A kit for simultaneously detecting six rice viruses and application thereof
By designing specific primer sets and a one-step RT-PCR method, the problem of accurate detection of various rice viruses has been solved, enabling rapid and reliable multiplex virus detection and supporting disease monitoring and control.
Patent Information
- Application Number
- CN202111483040.2
- Authority / Receiving Office
- CN · China
- Patent Type
- Patents(China)
- Current Assignee / Owner
- Filing Date
- 2021-12-07
- Publication Date
- 2025-10-24
- Estimated Expiration
- 2041-12-07
AI Technical Summary
Existing technologies are insufficient for the rapid and accurate detection of multiple rice viruses, especially when multiple different symptoms appear on the same plant, which can easily lead to misdiagnosis and affect the effective prevention and control of diseases.
A kit was designed containing a specific primer set for detecting six rice viruses, and a one-step RT-PCR method combined with agarose gel electrophoresis was used to achieve simultaneous detection of multiple viruses.
It enables rapid and reliable simultaneous detection of six rice viruses, reducing workload and costs, providing a powerful tool for disease monitoring and control, and laying a solid technical foundation for disease tracing.
Smart Images
Figure CN114410833B_ABST
Abstract
Description
TECHNICAL FIELD
[0001] The present application belongs to the field of agricultural technology, and particularly relates to a kit for simultaneously detecting six rice viruses and application thereof. BACKGROUND
[0002] Rice (Oryza sativa L.) is the source of staple food for half of the world's population. Rice virus disease, as one of the important diseases in agricultural production, occurs widely in China, Japan, Korea, India, the Philippines, Vietnam and other countries and rice production areas in Africa (Uehara-Ichiki et al., 2013a). Rice viruses not only infect rice, but also infect corn, wheat and other gramineous plants, with a wide host range. In addition, new and old rice viruses occur alternately, and new viruses are constantly being discovered, while old viruses occur latently. Due to the lack of rice virus-resistant immune varieties, rice virus disease cannot be effectively and completely controlled, and always threatens agricultural production, brings great security risks and causes great economic losses.
[0003] Currently, there are 17 rice viruses reported in the world, and as many as 12 of them have occurred in China. Currently available in production are 8 rice virus diseases, including rice stripe virus (RSV), rice grassy stunt virus (RGSV), rice dwarf virus (RDV), rice ragged stunt virus (RRSV), rice black-streaked dwarf virus (RBSDV), southern rice black-streaked dwarf virus (SRBSDV), rice gall dwarf virus (RGDV) and rice stripe mosaic virus (RSMV). The infection of these rice viruses mostly causes dwarfing, increased tillering, dark green and curly leaves, and rigid leaf blades of rice plants, and similar disease symptoms. However, when different symptoms appear on the same rice plant, it is difficult to diagnose through disease symptoms.
[0004] In the southern rice production area, RDV, RSV, SRGBSDV, RRSV, RGSV, RBSDV occur mixed infection all year round, and the early symptoms of infection are similar, which is extremely easy to lead to misdiagnosis of viruses. Rapid and accurate diagnosis is of great significance for effective prevention and control of disease epidemic at the early stage of infection, and if there is a mistake, it is likely to affect production practice, so it is necessary to establish a PCR system that can rapidly and efficiently and accurately detect multiple viruses. Each rice virus contains a dsRNA or ssRNA genome. RDV, SRGBSDV, RBSDV and RRSV contain 10-12 fragments of dsRNA (Hibino, 1996), and RSV and RGSV contain 4-6 ssRNA genomes, and the sequence homology of the viruses is different. SRGBSDV and RBSDV have the highest homology, and their most conserved components (fragments 1, 2 and 10) have 78.5%-79.2% similarity (Wang et al., 2010). The genomes of several other viruses are significantly different from those of SRGBSDV and RBSDV. Therefore, according to the sequence differences of the genomes of these viruses, specific primers for each virus are designed, and a method for simultaneously detecting the six viruses is established, which is of great significance for monitoring virus transmission vectors, disease epidemics and other production practices. SUMMARY
[0005] The purpose of the present application is to provide a kit for simultaneously detecting six rice viruses and its application.
[0006] In order to achieve the above-mentioned purpose, the technical scheme adopted by the present application is as follows:
[0007] A kit for simultaneously detecting six rice viruses, comprising: a primer set for detecting rice sawtooth leaf stunt virus RRSV, a primer set for detecting rice stripe virus RSV, a primer set for detecting rice dwarf virus RDV, a primer set for detecting southern rice black-streaked dwarf virus SRGBSDV, a primer set for detecting rice black-streaked dwarf virus RBSDV, and a primer set for detecting rice grassy stunt virus RGSV.
[0008] The primer set for detecting rice sawtooth leaf stunt virus RRSV is as follows:
[0009] RRSV CP(p8)-F CGGAGAGAGATAACGCTTGG
[0010] RRSV CP(p8)-R CACAGTAATAACCGCACGCT.
[0011] The primer set for detecting rice stripe virus RSV is as follows:
[0012] RSV CP (pC3)-F GGCTGTGGACTCTTCTGACC
[0013] RSV CP (pC3)-R TTGTCAGACCACGCTCCTTC
[0014] The primer set for detecting the rice dwarf virus RDV is as follows:
[0015] RDV CP (p8)-F TGTATGAGCGCCAAAATGCG
[0016] RDV CP (p8)-R CCACCACCAAGTGAGAACGA
[0017] The primer set for detecting the southern rice black-streaked dwarf virus SRBSDV is as follows:
[0018] SRBSDV CP (p10)-F CACACTTCTGTCTCACTTCAACTCTCT
[0019] SRBSDV CP (p10)-R CTTACGCAACGATGAACCTTTCTCTAT
[0020] The primer set for detecting the rice black-streaked dwarf virus RBSDV is as follows:
[0021] RBSDV CP (p10)-F GAAGGAAACATTACTTTGAAGCCC
[0022] RBSDV CP (p10)-R CGCTCAACACTTCGCCAAT
[0023] The primer set for detecting the rice grassy stunt virus RGSV is as follows:
[0024] RGSV CP (pC5)-F ATTGAGACCCATTAGTACCGTTG
[0025] RGSV CP (pC5)-R AGAGCAGTTTCCTGTAGTCCCCA
[0026] Further, the above kit further comprises: Onestep RT / Taq Mix, 5x Reaction Buffer and DEPC-ddH2O.
[0027] The method for simultaneously detecting six rice viruses by using the above kit comprises the following steps:
[0028] Step 1, extracting total RNA from rice leaves;
[0029] Step 2, using the total RNA of rice leaves extracted in step 1 as a template, the kit of claim 1 is used for RT-PCR amplification;
[0030] Step 3, the PCR amplification product of step 2 is detected by agarose gel electrophoresis;
[0031] The result judgment standard is as follows: the band between 100-250bp exists rice stripe virus RSV; the band between 250-500bp, close to 250bp exists rice grassy stunt virus RGSV, close to 500bp exists rice dwarf virus RDV; the band between 500-750bp exists rice ragged stunt virus RRSV; close to 750bp exists rice black streaked dwarf virus; close to 1000bp exists southern rice black-streaked dwarf virus SRBSDV.
[0032] Further, the RT-PCR amplification system in step 2 comprises: Onestep RT / Taq Mix 0.75 μL, 5×Reaction Buffer 4 μL, the template amount is 1 μg, 0.3 μM RSV primer 0.6 μL, 0.2 μM RDV primer 0.4 μL, 0.25 μM RGSV primer 0.3 μL, 0.2 μM RRSV primer 0.4 μL, 0.3 μM RBSDV primer 0.6 μL, 0.1 μM SRBSDV primer 0.2 μL, DEPC-ddH2O is supplemented to 20 μL.
[0033] Further, the RT-PCR amplification condition in step 2 is as follows:
[0034] Reverse transcription reaction condition: 50℃, 30min;
[0035] RT-PCR reaction condition: pre-denaturation, 94℃, 2min; denaturation, 94℃, 30s; annealing, 58℃, 30s; extension, 72℃, 1min; repeat denaturation, annealing and extension for 30 cycles; final extension, 72℃, 10min.
[0036] The kit of the application can conveniently, quickly and reliably detect six kinds of rice viruses at the same time, which not only saves the detection cost, but also quickly obtains the result, reduces the workload, can carry out detailed and in-depth virological research, provides a favorable starting point for the disease and virus transmission medium of the disease to better study the field disease of rice, provides a favorable starting point for the disease and virus transmission medium of the disease to better study the field disease of rice, provides a favorable starting point for the disease and virus transmission medium of the disease to better study the field disease of rice, and lays a good technical foundation for the cause of the outbreak of large-scale sudden viral disease, and has a broad application prospect. BRIEF DESCRIPTION OF DRAWINGS
[0037] Figure 1 Gel electrophoresis map of PCR products amplified by 6 rice virus specific primers. Among them: DNA Maker; 1: RSV; 3: RGSV; 5: RDV; 7: RRSV; 9: RBSDV; 11: SRGBSDV; 2, 4, 6, 8, 10, 12 are negative controls.
[0038] Figure 2 The results of the concentration optimization of 6 virus detection primers. Among them: DNA Maker; 0.2, 0.3, 0.4, 0.5, 0.6 correspond to the volume of virus detection primer added (μL) respectively.
[0039] Figure 3 The results of the annealing temperature optimization. Among them: DNA Maker; 54, 56, 58, 60 correspond to different annealing temperatures respectively.
[0040] Figure 4 The results of the optimization of the amount of Onestep RT / Taq Mix. Among them: DNA Maker; 0.75, 1.0, 1.25, 1.5 correspond to different amounts of Onestep RT / Taq Mix respectively.
[0041] Figure 5 The results of the sensitivity and stability of PCR detection. Among them: DNA Maker; Lane 1, 2, Lane 3, 4, Lane 5, 6, Lane 7, 8 correspond to the dilution multiples of mixed templates respectively.
[0042] Figure 6 The results of the detection of field samples. Among them: M: DNA Maker; 1-9: mixed field rice virus samples infected. DETAILED DESCRIPTION
[0043] The technical solutions of the present application will be described below in conjunction with the embodiments. Obviously, the described embodiments are part of the embodiments of the present application, rather than all the embodiments. Based on the embodiments in the present application, all other embodiments obtained by those skilled in the art without creative labor fall within the scope of protection of the present application.
[0044] The materials and reagents used in the present application are as follows:
[0045] 1、Materials: Rice samples infected with RDV, RSV, SRBSDV, RRSV, RGSV and RBSDV, and healthy rice samples were collected from the experimental field of the Center for Vector-borne Virus Research, Fujian Agriculture and Forestry University.
[0046] 2、Main reagents: Plant total RNA extraction kit was purchased from Omega-BioTek Company (EZNA Total RNA Kit 1; R6834-02); Toyobo high-efficiency reverse transcription ReverTra Ace kit (TRT-101); GenStart StarScript II one-step RT-PCR kit (A215), and all primers were synthesized by Fuzhou Shangya Biotechnology Co., Ltd.
[0047] Example 1
[0048] 1、Extraction of total RNA from rice leaves
[0049] 6 samples of total RNA of rice virus, mixed infection samples and healthy rice samples were extracted according to the operation steps of the total RNA extraction kit (R6834-02) of Omega-BioTek Company: 0.1 g of rice leaves were ground into powder with liquid nitrogen and transferred into a 1.5 mL RNase-free centrifuge tube, 20 μL of mercaptoethanol was added to 1 mL of Buffer RCL, 500 μL of Buffer RCL was added to each sample, vortexed and mixed, incubated at 55°C for 3 min, centrifuged (12000 rpm, 5 min, 4°C), the supernatant was transferred to a DNA adsorption column, centrifuged (12000 rpm, 2 min, 4°C), and the liquid was transferred to a 1.5 mL RNase-free centrifuge tube, the same volume of RCB (about 450 μL) was added, mixed gently, the mixed solution was moved to the RNA adsorption column, centrifuged (10000 rpm, 1 min, 4°C), washed once with RWF 400 μL (10000 rpm, 1 min, 4°C), and the filtrate was discarded; DNase I digestion, 75 μL of digestion solution (DNA digestion enzyme 1.5 μL, 73.5 μL DNA digest buffer) was added to each sample, and it was left for 30 min; then washed once with RWF 400 μL (10000 rpm, 1 min, 4°C), the filtrate was discarded, 700 μL of Wash Buffer II was added, centrifuged (10000 rpm, 1 min, 4°C), the filtrate was discarded, 500 μL of RNA Wash Buffer II was added, centrifuged (10000 rpm, 1 min, 4°C), the RNA Mini Column was centrifuged at 1000 rpm for 2 min, then transferred to a new RNase-free 1.5 mL centrifuge tube, 50 μL of DEPC-H2O was added, and centrifuged at 12000 rpm for 1 min, the filtrate (RNA) was stored in a -80°C refrigerator for standby.
[0050] 2, one-step RT-PCR
[0051] The RNA extracted above was used as a template to use the one-step RT-PCR kit of Genstar, according to the recommended reaction system of the instruction: RNA template 1 μg, upstream primer (10 μM) 0.4 μL; downstream primer (10 μM) 0.4 μL; 5×Reaction Buffer 4 μL; One step RT / Taq mix 1.5 μL; supplemented with DEPC-ddH2O to 20 μL; reverse transcription reaction conditions: 50°C, 30 min; RT-PCR reaction conditions: pre-denaturation, 94°C, 2 min; denaturation, 94°C, 30 s; annealing, 58°C, 30 s; extension, 72°C, 1 min; (repeat denaturation, annealing and extension for 30 cycles); final extension, 72°C, 10 min.
[0052] 3. Design and selection of primers
[0053] The gene sequences of the coat protein (CP) of six rice viruses, RRSV, RSV, RDV, SRBSDV, RBSDV and RGSV, were retrieved from the National Center for Biotechnology Information (NCBI). Primer Premier 5.0 software was used to design primers, and the Oligo program was used to analyze whether secondary structures and 3' end pairing were present in each primer set. On this basis, according to the detection principle of one-step multiplex RT-PCR, the amplification of multiple target fragments was completed at similar annealing temperatures in one step, and detection primers for the six rice viruses with similar Tm values were selected. All primers were synthesized by Fuzhou Shangya Biotechnology Co., Ltd. (Table 1).
[0054] Table 1. Detection primers for multiplex RT-PCR
[0055]
[0056] A series of detection primers (Table 1) were designed using the CP gene sequences of the six rice viruses, RRSV, RSV, RDV, SRBSDV, RBSDV and RGSV, as templates. After experimental screening, one pair of specific detection primers was selected for each virus (Table 2), and the amplification products of different rice viruses could be clearly distinguished in 1.5% agarose gel, as shown in Figure 1. Among them, RRSV was 600 bp; RSV was 212 bp; RDV was 433 bp; SRBSDV was 973 bp; RBSDV was 808 bp; and RGSV was 300 bp. The negative control group did not produce amplification products. The above PCR products were confirmed by Sanger sequencing. It was confirmed that the detection primers listed in Table 2 met the detection rules of one-step multiplex RT-PCR. Figure 1
[0057] Table 2. Screening results of detection primers for the six rice viruses
[0058]
[0059] 4. Optimization of primer concentration for single RT-PCR of the six rice viruses
[0060] Except for the different gradients of primer concentration, the other components were used according to the recommended amounts of the kit, namely, 1 μg template, 4 μL Reaction Buffer, 1.5 μL Onestep RT / Taq Mix, and the annealing temperature was 58°C. According to the preliminary experiment, four gradients of primer concentrations were set for the detection of six rice viruses. The amounts of RSV and RBSDV detection primers were 0.3, 0.4, 0.5, and 0.6 μL, respectively, and the amounts of RDV, RRSV, RGSV, and SRBSDV detection primers were 0.2, 0.3, 0.4, and 0.5 μL, respectively. After the PCR program was completed, Figure 2 It can be seen that when the amount of RSV detection primer is 0.3 μL, the target amplification band is almost invisible. As the primer concentration increases, the band brightness gradually becomes clearer ( Figure 2 A), and finally selected 0.6 μL of virus detection primer (final concentration 0.3 μM) as the optimal dosage for RSV detection.
[0061] As mentioned above, the primer addition gradients for RDV detection were 0.2, 0.3, 0.4, and 0.5 μL, respectively. After the PCR program was completed, it could be seen from the gel electrophoresis that the RDV target band could be clearly amplified under different concentration gradients. Finally, the primer addition amount of 0.4 μL (final concentration of 0.2 μM) was selected as the optimal RDV detection amount ( Figure 2 B).
[0062] The primer addition gradients for detecting RGSV were 0.2, 0.3, 0.4, and 0.5 μL, respectively. From the gel electrophoresis diagram ( Figure 2 In C), it can be seen that as the primer concentration increases, the brightness of the band gradually becomes clearer. Finally, 0.5 μL of virus detection primer (final concentration of 0.25 μM) was selected as the optimal dosage for RGSV detection.
[0063] The primer addition gradients for detecting RRSV were 0.2, 0.3, 0.4, and 0.5 μL, respectively. Figure 2 D) shows that when the amount of detection primer added is 0.4 μL, the virus-specific amplification band is bright and clear. Finally, the amount of virus detection primer added is 0.4 μL (final concentration is 0.2 μM) as the optimal amount for RRSV detection.
[0064] The primer addition gradients for detecting RBSDV were 0.3, 0.4, 0.5, and 0.6 μL, respectively. After the PCR program was completed, the target band of RBSDV could be clearly amplified from the gel electrophoresis diagram under different concentration gradients. As the primer concentration increased, the brightness of the band became clearer ( Figure 2 E), and finally selected the virus detection primer dosage of 0.6 μL (final concentration of 0.3 μM) as the optimal RBSDV detection dosage.
[0065] The primer addition gradient for detecting SRBSDV is 0.2, 0.3, 0.4, 0.5 μL respectively, and after the PCR program, the gel electrophoresis result is as shown in Fig. 2. Figure 2 It can be seen from Fig. 2 that the target band of SRBSDV can be obviously amplified in the selected virus primer concentration range, and the amplification effect is obviously better than that of the other five primers in the range, and finally the virus detection primer addition of 0.2 μL (the final concentration is 0.1 μM) is selected as the optimal SRBSDV detection amount.
[0066] 5. Optimization of annealing temperature of 6 rice virus primers under single RT-PCR
[0067] Under the condition that the amounts of template, Reaction Buffer and Onestep RT / Taq Mix are not changed according to the recommended amount of the kit, the optimal annealing temperature of PCR reaction is further explored in this embodiment. Accordingly, a series of gradient annealing temperatures (54, 56, 58, 60 °C respectively) are designed in the RT-PCR reaction, and the optimal upstream and downstream primer concentrations are selected for PCR reaction. The RT-PCR reaction program is as follows: RNA reverse transcription at 50 °C for 30 min; pre-denaturation at 94 °C for 2 min; (denaturation at 94 °C for 30 s; annealing temperature setting for 4 gradients for 30 s, extension at 72 °C for 1 min) for 35 cycles; final extension at 72 °C for 10 min. After gel electrophoresis, the result is as shown in Fig. 3. Figure 3 The results show that the PCR products of 6 different viruses are effectively amplified, and the size is correct. The four different gradient annealing temperatures have little effect on the amplification effect, which indicates that the primer specificity is good in the set range, and considering that increasing the annealing temperature is an effective means to inhibit the primer self-ligation, in order to avoid the occurrence of unexpected situations after primer mixing and reduce the mutual influence between primers, 58 °C is determined as the final annealing temperature for subsequent PCR amplification.
[0068] 6. Optimization of the amount of Onestep RT / Taq Mix
[0069] The enzyme is expensive, in order to save the amount of enzyme, under the premise of ensuring the amplification effect, the amount of Onestep RT / Taq Mix of the present application is optimized, and it is noticed in the use process that reducing the amount of enzyme can also amplify the specific band of virus. Under the premise of determining the upstream and downstream primer concentrations and the annealing temperature, the amount of Onestep RT / Taq Mix is further optimized, in order to ensure the amplification effect and reduce unnecessary mistakes, half of the recommended amount of the kit is determined as the minimum concentration (0.75 μL), and four gradient additions of 0.75, 1.0, 1.25, 1.5 μL are set, and after the PCR program, the gel electrophoresis result is as shown in Fig. 4. Figure 4 As shown in 6, four gradient enzyme dosages can all amplify the specific fragments of six viruses, and the amplification effect does not significantly increase with the increase of enzyme concentration, that is, the same amplification efficiency can be obtained when the dosage of Onestep RT / Taq Mix is half of the recommended dosage of the kit, so that more experimental cost is saved. Therefore, under the premise of ensuring the amplification effect, the dosage of Onestep RT / Taq Mix is finally determined to be 0.75 μL as the final amount.
[0070] 7. Sensitivity and stability analysis of multiplex one-step RT-PCR
[0071] The rice plants infected with RSV, RDV, RRSV, RGSV, RBSDV and SRSBDV respectively were extracted for RNA, and the six virus-specific detection primers were mixed in equal volume (the final concentrations were RSV 0.3 μM, RDV 0.2 μM, RGSV 0.25 μM, RRSV 0.2 μM, RBSDV 0.3 μM and SRSBDV 0.1 μM, respectively). The sensitivity and stability of virus detection were analyzed according to the program of multiplex one-step RT-PCR, the annealing temperature was set to 58°C, the extension time was 1 min, and the other reaction parameters were set according to the recommendation. The results are shown in Figure 5 As shown in 6, four gradient enzyme dosages can all amplify the specific fragments of six viruses, and the amplification effect does not significantly increase with the increase of enzyme concentration, that is, the same amplification efficiency can be obtained when the dosage of Onestep RT / Taq Mix is half of the recommended dosage of the kit, so that more experimental cost is saved. Therefore, under the premise of ensuring the amplification effect, the dosage of Onestep RT / Taq Mix is finally determined to be 0.75 μL as the final amount.
[0072] Example 2
[0073] In this example, the virus-infected rice samples collected in the field were extracted for RNA, and the actual application of multiplex one-step RT-PCR was practiced. The results are shown in 6. Whether it is a single virus or a complex infection of multiple viruses, this reaction system (multiplex one-step RT-PCR) can analyze the corresponding virus infection data, and the virus-specific amplification effect is obvious, further confirming the reliability and practicability of this detection method.
[0074] Based on the above examples, the application ultimately determines the optimal reaction system of multiplex one-step RT-PCR for detecting rice viruses: the final concentrations of the six virus-specific detection primers are RSV 0.3 μM (primer addition amount 0.6 μL), RDV 0.2 μM (primer addition amount 0.4 μL), RGSV 0.25 μM (primer addition amount 0.3 μL), RRSV 0.2 μM (primer addition amount 0.4 μL), RBSDV 0.3 μM (primer addition amount 0.6 μL), and SRSBDV 0.1 μM (primer addition amount 0.2 μL); the amount of one-step RT / Taq Mix is 0.75 μL; the amount of 5×Reaction Buffer is 4 μL; the amount of template is 1 μg; the annealing temperature is 58°C; and finally DEPC-ddH2O is added to 20 μL. The extension time is 1 min, and other reaction parameters are set according to the recommendations of the kit.
[0075] The multiplex RT-PCR in the application is a multi-site amplification in the same system, which is improved on the basis of single RT-PCR, but is not simply mixed. In the experimental process, the design of primers is a key factor affecting the amplification effect. Among the six rice viruses, the coat protein genes of some viruses are highly conserved, for example, RBSDV and SRSBDV. Primers are designed for conserved genes to avoid homology between primers and the formation of primer dimers, thereby ensuring the specific amplification of primers, approaching the sensitivity and stability of single RT-PCR detection, and ensuring similar amplification efficiency between the amplified fragments, which requires similar annealing temperatures. The experimental design of the application effectively avoids these situations.
[0076] On the other hand, the results of multiplex RT-PCR will appear multiple amplified fragments of different sizes, but the obtained electrophoresis bands are easy to distinguish different rice viruses, so it is necessary to ensure that adjacent size bands have a certain difference distribution, and the fragment size can be easily estimated under the reference of Maker. In the application, the Maker indicating bands are 100, 250, 500, 750, 1000, 2000, 3000, and 5000 bp. The target band of RSV-specific amplification is between 100 and 250 bp; the target bands of RGSV and RDV are between 250 and 500 bp, wherein RGSV is close to 250 bp and RDV is close to 500 bp; the target band of RRSV is between 500 and 750 bp; the target band of RBSDB is close to 750 bp; and the target band of SRSBDV is close to 1000 bp. The specific amplification bands of each rice virus are easy to distinguish, which meets the expected detection effect.
[0077] The multiplex one-step RT-PCR detection can simultaneously detect six rice viruses conveniently, quickly and reliably, saves detection cost, quickly obtains results, reduces workload, can conduct detailed and in-depth virological research, better studies the pathogenesis and virus-carrying rate of transmission media of field diseases of rice, provides an advantageous starting point for disease forecasting and prevention and control, lays a good technical foundation for the traceability of the cause of large-scale sudden virus disease outbreaks, and has a broad application prospect. SEQUENCE LISTING <110> Zhangzhou Vocational and Technical College <120> A kit for simultaneously detecting six rice viruses and application thereof <130> 20211207 <141> 2021-12-07 <160> 30 <170> SIPOSequenceListing 1.0 <210> 1 <211> 27 <212> DNA <213> Artificial Sequence (Artificial Sequence) <400> 1 cacacttctg tctcacttca actctct 27 <210> 2 <211> 27 <212> DNA <213> Artificial Sequence (Artificial Sequence) <400> 2 cttacgcaac gatgaacctt tctctat 27 <210> 3 <211> 27 <212> DNA <213> Artificial Sequence (Artificial Sequence) <400> 3 cacacttctg tctcacttca actctct 27 <210> 4 <211> 22 <212> DNA <213> Artificial Sequence (Artificial Sequence) <400> 4 agcaggaact tcacgacaac at 22 <210> 5 <211> 20 <212> DNA <213> Artificial Sequence <400> 5 tgtatgagcg ccaaaatgcg 20 <210> 6 <211> 20 <212> DNA <213> Artificial Sequence <400> 6 ccaccaccaa gtgagaacga 20 <210> 7 <211> 20 <212> DNA <213> Artificial Sequence <400> 7 aactgggtgt ggcaaaaacg 20 <210> 8 <211> 19 <212> DNA <213> Artificial Sequence <400> 8 cgaagctgcg acaggaaag 19 <210> 9 <211> 17 <212> DNA <213> Artificial Sequence <400> 9 agccattctt cgtcgcc 17 <210> 10 <211> 20 <212> DNA <213> Artificial Sequence <400> 10 tggacaggga ggttgttcgc 20 <210> 11 <211> 18 <212> DNA <213> Artificial Sequence <400> 11 ggcggaatgg atggtaat 18 <210> 12 <211> 18 <212> DNA <213> Artificial Sequence <400> 12 ggtgcttcac gatgggtt 18 <210> 13 <211> 20 <212> DNA <213> Artificial Sequence <400> 13 cggagagaga taacgcttgg 20 <210> 14 <211> 20 <212> DNA <213> Artificial Sequence <400> 14 cacagtaata accgcacgct 20 <210> 15 <211> 23 <212> DNA <213> Artificial Sequence <400> 15 atgtgcgttc agattcggat ttg 23 <210> 16 <211> 23 <212> DNA <213> Artificial Sequence <400> 16 aggcggcaga ccactattac tac 23 <210> 17 <211> 21 <212> DNA <213> Artificial Sequence <400> 17 cctctgagtt ggtctttgaa t 21 <210> 18 <211> 19 <212> DNA <213> Artificial Sequence <400> 18 ttggagatgg tcactgggc 19 <210> 19 <211> 23 <212> DNA <213> Artificial Sequence <400> 19 attgagaccc attagtaccg ttg 23 <210> 20 <211> 23 <212> DNA <213> Artificial Sequence <400> 20 agagcagttt cctgtagtcc cca 23 <210> 21 <211> 22 <212> DNA <213> Artificial Sequence <400> 21 ggtatgggat agtgtcctcg gt 22 <210> 22 <211> 22 <212> DNA <213> Artificial Sequence <400> 22 23tcagccaggt tctttgactt gc 22 24 20 21 22 23 20 24 20 21 22 23 20 24 24 21 22 23 24 19 20 21 22 23 19 20 20 21 22 23 20 20 20 21 22 23 gctacttcgt cagttagatc 20 <210> 29 <211> 18 <212> DNA <213> Artificial Sequence <400> 29 aagcagaggt gccatcgt 18 <210> 30 <211> 19 <212> DNA <213> Artificial Sequence <400> 30 gcatcttccc aaactaccg 19
Claims
1. A kit for simultaneous detection of six rice viruses, characterized in that, comprise: a primer set for detecting rice ragged stunt virus RRSV, a primer set for detecting rice stripe virus RSV, a primer set for detecting rice dwarf virus RDV, a primer set for detecting southern rice black-streaked dwarf virus SRBSDV, a primer set for detecting rice black-streaked dwarf virus RBSDV and a primer set for detecting rice grassy stunt virus RGSV; the primer set for detecting rice ragged stunt virus RRSV is as follows: RRSV CP (p8)-F CGGAGAGAGATAACGCTTGG RRSV CP (p8)-R CACAGTAATAACCGCACGCT; the primer set for detecting rice stripe virus RSV is as follows: RSV CP (pC3)-F GGCTGTGGACTCTTCTGACC RSV CP (pC3)-R TTGTCAGACCACGCTCCTTC; the primer set for detecting rice dwarf virus RDV is as follows: RDV CP (p8)-F TGTATGAGCGCCAAAATGCG RDV CP (p8)-R CCACCACCAAGTGAGAACGA; the primer set for detecting southern rice black-streaked dwarf virus SRBSDV is as follows: SRBSDV CP (p10)-F CACACTTCTGTCTCACTTCAACTCTCT SRBSDV CP (p10)-R CTTACGCAACGATGAACCTTTCTCTAT; the primer set for detecting rice black-streaked dwarf virus RBSDV is as follows: RBSDV CP(p10)-F GAAGGAAACATTACTTTGAAGCCC RBSDV CP(p10)-R CGCTCAACACTTCGCCAAT; the primer set for detecting rice grassy stunt virus RGSV is as follows: RGSV CP (pC5)-F ATTGAGACCCATTAGTACCGTTG RGSV CP (pC5)-R AGAGCAGTTTCCTGTAGTCCCCA. further comprise: Onestep RT / Taq Mix, 5×Reaction Buffer and DEPC-ddH2O. the rice virus is rice ragged stunt virus RRSV, rice stripe virus RSV, rice dwarf virus RDV, southern rice black-streaked dwarf virus SRBSDV, rice black-streaked dwarf virus RBSDV and rice grassy stunt virus RGSV. comprise the following steps: step 1, extracting total RNA from rice leaves; step 2, using the kit of claim 1 to perform RT-PCR amplification on the total RNA extracted from rice leaves in step 1, taking the total RNA as a template; 2. The kit for simultaneous detection of six rice viruses according to claim 1, characterized by, step 3, performing agarose gel electrophoresis detection on the PCR amplification product of step 2. 3. Use of the kit according to claim 1 for detecting a virus in rice, characterized in that, 4. The method for detecting the rice virus using the kit according to claim 1, characterized in that, The result judging criteria are as follows: the existence of rice stripe virus RSV is indicated by the appearance of a band between 100-250 bp; the existence of rice grassy stunt virus RGSV is indicated by the appearance of a band close to 250 bp, the existence of rice dwarf virus RDV is indicated by the appearance of a band close to 500 bp, the existence of rice ragged stunt virus RRSV is indicated by the appearance of a band between 500-750 bp, the existence of rice black streaked dwarf virus is indicated by the appearance of a band close to 750 bp, and the existence of southern rice black-streaked dwarf virus SRBSDV is indicated by the appearance of a band close to 1000 bp.
5. The method of claim 4, wherein, The RT-PCR amplification system in step 2 comprises: Onestep RT / Taq Mix 0.75 μL, 5 × Reaction Buffer 4 μL, 1 μg of template, 0.3 µM RSV primer 0.6 µL, 0.2 µM RDV primer 0.4 µL, 0.25 µM RGSV primer 0.3 µL, 0.2 µM RRSV primer 0.4 µL, 0.3 µM RBSDV primer 0.6 µL, 0.1 µM SRBSDV primer 0.2 µL, and DEPC-ddH2O, supplemented to 20 μL.
6. The method of claim 4, wherein, The RT-PCR amplification conditions in step 2 are as follows: Reverse transcription reaction conditions: 50 ℃, 30 min; RT-PCR reaction conditions: pre-denaturation, 94 ℃, 2 min; denaturation, 94 ℃, 30 s; annealing, 58 ℃, 30 s; extension, 72 ℃, 1 min; repeat denaturation, annealing and extension for 30 cycles; final extension, 72 ℃, 10 min.