Primer and probe combination, PCR method and kit for authenticity identification and quantitative detection of Fritillaria cirrhosa

Abstract

A primer and probe combination, a PCR method and a kit for authenticity identification and quantitative detection of Fritillaria cirrhosa, wherein the primer and probe combination for authenticity identification and quantitative detection of Fritillaria cirrhosa comprises one or more of the following primer and probe combinations: combination 1, comprising primers of SEQ ID NO1-2 and a probe of SEQ ID NO3; combination 2, comprising primers of SEQ ID NO4-5 and a probe of SEQ ID NO6; combination 3, comprising primers of SEQ ID NO7-8 and a probe of SEQ ID NO9; combination 4, comprising primers R of SEQ ID NO10-11 and a probe P of SEQ ID NO12; combination 5, comprising primers of SEQ ID NO13-14 and a probe of SEQ ID NO15; combination 6, comprising primers of SEQ ID NO16-17 and a probe of SEQ ID NO18; combination 7, comprising primers of SEQ ID NO19-20 and a probe of SEQ ID NO21; combination 8, comprising primers of SEQ ID NO22-23 and a probe of SEQ ID NO24. It has the advantages of not only being able to accurately identify authenticity but also being able to perform quantitative testing.

Description

Technical Field

[0001] The present application relates to the technical field of identification of Fritillaria cirrhosa, and specifically refers to a primer and probe combination, a PCR method and a kit for authenticity identification and quantitative detection of Fritillaria cirrhosa. Background Art

[0002] Fritillaria cirrhosa is a traditional Chinese medicine for relieving cough, reducing phlegm and relieving asthma. Due to the large demand, it is very common in the market to sell closely related species of Fritillaria cirrhosa as Fritillaria cirrhosa. There is an urgent need for a quantitative detection method to solve the problem of adulteration of Fritillaria cirrhosa, especially Fritillaria cirrhosa powder, and to accurately quantify the amount of adulterated products added.

[0003] The identification methods of Fritillaria cirrhosa stipulated in the 2015 edition of the Chinese Pharmacopoeia mainly include microscopic identification, thin layer chromatography and polymerase chain reaction-restriction fragment length polymorphism (PCR-RFLP). The shortcomings of the PCR-RFLP method are: the sampling is based on a single Fritillaria cirrhosa unit, which is not uniform; in order to ensure the representativeness of the sampling as much as possible, 6-10 grains are generally taken, which is a large workload and still cannot obtain good representativeness. If the entire Fritillaria cirrhosa sample can be ground into powder and mixed, and then sampled and tested, the uniformity and representativeness of the sampling can be guaranteed. However, because the sensitivity of this method is extremely high, a small amount of Fritillaria cirrhosa in the sample can produce a positive result, but the method itself cannot quantitatively determine the content ratio of Fritillaria cirrhosa; on the other hand, Fritillaria cirrhosa is often used in the form of powder in clinical practice, which makes it more convenient for criminals to use counterfeit products to impersonate or add Fritillaria cirrhosa. Therefore, in practical work, it is urgent to establish a new and effective quantitative detection method to solve the adulteration problem of Fritillaria cirrhosa, especially the counterfeit products in Fritillaria cirrhosa powder, and accurately quantify the amount of counterfeit products added.

[0004] Luo Dalong et al. (Application of real-time fluorescence quantitative PCR in the identification of Fritillaria cirrhosa [J]. Chinese Pharmacist, 2016, 19(6):1068) used real-time fluorescence quantitative PCR to identify Fritillaria cirrhosa, Fritillaria thunbergii, Fritillaria thunbergii, Fritillaria thunbergii, etc., using the same primer sequence as the pharmacopoeia method and the SYBR Green method. This method produces a lot of non-specific products, which will lead to high background and false positives. According to the reports of CZ Wang (Simultaneous identification of Bulbus FritillariaeCirrhosae using PCR-RFLP analysis), Xu Chuanlin (Study on molecular identification methods of Fritillariae Cirrhosae [J]. Journal of China Pharmaceutical University, 2010, 41(3): 226) and Zhang Wenjuan et al. (Study on the application of polymerase chain reaction-restriction fragment length polymorphism method in the detection of adulteration of Fritillariae Cirrhosae [J]. Journal of Drug Analysis, 2014, 34(10): 1830), the primer sequences of Fritillariae Cirrhosae and its common counterfeits, such as Fritillariae pekinensis, Fritillariae thunbergii and Fritillaria iridi, can amplify PCR amplification bands of the same size of about 300 bp using the pharmacopoeia method. It is necessary to further use the restriction endonuclease method to distinguish Fritillariae Cirrhosae and its counterfeits. Therefore, the real-time fluorescence quantitative PCR method of Luo Dalong et al. for the identification of Fritillariae Cirrhosae needs further confirmation research.

[0005] The existing PCR identification methods for Fritillaria cirrhosae cannot be quantitative, and because the PCR detection method is too sensitive, qualitative screening tests cannot effectively distinguish between cross-contamination and intentional adulteration. There is still a lack of standards for DNA quantitative detection methods for adulteration of Chinese medicinal materials in my country, so it is urgent to establish DNA semi-quantitative or quantitative detection methods for Chinese medicinal materials components to provide specific and effective relative quantitative data to meet the needs of drug market supervision.

[0006] CN201910170554.9, relates to a PCR primer and method for identifying the authenticity of Fritillaria cirrhosa or detecting the degree of adulteration of Fritillaria cirrhosa. Although the technical solution mentions that the two pairs of primers designed can detect the degree of adulteration of Fritillaria cirrhosa, since the solution is based on the primers designed based on the ITS1 region sequence, and the difference between the ITS1 sequences of Fritillaria cirrhosa and its counterfeits is very small, with only a 1-2bp base difference between the primers, it is easy to cause mismatch between the primers and the template, resulting in high background and false positives, affecting the result judgment.

[0007] CN201810133568.9, relates to a PCR method for quickly identifying the authenticity of Fritillaria cirrhosa. In this technical solution, a pair of primers are designed based on the ITS1 region sequence to identify the authenticity of Fritillaria cirrhosa. However, there is also a problem of false positives due to poor primer specificity. Moreover, this patent document is the same as the prior art, using an ordinary PCR method, which can only identify the authenticity but has no way to quantitatively determine the content ratio of Fritillaria cirrhosa. Summary of the invention

[0008] In view of the above-mentioned deficiencies in the prior art, the present application provides a primer and probe combination for authenticating Fritillaria cirrhosae which can not only accurately identify the authenticity but also perform quantitative detection.

[0009] In order to solve the above technical problems, the technical solution adopted in this application is: a primer and probe combination for authenticity identification and quantitative detection of Fritillaria cirrhosa, which combination includes one or more of the following primer and probe combinations:

[0010] (1) Primer and probe combination 1, comprising primer F of SEQ ID NO1, primer R of SEQ ID NO2, and probe P of SEQ ID NO3;

[0011] (2) Primer and probe combination 2, comprising primer F of SEQ ID NO4, primer R of SEQ ID NO5, and probe P of SEQ ID NO6;

[0012] (3) Primer and probe combination 3, comprising primer F of SEQ ID NO7, primer R of SEQ ID NO8, and probe P of SEQ ID NO9;

[0013] (4) Primer and probe combination 4, comprising primer F of SEQ ID NO: 10, primer R of SEQ ID NO: 11, and probe P of SEQ ID NO: 12;

[0014] (5) Primer and probe combination 5, comprising primer F of SEQ ID NO:13, primer R of SEQ ID NO:14, and probe P of SEQ ID NO:15;

[0015] (6) Primer and probe combination 6, comprising primer F of SEQ ID NO:16, primer R of SEQ ID NO:17, and probe P of SEQ ID NO:18;

[0016] (7) Primer and probe combination 7, comprising primer F of SEQ ID NO: 19, primer R of SEQ ID NO: 20, and probe P of SEQ ID NO: 21;

[0017] (8) Primer and probe combination 8, comprising primer F of SEQ ID NO:22, primer R of SEQ ID NO:23, and probe P of SEQ ID NO:24.

[0018] Further preferably, the primer and probe combination for authenticity identification and quantitative detection of Fritillaria cirrhosa described in the present application includes one or more of the following primer and probe combinations: primer and probe combination 1, including primer F of SEQ ID NO1, primer R of SEQ ID NO2, and probe P of SEQ ID NO3; and / or primer and probe combination 8, including primer F of SEQ ID NO22, primer R of SEQ ID NO23, and probe P of SEQ ID NO24.

[0019] Furthermore, the primer and probe combination for authenticity identification of Fritillaria cirrhosa described in the present application is: primer and probe combination 1, including primer F of SEQ ID NO1, primer R of SEQ ID NO2, and probe P of SEQ ID NO3.

[0020] Furthermore, the primer and probe combination for quantitative detection of Fritillaria cirrhosa described in the present application is: primer and probe combination 8, including primer F of SEQ ID NO22, primer R of SEQ ID NO23, and probe P of SEQ ID NO24.

[0021] The present application also provides a PCR method for identifying the authenticity of Fritillaria cirrhosa, which comprises: extracting genomic DNA from a Fritillaria cirrhosa sample, using the extracted genomic DNA as a template, and performing a dual fluorescence quantitative PCR reaction using the primer and probe combination designed as described above in the present application; and then using the 2-∆∆Ct relative quantitative method to achieve rapid qualitative and quantitative detection of common adulterations of Fritillaria cirrhosa.

[0022] Furthermore, the dual fluorescence quantitative PCR reaction system of the present application is 20 μL: template DNA (10 ng / μL) 1 μL, primer (10 μmol / L) 0.6 μL (×4), probe P732 (10 μmol / L) 0.3 μL, probe P1222 (10 μmol / L) 0.3 μL, 1×QN ROX Dye Solution 1 μL, 2×Probe PCR Master Mix 10 μL, sterile ultrapure water 5 μL; reaction parameters: 95°C pre-denaturation for 2 min, and 40 cycles of amplification reaction.

[0023] Furthermore, the above-mentioned cyclic amplification reaction was performed 40 times in the present application, and the conditions for each cyclic amplification were: denaturation at 95° C. for 5 s and annealing at 60° C. for 30 s.

[0024] The present application also provides a real-time fluorescence quantitative PCR kit for detecting adulteration and quantitative detection of Fritillaria cirrhosa, which comprises the above-mentioned PCR primer and probe combination for detecting adulteration and quantitative detection of Fritillaria cirrhosa.

[0025] Advantages and beneficial effects of this application:

[0026] 1. The primers and probes designed in this application can achieve rapid qualitative and quantitative detection of common adulteration of Fritillaria cirrhosae using the 2-∆∆Ct relative quantitative method. The method has high sensitivity, simple operation and good repeatability. The Ct value of the P732 probe is linearly related to its corresponding DNA concentration c, with a correlation coefficient of R²=0.999, an amplification efficiency of Eff=100.349%, and a linear equation of Ct=-3.314c+36.667. The standard curve is shown in Fig. 9 The Ct value of the P1222 probe is linearly related to its corresponding DNA concentration c, with a correlation coefficient of R²=1, an amplification efficiency of Eff=100.606%, and a linear equation of Ct=-3.308c+36.237. The standard curve is shown in Fig.10 . The method established in this application was used to detect all collected samples, and the accuracy of the qualitative detection results was 100%, and the DNA qualitative sensitivity reached 0.001 ng / μL. The quantitative detection has good accuracy, repeatability, and durability. When the amount of Sichuan Fritillaria counterfeit (taking Fritillaria cirrhosa as an example) added is above 0.5%, the amplification curve has a good linear shape, and a typical "S" curve and amplification plateau can be seen, and the Ct value of 19 out of 20 measurements is less than 35. The specific Ct value is shown in Table 2. Therefore, the detection limit of the method of this application for detecting Sichuan Fritillaria counterfeit DNA is 0.025 ng / μL. When the amount of counterfeit added is greater than 1%, the recovery rate RSD is less than 20%, so the quantitative limit of the method of this application for detecting Sichuan Fritillaria counterfeit DNA is 0.05 ng / μL. The method of the present application is simple and easy to operate. It can be qualitatively detected when the amount of adulterated products is greater than 0.5%, and can accurately and quantitatively detect adulteration when the amount of adulterated products is greater than 1%. It can meet the needs of daily inspection of Fritillaria cirrhosa and is of great significance to the quality control of Fritillaria cirrhosa. The design idea adopted by the method has certain development potential in the development of molecular identification methods for traditional Chinese medicines.

[0027] 2. The real-time fluorescence quantitative PCR method established in this application can be used to develop a rapid identification detection kit for Fritillaria cirrhosa. Through PCR detection of 7 authentic samples of Fritillaria cirrhosa, 8 common counterfeit samples, and 10 market sampling samples, no amplification of probe P732 was found in the authentic samples, and stable amplification of probe P1222 was found. Both probe P732 and probe P1222 of counterfeit samples were stably amplified. After comparison with the pharmacopoeia PCR-RFLP method, the consistency was 100%. The real-time fluorescence quantitative PCR detection method established in this application can make a qualitative test for the authenticity of Fritillaria cirrhosa. Through the detection of simulated samples, the method established in this application can make a relative quantitative test for the authenticity of Fritillaria cirrhosa, and the accuracy of the quantitative results can be controlled within ±4%.

[0028] 3. The specific primers and probes designed in the present application are designed based on the sequence interval with relatively large differences between Fritillaria cirrhosa and its counterfeits. The base differences between the primers are large, and it is not easy to cause mismatches between the primers and the template, thereby avoiding high background and false positives, and reducing the impact of result judgment; the primers and probes of the present application are combined with optimized fluorescence quantitative PCR reaction conditions to obtain a concentration curve for relative quantification of Fritillaria cirrhosa counterfeits. The accuracy of the quantitative method is within ±2%, and the amount of Fritillaria cirrhosa counterfeits added can be quickly and accurately quantitatively analyzed; the established method can fill the gap in the quantitative detection method of adulterated DNA of Chinese medicinal materials in my country, lay a solid foundation for the establishment of pharmacopoeia standard methods, and provide a solid technical guarantee for cracking down on illegal and irregular acts such as adulteration and selling of Chinese medicinal materials. BRIEF DESCRIPTION OF THE DRAWINGS

[0029] Figure 1 Amplification curve of authentic Fritillaria cirrhosa.

[0030] Figure 2 Amplification curve of Fritillaria thunbergii.

[0031] Figure 3 Amplification curve of Fritillaria cirrhosa.

[0032] Figure 4 Amplification curve of Fritillaria iliense.

[0033] Figure 5 Amplification curve of Fritillaria thunbergii.

[0034] Figure 6 Amplification curve of Fritillaria thunbergii.

[0035] Figure 7 Amplification curve of Fritillaria hupehensis.

[0036] Figure 8Sensitivity test amplification curve: Note: The red, yellow, green, cyan, light blue, dark blue and purple curves are the amplification curves when the DNA content of Fritillaria cirrhosa fake is 100%, 10%, 1%, 0.1%, 0.01%, 0.001% and 0.0001%, respectively.

[0037] Fig. 9 P732 standard curve.

[0038] Fig.10 P1222 standard curve. DETAILED DESCRIPTION

[0039] The present application is further described in detail below through specific implementation modes, but the present application is not limited to the following implementation modes. Example

[0040] Through sequence analysis and sequencing verification, the common sequence of common counterfeits of Fritillaria cirrhosa on the chloroplast genome that distinguishes it from the authentic Fritillaria cirrhosa (counterfeit-specific sequence) was obtained: 5'-GGAGAA CACATACATAAAAAAATTAGCATGCAA-3' (SEQ ID NO25), and the sequence shared by the authentic Fritillaria cirrhosa and counterfeits (internal reference sequence): 5'-CCCGCAGCTTCCGCCTTGACAGGGCGGTGCTCTGACCGATTGAACTACAATCCCAGCGAGGTGTATGG-3' (SEQ ID NO26).

[0041] - Specifically, refer to the following comparison sequences of Fritillaria cirrhosa and common counterfeits (SEQ ID NO27-SEQ ID NO62):

[0042] Fritillaria TTATTATATA CTAATAGATT TAATTAATAT TAATTATTAA TATAATTAATTAATATAATA

[28840]

[0043] Dark purple Fritillaria TTATTATATA CTAATAGATT TAATTAATAT TAATTATTAA TATAATTAATTAATATAATA

[28840]

[0044] Gansu Fritillaria TTATTATATA CTAATAGATT TAATTAATAT TAATTATTAA TATAATTAATTAATATAATA

[28840]

[0045] Fritillaria delavayi TTATTATATA CTAATAGATT TAATTAATAT TAATTATTAA TATAATTAATTAATATAATA

[28840]

[0046] Fritillaria unibracteata TTATTATATA CTAATAGATT TAATTAATAT TAATTATTAA TATAATTAATTAATATAATA

[28840]

[0047] Fritillaria taipaiensis TTATTATATA CTAATAGATT TAATTAATAT TAATTATTAA TATAATTAATTAATATAATA

[28840]

[0048] Fritillaria ussuriensis TTATTATATA CTAATGGATT TAATTAATAT TAATTATTAA TATAATTAATTAATATAATA

[28840]

[0049] Fritillaria thunbergii TTATTATATA CTAATAGATT TAATTAATAT TAATTATTAA TATAATTAATTAATATAATA

[28840]

[0050] Fritillaria walujewii TTATTATATA CTAATAGATT TAATTAATAT TAATTATTAA TATAATTAATTAATATAATA

[28840]

[0051] Fritillaria pallidiflora TTATTATATA CTAATAGATT TAATTAATAT TAATTATTAA TATAATTAATTAATATAATA

[28840]

[0052] Fritillaria hupehensis TTATTATATA CTAATAGATT TAATTAATAT TAATTATTAA TATAATTAATTAATATAATA

[28840]

[0053] Fritillaria anhuiensis TTATTATATA CTAATAGATT TAATTAATAT TAATTATTAA TATAATTAATTAATATAATA

[28840]

[0054] Fritillaria cirrhosa TCCTCTTCTC TTTC-TTGGA TTGGG----- ---------- ------------------TT

[28900]

[0055] Dark purple Fritillaria TCCTCTTCTC TTTC-TTGGA TTGGG----- ---------- ------------------TT

[28900]

[0056] Gansu Fritillaria TCCTCTTCTC TTTC-TTGGA TTGGG----- ---------- ------------------TT

[28900]

[0057] Fritillaria thunbergiiTCCTCTTCTC TTTC-TTGGA TTGGG----- ---------- ------------------TT

[28900]

[0058] Wabu Fritillary TCCTCTTCTC TTTC-TTGGA TTGGG----- ---------- ------------------TT

[28900]

[0059] Taibai Fritillaria TCCTCTTCTC TTTC-TTGGA TTGGG----- ---------- ------------------TT

[28900]

[0060] Fritillaria TCCTCTTCTC TTTCGTTGGA TTGGGGGAGA ACACATACAT AAAAAAATTAGCATGCAATT

[28900]

[0061] Fritillaria TCCTCTTCTC TTTCGTTGGA TTGGGGGAGA ACACATACAT AAAAAAATTAGCATGCAATT

[28900]

[0062] Xinjiang Fritillaria TCCTCTTCTC TTTCGTTGGA TTGGGGGAGA ACACATACAT AAAAAA-TTAGCATGCAATT

[28900]

[0063] Fritillaria iliensis TCCTCTTCTC TTTCGTTGGA TTGGGGGAGA ACACATACAT AAAAAA-TTAGCATGCAATT

[28900]

[0064] Fritillaria hupehensis TCCTCTTCTC TTTCGTTGGA TTGGGGGAGA ACACATACAT AAAAAA-TTAGCATGCAATT

[28900]

[0065] Fritillaria thunbergii var. chekiangensis TCCTCTTCTC TTTCGTTGGA TTGGGGGAGA ACACATACAT AAAAAA-TTAGCATGCAATT

[28900]

[0066] Fritillaria cirrhosa TGAATGAGAT AGATTTTTTT AATTAAAATA TAGAGGATAC ACAAGTCGGAGTTGGAAAAG

[28960]

[0067] Fritillaria unibracteata TGAATGAGAT AGATTTTTTT AATTAAAA-A TAGAGGATAC ACAAGTCGGAGTTGGAAAAG

[28960]

[0068] Fritillaria przewalskii TGAATGAGAT AGATTTTTTT AATTAAAATA TAGAGGATAC ACAAGTCGGAGTTGGAAAAG

[28960]

[0069] Fritillaria delavayi TGAATGAGAT AGATTTTTTT AATTAAAATA TAGAGGATAC ACAAGTCGGAGTTGGAAAAG

[28960]

[0070] Fritillaria wabuensis TGAATGAGAT AGATTTTTTT AATTAAAA-A TAGAGGATAC ACAAGTCGGAGTTGGAAAAG

[28960]

[0071] Fritillaria taipaiensis TGAATGAGAT AGATTTTTTT AATTAAAA-A TAGAGGATAC ACAAGTCGGAGTTGGAAAAG

[28960]

[0072] Fritillaria ussuriensis TGAATGAGAT AGAATTTTTT AATTAAAA-A TAGAGGATAC ACAAGTCGGAGTTGGAAAAG

[28960]

[0073] Fritillaria thunbergii TGAATGAGAT AGAATTTTTT AATTAAAA-A TAGAGGATAC ACAAGTCGGAGTTGGAAAAG

[28960]

[0074] Xinjiang Fritillaria TGAATGAGAT AGAATTTTTT AATTAAAA-A TAGAGGATAC ACAAGTCGGAGTTGGAAAAG

[28960]

[0075] Fritillaria ili TGAATGAGAGATAGAGATAGAGATA AATTAAAA-A TAGAGGATAC ACAAGTCGGAGTTGGAAAAG

[28960]

[0076] Hubei Fritillaria TGAATGAGAT AGAATTTTTT AATTAAAA-A TAGAGGATAC ACAAGTCGGAGTTGGAAAAG

[28960]

[0077] Fritillaria TGAATGAGAT AGAATTTTTT AATTAAAA-A TAGAGGATAC ACAAGTCGGAGTTGGAAAAG

[28960]

[0078] 2. Based on the common sequences and differential sequences of the authentic and counterfeit products mentioned above, three TaqMan MGB probes (P732, P1222, and P783) and eight pairs of corresponding primers were designed, as shown in Table 1. After screening, the specific primer and probe combination "472F-581R-P732" can be specifically amplified in common counterfeit Fritillaria cirrhosae with good amplification effect, and can be used for authenticity identification. The primer and probe combination "1183F-1247R-P1222" used for relative quantitative detection can stably amplify in all Fritillaria samples. The sequences of Fritillaria were extracted and amplified with primers and probes using the extracted sequences as templates. The concentrations of primers and probes, annealing temperature and other reaction conditions were optimized. The optimized dual fluorescence quantitative PCR reaction system was 20 μL: template DNA (10 ng / μL) 1 μL, primers (10 μmol / L) 0.6 μL (×4), probe P732 (10 μmol / L) 0.3 μL, probe P1222 (10 μmol / L) 0.3 μL, 1×QN ROX Dye Solution 1 μL, 2×Probe PCR Master Mix 10 μL, and sterile ultrapure water 5 μL. Reaction parameters: 95℃ pre-denaturation for 2 min, 40 cycles of amplification reaction (95℃ denaturation for 5 s, 60℃ annealing for 30 s).

[0079] Table 1 Sequences of primer and probe combinations

[0080]

[0081] Attached Figure 1-7 Shown are the amplification curves of different Fritillaria species.

[0082] 3. The dual real-time fluorescence quantitative PCR method based on TaqMan probes established in this application, followed by the 2-∆∆Ct relative quantitative method, can achieve rapid qualitative and quantitative detection of common adulteration of Fritillaria cirrhosae, and the method has high sensitivity (see Appendix for details). Figure 8 ), easy to operate, good repeatability. The Ct value of the P732 probe is linearly related to its corresponding DNA concentration c, with a correlation coefficient of R²=0.999, an amplification efficiency of Eff=100.349%, and a linear equation of Ct=-3.314c+36.667. The standard curve is shown in Fig. 9 The Ct value of the P1222 probe is linearly related to its corresponding DNA concentration c, with a correlation coefficient of R²=1, an amplification efficiency of Eff=100.606%, and a linear equation of Ct=-3.308c+36.237. The standard curve is shown in Fig.10 . The method established in this application was used to test all collected samples. The accuracy of the qualitative test results was 100%, and the DNA qualitative sensitivity reached 0.001 ng / μL. The quantitative test has good accuracy, repeatability, and durability. Figure 2 ) When the amount of doping was above 0.5%, the amplification curve had a good linear shape, and a typical "S" curve and amplification plateau period were observed. The Ct values ​​of 19 out of 20 measurements were less than 35. The specific Ct values ​​are shown in Table 2. Therefore, the detection limit of the method for detecting the fake DNA of Fritillaria cirrhosa was 0.025 ng / μL. When the amount of doping was greater than 1%, the recovery rate RSD was less than 20%. Therefore, the quantitative limit of the method for detecting the fake DNA of Fritillaria cirrhosa was 0.05 ng / μL. The method is simple and easy to operate. When the amount of doping was greater than 0.5%, it could be qualitatively identified. When the amount of doping was greater than 1%, the adulteration could be accurately and quantitatively detected. It could meet the needs of daily inspection of Fritillaria cirrhosa and was of great significance to the quality control of Fritillaria cirrhosa. The design idea adopted by this method has certain development potential in the development of molecular identification methods for traditional Chinese medicines.

[0083] Table 2 Ct values ​​of 20 measurements

[0084] Adulteration ratio 0.10% 0.20% 0.50% 1% 2% 5% 1 group Ct value 38.18 34.258 33.251 31.185 30.926 29.503 Ct values ​​of 2 groups 38.294 34.423 34.578 32.481 31.357 29.59 3 groups of Ct values 36.556 34.635 33.69 32.816 31.698 30.028 4 groups of Ct values 36.951 34.741 34.24 33.518 31.972 30.361 5 groups of Ct values 37.389 34.834 33.986 33.226 31.847 30.182 6 groups of Ct values 38.222 33.991 33.886 33.215 31.907 30.183 7 groups of Ct values 34.86 33.553 33.976 33.282 32.239 30.208 8 groups of Ct values 38.008 34.016 33.688 33.108 32.149 30.137 9 groups of Ct values 38.696 36.372 33.759 33.122 32.274 30.265 10 groups of Ct values 36.766 36.129 34.508 33.156 32.259 30.552 11 groups of Ct values 37.338 34.37 32.912 31.247 31.071 29.673 12 groups of Ct values 36.851 34.821 33.476 32.48 31.204 29.431 13 groups of Ct values 35.957 34.604 33.552 32.954 31.632 29.753 14 groups of Ct values 36.653 34.797 34.345 33.25 31.728 30.197 15 groups of Ct values 36.221 34.466 33.925 33.22 31.954 30.201 16 groups of Ct values 36.821 34.37 34.141 33.287 31.688 30.128 17 groups of Ct values 37.083 33.475 33.53 32.784 31.897 29.99 18 groups of Ct values 35.861 34.398 33.442 32.708 32.004 30.364 19 groups of Ct values 37.877 35.271 33.671 32.723 31.821 30.05 20 groups of Ct values 37.338 35.827 33.745 32.932 31.791 30.476

[0085] Table 3 Recovery and RSD results of 20 measurements

[0086] Adulteration ratio 0.10% 0.20% 0.50% 1.0% 2.0% 5.0% Recovery rate of group 1 (%) 100 400 200 130 132 138 Recovery rate of 2 groups (%) 100 350 120 120 130 126 Recovery rate of 3 groups (%) 0 300 160 90 120 120 Recovery rate of 4 groups (%) 200 300 120 110 100 86 Recovery rate of 5 groups (%) 200 250 140 90 100 98 Recovery rate of 6 groups (%) 100 300 140 110 90 94 Recovery rate of 7 groups (%) 400 400 140 90 85 94 Recovery rate of 8 groups (%) 100 300 140 100 85 90 Recovery rate of 9 groups (%) 100 150 140 100 85 96 Recovery rate of 10 groups (%) 200 250 120 100 85 86 Recovery rate of 11 groups (%) 200 400 260 180 160 134 Recovery rate of 12 groups (%) 0 300 180 140 130 134 Recovery rate of 13 groups (%) 200 300 160 110 110 116 Recovery rate of 14 groups (%) 200 300 140 100 105 92 Recovery rate of 15 groups (%) 300 300 140 100 100 96 Recovery rate of 16 groups (%) 200 250 120 100 95 92 Recovery rate of 17 groups (%) 200 400 160 110 95 90 Recovery rate of 18 groups (%) 200 250 160 110 90 84 Recovery rate of 19 groups (%) 300 200 160 110 90 98 Recovery rate of 20 groups (%) 100 200 140 110 95 82 Mean(%) 170 295 152 110.5 104.1 102.3 SD (%) 99 71 33 21 20 18 RSD(%) 58 24 22 19 19 18

[0087] Through the above-mentioned embodiment, it can be known that the real-time fluorescence quantitative PCR method established by the present application can be used to develop a rapid identification test kit for Fritillaria cirrhosa. By PCR detection of 7 authentic samples of Fritillaria cirrhosa, 8 common counterfeit samples and 10 market sampling samples, the authentic samples did not see the amplification of probe P732, and the stable amplification of probe P1222 was seen. The counterfeit sample probe P732 and probe P1222 were both stably amplified. After being compared with the pharmacopoeia PCR-RFLP method, the consistency was 100%. The real-time fluorescence quantitative PCR detection method established by the present application can make qualitative verification of the authenticity of Fritillaria cirrhosa. By the detection of simulated samples, the method established by the present application can make relative quantitative verification of the authenticity of Fritillaria cirrhosa, and the accuracy of the quantitative result can be controlled within ± 4%, and the relative quantitative measurement value and relative error results of mixed counterfeit products are shown in Table 4.

[0088] Table 4 Concentration and purity of DNA extracted from mixed products

[0089] Content of counterfeit products (%) Measurement value (%) Relative error (%) 10 10.4 4 20 19.3 -3.5 50 51.3 2.6 Sequence Listing <110> Ningbo Drug Inspection Institute <120> Primer and probe combination, PCR method and kit for authenticity identification and quantitative detection of Fritillaria cirrhosa <130> 2021 <160> 62 <170> SIPOSequenceListing 1.0 <210> 1 <211> twenty two <212> DNA <213> Artificial synthesis () <400> 1 cctcttctct ttcttggatt gg 22 <210> 2 <211> twenty two <212> DNA <213> Artificial Sequence() <400> 2 aactccgact tgtgtatcct ct 22 <210> 3 <211> 20 <212> DNA <213> Artificial Sequence() <400> 3 ttttatgtat gtgttctccc 20 <210> 4 <211> 29 <212> DNA <213> Artificial Sequence() <400> 4 gggagaacac atacataaaa aaattagca 29 <210> 5 <211> 19 <212> DNA <213> Artificial Sequence() <400> 5 cccagccctt ttccaactc 19 <210> 6 <211> 20 <212> DNA <213> Artificial Sequence() <400> 6 ttttatgtat gtgttctccc 20 <210> 7 <211> twenty two <212> DNA <213> Artificial Sequence() <400> 7 cctcttctct ttcttggatt gg 22 <210> 8 <211> 25 <212> DNA <213> Artificial Sequence() <400> 8 atctatctca ttcaaattgc atgct 25 <210> 9 <211> 20 <212> DNA <213> Artificial Sequence() <400> 9 ttttatgtat gtgttctccc 20 <210> 10 <211> twenty two <212> DNA <213> Artificial Sequence() <400> 10 cctcttctct ttcttggatt gg 22 <210> 11 <211> 18 <212> DNA <213> Artificial Sequence() <400> 11 agtgcccagc ccttttcc 18 <210> 12 <211> 20 <212> DNA <213> Artificial Sequence() <400> 12 ttttatgtat gtgttctccc 20 <210> 13 <211> twenty four <212> DNA <213> Artificial Sequence() <400> 13 atcctcttct ctttcttgga ttgg 24 <210> 14 <211> 19 <212> DNA <213> Artificial Sequence() <400> 14 cccagccctt ttccaactc 19 <210> 15 <211> 20 <212> DNA <213> Artificial Sequence() <400> 15 ttttatgtat gtgttctccc 20 <210> 16 <211> twenty four <212> DNA <213> Artificial Sequence() <400> 16 atcctcttct ctttcttgga ttgg 24 <210> 17 <211> 26 <212> DNA <213> Artificial Sequence() <400> 17 aaatctatct cattcaaatt gcatgc 26 <210> 18 <211> 20 <212> DNA <213> Artificial Sequence() <400> 18 ttttatgtat gtgttctccc 20 <210> 19 <211> twenty three <212> DNA <213> Artificial Sequence() <400> 19 cctcttctct ttcttggatt ggg 23 <210> 20 <211> twenty two <212> DNA <213> Artificial Sequence() <400> 20 taatgaaatg gagtagagtg cc 22 <210> twenty one <211> twenty three <212> DNA <213> Artificial Sequence() <400> twenty one taaaaataga ggatacacaa gtc 23 <210> twenty two <211> 18 <212> DNA <213> Artificial Sequence() <400> twenty two gcagcttccg ccttgaca 18 <210> twenty three <211> 20 <212> DNA <213> Artificial Sequence() <400> twenty three ccatacacct cgctgggatt 20 <210> twenty four <211> 16 <212> DNA <213> Artificial Sequence() <400> twenty four tgctctgacc gattga 16 <210> 25 <211> 33 <212> DNA <213> Fritillaria partial sequence () <400> 25 ggagaacaca tacataaaaa aattagcatg caa 33 <210> 26 <211> 68 <212> DNA <213> Fritillaria partial sequence () <400> 26 cccgcagctt ccgccttgac agggcggtgc tctgaccgat tgaactacaa tcccagcgag 60 gtgtatgg 68 <210> 27 <211> 60 <212> DNA <213> Fritillaria cirrhosa 28840() <400> 27 ttattatata ctaatagatt taattaatat taattattaa tataattaat taatataata 60 <210> 28 <211> 60 <212> DNA <213> Dark Purple Fritillary 28840() <400> 28 ttattatata ctaatagatt taattaatat taattattaa tataattaat taatataata 60 <210> 29 <211> 60 <212> DNA <213> Fritillaria gansuensis 28840() <400> 29 ttattatata ctaatagatt taattaatat taattattaa tataattaat taatataata 60 <210> 30 <211> 60 <212> DNA <213> Fritillaria delavayi 28840() <400> 30 ttattatata ctaatagatt taattaatat taattattaa tataattaat taatataata 60 <210> 31 <211> 60 <212> DNA <213> Fritillaria unibracteata 28840() <400> 31 ttattatata ctaatagatt taattaatat taattattaa tataattaat taatataata 60 <210> 32 <211> 60 <212> DNA <213> Fritillaria taipaiensis 28840() <400> 32 ttattatata ctaatagatt taattaatat taattattaa tataattaat taatataata 60 <210> 33 <211> 60 <212> DNA <213> Fritillaria ussuriensis 28840() <400> 33 ttattatata ctaatggatt taattaatat taattattaa tataattaat taatataata 60 <210> 34 <211> 60 <212> DNA <213> Fritillaria thunbergii 28840() <400> 34 ttattatata ctaatagatt taattaatat taattattaa tataattaat taatataata 60 <210> 35 <211> 60 <212> DNA <213> Fritillaria walujewii Regel 28840() <400> 35 ttattatata ctaatagatt taattaatat taattattaa tataattaat taatataata 60 <210> 36 <211> 60 <212> DNA <213> Fritillaria pallidiflora Schrenk 28840() <400> 36 ttattatata ctaatagatt taattaatat taattattaa tataattaat taatataata 60 <210> 37 <211> 60 <212> DNA <213> Fritillaria hupehensis Hsiao et K. C. Hsia 28840() <400> 37 ttattatata ctaatagatt taattaatat taattattaa tataattaat taatataata 60 <210> 38 <211> 60 <212> DNA <213> Fritillaria anhuiensis Hsiao et K. C. Hsia 28840() <400> 38 ttattatata ctaatagatt taattaatat taattattaa tataattaat taatataata 60 <210> 39 <211> 26 <212> DNA <213> Fritillaria cirrhosa D. Don 28900() <400> 39 tcctcttctc tttcttggat tgggtt 26 <210> 40 <211> 26 <212> DNA <213> Dark Purple Fritillary 28900() <400> 40 tcctcttctc tttcttggat tgggtt 26 <210> 41 <211> 26 <212> DNA <213> Fritillaria gansuensis 28900() <400> 41 tcctcttctc tttcttggat tgggtt 26 <210> 42 <211> 26 <212> DNA <213> Fritillaria thunbergii 28900() <400> 42 tcctcttctc tttcttggat tgggtt 26 <210> 43 <211> 26 <212> DNA <213> Wabu Fritillary 28900() <400> 43 tcctcttctc tttcttggat tgggtt 26 <210> 44 <211> 26 <212> DNA <213> Fritillaria taibaiensis 28900() <400> 44 tcctcttctc tttcttggat tgggtt 26 <210> 45 <211> 60 <212> DNA <213> Fritillaria 28900() <400> 45 tcctcttctc tttcgttgga ttgggggaga acacatacat aaaaaaatta gcatgcaatt 60 <210> 46 <211> 60 <212> DNA <213> Fritillaria thunbergii 28900() <400> 46 tcctcttctc tttcgttgga ttgggggaga acacatacat aaaaaaatta gcatgcaatt 60 <210> 47 <211> 59 <212> DNA <213> Xinjiang Fritillaria 28900() <400> 47 tcctcttctc tttcgttgga ttgggggaga acacatacat aaaaaattag catgcaatt 59 <210> 48 <211> 59 <212> DNA <213> Fritillaria yiliensis 28900() <400> 48 tcctcttctc tttcgttgga ttgggggaga acacatacat aaaaaattag catgcaatt 59 <210> 49 <211> 59 <212> DNA <213> Hubei Fritillaria 28900() <400> 49 tcctcttctc tttcgttgga ttgggggaga acacatacat aaaaaattag catgcaatt 59 <210> 50 <211> 59 <212> DNA <213> Fritillaria thunbergii 28900() <400> 50 tcctcttctc tttcgttgga ttgggggaga acacatacat aaaaaattag catgcaatt 59 <210> 51 <211> 60 <212> DNA <213> Fritillaria cirrhosa D. Don 28960() <400> 51 tgaatgagat agattttttt aattaaaata tagaggatac acaagtcgga gttggaaaag 60 <210> 52 <211> 59 <212> DNA <213> Fritillaria unibracteata Hsiao et K. C. Hsia 28960() <400> 52 tgaatgagat agattttttt aattaaaaat agaggataca caagtcggag ttggaaaag 59 <210> 53 <211> 60 <212> DNA <213> Fritillaria przewalskii Maxim. 28960() <400> 53 tgaatgagat agattttttt aattaaaata tagaggatac acaagtcgga gttggaaaag 60 <210> 54 <211> 60 <212> DNA <213> Fritillaria delavayi Franch. 28960() <400> 54 tgaatgagat agattttttt aattaaaata tagaggatac acaagtcgga gttggaaaag 60 <210> 55 <211> 59 <212> DNA <213> Fritillaria wabuensis S. Y. Tang et S. C. Yue 28960() <400> 55 tgaatgagat agattttttt aattaaaaat agaggataca caagtcggag ttggaaaag 59 <210> 56 <211> 59 <212> DNA <213> Fritillaria taipaiensis 28960() <400> 56 tgaatgagat agattttttt aattaaaaat agaggataca caagtcggag ttggaaaag 59 <210> 57 <211> 59 <212> DNA <213> Fritillaria ussuriensis 28960() <400> 57 tgaatgagat agaatttttt aattaaaaat agaggataca caagtcggag ttggaaaag 59 <210> 58 <211> 59 <212> DNA <213> Fritillaria thunbergii 28960() <400> 58 tgaatgagat agaatttttt aattaaaaat agaggataca caagtcggag ttggaaaag 59 <210> 59 <211> 59 <212> DNA <213> Fritillaria walujewii 28960() <400> 59 tgaatgagat agaatttttt aattaaaaat agaggataca caagtcggag ttggaaaag 59 <210> 60 <211> 59 <212> DNA <213> Fritillaria pallidiflora 28960() <400> 60 tgaatgagat agaatttttt aattaaaaat agaggataca caagtcggag ttggaaaag 59 <210> 61 <211> 59 <212> DNA <213> Fritillaria hupehensis Hsiao et K. C. Hsia 28960() <400> 61 tgaatgagat agaatttttt aattaaaaat agaggataca caagtcggag ttggaaaag 59 <210> 62 <211> 59 <212> DNA <213> Fritillaria thunbergii Miq. var. chekiangensis Hsiao et K. C. Hsia 28960() <400> 62 tgaatgagat agaatttttt aattaaaaat agaggataca caagtcggag ttggaaaag 59

Claims

1. A primer and probe combination for authenticity identification and quantitative detection of Fritillaria cirrhosa, characterized in that: The kit includes the following two primer and probe combinations: (1) Primer and probe combination 1, comprising primer F as shown in SEQ ID NO. 1, primer R as shown in SEQ ID NO. 2, and probe P732 as shown in SEQ ID NO. 3; (2) A primer and probe combination 8, comprising a primer F as shown in SEQ ID NO:22, a primer R as shown in SEQ ID NO:23, and a probe P1222 as shown in SEQ ID NO:

24.

2. The primer and probe combination for authenticity identification and quantitative detection of Fritillaria cirrhosa according to claim 1, characterized in that: The primer and probe combination used for authenticity identification of Fritillaria cirrhosa is: primer and probe combination 1, including primer F as shown in SEQ ID NO1, primer R as shown in SEQ ID NO2, and probe P732 as shown in SEQ ID NO3.

3. The primer and probe combination for authenticity identification and quantitative detection of Fritillaria cirrhosa according to claim 1, characterized in that: The primer and probe combination used for quantitative detection of Fritillaria cirrhosa is: primer and probe combination 8, including primer F as shown in SEQ ID NO22, primer R as shown in SEQ ID NO23, and probe P1222 as shown in SEQ ID NO24.

4. A PCR method for authenticity identification and quantitative detection of Fritillaria cirrhosae, characterized in that: The method comprises: extracting genomic DNA from a Fritillaria cirrhosa sample, using the extracted genomic DNA as a template, and performing a dual fluorescence quantitative PCR reaction using the primer and probe combination of claim 1; and then using 2 -∆∆Ct The relative quantitative method can realize the rapid qualitative and quantitative detection of common adulteration of Fritillaria cirrhosa.

5. The PCR method for authenticity identification and quantitative detection of Fritillaria cirrhosae according to claim 4, characterized in that: The dual fluorescence quantitative PCR reaction system is 20 μL: 1 μL of 10 ng / μL template DNA, 0.6 μL of each 10 μmol / L primer, 0.3 μL of 10 μmol / L probe P732, 0.3 μL of 10 μmol / L probe P1222, 1 μL of 1×QN ROX Dye Solution, 10 μL of 2×Probe PCR Master Mix, and 5 μL of sterile ultrapure water; reaction parameters: pre-denaturation at 95°C for 2 min and 40 cycles of amplification reaction.

6. The PCR method for authenticity identification and quantitative detection of Fritillaria cirrhosae according to claim 5, characterized in that: The cyclic amplification reaction was repeated 40 times, and the conditions for each cyclic amplification were: denaturation at 95°C for 5 s and annealing at 60°C for 30 s.

7. A real-time fluorescence quantitative PCR kit for detecting adulteration and quantitative detection of Fritillaria cirrhosa, characterized in that: The kit comprises the PCR primer and probe combination for detecting adulteration and quantitative detection of Fritillaria cirrhosae as described in any one of claims 1 to 3.

Images