Transcriptional regulation factor OsSEUSS gene and application thereof in resisting southern rice black-streaked dwarf virus
By editing the rice OsSEUSS gene using CRISPR/Cas9 technology, constructing the YL-Hu-OsSEUSS vector, and introducing it into rice varieties, the problem of insufficient resistance of rice varieties to Southern Rice Black-Streaked Dwarf Virus was solved, significantly enhancing antiviral capabilities and enriching the molecular mechanisms of rice virus interactions.
Patent Information
- Application Number
- CN202411591678.1
- Authority / Receiving Office
- CN · China
- Patent Type
- Applications(China)
- Current Assignee / Owner
- Filing Date
- 2024-11-08
- Publication Date
- 2026-05-08
AI Technical Summary
Existing rice varieties lack broad-spectrum resistance to Southern Rice Black-Streaked Dwarf Virus, leading to problems such as stunted growth and reduced yield caused by viral infection. Furthermore, the mechanism of OsSEUSS in rice's antiviral immunity is unclear in current research.
The rice OsSEUSS gene was targeted and edited using CRISPR/Cas9 technology, and the YL-Hu-OsSEUSS vector was constructed. It was then introduced into rice varieties via Agrobacterium-mediated transformation to obtain Osseuss-5# and Osseuss-16# transgenic rice, which negatively regulated OsSEUSS gene expression to enhance antiviral ability.
It significantly enhances rice's resistance to Southern Rice Black-Streaked Dwarf Virus, alleviates dwarfism symptoms, reduces virus accumulation, and provides a theoretical basis and technical support for green control of rice viral diseases.
Smart Images

Figure CN121991963A_ABST
Abstract
Description
Technical Field
[0001] This invention relates to the fields of transgenic technology and plant disease control, specifically to the targeted editing of the rice OsSEUSS gene containing the LIM-binding domain transcriptional regulator using CRISPR / Cas9 technology and its application in resistance to southern rice black-streaked dwarf disease. Background Technology
[0002] Rice viral diseases are a serious type of systemic infectious disease affecting rice crops in my country. Due to their sudden onset, severe damage, and large affected areas, they have always been a key and challenging aspect of pest and disease control. Southern rice black-streaked dwarf virus (SRBSDV) is a malignant viral disease of rice caused by Southern rice black-streaked dwarf virus (SRBSDV). This virus was first identified and named in my country as a new species of virus that harms crops. It was first discovered in 2001 by Professor Zhou Guohui of South China Agricultural University in Yangxi County, Guangdong Province, and was officially identified as a new species of Southern rice black-streaked dwarf virus in 2008. Subsequently, it has spread to many major rice-producing areas, including Guangxi, Hunan, Hubei, Hainan, Jiangxi, Zhejiang, Fujian, and Anhui, posing a significant threat to rice production in my country. It is now listed as a Class A crop pest and disease by the Ministry of Agriculture and Rural Affairs.
[0003] SRBSDV has a wide host range in the field. Besides damaging rice, it can also infect many other gramineous plants and weeds, such as corn, wheat, sorghum, barnyard grass, foxtail, and others. Under natural conditions, SRBSDV is transmitted by the white-backed planthopper. Typical symptoms after infection include stunted growth, increased tillering, short, broad, stiff, dark green leaves with waxy white nodular protrusions along the veins and stem base. Infected plants may fail to head or produce incomplete headings, often leading to reduced yields or even total crop failure. In recent years, many domestic and international scholars have made good progress in discovering resistance genes to effectively control rice virus diseases. However, for such a diverse range of rice viruses, the rice germplasm currently widely planted and promoted in my country (including conventional rice, hybrid rice, sterile lines, and restorer lines) still lacks broad-spectrum resistance. Therefore, the system screens key host factors that interact with these rice viruses and identifies key genes or pathways that enable rice to be broadly resistant or highly susceptible. By using targeted modification, rice can be protected from viral hostage-taking while enhancing its broad-spectrum antiviral ability, providing an important theoretical basis and technical support for the integrated control of rice viral diseases and crop improvement.
[0004] SEUSS, a transcription factor initially cloned from Arabidopsis thaliana in 2002, encodes a protein containing at least two glutamine-rich domains (Q-rich) and a highly conserved heteropolymerized LIM-binding domain (LDB). LIM domains are a class of regulatory factors widely found in eukaryotes, playing a crucial role in cell development. They directly participate in various physiological and biochemical processes, including gene transcription, cytoskeleton formation, and signal transduction, and also play a vital role in regulating plant organ development and morphogenesis. For example, in both monocotyledonous rice and dicotyledonous Arabidopsis thaliana, the deletion of the key SEUSS gene leads to inhibited plant growth and development, partial loss of floral organ types, shortened taproots, and reduced lateral root numbers. Furthermore, researchers have found that in Arabidopsis thaliana, SEUSS can also function as a crucial component of the light-temperature signaling pathway, complexly regulating plant morphogenesis to achieve precise control over growth and development, enabling plants to better adapt to light-temperature environments. Besides regulating plant growth and development, the SEUSS transcription factor can also participate in regulating plant stress responses. Existing studies have found that when Arabidopsis senses osmotic stress, SEUSS can induce liquid-liquid phase separation in plant cells through its intrinsically disordered region (IDR) at its N-terminus, forming biomolecule aggregates to promote the expression of osmotic stress genes, thereby enhancing the plant's tolerance to hyperosmotic stress. Although preliminary research on the function of the SEUSS protein has been observed in dicotyledonous Arabidopsis, related studies on its application in rice stress resistance are limited, especially regarding the mechanism by which OsSEUSS regulates plant antiviral immunity under viral infection conditions. Summary of the Invention
[0005] To address the shortcomings of existing technologies, this invention relates to a method for targeted editing of the rice OsSEUSS gene, a transcriptional regulator containing a LIM-binding domain, using CRISPR / Cas9 technology.
[0006] On the one hand, the OsSEUSS gene has the nucleotide sequence shown in SEQ ID NO.1.
[0007]
[0008] On the other hand, the amino acid sequence (SEQ ID NO: 2) of the rice LIM-binding domain transcriptional regulatory factor OsSEUSS gene is as follows:
[0009] MSGAPCSNLGLVPRDMHGSIPISTTNSSGPSIGVSSLVTDANSSLSGGAQLQPSTSMNADSFMRLPASPMSFSSNNISGSSVIDGPIVQQSPPQEQMQKRRSSSVTSQPVIDAAGALHAQKKSRVDIRQDDILQHNLIQQLLQGQSSLHLQGQQNPQIQALIHQHKLAQIQQQQQHQMLQPFSQIQQSQVGIPRQPQLRPPLAQPGMQLAGPVRTPVENGLCSRRLKQYLYHKRHRPENNPITYWRKLIDEYFAPRARERWCVSSYEKRGNPSGAVPHTAPDSWRCDICNTHGGKGYEATYEILPRLCQIRFDHGVIDEYLFLDMANEFRLPNGLMLLEHTKVVQKSIYEHMHVIHEGQLRIIFTPELKIMSWEFCSRRHDEYITRRFLSPQVAHLLQVAQKYQTVATESGPAGVSNSDAQNICNMFVTASRQLAKNIDHHTLNEHGLSKRYVRCLQISEVVNHMKDLIEFSHKNKLGPIEGLKSYPKQTAAKLPVQNMHEPKQLMAAAGLPNDQTNLKAMGVKTEMNTHANETHGIGPIGNGPQNAAALNNYQNPIGNGLQNAAALNNYQNILRSSVANQSLLQQEASSMFKGPTAMHNGIQLEASRSFRGPNQVHLAQFQHPASFQQPMPQQSSLQGLGVSPQYQQHVLHQLLQEAKNTNNRVLAQQQQQQQLQHAPANSGLASGGTAITGSAASGDHMNNNGAVKGGTPMVTTGPSSVINNTASILPSRSNSFKSVSSNPQVAAAAGGGIGSGGHAATPKADALHELDDLDNLGNLISTELEESGLFLGDQAGGGYSWNM*
[0010] On the other hand, the target for the CRISPR / Cas9 system to directionally edit the OsSEUSS gene is shown in SEQ ID NO:3: GCTAACTCATCGCTCTCCGGAGG.
[0011] On the other hand, this invention relates to the application of the rice OsSEUSS gene, which contains the LIM-binding domain transcriptional regulator, in the breeding of crops resistant to the Fijivirus genus of the Reoviridae family, particularly in the breeding of gramineous food crops;
[0012] In some embodiments, the Fijivirus genus includes Maize Rough Dwarf Virus (MRDV), Rice Black Streaked Dwarf Virus (RBSDV), and Southern Rice Black Streaked Dwarf Virus (SRBSDV).
[0013] In some implementations, the Fijivirus genus most preferably includes Southern Rice Black-Streaked Dwarf Virus and Rice Black-Streaked Dwarf Virus.
[0014] In some implementations, the preferred gramineous food crops are rice, maize, wheat, oats, and barley; more preferably rice, with the most preferred being chopped corn 11.
[0015] In some implementations, the negative regulation of OsSEUSS gene expression is achieved via a CRISPR / Cas9 system; the target of the CRISPR / Cas9 system is shown in SEQ ID NO:3.
[0016] On the other hand, the present invention relates to a method for preparing a transgenic plant resistant to southern rice black-streaked dwarf disease, the steps of which include:
[0017] 1) Construction of rice OsSEUSS gene knockout vector;
[0018] 2) Rice genetic transformation, Agrobacterium-mediated transformation and callus induction culture;
[0019] 3) Identification of positive transgenic plants;
[0020] In some embodiments, the construction steps of the rice OsSEUSS gene knockout vector further include: designing primers based on the OsSEUSS sequence shown in SEQ ID No:1 on the CRISPR-GE website (http: / / skl.scau.edu.cn / ), cloning the gene sgRNA fragment from rice, and recovering the PCR product from the gel; using the pYLsgRNA-OsU3 vector as a template, ligating the target sequence to the U3 promoter and gRNA scaffold respectively; mixing the two PCR products as a template, and using overlapping PCR to ligate the U3 promoter, target sequence, and gRNA scaffold together to form an sgRNA expression cassette; mixing the gRNA expression cassette product and the uncut pYLCRISPR / Cas9Pubi-H plasmid, and digesting them with BsaI at 37℃ for 15 min; after digestion, adding 1.5 μL of 10×DNA Ligase Buffer and 35 U T4. The ligase was digested and ligated for 15 cycles using a variable-temperature cycling program: 37℃ for 5 min, 10℃ for 5 min, and 20℃ for 5 min. Positive clones were selected and sequenced to confirm the successful construction of the expression vector YL-Hu-OsSEUSS. The recombinant plasmid was obtained, and its quality was detected by 1% agarose gel electrophoresis.
[0021] In some embodiments, the steps of rice genetic transformation, Agrobacterium transformation, and callus induction culture further include:
[0022] Callus induction: First, select mature rice seeds, peel off the husks, pour them into centrifuge tubes, add 75% ethanol for 1 minute for disinfection, then discard the ethanol, rinse three times with sterile water, then add 15 mL of 30% sodium hypochlorite for 20 minutes for disinfection, then discard the sodium hypochlorite and rinse 5-6 times with sterile water; use a pipette to remove excess water, transfer the seeds to the induction medium, and incubate in a 28℃ light incubator for 3 weeks; use pre-sterilized forceps to transfer the callus tissue to the subculture medium, and subculture in a 28℃ light incubator for 1 week;
[0023] Transformation and culture of Agrobacterium: The plasmid containing the target vector was transformed into Agrobacterium rhizogenes GV3101 using the following steps: 5 μL of plasmid was added to 100 μL of competent Agrobacterium GV3101 cells, and the mixture was stirred by pipetting. The mixture was then added to a sterile electrode cup that had been pre-cooled to 4°C. Electroporation was performed at 220V. LB liquid medium without antibiotics was added, and the mixture was incubated at 28°C with shaking for about 3 hours. The mixture was then evenly spread on LB solid medium containing 50 μg / L Kan and 50 μg / L Rif, and incubated in the dark at 28°C for 2 days until single colonies appeared.
[0024] Agrobacterium transfection: Use a pipette to aspirate the infection solution and wash off the Agrobacterium on the plate to obtain the Agrobacterium suspension used for co-culture transformation of rice. Select a sufficient number of callus tissues and place them in a 100ml sterile Erlenmeyer flask. Add an appropriate amount of Agrobacterium suspension and incubate at room temperature for 20 minutes, shaking occasionally. Discard the bacterial solution, place the callus tissues on sterile filter paper to absorb excess bacterial solution, and then transfer them to a solid co-culture medium lined with a layer of sterile filter paper. Incubate at 26°C in the dark for 3 days.
[0025] Screening Culture: After 3 days of co-culture, the callus tissue needs to be cleaned. Using a 1mL blue pipette tip, the callus on the co-culture medium is transferred to a sterilized Erlenmeyer flask. Sterile water is added to rinse both sides. For the third rinse, sterile water containing 500ug / L carbenicillin is used. After removing excess water with a pipette, the callus is transferred to sterile filter paper and dried using the air blower in a laminar flow hood for about 30 minutes. After the callus is dried, it is transferred to a medium containing hygromycin B for screening culture. The culture conditions are 28-30℃, dark culture; the screening time is 3-4 weeks.
[0026] Seedling rooting: When the differentiated seedlings grow to about 2-3cm and have obvious roots, they can be transferred to rooting medium to allow them to grow. The rooting medium should be poured into a relatively tall bottle or tube so that the rooted seedlings have enough space to grow tall. Rooting culture conditions: 28-30℃, sterile light culture.
[0027] In some embodiments, the identification of the positive transgenic plants further includes: taking young leaves from T0 and T1 generation single plants, extracting DNA, amplifying the sgRNA target site using target-specific primers, detecting the amplified products by 1% gel electrophoresis, recovering the band-specific and correctly sized fragments, and sequencing them. These were named Osseuss-ko (Osseuss-5# and Osseuss-16#), demonstrating the successful construction of the transgenic rice line.
[0028] In some embodiments, the identification step of the positive transgenic plant further includes:
[0029] The resistance of the CRISPR / Cas9 gene knockout mutant Osseuss-ko transgenic line to Southern Rice Black-Streaked Dwarf Virus was tested by artificial inoculation with SRBSDV.
[0030] In some embodiments, the induction medium comprises: N6 medium 24.1 g / L, 2 mg / L 2,4-D, pH 5.8.
[0031] In some embodiments, the subculture medium comprises: N6 medium 24.1 g / L, 2 mg / L 2,4-D, 50 mg / L hygromycin, 300 mg / mL cephalosporin, pH 5.8.
[0032] In some embodiments, the rooting medium comprises: 1 / 2 MS 39.45 g / L, 0.5 mg / L NAA, 50 mg / L hygromycin, pH 5.8.
[0033] In some embodiments, the co-culture medium comprises: 24.1 g / L N6 medium, 2 mg / L 2,4-D, 200 μmol / L acetylsylgenone, and pH 5.2.
[0034] Compared with the prior art, the advantages and beneficial effects of the present invention are:
[0035] This invention constructs the YL-Hu-OsSEUSS vector and introduces it into the rice variety (Zhonghua 11) using Agrobacterium-mediated transformation, obtaining two stably heritable transgenic rice varieties, named Osseuss-5# and Osseuss-16#, respectively. Detecting their resistance to Southern Rice Black-Streaked Dwarf Virus (SRBSDV) helps deepen our understanding of the green control of rice viral diseases and enriches our knowledge of the molecular mechanisms of rice-SRBSDV interaction. Attached Figure Description
[0036] Figure 1 Results of Osseuss mutation in Osseuss-ko mutant transgenic rice.
[0037] Figure 2 Symptoms of disease in transgenic Osseuss-ko mutant and control Zhonghua 11 after SRBSDV infection.
[0038] Figure 3 : Detection of virus content in Osseuss-ko mutant transgenic and control Zhonghua 11 after SRBSDV infection.
[0039] Abbreviations: Mock: Healthy rice; SRBSDV: Rice infected with Southern Rice Black-Streaked Dwarf Virus (SRBSDV); ZH11: Wild-type Zhonghua 11 rice, background control.
[0040] The following examples are provided to better illustrate the content of the present invention, but are not intended to limit the scope of the invention to the illustrated examples. Non-essential improvements and adjustments made to the implementation schemes by those skilled in the art based on the above description are still within the protection scope of the present invention. Detailed Implementation
[0041] The rice variety used in this series of experiments was: Zhonghua 11.
[0042] The relevant culture medium components are as follows:
[0043] Induction medium: N6 medium (manufacturer: Haibo Biotechnology Co., Ltd., product number: HBZ0601) 24.1g / L, 2mg / L 2,4-D, pH=5.8.
[0044] Subculture medium: N6 medium (manufacturer: Haibo Biotechnology Co., Ltd., product number: 15HBZ0601) 24.1 g / L, 2,4-D, 50 mg / L hygromycin, 300 mg / mL cephalosporin, pH=5.8.
[0045] Co-culture medium: N6 medium (manufacturer: Haibo Biotechnology Co., Ltd., product number: HBZ0601) 24.1 g / L, 2 mg / L 2,4-D, 200 μmol / L acetylsylgenone, pH=5.2.
[0046] Rooting medium: 1 / 2 MS (Manufacturer: Haibo Biotechnology Co., Ltd., Product No.: HB8469-6)
[0047] 39.45 g / L, 0.5 mg / L NAA, 50 mg / L hygromycin, pH = 5.8.
[0048] Example 1: Construction of rice YL-Hu-OsSEUSS vector
[0049] The CRISPR / Cas9 gene editing vector construction protocol uses overlapping PCR to construct the sgRNA expression cassette. The PCR primer sequences are as follows:
[0050] SEQ ID NO:4
[0051] YL-Hu-OsSEUSS-F:
[0052] CAGTGGTCTCATGCAGCTAACTCATCGCTCTCCGGAGG;
[0053] SEQ ID NO:5
[0054] YL-Hu-OsSEUSS-R:
[0055] CAGTGGTCTCAAAACCCTCCGGAGAGCGATGAGTTAGC
[0056] The specific steps for constructing its expression box are as follows:
[0057] Primers were designed using the OsSEUSS sequence shown in SEQ ID No:1 on the CRISPR-GE website (http: / / skl.scau.edu.cn / ) to clone the sgRNA fragment from rice. The PCR products were then recovered from the gel. Using the pYLsgRNA-OsU3 vector as a template, the target sequence was ligated to the U3 promoter and the gRNA scaffold, respectively. The two PCR products were mixed and used as a template to ligate the U3 promoter, target sequence, and gRNA scaffold together using overlapping PCR to form an sgRNA expression cassette.
[0058] Next, the gRNA expression cassette product and undigested pYLCRISPR / Cas9Pubi-H plasmid (Newp Biotechnology) were mixed and digested with BsaI at 37°C for 15 min. After digestion, 1.5 μL of 10×DNA Ligase Buffer and 35 U of T4 ligase were added, and ligation was performed using a variable-temperature cycling program for 15 cycles: 37°C for 5 min; 10°C for 5 min; 20°C for 5 min. Positive clones were selected and sequenced to confirm the successful construction of the expression vector YL-Hu-OsSEUSS. The correctly sequenced recombinant vector was then transformed into Agrobacterium GV3101.
[0059] Example 2: Genetic transformation of rice
[0060] 1) Callus induction and subculture: Select newly harvested mature rice seeds, remove the husks, pour into 50ml centrifuge tubes, add 15mL of 75% ethanol for 1 minute for sterilization, discard the ethanol, rinse three times with sterile water, discard the ethanol, then add 15mL of 30% sodium hypochlorite for 20 minutes for sterilization, discard the sodium hypochlorite, and rinse 5-6 times with sterile water. Use a pipette to remove excess water, transfer the seeds to induction medium, and incubate in a 28℃ light incubator for 3 weeks. Transfer the grown callus tissue to subculture medium using pre-sterilized forceps, and subculture in a 28℃ light incubator for 1 week.
[0061] 2) Transformation and culture of Agrobacterium: The plasmid containing the target vector was transformed into Agrobacterium rhizogenes GV3101 (manufacturer: Shanghai Weidi, catalog number: AC1003S) using the following steps: 5 μL of plasmid was added to 100 μL of competent Agrobacterium GV3101 cells, and the mixture was mixed by pipetting. The mixture was then added to a sterile electrode cup that had been pre-cooled to 4°C. Electroporation was performed at 220V. LB liquid medium without antibiotics was added, and the mixture was cultured in a shaker at 28°C for about 3 hours. The culture was then evenly spread on LB solid medium containing 50 μg / L Kan and 50 μg / L Rif, and cultured in the dark at 28°C for 2-3 days until single colonies appeared.
[0062] 3) Agrobacterium transfection of callus: Use a pipette to aspirate the infection solution and wash off the Agrobacterium from the plate to prepare the Agrobacterium suspension required for rice transformation. Select a sufficient number of callus tissues (the callus should be in good condition, bright yellow in color, round and firm in texture, and the particle diameter should be about 3 mm), place them in a 100 mL sterile Erlenmeyer flask, add an appropriate amount of Agrobacterium suspension, and incubate at room temperature for 20 minutes, shaking occasionally. Discard the bacterial solution, place the callus tissues on sterile filter paper to absorb excess bacterial solution, and then transfer them to a solid co-culture medium lined with a layer of sterile filter paper. Incubate at 26°C in the dark for 3 days.
[0063] 4) Screening Culture: After 3 days of co-culture, the callus tissue needs to be cleaned. Using a 1mL blue pipette tip, transfer the callus from the co-culture medium to a sterile Erlenmeyer flask and rinse twice with sterile water. Rinse a third time with sterile water containing 500ug / L carbenicillin. After aspirating excess water with a pipette, transfer the callus to sterile filter paper and dry it using the airflow from a laminar flow hood for approximately 30 minutes. Once dry, transfer the callus to screening medium for screening culture at 28-30℃ in the dark for 3-4 weeks.
[0064] 5) Seedling Rooting: When the seedlings grow to about 2-3 cm and have a noticeable root system, they can be transferred to a rooting medium to continue growing. The rooting medium should be poured into taller bottles or tubes so that the seedlings have enough space to grow upwards. The optimal conditions for rooting are aseptic light culture at 28-30 degrees Celsius.
[0065] Example 3: Identification of positive transgenic plants
[0066] Young leaves from T0 and T1 generation plants were collected, and DNA was extracted using the CTAB method. sgRNA targeting sites were amplified using target-specific primers. The amplification products were detected by 1% gel electrophoresis. Fragments with specific bands and correct sizes were recovered from the gel and sequenced. The sequencing primers are as follows:
[0067] SEQ ID NO:6
[0068] OsSEUSS-F:ACAGTTCTTATCCAGTAAGATATTTG
[0069] SEQ ID NO:7
[0070] OsSEUSS-R:GAGGGTTCTGTTGACCCTGCAGATG
[0071] Experimental results are as follows Figure 1As shown, sequencing results indicate that Osseuss-5# inserts a base T at the target site, causing OsSEUSS to terminate prematurely at the 60th amino acid site, while Osseuss-16# inserts a base A at the target site, similarly causing OsSEUSS to terminate prematurely at the 60th amino acid site. This demonstrates the successful construction of the transgenic rice line.
[0072] Example 4: Artificial inoculation with SRBSDV
[0073] (1) After soaking and germinating the Osseuss-ko transgenic plants and the control Zhonghua 11 rice material for 2-3 days, the seeds were sown in 1L beakers after they turned white, with about 30 seedlings per beaker. Three biological replicates were made and cultured at 30℃ under 16h light and 8h dark conditions.
[0074] (2) Virus inoculation experiment was conducted using 3-4 instar SRBSDV-carrying and healthy white-backed planthoppers. At a ratio of 1.5 planthoppers per seedling, SRBSDV-carrying and virus-free white-backed planthoppers were inoculated onto rice plants at the 3-4 leaf stage. After feeding for 3 days, all the insects were swept out.
[0075] (3) After 30 days, observe the symptoms of diseased rice and determine the virus-carrying status of rice by RT-qPCR.
[0076] Example 5: Resistance analysis of rice after SRBSDV inoculation
[0077] Thirty days after transplanting, SRBSDV-infected rice exhibited stunted growth. Compared to the control Zhonghua 11 (ZH11), the two mutant transgenic lines of Osseuss-ko (Osseuss-5# and Osseuss-16#) showed mild stunting symptoms, while the stunting symptoms of the control ZH11 were more severe. Figure 2 As shown. Diseased rice plants were sampled in a pooled manner, with three biological replicates per group. The RNA expression levels of the virus genes SRBSDV S2 and S4 and the rice internal reference gene OsUBQ5 were detected using qRT-PCR. Figure 3 As shown, the virus accumulation levels of Osseuss-5# and Osseuss-16# were significantly lower than those of the control ZH11. These results indicate that the resistance of the Osseuss-ko rice mutant to SRBSDV infection is influenced by the OsSEUSS gene, and that mutating OsSEUSS in rice can significantly enhance its resistance to SRBSDV.
[0078] The quantitative primer sequences are as follows:
[0079] qSRBSDV-S2-F CATCGACCAAGTTCAACCCG; SEQ ID NO:8
[0080] qSRBSDV-S2-R AAGAAGTCTGCGGGTGAAGA; SEQ ID NO:9
[0081] qSRBSDV-S4-F AAAGTGAACCCGTTGCTGAC; SEQ ID NO:10
[0082] qSRBSDV-S4-R TGCAACGCTAGATCCTATGC; SEQ ID NO:11
[0083] qOsUBQ5-F ACCACTTCGACCGCCACTACT; SEQ ID NO:12
[0084] qOsUBQ5-R ACGCCTAAGCCTGCTGGTT; SEQ ID NO:13
[0085] In summary, the experimental results show that, compared with the control ZH11, the Osseuss-ko mutant transgenic rice plants significantly enhance rice resistance to SRBSDV (including phenotypic symptoms and viral load in diseased plants). Therefore, this invention successfully obtained SRBSDV-resistant transgenic rice through gene editing, which is of great significance to agricultural development and national food security, and has achieved unexpected technical results.
Claims
1. Application of the rice transcriptional regulator OsSEUSS gene in the breeding of grain crops resistant to Southern Rice Black-Streaked Dwarf Virus, the gene sequence of which is shown in SEQ ID NO:
1.
2. The application according to claim 1, wherein the amino acid sequence of the OsSEUSS gene is shown in SEQ ID NO:
2.
3. The application according to any one of claims 1-2, wherein the crop is preferably rice, corn, wheat, oats and barley; more preferably rice, and most preferably flower 11.
4. The application according to any one of claims 1-3, which increases the resistance of rice to Southern rice black streaked dwarf virus (SRBSDV) by negatively regulating the expression of the OsSEUSS gene.
5. The application according to claim 4, wherein the negative regulation of OsSEUSS gene expression is achieved by a CRISPR / Cas9 system; the target of the CRISPR / Cas9 system is shown in SEQ ID NO:
3.
6. A method for improving the resistance of rice to Southern Rice Black-Streaked Dwarf Virus, comprising using CRISPR / Cas9 technology to target and edit the rice OsSEUSS gene, which contains a LIM-binding domain transcriptional regulatory factor, and the nucleotide sequence of the OsSEUSS gene is shown in SEQ ID NO.
1.
7. An sgRNA having a target sequence binding region as shown in SEQ ID NO:
3.
8. A method for identifying resistance of rice to Southern Rice Black-Streaked Dwarf Virus, comprising the following steps: Young leaves from T0 and T1 generation rice plants were collected, with wild-type Zhonghua 11 as a control. DNA was extracted using the CTAB method, amplified using target-specific primers, and the amplified products were detected by 1% gel electrophoresis. Fragments with specific bands and correct size were recovered from the gel and sequenced. The mutation status of the OsSEUSS gene in the rice was confirmed by comparing the sequences of the amplified products.
9. The method of claim 8, wherein the target-specific primers are as follows: SEQ ID NO:6 OsSEUSS-F:ACAGTTCTTATCCAGTAAGATATTTG SEQ ID NO:7 OsSEUSS-R:GAGGGTTCTGTTGACCCTGCAGATG.