80 Gly Ala Leu Leu Ala Asp Lys Lys Thr Glu Glu Thr Thr Leu Leu Glu 85 90 95 Asp Arg Ile Leu Thr Thr Arg His Asn Thr Thr Thr Ser Thr Thr Gln 100 105 110 Ser Ser Val Gly Val Thr Tyr Gly Tyr Ala Ser Ala Asp Arg Phe Leu 115 120 125 Pro Gly Pro Asn Thr Ser Gly Leu Glu Thr Arg Val Glu Gln Ala Glu 130 135 140 Arg Phe Phe Lys Glu Lys Leu Phe Thr Trp Thr Ala Ser Gln Glu Tyr 145 150 155 160 Ala His Val His Leu Leu Glu Leu Pro Val Asp His Lys Gly Ile Tyr 165 170 175 Gly Ala Met Leu Ala Ser His Thr Tyr Val Arg Asn Gly Trp Asp Val 180 185 190 Gln Val Ser Ala Thr Ser Thr Gln Phe Asn Gly Gly Thr Leu Leu Val 195 200 205 Ala Met Val Pro Glu Leu His Lys Leu Asp Lys Arg Asp Val Ser Gln 210 215 220 Leu Thr Leu Phe Pro His Gln Phe Ile Asn Pro Arg Thr Asn Thr Thr 225 230 235 240 Ala His Ile Val Val Pro Tyr Val Gly Val Asn Arg His Asp Gln Ala 245 250 255 Lys Met His Lys Ala Trp Thr Leu Val Val Ala Val Leu Ala Pro Leu 260 265 270 Thr Thr Ser Asn Met Gly Gln Asp Asn Val Glu Val Tyr Ala Asn Ile 275 280 285 Ala Pro Thr Asn Val Tyr Val Ala Gly Glu Arg Pro Thr Lys Gln 290 295 300 <210> 28 <211> 216 <212> PRT <213> Artificial Sequence <400> 28 Thr Thr Ser Ala Gly Glu Gly Gly Asp Ile Val Thr Ala Asp Val Thr 1 5 10 15 Thr His Gly Gly Thr Val Asp Ser Pro Arg Arg Gln His Thr Asn Val 20 25 30 Glu Phe Leu Leu Asp Arg Phe Thr His Ile Gly Gln Ile Thr Asn Ser 35 40 45 Lys Thr Ile Asp Leu Met Asp Thr Lys Glu His Thr Leu Val Gly Ala 50 55 60 Ile Leu Arg Ser Ala Thr Tyr Tyr Phe Cys Asp Leu Glu Val Ala Val 65 70 75 80 Leu Gly Thr Gly Gln Trp Thr Gly Trp Val Pro Asn Gly Cys Pro His 85 90 95 Thr Glu Arg Val Glu Asp Asn Pro Val Val His Ala Lys Asn Gly Val 100 105 110 Ala Arg Phe Ala Leu Pro Tyr Thr Ala Pro His Ser Val Leu Ala Thr 115 120 125 Val Tyr Asn Gly Asn Cys Lys Tyr Ser Lys Thr Gln His Val Thr Ser 130 135 140 Arg Arg Gly Asp Leu Ala Thr Leu Gln Gln Arg Val Glu Asn Glu Thr 145 150 155 160 Thr Arg Cys Arg Pro Thr Thr Phe Asn Phe Gly Arg Leu Leu Cys Asp 165 170 175 Thr Gly Glu Val Tyr Tyr Arg Met Lys Arg Ala Glu Leu Tyr Cys Pro 180 185 190 Arg Pro Leu Lys Val Arg Tyr Thr His Thr Thr Asp Arg Tyr Lys Thr 195 200 205 Lys Leu Glu Ala Pro Asp Lys Gln 210 215 <210> 29 <211> 221 <212> PRT <213> Artificial Sequence <400> 29 Gly Ile Val Pro Val Ala Cys His Asp Gly Tyr Gly Gly Phe Gln Asn 1 5 10 15 Thr Asp Pro Lys Thr Ala Asp Pro Ile Tyr Gly Leu Val Ser Asn Pro 20 25 30 Pro Arg Thr Ala Phe Pro Gly Arg Phe Thr Asn Leu Leu Asp Val Ala 35 40 45 Glu Ala Cys Pro Thr Phe Leu Asp Phe Asp Gly Thr Pro Tyr Val Arg 50 55 60 Thr Gly His Asn Ser Gly Ser Lys Thr Leu Ala His Ile Asp Leu Ala 65 70 75 80 Phe Gly His Lys Ser Phe Lys Asn Thr Tyr Leu Ala Gly Leu Ala Gln 85 90 95 Tyr Tyr Ala Gln Tyr Ser Gly Ser Leu Asn Leu His Phe Met Tyr Thr 100 105 110 Gly Pro Thr Gln Ser Lys Ala Arg Phe Met Val Ala Tyr Ile Pro Pro 115 120 125 Gly Thr Glu Pro Val Pro Lys Thr Pro Glu Glu Ala Ala His Cys Tyr 130 135 140 His Ser Glu Trp Asp Thr Gly Leu Asn Ser Lys Phe Thr Phe Thr Val 145 150 155 160 Pro Tyr Met Ser Ala Ala Asp Phe Ala Tyr Thr Tyr Cys Asp Glu Pro 165 170 175 Glu Gln Ala Ser Ala Gln Gly Trp Val Thr Leu Tyr Gln Ile Thr Asp 180 185 190 Thr His Asp Pro Asp Ser Ala Val Leu Val Ser Val Ser Ala Gly Ala 195 200 205 Asp Leu Glu Phe Arg Leu Pro Ile Asn Pro Ala Thr Gln 210 215 220 <210> 30 <211> 97 <212> PRT <213> Artificial Sequence <400> 30 Met Gly His His His His His His Ser Asp Glu Lys Lys Gly Gly Glu 1 5 10 15 Thr Glu His Ile Asn Leu Lys Val Leu Gly Gln Asp Asn Ala Val Val 20 25 30 Gln Phe Lys Ile Lys Lys His Thr Pro Leu Arg Lys Leu Met Asn Ala 35 40 45 Tyr Cys Asp Arg Ala Gly Leu Ser Met Gln Val Val Arg Phe Arg Phe 50 55 60 Asp Gly Gln Pro Ile Asn Glu Asn Asp Thr Pro Thr Ser Leu Glu Met 65 70 75 80 Glu Glu Gly Asp Thr Ile Glu Val Tyr Gln Gln Gln Thr Gly Gly Ala 85 90 95 Pro

Claims

1. A method for preparing virus-like particles, characterized in that: The following steps are involved: 1) The viral structural protein genes VP0, VP1 and VP3 were fused with the small ubiquitin-like modifier protein gene sequence, and the resulting fusion genes were cloned into the pET-28a vector to obtain pET / VP0-VP1 and pET / VP3; The virus is swine vesicular disease virus or South African foot-and-mouth disease virus; When the virus is swine vesicular disease virus, the amino acid sequence of VP0 is shown in SEQ ID NO: 18; the amino acid sequence of VP1 is shown in SEQ ID NO: 19; the amino acid sequence of VP3 is shown in SEQ ID NO: 20; The South African foot-and-mouth disease virus is SAT1 foot-and-mouth disease virus, SAT2 foot-and-mouth disease virus or SAT3 foot-and-mouth disease virus; The amino acid sequence of VP0 of the SAT1 type foot-and-mouth disease virus is shown in SEQ ID NO: 21; the amino acid sequence of VP1 is shown in SEQ ID NO: 22; the amino acid sequence of VP3 is shown in SEQ ID NO: 23; The amino acid sequence of VP0 of the SAT2 foot-and-mouth disease virus is shown in SEQ ID NO: 24; the amino acid sequence of VP1 is shown in SEQ ID NO: 25; and the amino acid sequence of VP3 is shown in SEQ ID NO: 26; The amino acid sequence of VP0 of the SAT3 type foot-and-mouth disease virus is shown in SEQ ID NO: 27; the amino acid sequence of VP1 is shown in SEQ ID NO: 28; the amino acid sequence of VP3 is shown in SEQ ID NO: 29; 2) replacing the kanamycin resistance gene in the pET / VP3 described in step 1) with the ampicillin resistance gene to obtain pETa / VP3; 3) co-transforming the pET / VP0-VP1 described in step 1) and the pETa / VP3 described in step 2) into a prokaryotic expression system, and isolating and obtaining three small ubiquitination-modified protease-cleaved fusion proteins through recombinant expression; 4) The three small ubiquitination-modified proteases described in step 3) are enzymatically cleaved from the fusion proteins to remove the small ubiquitination-modified tag proteins, and VP0, VP1 and VP3 recombinant proteins are collected and assembled in vitro to obtain virus-like particles.

2. The preparation method according to claim 1, characterized in that: The nucleotide sequence of the small ubiquitin-like modifier protein gene in step 1) is shown in SEQ ID NO:

1.

3. The preparation method according to claim 1, characterized in that: The multiple cloning site of the pET-28a vector in step 1) is a SalI / BamHI and / or HindIII / Xho I restriction site.

4. The virus-like particle prepared by the preparation method according to any one of claims 1 to 3, characterized in that: The virus-like particle is composed of virus structural proteins VP1, VP0 and VP3; when the virus is swine vesicular disease virus, the amino acid sequence of VP0 is shown in SEQ ID NO: 18; the amino acid sequence of VP1 is shown in SEQ ID NO: 19; and the amino acid sequence of VP3 is shown in SEQ ID NO: 20; When the virus is a South African foot-and-mouth disease virus, the South African foot-and-mouth disease virus includes a SAT1 foot-and-mouth disease virus, a SAT2 foot-and-mouth disease virus or a SAT3 foot-and-mouth disease virus; The amino acid sequence of VP0 of the SAT1 type foot-and-mouth disease virus is shown in SEQ ID NO: 21; the amino acid sequence of VP1 is shown in SEQ ID NO: 22; the amino acid sequence of VP3 is shown in SEQ ID NO: 23; The amino acid sequence of VP0 of the SAT2 foot-and-mouth disease virus is shown in SEQ ID NO: 24; the amino acid sequence of VP1 is shown in SEQ ID NO: 25; and the amino acid sequence of VP3 is shown in SEQ ID NO: 26; The amino acid sequence of VP0 of the SAT3 type foot-and-mouth disease virus is shown in SEQ ID NO:27; the amino acid sequence of VP1 is shown in SEQ ID NO:28; and the amino acid sequence of VP3 is shown in SEQ ID NO:

29.

5. Use of the virus-like particles according to claim 4 in the preparation of vaccines for preventing and controlling viral diseases; the viral diseases include swine vesicular disease and / or foot-and-mouth disease.

6. A virus-like particle vaccine for preventing and controlling viral diseases, characterized in that: The method comprises the virus-like particle according to claim 4 and an adjuvant.

Images