Primer and method for detecting rice black-streaked dwarf virus based on recombinase polymerase amplification technology

Abstract

The invention designs a specific primer for detecting the rice black-streaked dwarf virus based on a recombinase polymerase amplification technology (RPA), and a rapid RBSDV detection method is invented by using the primer. According to the RBSDV rapid detection method based on the RPA amplification technology, exponential amplification of nucleic acid is carried out at the constant temperature of 42 DEG C, the amplification reaction can be completed within 30 minutes, and an RPA product can be qualitatively analyzed by using an agarose gel electrophoresis or lateral flow chromatography test strip method. On the premise that the pathogen identification accuracy and sensitivity are guaranteed, the consumed time is shorter, the pathogen types causing the field rice virus diseases can be efficiently and accurately detected, and the accurate prediction and forecasting capacity of frequent, new and sudden rice virus diseases is improved.

Description

Technical Field

[0001] This invention relates to the field of plant protection, and more specifically to primer design and the establishment of a rapid detection method for detecting rice black-streaked dwarf virus based on RPA amplification technology. Background Technology

[0002] Rice (Oryza sativa L.) is a staple food crop for about half the world's population and is widely cultivated in more than 100 countries, with Asia being the main growing region. Stable rice production is crucial for ensuring global food security. In my country's grain production, rice accounts for 25%–30% of the total sown area of ​​all grain crops, and its total output accounts for 40%–45% of the country's total grain output. Furthermore, two-thirds of my country's population relies on rice as their staple food; therefore, rice production holds a vital position in my country's national economy. With global climate change and the development of agricultural production methods, insect-borne rice viral diseases seriously threaten rice production security. Currently, 15 viruses have been isolated and identified from rice plants in Asia. Among them, Rice Black-Streaked Dwarf Virus (RBSDV) poses a significant threat to rice production. This virus belongs to the Fijivirus genus of the Reoviridae family. It is primarily transmitted by the rice planthopper via a non-ovulatory route. Infection in rice leads to stunted growth, dark green leaves with twisted and deformed new leaves, and white waxy nodule-like protrusions on the veins and stem base. It also causes abnormal heading or malformed panicle development, ultimately resulting in a decreased grain filling rate. Since its outbreak in Zhejiang Province in 1963, this disease has been prevalent in Jiangsu, Zhejiang, and other regions between 1990 and 2014. In 2010, it caused a rice yield reduction of over 1 million tons. Therefore, establishing rapid, accurate, and sensitive methods for detecting rice viruses is of great significance for the prevention and control of rice viral diseases.

[0003] Common methods for detecting RBSDV include electron microscopy, serological testing, and molecular biological methods. While electron microscopy allows direct observation of non-enveloped spherical virus particles characteristic of the Fijivirus genus, it requires complex sample preparation such as negative staining or ultrathin sectioning, making it unsuitable for detecting low concentrations of virus and unable to determine the virus's genome sequence or other biological information. Therefore, relying solely on this technique cannot guarantee accuracy, and the time-consuming process fails to meet the needs of rapid field detection. Because RBSDV and SRBSDV share 84% amino acid sequence homology, serological detection of RBSDV may result in cross-reactions with other rice viruses, leading to false positives. Compared to serological methods, molecular biological methods such as RT-PCR and qRT-PCR offer higher sensitivity, shorter detection times, and higher accuracy, and are widely used for plant virus detection. However, these techniques require sophisticated equipment, making them unsuitable for rapid virus detection needs at the grassroots level. Recombinase polymerase amplification (RPA) mainly consists of recombinase, single-strand binding protein, and DNA polymerase. The recombinase binds to primers to form a nucleic acid-protein complex and locates the template. The single-strand binding protein stabilizes the replaced DNA strand. Subsequently, the DNA polymerase recognizes the exposed 3' end of the primer after recombinase dissociation and begins amplification. Simultaneously, the DNA polymerase extends the primer and unwinds and amplifies the template. If the target sequence is present in the template, exponential amplification of DNA can be performed under isothermal conditions (37–40°C), completing the amplification reaction in 30 minutes. Alternatively, by adding reverse transcriptase to the reaction system, RNA can be directly used as a template to establish a reverse transcription-recombinase polymerase amplification (RT-RPA) reaction system, thus integrating reverse transcription and target sequence amplification. RPA products can be qualitatively or quantitatively analyzed using methods such as agarose gel electrophoresis, lateral flow dipstick (LFD) chromatography, and real-time quantitative PCR. Compared to existing plant virus detection methods, RPA-based detection methods are simple to operate, rapid, and highly specific. Therefore, establishing a rapid detection method for RBSDV based on RPA technology is of great significance for efficiently and accurately identifying the pathogens causing rice viral diseases in the field, improving the accuracy of prediction and forecasting of common, emerging, and sudden-onset rice viral diseases, and enabling targeted prevention and control measures. Summary of the Invention

[0004] To achieve rapid diagnosis of rice black-streaked dwarf virus (RBSDV), ensure rice growth safety, and overcome the problems existing in current detection techniques, this invention designs and establishes primers and a method for RBSDV based on RPA amplification technology. This makes virus detection more suitable for field use and reduces detection time while maintaining accuracy and sensitivity in pathogen identification.

[0005] To achieve the above objectives, the present invention is implemented through the following technical solution:

[0006] 1. Further optimized primers suitable for detecting RBSDV using RPA amplification technology are characterized by the following information on the specific detection primers designed and synthesized for this virus: forward primer RBSDV-RPA-F: 5'-3': TGCAAATTATCCAAATAGAGTTAGTATGCAC; reverse primer RBSDV-RPA-R: 5'-3': AATAGTAACTGCTTCTCGAGATGTAGGAC, with an amplified fragment size of 269bp.

[0007] 2. Further preferably, the 5' end of the forward specific detection primer of RBSDV is modified with a FAM group, and the 5' end of the reverse specific detection primer of RBSDV is modified with a Biotin group; or the 5' end of the forward specific detection primer of RBSDV is modified with a Biotion group, and the 5' end of the reverse specific detection primer of RBSDV is modified with a FAM group.

[0008] 3. A method for rapid detection of RBSDV based on RPA amplification technology, comprising the following steps:

[0009] 1) Further optimization: Total nucleic acid was extracted from the sample using the CTAB method (RNA extracted by other methods is also acceptable).

[0010] Take 2 mL sterile centrifuge tubes and add 1 large and 5 small sterile steel balls to each tube. Weigh approximately 0.1 g of diseased leaves into the centrifuge tubes, add 1.2 mL of CTAB buffer (2% CTAB, 2% PVP-40, 100 mM Tris-HCl, pH 8.0, 1.4 M NaCl, 20 mM EDTA, 0.2% mercaptoethanol), pre-cool in a -80℃ freezer for 3–5 min, then grind twice in a high-throughput tissue homogenizer at 60 Hz for 90 s; incubate at 65℃ for 45–60 min; centrifuge at 13000 rpm for 10 min, transfer 650 μL of supernatant to a new 1.5 mL centrifuge tube, add an equal volume of chloroform / isoamyl alcohol (24:1), vortex to mix for 30 s; centrifuge at 13000 rpm for 10 min, carefully transfer 500 μL of supernatant to a new 1.5 mL centrifuge tube, add 3… Add 50 μL of isopropanol, gently invert the centrifuge tube to mix the liquid thoroughly, let it stand at room temperature for 10 min, centrifuge at 13000 r / min for 15 min, and carefully aspirate the supernatant with a micropipette; add 500 μL of 75% ethanol to the precipitate, centrifuge at 13000 r / min for 10 min, carefully aspirate the supernatant with a micropipette, and allow the precipitate to air dry at room temperature for 10-15 min; add 100 μL of ddH2O and place on ice for 30 min, repeatedly pipette the liquid to dissolve the precipitate, and store at -80℃ for later use.

[0011] 2) Further preferred method: using the total nucleic acid extracted from the sample in step 1) as a template, RPA amplification is performed using the primer set described in claim 1 or 2.

[0012] The reagent kit used was the RNA isothermal rapid amplification kit (catalog number: WLRB8207KIT) manufactured by Anpu Future (Changzhou) Biotechnology Co., Ltd. The reaction system consisted of: 30 μL Buffer A, 2.5 μL Buffer B, 0.5 μL each of forward primer (10 μM) and reverse primer (10 μM), 1 μL RNA template, and 15.5 μL RNase-free ddH2O. The mixture was added to the reaction tube, thoroughly mixed, and incubated at 42°C for 30 min.

[0013] 3) Further optimization involves purifying the RPA product obtained in step 2.

[0014] Add 50 μL of phenol:chloroform:isoamyl alcohol (25:24:1) RNA extraction buffer to the RPA reaction product, mix well, centrifuge at 12000 rpm for 5 min, and collect the supernatant.

[0015] 4) Agarose gel electrophoresis to detect amplification results

[0016] Take 7.5 μL of the purified RPA product and electrophoresis it on a 1.5% agarose gel in 0.5×TBE buffer at 150V for 15 min. Observe the results.

[0017] 4. A method for rapid detection of RBSDV based on RPA-LFD technology, characterized by the following steps:

[0018] 1) Total nucleic acid was extracted from the sample using the CTAB method (RNA extracted by other methods is also acceptable), see Invention Content 3;

[0019] 2) Using the total nucleic acid extracted from the sample in step 1) as a template, RPA amplification is performed using the primer set described in claim 1 or 2, as described in invention content 3;

[0020] 3) Further optimization involves using lateral flow chromatography test strips to detect the amplification products.

[0021] The test strip contains a gold-labeled FAM antibody in the gold pad, a Biotion antibody in the test line, and a goat anti-mouse secondary antibody in the test line. Take 10 μL of RPA product, dilute it 10-fold, and add it all to the sample well of the test strip. If two bands appear on the test strip, one in the control area and one in the test area, the result is positive, indicating the presence of RBSDV in the sample. If only one band appears in the control area and no band appears in the test area, the result is negative, indicating the absence of RBSDV in the sample.

[0022] Beneficial effects of the invention

[0023] 1. By selecting conserved regions of the RBSDV genome sequence and avoiding parts with high nucleotide similarity in the genomes of the two viruses, and in accordance with the requirements of RPA amplification primer design, the RBSDV detection primers designed in this invention have good detection effect and detection specificity.

[0024] 2. This invention establishes a rapid detection method for RBSDV based on RPA amplification technology and combined with lateral flow chromatography technology, which greatly saves the detection time of rice virus diseases, reduces the detection difficulty, and improves the ability to quickly diagnose rice virus diseases in the field.

[0025] 3. The detection method for RBSDV based on RPA amplification technology established in this invention has good detection specificity, and the detection sensitivity is comparable to or better than that of conventional PCR.

[0026] 4. The RPA amplification kit used can amplify RNA as a template. For RNA viruses like RBSDV, no additional reverse transcription step is required, enabling one-step detection of RNA viruses. This reduces the number of steps, saves experimental time, and also reduces the contamination rate to some extent. Attached Figure Description

[0027] Figure 1 This study analyzes the primers and methods used for detecting RBSDV based on RPA amplification technology, and examines their detection effectiveness. M: TsingKe DL2000 DNA Marker; Mock: Healthy sample.

[0028] Figure 2 This study analyzes the primers and methods for detecting RBSDV based on RPA amplification technology, focusing on detection specificity; M: TsingKe DL2000 DNA Marker

[0029] Figure 3 Analysis of the detection effect of the rapid detection method for RBSDV based on RPA-LFD; Mock: Healthy samples

[0030] Figure 4 This is a detection specificity analysis based on RPA-LFD for rapid detection of RBSDV.

[0031] Figure 5 This study analyzed the detection sensitivity of RBSDV based on RPA-LFD rapid detection; a) the RPA-LFD detection specificity of RBSDV in rice plants; and b) the RPA-LFD detection specificity of RBSDV in planthoppers. Detailed Implementation

[0032] To make the objectives, technical solutions, and beneficial effects of the present invention clearer, the preferred embodiments of the present invention will be described in detail below to facilitate understanding by those skilled in the art.

[0033] Example 1: Primers and methods for detecting RBSDV based on RPA amplification technology; analysis of detection effect and specificity.

[0034] 1. Experimental materials

[0035] PCR verification confirmed that field samples were infected with RBSDV, RSV, and SRBSDV individually.

[0036] 2. Primer design and synthesis

[0037] A primer set suitable for detecting RBSDV using RPA amplification technology was designed and synthesized. The specific information is as follows: Forward primer, RBSDV-RPA-F: 5'-3': TGCAAATTATCCAAATAGAGTTAGTATGCAC; Reverse primer, RBSDV-RPA-R: 5'-3': AATAGTAACTGCTTCTCGAGATGTAGGAC; Amplified fragment size 269bp.

[0038] 3. Total nucleic acid was extracted from the samples using the CTAB method.

[0039] Take 2 mL sterile centrifuge tubes and add 1 large and 5 small sterile steel balls to each tube. Weigh approximately 0.1 g of diseased leaves into the centrifuge tubes, add 1.2 mL of CTAB buffer (2% CTAB, 2% PVP-40, 100 mM Tris-HCl, pH 8.0, 1.4 M NaCl, 20 mM EDTA, 0.2% mercaptoethanol), pre-cool in a -80℃ freezer for 3–5 min, then grind twice in a high-throughput tissue homogenizer at 60 Hz for 90 s; incubate at 65℃ for 45–60 min; centrifuge at 13000 rpm for 10 min, transfer 650 μL of supernatant to a new 1.5 mL centrifuge tube, add an equal volume of chloroform / isoamyl alcohol (24:1), vortex to mix for 30 s; centrifuge at 13000 rpm for 10 min, carefully transfer 500 μL of supernatant to a new 1.5 mL centrifuge tube, add 3… Add 50 μL of isopropanol, gently invert the centrifuge tube to mix the liquid thoroughly, let it stand at room temperature for 10 min, centrifuge at 13000 r / min for 15 min, and carefully aspirate the supernatant with a micropipette; add 500 μL of 75% ethanol to the precipitate, centrifuge at 13000 r / min for 10 min, carefully aspirate the supernatant with a micropipette, and allow the precipitate to air dry at room temperature for 10-15 min; add 100 μL of ddH2O and place on ice for 30 min, repeatedly pipette the liquid to dissolve the precipitate, and store at -80℃ for later use.

[0040] 4. RPA amplification

[0041] The RNA isothermal rapid amplification kit (catalog number: WLRB8207KIT) manufactured by Anpu Future (Changzhou) Biotechnology Co., Ltd. was used. The reaction system consisted of: 30 μL Buffer A, 2.5 μL Buffer B, 0.5 μL each of forward primer (10 μM) and reverse primer (10 μM), 1 μL RNA template, and 15.5 μL RNase-free ddH2O. The mixture was added to the reaction tube, thoroughly mixed, and incubated at 42°C for 30 min.

[0042] 5. RPA product purification

[0043] Add 50 μL of phenol:chloroform:isoamyl alcohol (25:24:1) RNA extraction buffer to the RPA reaction product, mix well, centrifuge at 12000 rpm for 5 min, and collect the supernatant.

[0044] 6. Agarose gel electrophoresis to detect amplification results

[0045] Take 7.5 μL of the purified RPA product and electrophoresis it on a 1.5% agarose gel in 0.5×TBE buffer at 150V for 15 min. Observe the results.

[0046] 7. Results Analysis

[0047] RBSDV primers were used to perform RPA amplification on nucleic acid templates from both virus-infected and healthy samples. The purified RPA amplification products were then detected by agarose gel electrophoresis. The results showed that the designed RBSDV primers effectively amplified the target fragment. Figure 1 This demonstrates that the designed primer combination and RPA reaction system have good amplification effects. Further analysis of the detection specificity of the designed RBSDV detection primers was conducted. RPA detection was performed on samples infected with RBSDV, RSV, and SRBSDV using the aforementioned primers. Agarose gel electrophoresis results showed that the designed detection primers could only amplify the target band in samples containing the corresponding virus. Figure 2 This demonstrates that the designed RBSDV-specific detection primers have good detection specificity.

[0048] Case Study 2: Analysis of the Detection Effect of a Rapid RBSDV Detection Method Based on RPA Amplification Technology Combined with Sideflow Chromatography (RPA-LFD)

[0049] 1. Experimental materials

[0050] PCR confirmed that the field samples were infected with RBSDV alone.

[0051] 2. Primer design and synthesis

[0052] Primers suitable for RPA amplification technology to detect RBSDV were designed and synthesized. The specific information is as follows: Forward primer, RBSDV-RPA-F: 5'-3': TGCAAATTATCCAAATAGAGTTAGTATGCAC; Reverse primer, RBSDV-RPA-R: 5'-3': AATAGTAACTGCTTCTCGAGATGTAGGAC, with an amplified fragment size of 269bp.

[0053] The 5' end of the forward specific detection primer for RBSDV is modified with a FAM group, and the 5' end of the reverse specific detection primer for RBSDV is modified with biotin.

[0054] 3. Total nucleic acid was extracted from the samples using the CTAB method.

[0055] Take 2 mL sterile centrifuge tubes and add 1 large and 5 small sterile steel balls to each tube. Weigh approximately 0.1 g of diseased leaves into the centrifuge tubes, add 1.2 mL of CTAB buffer (2% CTAB, 2% PVP-40, 100 mM Tris-HCl, pH 8.0, 1.4 M NaCl, 20 mM EDTA, 0.2% mercaptoethanol), pre-cool in a -80℃ freezer for 3–5 min, then grind twice in a high-throughput tissue homogenizer at 60 Hz for 90 s; incubate at 65℃ for 45–60 min; centrifuge at 13000 rpm for 10 min, transfer 650 μL of supernatant to a new 1.5 mL centrifuge tube, add an equal volume of chloroform / isoamyl alcohol (24:1), vortex to mix for 30 s; centrifuge at 13000 rpm for 10 min, carefully transfer 500 μL of supernatant to a new 1.5 mL centrifuge tube, add 3… Add 50 μL of isopropanol, gently invert the centrifuge tube to mix the liquid thoroughly, let it stand at room temperature for 10 min, centrifuge at 13000 r / min for 15 min, and carefully aspirate the supernatant with a micropipette; add 500 μL of 75% ethanol to the precipitate, centrifuge at 13000 r / min for 10 min, carefully aspirate the supernatant with a micropipette, and allow the precipitate to air dry at room temperature for 10-15 min; add 100 μL of ddH2O and place on ice for 30 min, repeatedly pipette the liquid to dissolve the precipitate, and store at -80℃ for later use.

[0056] 4. RPA amplification

[0057] The RNA isothermal rapid amplification kit (catalog number: WLRB8207KIT) manufactured by Anpu Future (Changzhou) Biotechnology Co., Ltd. was used. The reaction system consisted of: 30 μL Buffer A, 2.5 μL Buffer B, 0.5 μL each of forward primer (10 μM) and reverse primer (10 μM), 1 μL RNA template, and 15.5 μL RNase-free ddH2O. The mixture was added to the reaction tube, thoroughly mixed, and incubated at 42°C for 30 min.

[0058] 5. Detection of amplification products using lateral flow chromatography test strips.

[0059] Take 10 μL of RPA product, dilute it 10 times, and add it all to the sample well of the test strip. Wait 5 minutes and observe the color development results.

[0060] 6. Results Analysis

[0061] Using RBSDV primers (the forward primer with FAM modification at the 5' end and the reverse primer with Biotion modification at the 5' end), RPA amplification was performed on nucleic acid templates from samples infected with the virus and nucleic acid templates from healthy samples. The RPA amplification products were diluted and tested using a test strip with a gold-labeled pad containing gold-labeled FAM antibody, a test line containing Biotion antibody, and a control line containing goat anti-mouse secondary antibody. The results showed that both the test line and the control line on the test strip infected with the corresponding virus showed color, while only the control line on the healthy plant sample showed color. Figure 3 This demonstrates that the established RPA-LFD system has good amplification effect.

[0062] Implementation Case 3: Detection Specificity Analysis of a Rapid RBSDV Detection Method Based on RPA-LFD

[0063] 1. Experimental materials

[0064] PCR verification confirmed that field samples were infected with RBSDV, RSV, and SRBSDV individually.

[0065] 2. Primer design and synthesis

[0066] Primers suitable for RPA amplification technology to detect RBSDV were designed and synthesized. The specific information is as follows: Forward primer, RBSDV-RPA-F: 5'-3': TGCAAATTATCCAAATAGAGTTAGTATGCAC; Reverse primer, RBSDV-RPA-R: 5'-3': AATAGTAACTGCTTCTCGAGATGTAGGAC, with an amplified fragment size of 269bp.

[0067] The 5' end of the forward specific detection primer for RBSDV is modified with a FAM group, and the 5' end of the reverse specific detection primer for RBSDV is modified with biotin.

[0068] 3. Total nucleic acid was extracted from the samples using the CTAB method.

[0069] Take 2 mL sterile centrifuge tubes and add 1 large and 5 small sterile steel balls to each tube. Weigh approximately 0.1 g of diseased leaves into the centrifuge tubes, add 1.2 mL of CTAB buffer (2% CTAB, 2% PVP-40, 100 mM Tris-HCl, pH 8.0, 1.4 M NaCl, 20 mM EDTA, 0.2% mercaptoethanol), pre-cool in a -80℃ freezer for 3–5 min, then grind twice in a high-throughput tissue homogenizer at 60 Hz for 90 s; incubate at 65℃ for 45–60 min; centrifuge at 13000 rpm for 10 min, transfer 650 μL of supernatant to a new 1.5 mL centrifuge tube, add an equal volume of chloroform / isoamyl alcohol (24:1), vortex to mix for 30 s; centrifuge at 13000 rpm for 10 min, carefully transfer 500 μL of supernatant to a new 1.5 mL centrifuge tube, add 3… Add 50 μL of isopropanol, gently invert the centrifuge tube to mix the liquid thoroughly, let it stand at room temperature for 10 min, centrifuge at 13000 r / min for 15 min, and carefully aspirate the supernatant with a micropipette; add 500 μL of 75% ethanol to the precipitate, centrifuge at 13000 r / min for 10 min, carefully aspirate the supernatant with a micropipette, and allow the precipitate to air dry at room temperature for 10-15 min; add 100 μL of ddH2O and place on ice for 30 min, repeatedly pipette the liquid to dissolve the precipitate, and store at -80℃ for later use.

[0070] 4. RPA amplification

[0071] The RNA isothermal rapid amplification kit (catalog number: WLRB8207KIT) manufactured by Anpu Future (Changzhou) Biotechnology Co., Ltd. was used. The reaction system consisted of: 30 μL Buffer A, 2.5 μL Buffer B, 0.5 μL each of forward primer (10 μM) and reverse primer (10 μM), 1 μL RNA template, and 15.5 μL RNase-free ddH2O. The mixture was added to the reaction tube, thoroughly mixed, and incubated at 42°C for 30 min.

[0072] 5. Detection of amplification products using lateral flow chromatography test strips.

[0073] Take 10 μL of RPA product, dilute it 10 times, and add it all to the sample well of the test strip. Wait 5 minutes and observe the color development results.

[0074] 6. Results Analysis

[0075] The detection specificity of the established RPA-LFD method for RBSDV was further analyzed. The primers described above were used to perform RPA detection on samples infected with RBSDV, RSV, and SRBSDV, respectively. The RPA amplification products were diluted and detected using test strips. The results showed that the established rapid RPA-LFD detection method has good detection specificity. Figure 4 ).

[0076] Implementation Case 4: Sensitivity Analysis of Rapid RBSDV Detection Based on RPA-LFD

[0077] 1. Experimental materials

[0078] PCR verification showed that total nucleic acid from field samples infected with RBSDV alone was diluted 10-fold to 10-10 times as nucleic acid templates. PCR verification also showed that total nucleic acid from RBSDV-infected or non-virulent planthoppers was mixed in different ratios (1:0 to 1:9999, virulent:non-virulent), and the resulting nucleic acid mixtures served as nucleic acid templates.

[0079] 2. Primer design and synthesis

[0080] Primers suitable for RPA amplification technology to detect RBSDV were designed and synthesized. The specific information is as follows: Forward primer, RBSDV-RPA-F: 5'-3': TGCAAATTATCCAAATAGAGTTAGTATGCAC; Reverse primer, RBSDV-RPA-R: 5'-3': AATAGTAACTGCTTCTCGAGATGTAGGAC, with an amplified fragment size of 269bp.

[0081] The 5' end of the forward specific detection primer for RBSDV is modified with a FAM group, and the 5' end of the reverse specific detection primer for RBSDV is modified with biotin.

[0082] 3. RPA amplification

[0083] The RNA isothermal rapid amplification kit (catalog number: WLRB8207KIT) manufactured by Anpu Future (Changzhou) Biotechnology Co., Ltd. was used. The reaction system consisted of: 30 μL Buffer A, 2.5 μL Buffer B, 0.5 μL each of forward primer (10 μM) and reverse primer (10 μM), 1 μL RNA template, and 15.5 μL RNase-free ddH2O. The mixture was added to the reaction tube, thoroughly mixed, and incubated at 42°C for 30 min.

[0084] 4. Detection of amplification products using lateral flow chromatography test strips.

[0085] Take 10 μL of RPA product, dilute it 10 times, and add it all to the sample well of the test strip. Wait 5 minutes and observe the color development results.

[0086] 5. Results Analysis

[0087] RPA-LFD detection was performed on nucleic acid templates with different dilution ratios or mixing ratios. The results showed that the lowest effective detection concentration of RBSDV based on RPA-LFD for rice plants was 10⁻⁸ nucleic acid stock solution, and the detection limit for RBSDV in planthoppers was 0.01%, demonstrating that the established RPA-LFD rapid detection method has high detection sensitivity.

[0088] Finally, it should be noted that the above preferred embodiments are only used to illustrate the technical solutions of the present invention and are not intended to limit it. Although the present invention has been described in detail through the above preferred embodiments, those skilled in the art should understand that various changes can be made to it in form and detail without departing from the scope defined by the claims of the present invention.

[0089] The above implementation does not limit the scope of this invention in any way.

Claims

1. A primer set suitable for detecting RBSDV using RPA amplification technology, characterized in that: The specific detection primers designed and synthesized are as follows: Forward primer, RBSDV-RPA-F: 5'-3': TGCAAATTATCCAAATAGAGTTAGTATGCAC; Reverse primer, RBSDV-RPA-R: 5'-3': AATAGTAACTGCTTCTCGAGATGTAGGAC, amplified fragment size 269bp.

2. The primer set according to claim 1, characterized in that: The 5' end of the forward specific detection primer for RBSDV is modified with a FAM group, and the 5' end of the reverse specific detection primer for RBSDV is modified with a Biotin group; or the 5' end of the forward specific detection primer for RBSDV is modified with a Biotion group, and the 5' end of the reverse specific detection primer for RBSDV is modified with a FAM group.

3. The primer set as described in claim 1 or 2 is used to detect whether a biological sample contains RBSDV.

4. A method for rapid detection of RBSDV based on RPA amplification technology, characterized in that, Includes the following steps: 1) Extract total nucleic acid from the sample using the CTAB method (RNA extracted by other methods is also acceptable); 2) Using the total nucleic acid extracted from the sample in step 1) as a template, RPA amplification was performed using the primer set described in claim 1 or 2. The reaction system consisted of: 30 μL Buffer A, 2.5 μL Buffer B, 0.5 μL each of the forward primer (10 μM) and the reverse primer (10 μM), 1 μL RNA template, and 15.5 μL RNase-free ddH2O. The above system was added to the reaction tube, mixed thoroughly, and then placed at 42°C for 30 min. 3) Purify the RPA product obtained in step 2; 4) Agarose gel electrophoresis was used to detect the amplification results.

5. A method for rapid detection of RBSDV based on RPA amplification technology combined with lateral flow chromatography (LFD), characterized in that, Includes the following steps: 1) Extract total nucleic acid from the sample using the CTAB method (RNA extracted by other methods is also acceptable); 2) Using the total nucleic acid extracted from the sample in step 1) as a template, RPA amplification was performed using the primer set described in claim 1 or 2. The reaction system consisted of: 30 μL Buffer A, 2.5 μL Buffer B, 0.5 μL each of forward primer (10 μM) and reverse primer (10 μM), 1 μL RNA template, and 15.5 μL RNase-free ddH2O. The above system was added to a reaction tube, mixed thoroughly, and then placed at 42°C for 30 min. 3) Detect the amplification products using side-flow chromatography test strips.

Images