Methods for inducing an immune response by administering polymeric vesicles with associated antigens and polymeric vesicles with associated adjuvants, and compositions comprising these two polymeric vesicle groups.

Abstract

This invention relates to a method for inducing an immune response in a subject by administering an antigen and an adjuvant, wherein the antigen is associated with a first polymeric vesicle group and wherein the adjuvant is associated with a second polymeric vesicle group, and wherein both polymeric vesicle groups are administered to the subject. The invention also relates to compositions comprising the two polymeric vesicle groups of the invention (e.g., vaccines), methods for inducing an immune response, or methods for treating, improving, preventing, or diagnosing cancer, autoimmune diseases, or infectious diseases, said methods comprising providing the polymeric vesicles of the invention.

Description

[0001] Cross-references to related applications

[0002] This application claims the benefit of priority to European Patent Application No. 19189549.9, filed on 1 August 2019, and European Patent Application No. 20171327.8, filed on 24 April 2020, the contents of which are incorporated herein by reference in their entirety for all purposes.

[0003] sequence list

[0004] This application contains a sequence list in computer-readable form, which is incorporated herein by reference. Technical Field

[0005] This invention relates to a method for inducing an immune response by administering an antigen and an adjuvant, wherein the antigen is associated with a first polymeric vesicle group, and wherein the adjuvant is associated with a second polymeric vesicle group, and wherein both polymeric vesicle groups are administered to a subject. The invention also relates to compositions comprising these two polymeric vesicle groups and the therapeutic use of these two polymeric vesicle groups. The antigen can be any antigen capable of inducing an immune response and can be, for example, a polypeptide, a carbohydrate, a polynucleotide, or a combination thereof. Background Technology

[0006] Although immunization is a well-established process, different immunogens or antigens elicit varying levels of response. For example, membrane proteins form a class of antigens that produce low levels of response, meaning that large quantities of membrane proteins are needed to generate or provoke the required level of immune response. Membrane proteins are notoriously difficult to synthesize and are insoluble in water without detergents. This makes obtaining sufficient quantities of membrane proteins for immunization both expensive and challenging. Furthermore, membrane proteins require proper folding to function correctly. Generally, correctly folded native membrane proteins are far more immunogenic than their solubilized forms, which do not fold in a physiologically relevant manner. Therefore, even though adjuvants can be used to enhance the immunogenicity of such solubilized antigens, this is an inefficient method with little advantage (e.g., WO2014 / 077781A1).

[0007] Although transfected cells and lipid-based systems have been used to present membrane protein antigens to increase the chances of isolating potentially effective antibodies in vivo, these systems are often unstable (e.g., oxidatively sensitive), tedious, and expensive. Furthermore, the current state-of-the-art technology for such membrane protein antigens involves using inactive virus-like particles for immunization.

[0008] On the other hand, vaccines are the most effective method for preventing diseases (primarily infectious diseases) [e.g., Liu et al., 2016]. To date, most licensed vaccines are made from live or inactivated viruses. While they are effective in generating humoral responses (antibody-mediated responses) to prevent viral replication and entry into cells, the safety of such vaccines remains a concern. Over the past few decades, scientific advances have helped overcome these issues by engineering vaccine vectors from non-replicating recombinant viruses. Meanwhile, protein-based antigens or subunit antigens have been explored as a safer option. However, such protein-based vaccines often result in illicit and poor immune responses (humoral and cellular). Several methods have been used to improve the immunogenicity of antigens. For example, the microencapsulation of antigens into polymers has been extensively studied; however, while this does enhance immunogenicity, the problems of antigen aggregation and denaturation remain unresolved [e.g., Hilbert et al., 1999]. Furthermore, adjuvants (such as oil-in-water emulsions or polymeric emulsions) [e.g., US9636397B2, US2015 / 0044242A1] are used with antigens to elicit more pronounced humoral and cellular responses. Despite these advances, they remain less efficient in terms of uptake and cross-presentation. To facilitate cross-presentation, virus-like particles mimicking these properties have been developed based on information available to the immune system during viral infection. Synthetic structures, such as liposomes with encapsulated antigens, are particularly attractive. Liposomes are monolayer self-assembled structures made of lipids, and cationic liposomes are more attractive and promising as delivery media because they can be efficiently taken up by antigen-presenting cells (APCs) [e.g., Maji et al., 2016]. Moreover, liposomes allow for the integration of immunomodulators such as monophospholipid A (MPL) and CpG oligodeoxynucleotides, which are Toll-like receptor (TLR) agonists that can stimulate immune cells via receptors. Despite the advantages of such delivery media, one limiting factor is the stability of liposomes in the presence of serum components. By polyPEGylation and loading high-melting-point lipids, the stability problem of liposomes has been reduced to some extent. One well-characterized example is the formation of inner bilayer cross-linked multilayer vesicles (ICMVs) stabilized by short covalent cross-links connecting lipids [e.g., Moon et al., 2011]. Other nanoparticle structures, such as nanodiscs [e.g., Kuai et al., 2017] or pH-sensitive particles [e.g., Luo et al., 2017], have achieved successful immunization. However, such strategies either still require adjuvants or are ineffective outside of the proto-ovalbumin (OVA) model.

[0009] In addition, polymeric vesicles can serve as a stable alternative to liposomes and have been used to integrate membrane proteins to elicit immune responses [e.g., Quer et al., 2011, WO2014 / 077781A1]. Protein antigens have also been encapsulated in the membranes of chemically modified polymeric vesicles (however, oxidatively sensitive membranes) to release antigens and adjuvants into dendritic cells [e.g., Stano et al., 2013].

[0010] Despite the progress made by using polymers, there is still a need to provide alternative methods to elicit immune responses, particularly for the treatment and / or prevention of infectious diseases, cancers, and autoimmune diseases. Summary of the Invention

[0011] The present invention relates to a method for inducing an immune response in a subject by administering an antigen and an adjuvant, wherein the antigen is associated with a first polymeric vesicle group and wherein the adjuvant is associated with a second polymeric vesicle group, and wherein both polymeric vesicle groups are administered to the subject.

[0012] In such methods, the antigen is associated with the first polymer vesicle group by encapsulating the antigen in the first polymer vesicle group, by integrating the antigen into the circumferential membrane of the polymer vesicles of the first polymer vesicle group, by covalently attaching the antigen to the outer surface of the polymer vesicles, and / or by non-covalently attaching the antigen to the outer surface of the polymer vesicles.

[0013] In such methods, the adjuvant is also associated with the second polymer vesicle group by encapsulating the adjuvant in the second polymer vesicle group, by integrating the adjuvant into the circumferential membrane of the polymer vesicles of the second polymer vesicle group, by covalently attaching the adjuvant to the outer surface of the polymer vesicles, and / or by non-covalently attaching the adjuvant to the outer surface of the polymer vesicles.

[0014] In an embodiment of the method, the antigen may be selected from polypeptides, carbohydrates, polynucleotides, and combinations thereof.

[0015] The present invention further relates to a method for producing the two polymer vesicle clusters. The present invention further relates to compositions comprising the two polymer vesicle clusters of the present invention, isolated antigen-presenting cells and hybridoma cells exposed to the polymer vesicles or compositions of the present invention. The present invention also relates to vaccines comprising the two polymer vesicle clusters of the present invention, methods for inducing an immune response, or methods for treating, improving, preventing, or diagnosing cancer, autoimmune diseases, or infectious diseases, such methods comprising providing the polymer vesicles of the present invention to a subject in need of such treatment.

[0016] The present invention also relates to the use of the two polymer vesicle groups for inducing an immune response, wherein at least one polymer vesicle group or both groups have an average diameter of about 120 nm or 140 nm or greater, wherein the polymer vesicle group has an antigen or adjuvant associated with the polymer vesicle, such as a soluble encapsulating antigen or encapsulating adjuvant, wherein the antigen may be selected from:

[0017] i) Polypeptides;

[0018] ii) Carbohydrates;

[0019] iii) Polynucleotides, preferably not antisense oligonucleotides, and more preferably, the polynucleotides are DNA or mRNA molecules.

[0020] iv) lipids or

[0021] Any combination of v)i) to iv).

[0022] The present invention also relates to the use of the two polymeric vesicle groups for inducing an immune response, wherein at least one group or both groups have an average diameter of about 120 nm or 140 nm or greater, and the polymeric vesicle groups have an associated antigen (e.g., a soluble encapsulated antigen) or adjuvant. The antigen may be selected from:

[0023] i) Polypeptides;

[0024] ii) Carbohydrates;

[0025] iii) Polynucleotides, preferably not antisense oligonucleotides, and more preferably, the polynucleotides are DNA or mRNA molecules.

[0026] iv) lipids or

[0027] Any combination of v)i) to iv).

[0028] In an alternative embodiment, the present invention provides a method for inducing an immune response in a subject by administering an antigen and an adjuvant, wherein the antigen is associated with a first polymeric vesicle group, and wherein a second polymeric vesicle group serves as an adjuvant, and wherein both polymeric vesicle groups are administered to the subject.

[0029] In this invention, it was discovered that two distinct polymer vesicle groups lead to an increased immune response, one group being associated with the antigen and the other with the adjuvant only. Furthermore, it was found in the course of this invention that the polymer vesicles provided by this invention allow soluble (solubilized) encapsulated antigens (located within the polymer vesicles) to generate a stronger humoral immune response (than free antigens with or without adjuvants), and to induce CD8.(+) T-cell-mediated immune responses are mediated, thereby increasing antibody production efficiency in subjects. This efficiency improvement is achieved regardless of the use of adjuvants. Furthermore, the polymer vesicles of this invention induce CD8... (+) Its ability to induce T-cell-mediated immune responses significantly increases its potential as an immunotherapeutic antigen delivery and presentation system.

[0030] Because the polymer vesicles present soluble (e.g., solubilized) encapsulated antigens, antibodies generated using the polymer vesicles and methods of the present invention not only have higher production success rates and higher affinity for their corresponding in vitro or in vivo targets, but also correspondingly improved sensitivity when used in various solution-based antibody applications. Furthermore, it allows for the easy generation of antibodies against difficult antigens that cannot be triggered by conventional methods using free antigen injection, and / or reduces the amount of antigen required for such antibody generation, thereby lowering the cost of such production. In addition, the soluble (e.g., solubilized) encapsulated antigens presented by the polymer vesicles of the present invention can also trigger CD8. (+) T-cell-mediated immune responses extend the use of the corresponding polymer vesicles to cell-mediated immunity, thereby improving the immunotherapeutic and antigen delivery and presentation potential of the polymer vesicles.

[0031] Therefore, this application addresses this need by providing (when applied) two separate groups of polymeric vesicles that improve the immunogenic properties of the antigen, a method for producing the two groups of polymeric vesicles, and a composition comprising the two groups of polymeric vesicles, which are described below, the method for producing them, and the composition comprising such polymeric vesicles, the features of which are characterized in the claims and illustrated by the appended examples and drawings.

[0032] Sequence List Overview

[0033] As described in this article, refer to the UniProtKB registry number (http: / / www.uniprot.org / , as obtained in UniProtKBRelease 2017_12, unless otherwise stated or otherwise inherent).

[0034] SEQ ID NO:1 is the amino acid sequence of Reps1 P45A, a tumor neoantigen polypeptide derived from the MC-38 colon cancer mouse model.

[0035] SEQ ID NO:2 is the amino acid sequence of the tumor neoantigen peptide Adpgk R304M derived from the MC-38 colon cancer mouse model.

[0036] SEQ ID NO:3 is the amino acid sequence of the tumor neoantigen peptide Dpagt1 V213L derived from the MC-38 colon cancer mouse model.

[0037] SEQ ID NO:4 is the amino acid sequence of ovalbumin (OVA), UniProtKB accession number: P01012.

[0038] SEQ ID NO:5 is the amino acid sequence of hemagglutinin of influenza A virus (A / New York / 38 / 2016(H1N1)), UniProtKB accession number: A0A192ZYK0.

[0039] SEQ ID NO:6 is the amino acid sequence of hemagglutinin of influenza A virus (A / swine / 4 / Mexico / 2009(H1N1)), UniProtKB accession number: D2CE65.

[0040] SEQ ID NO:7 is the amino acid sequence of hemagglutinin from influenza A virus (A / Puerto Rico / 8 / 1934(H1N1)).

[0041] SEQ ID NO:8 is the amino acid sequence of hemagglutinin from influenza A virus (A / California / 07 / 2009(H1N1)).

[0042] SEQ ID NO:9 is the amino acid sequence of CD8 Trp2 173–196, a tumor neoantigen polypeptide derived from the melanoma B16-F10 mouse model.

[0043] SEQ ID NO:10 is the amino acid sequence of the tumor neoantigen polypeptide CD4 M30Kif18b K739N derived from the melanoma B16-F10 mouse model.

[0044] SEQ ID NO:11 is the amino acid sequence of the tumor neoantigen polypeptide CD4 M44Cpsf3l D314N derived from the melanoma B16-F10 mouse model.

[0045] SEQ ID NO:12 is the amino acid sequence of the soluble portion (amino acid residues 19 to 1327) of the spike protein (S protein) of porcine epidemic diarrhea virus (PEDv) (UniProtKB accession number: V5TA78).

[0046] SEQ ID NO:13 is the amino acid sequence of the S1 region (amino acid residues 19 to 739) of the PEDv spike protein (S protein), and

[0047] SEQ ID NO:14 is the amino acid sequence of the S2 region (amino acid residues 739 to 1327) of the PEDv spike protein (S protein).

[0048] SEQ ID NO:15 is the amino sequence of enhanced green fluorescent protein (eGFP).

[0049] SEQ ID NO:16 is the sequence of the CD8T cell peptide epitope (SIINFEKL).

[0050] SEQ ID NO:17 is the sequence of a CD8T cell peptide epitope (SVYDFFVWL).

[0051] SEQ ID NO:18 is the sequence of class B CpG oligodeoxynucleotide CpG ODN1826 (5'-tccatgacgttcctgacgtt-3') purchased from InvivoGen.

[0052] SEQ ID NO:19 is the amino acid sequence of the SARS-CoV-2 spike protein according to UniProtKB accession number no. P0DTC2.

[0053] SEQ ID NO:20 is the amino acid sequence of the SARS-CoV-2 spike protein according to UniProtKB accession number no.QII57278.1.

[0054] SEQ ID NO:21 is the amino acid sequence of the SARS-CoV-2 spike protein according to GenBank accession number no.YP_009724390.1.

[0055] SEQ ID NO:22 is the amino acid sequence of the SARS-CoV-2 spike protein according to GenBank accession number no.QIO04367.1.

[0056] SEQ ID NO:23 is the amino acid sequence of the SARS-CoV-2 spike protein according to GenBank accession number no. QHU79173.2.

[0057] SEQ ID NO:24 is the amino acid sequence of the SARS-CoV-2 spike protein according to GenBank accession number no.QII87830.1.

[0058] SEQ ID NO:25 is the amino acid sequence of the SARS-CoV-2 spike protein according to GenBank accession number no.QIA98583.1.

[0059] SEQ ID NO:26 is the amino acid sequence of the SARS-CoV-2 spike protein according to GenBank accession number no.QIA20044.1.

[0060] SEQ ID NO:27 is the amino acid sequence of the SARS-CoV-2 spike protein according to GenBank accession number no.QIK50427.1.

[0061] SEQ ID NO:28 is the amino acid sequence of the SARS-CoV-2 spike protein according to GenBank accession number no.QHR84449.1.

[0062] SEQ ID NO:29 is the amino acid sequence of the SARS-CoV-2 spike protein according to GenBank accession number no.QIQ08810.1.

[0063] SEQ ID NO:30 is the amino acid sequence of the SARS-CoV-2 spike protein according to GenBank accession number no.QIJ96493.1.

[0064] SEQ ID NO:31 is the amino acid sequence of the SARS-CoV-2 spike protein according to GenBank accession number no. QIC53204.1.

[0065] SEQ ID NO:32 is the amino acid sequence of the SARS-CoV-2 spike protein according to GenBank accession number no.QHZ00379.1.

[0066] SEQ ID NO:33 is the amino acid sequence of the SARS-CoV-2 spike protein according to GenBank accession number no.QHS34546.1.

[0067] SEQ ID NO:34 is the amino acid sequence of a soluble fragment of the SARS-CoV-2 spike protein corresponding to positions 16-1213 of UniProtKB accession number no. P0DTC2.

[0068] SEQ ID NO:35 is the amino acid sequence of a soluble fragment of the SARS-CoV-2 spike protein corresponding to UniProtKB accession number no. P0DTC2, positions 14-1204.

[0069] SEQ ID NO:36 is the amino acid sequence of a soluble fragment of the SARS-CoV-2 spike protein.

[0070] SEQ ID NO:37 is the amino acid sequence of a soluble fragment of the SARS-CoV-2 spike protein corresponding to UniProtKB accession number no. P0DTC2, positions 16-685.

[0071] SEQ ID NO:38 is the amino acid sequence of a soluble fragment of the SARS-CoV-2 spike protein corresponding to positions 686-1213 of UniProtKB accession number no. P0DTC2.

[0072] SEQ ID NO:39 is the amino acid sequence of a soluble fragment of the SARS-CoV-2 spike protein corresponding to UniProtKB accession number no. P0DTC2, positions 646-1204.

[0073] SEQ ID NO:40 is the amino acid sequence of a soluble fragment of the SARS-CoV-2 spike protein.

[0074] SEQ ID NO:41 is the amino acid sequence of a soluble fragment of the SARS-CoV-2 spike protein, corresponding to UniProtKB accession number no. P0DTC2, positions 318-524.

[0075] SEQ ID NO:42 is the amino acid sequence of the MERS-CoV spike protein according to UniProtKB accession number no.K0BRG7.

[0076] SEQ ID NO:43 is the amino acid sequence of a soluble fragment of the MERS-CoV spike protein corresponding to positions 1-1297 of UniProtKB accession number no. K0BRG7.

[0077] SEQ ID NO:44 is the amino acid sequence of a soluble fragment of the MERS-CoV spike protein corresponding to positions 18-725 of UniProtKB accession number no. K0BRG7.

[0078] SEQ ID NO:45 is the amino acid sequence of the soluble fragment of the MERS-CoV spike protein, corresponding to positions 726-1296 of UniProtKB accession number no. K0BRG7.

[0079] SEQ ID NO:46 is the amino acid sequence of the soluble fragment of the MERS-CoV spike protein corresponding to UniProtKB accession number no. K0BRG7, positions 377-588.

[0080] SEQ ID NO:47 is the amino acid sequence of the SARS-CoV-1 spike protein according to UniProtKB accession number no. P59594.

[0081] SEQ ID NO:48 is the amino acid sequence of a soluble fragment of the SARS-CoV-1 spike protein, corresponding to UniProtKB accession number no. P59594, positions 14-1195.

[0082] SEQ ID NO:49 is the amino acid sequence of a soluble fragment of the SARS-CoV-1 spike protein, corresponding to UniProtKB accession number no. P59594, positions 14-667.

[0083] SEQ ID NO:50 is the amino acid sequence of a soluble fragment of the SARS-CoV-1 spike protein, corresponding to positions 668-1195 of UniProtKB accession number P59594.

[0084] SEQ ID NO:51 is the amino acid sequence of the soluble fragment of the SARS-CoV-1 spike protein, corresponding to UniProtKB accession number no. P59594, positions 306-527.

[0085] SEQ ID NO:52 is the amino acid sequence of the furin cleavage site of the SARS-CoV-2 spike protein.

[0086] SEQ ID NO:53 is the amino acid sequence of the mutated furin cleavage site of the SARS-CoV-2 spike protein.

[0087] SEQ ID NO:54 is the amino acid sequence of the foldon domain.

[0088] SEQ ID NO:55 is the amino acid sequence of the GCN4 domain.

[0089] SEQ ID NO:56 is the amino acid sequence of the immune-silencing GCN4 domain.

[0090] SEQ ID NO:57 is the amino acid sequence of the bee venom peptide leader sequence.

[0091] SEQ ID NO:58 is the amino acid sequence of the furin cleavage site of the MERS-CoV spike protein.

[0092] SEQ ID NO:59 is the amino acid sequence of the mutated furin cleavage site of the MERS-CoV spike protein.

[0093] SEQ ID NO:60 is the amino acid sequence of the furin cleavage site of the SARS-CoV-1 spike protein.

[0094] SEQ ID NO:61 is the amino acid sequence of the mutated furin cleavage site of the SARS-CoV-1 spike protein.

[0095] SEQ ID NO:62 is the nucleotide sequence of CpG oligonucleotide ODN 2006.

[0096] SEQ ID NO:63 is the nucleotide sequence of CpG oligonucleotide ODN 2007.

[0097] SEQ ID NO:64 is the nucleotide sequence of CpG oligonucleotide ODN 2216.

[0098] SEQ ID NO:65 is the amino acid sequence of a soluble fragment of the SARS-CoV-2 spike protein that corresponds to positions 19-1204 of UniProtKB accession number no. P0DTC2 but has a mutated furin cleavage site.

[0099] SEQ ID NO:66 is the amino acid sequence of the SARS-CoV-2 spike protein, corresponding to positions 19-1273 of UniProtKB accession number no. P0DTC2, but with a mutated furin cleavage site. Attached Figure Description

[0100] Figure 1 A schematic diagram is shown illustrating immunization using polymer vesicles of the present invention encapsulating antigens and measuring humoral and cellular responses.

[0101] Figure 2 The results of dynamic light scattering of the polymer vesicles of the present invention are shown. Figure 2 A shows a dynamic light scattering pattern of polymer vesicles encapsulating OVA with a monodisperse group of 173.1 nm (diameter). Figure 2 B shows a table of average diameters (Z-mean values) of different polymeric vesicles encapsulating different antigens, measured by DLS. The names of the formulations, as shown in parentheses as “ACM-OVA”, “ACM-CpG”, “ACM-OVA-CpG”, and “ACM-Trp2”, are used elsewhere in this application.

[0102] Figure 3 Elution curves of polymer vesicles encapsulating OVA in size exclusion chromatography are shown.

[0103] Figure 4 Sodium dodecyl sulfate-polyacrylamide gel electrophoresis (SDS-PAGE) is shown for polymer vesicles encapsulating OVA.

[0104] Figure 5The encapsulation of nucleic acid (here, the gene encoding enhanced green fluorescent protein (eGFP)) in polymer vesicles of the present invention is shown, as well as the results of uptake of the polymer with the encapsulated nucleic acid in cells. Figure 5 A shows the fluorescence intensity uptake of different polymer vesicles inside the cell and the eGFP expression based on the DNA encapsulated in the polymer vesicles, while Figure 5 B and Figure 5 C shows a fluorescent image of cells transfected with polymer vesicles encapsulating DNA.

[0105] Figure 6 Antibody titers in mouse serum immunized with PBS, OVA only, OVA with SAS adjuvant, and unadjuvanted polymeric vesicles encapsulated with OVA were shown. OVA encapsulated with ACM only (hereinafter "ACM" refers to the polymeric vesicles of the present invention) induced IgG titers.

[0106] Figure 7 Antibody titers in mouse serum immunized with PBS, HA-only, and adjuvant-free HA-encapsulated polymeric vesicles were shown. HA-only encapsulated with ACM (the polymeric vesicles of the present invention) induced IgG titers.

[0107] Figure 8 Results from the MC-38 mouse tumor model are shown. Tumor volume was monitored in mice immunized with free peptides (hollow circles), ACM-encapsulated peptides (solid squares, the polymer vesicles of the present invention), or ACM-encapsulated peptides treated with anti-PD1 antibody (solid triangles). Compared to free peptides, ACM-encapsulated peptides (the polymer vesicles of the present invention) altered tumor development, and this alteration was further enhanced by the addition of anti-PD1 antibody. No adjuvant was added in any group.

[0108] Figure 9 The IgG antibody titers and virus neutralization (against strain PEDv USA / Colorado / 2013(CO / 13)) of mouse serum immunized with PBS and with soluble fragments of the PEDv S protein encapsulated in polymeric vesicles as used herein (“SPIKE protein-encapsulated polymeric vesicles”) are shown and compared with those of mouse serum immunized with inactivated PED virus (“inactivated PEDv”) and ACM polymeric vesicles only (i.e., without any antigen, “polymeric vesicles only”). Figure 9 The IgG titers showed that both the ACM-encapsulated PEDv S protein fragment and the inactivated virus induced IgG titers. Virus neutralization data indicated that only the ACM-encapsulated PEDv S protein resulted in a significant neutralizing titer, while the neutralizing effects of the negative control (ACM polymer vesicles without any antigen) and the inactivated PED virus were negligible.

[0109] Figure 10 The use of PBS and different polymer vesicles (such as BD21 (as defined below), PDMS is shown. 46 -PEO 37 (Labeled only as "PDMS" in the figure), PDMS with DSPE-PEG (distearylphosphatidylethanolamine [DSPE] polyethylene glycol) as an added lipid. 46 -PEO 37 Virus neutralization data from serum produced from mice immunized with polyethylene glycol-polylactic acid (PLA-PEG) containing a full-length soluble PED spike protein (in the case of "BD21 with soluble S protein") or its S1 or S2 fragment (in all other cases) encapsulated with soybean phospholipid (Asolectin lipid) (commercially available phospholipids derived from soybean). (For strain PEDv USA / Colorado / 2013(CO / 13)). Figure 10 As can be seen, the mouse group immunized with PBS samples did not show any virus neutralization, while all polymer vesicle formulations, whether encapsulating the full-length protein or its fragments, showed varying degrees of virus neutralization.

[0110] Figure 11 The IgA antibody titer of pigs orally immunized with PEDv S protein encapsulated in ACM without adjuvant is shown. The titer was obtained from fecal swabs. Figure 11 The titer shown increases over time, indicating that oral administration of the polymeric vesicles of the present invention, in which PEDv S protein is encapsulated, can elicit an immune response in pigs.

[0111] Figure 12 A schematic diagram is shown of soluble fragments of porcine epidemic diarrhea virus (PEDv) spike protein (S protein) (UniProtKB accession number: V5TA78) and SEQ ID NO:12 (amino acid residues 19 to 1327), SEQ ID NO:13 (amino acid residues 19 to 739), and SEQ ID NO:14 (amino acid residues 739 to 1327), which have been used to encapsulate soluble S proteins in polymer vesicles and subsequently immunize / vaccinate mice and pigs as described herein.

[0112] Figure 13 Tumor growth curves following prophylactic vaccination with ACM OVA formulations are shown. Different OVA formulations were administered, followed by 10 [units of vaccination]. 5 Tumor growth curve of mice with B16-OVA cells. Figure 13 A shows the PBS group, the free OVA and CpG administration group, and the ACM-encapsulated OVA and free CpG co-administration group. Figure 13B shows the PBS group, the ACM-encapsulated OVA and ACM-encapsulated CpG co-administration group, and the ACM encapsulated with OVA and CpG.

[0113] Figure 14 Tumor growth curves following therapeutic vaccination with different ACM OVA formulations are shown. 5 Tumor growth curve of mice with B16-OVA cells. Figure 14 A) PBS group, free OVA and CpG administration group and ACM-encapsulated OVA and free CpG co-administration group, B) PBS group, co-administration of free OVA and CpG-encapsulated ACM and co-administration of ACM-encapsulated OVA and ACM-encapsulated CpG, C) OVA-specific CD8 T cells quantified using dextramer specific to the SIINFEKL (SEQ ID NO: 16) peptide epitope of CD8 T cells.

[0114] Figure 15 The vaccination of 10 was shown 5 Tumor growth curves of mice with B16F10 cells treated with ACM melanoma B16F10 formulation. Figure 15 A illustrates the co-administration of PBS, free Trp2 (SEQ ID NO: 9) and CpG, co-administration of Trp2-encapsulated ACM and CpG, co-administration of free Trp2 and ACM-encapsulated CpG, and co-administration of ACM-encapsulated Trp2 and ACM-encapsulated CpG. Figure 15 B shows the quantification of Trp2-specific CD8-specific T cells in blood using a pentamer that is heterogeneous to the SVYDFFVWL (SEQ ID NO:17) peptide epitope of CD8 T cells, and Figure 15 C shows CD8T cell infiltration in the tumor.

[0115] Figure 16 The dynamic light scattering (DLS) spectrum of the OVA-conjugated ACM is shown.

[0116] Figure 17 The characterization of OVA-conjugated ACMs is shown, wherein, Figure 17 A shows the size exclusion chromatography (SEC) curve of OVA-conjugated ACM. Figure 17 B shows an SDS-PAGE of a sample loaded with the SEC peak and stained with silver.

[0117] Figure 18 The DLS spectrum of HA-conjugated ACM is shown.

[0118] Figure 19The immunoblot of ACM-conjugated HA samples is shown. The migration of conjugated HA and free HA differs.

[0119] Figure 20 The SEC curve (mAU, light gray trace) of the HA conjugate ACM is shown, superimposed with the ELISA signal (OD450, black trace) from all collected fractions.

[0120] Figure 21 Antibody titers from serum of C57Bl / 6 mice immunized with PBS, free OVA, free OVA and SAS, BD21-encapsulated OVA, and BD21-conjugated OVA are shown, p < 0.01.

[0121] Figure 22 Antibody titers are shown from serum of Balb / c mice immunized with PBS, free HA, BD21-encapsulated HA, and BD21-conjugated HA.

[0122] Figure 23 A schematic diagram shows soluble fragments of the SARS-CoV-2 spike protein (S protein) (UniProtKB accession number: P0DTC2) and SEQ ID NO:34 (amino acid residues 16 to 1213), SEQ ID NO:37 (amino acid residues 16 to 685), and SEQ ID NO:38 (amino acid residues 685 to 1213). According to UniProtKB, amino acids 1214-1234 form the transmembrane region, and amino acids 1235-1273 form the intraviral region. The endpoints of the S1 and S2 segments, the transmembrane region, and / or the intraviral region may vary depending on the prediction software. Figure 23 B shows a protocol for immunizing mice with ACM containing encapsulated SARS-CoV-2 spike proteins. Figure 23 C shows the IgG titers measured in Balb / C mice on day 35 after immunization with the following preparations: soluble S1 and S2 segments encapsulated with BD21 co-administered with adjuvant (Group 1), soluble S1 and S2 segments encapsulated with BD21 co-administered with encapsulated adjuvant (Group 2), soluble S2 segment encapsulated with BD21 co-administered with encapsulated adjuvant (Group 3), and PBS as a negative control (Group 4).

[0123] Figure 24 The protocol and results of immunizing mice with full-length soluble encapsulated SARS-CoV-2 spike protein encapsulated in ACM are shown. Figure 24 A illustrates the immunization protocol. Figure 24B shows the titers of IgG antibodies against SARS-CoV-2 spike protein 28 days after the first immunization in four groups. The following formulations were prepared: i) free recombinant spike protein (“fSpike”); ii) spike protein encapsulated in BD21 polymer vesicles (“ACM-spike”); iii) a mixture of free spike protein and free CpG adjuvant (“fSpikefCpG”); iv) a mixture of spike protein encapsulated in BD21 polymer vesicles and CpG encapsulated in BD21 polymer vesicles (“ACM-spikeACM-CpG”).

[0124] Figure 25 The results of a post-viral neutralization assay (PEDv) in guinea pigs after immunization with ACM containing encapsulated CpG S2 spike protein, administered via different routes, are presented.

[0125] Figure 26 The protocol and results of immunizing mice with ACM containing encapsulated MERS spike proteins are shown. Figure 26 A shows the immunization regimen. Figure 26 B shows the ELISA results targeting the S1 domain of the MERS-CoV spike protein. Figure 26 C shows the results of the virus neutralization test (MERS-CoV).

[0126] Figure 27 The results of a virus neutralization assay (PEDv) are shown in mice immunized with ACM containing either the S1 or S2 domains of the encapsulated PEDv spike protein, or ACM containing a mixture of the encapsulated S1 and S2 domains. Invention Details

[0128] The following detailed description refers to the accompanying embodiments and drawings, which illustrate by way of example specific details and implementations of the invention. These embodiments are described in sufficient detail to enable those skilled in the art to implement the invention. Other embodiments may be used, allowing structural, logical, and compromise changes without departing from the scope of the invention. The various aspects of the invention described herein are not necessarily mutually exclusive, as these aspects can be combined with one or more other aspects to form new embodiments of the invention.

[0129] This invention is based on the remarkable discovery that when two separate polymeric vesicle groups (where the first polymeric vesicle group is associated with the antigen only and the second polymeric vesicle group is associated with the adjuvant only) are administered together, the immune response to the antigen is improved, thereby providing immunization or therapeutic effects for, for example, infectious diseases or cancer (see Examples 7 to 9 or Example 19 of this application, wherein Example 8 shows that administration of a first polymeric vesicle group with an encapsulated antigen together with a separate second polymeric vesicle group with an encapsulated CpG (adjuvant) produced an immune response in mice with tumor burden and T cell infiltration; wherein Example 9 shows that administration of an immunogenic neotumor antigen Trp2 peptide encapsulated in the first polymeric vesicle group together with a CpG oligonucleotide (adjuvant) encapsulated in the second (independent) group showed a stronger anti-tumor response than, for example, free Trp2 peptide; and wherein when the spike protein of Sars-CoV-2 is encapsulated in the first polymeric vesicle group and the CpG oligonucleotide (adjuvant) is encapsulated in the second (independent) group, an immune response is produced. When encapsulated in a second (independent) cluster, Example 19 demonstrated the highest immune response against the spike protein of the Sars-CoV-2 virus. This finding that two independent polymer vesicle clusters lead to an improved immune response has the additional advantage of allowing for the independent / separate production of both polymer vesicle clusters. This further simplifies GMP production of, for example, the corresponding vaccine or therapeutic composition, because a first polymer vesicle cluster, for example, containing an antigen encapsulated in or conjugated to the surface of a polymer vesicle, can be produced under standardized GMP conditions, while a second polymer vesicle cluster, for example, containing an adjuvant encapsulated in or conjugated to the surface of a polymer vesicle, can also be produced under standardized conditions. These two clusters can then be combined during manufacturing (to produce a composition combining the two polymer vesicle clusters for co-administration) or administered individually to the subject. Such a pharmaceutical / vaccine manufacturing method is easier to control than, for example, encapsulating the antigen and adjuvant in the same polymer vesicle cluster.

[0130] An antigen can be associated with a first polymeric vesicle group through any possible interaction between the antigen and the first polymeric vesicle group. For example, the antigen can be encapsulated within the first polymeric vesicle group, as described in co-pending PCT application PCT / EP2019 / 051853, filed January 25, 2019, the entire contents of which are incorporated herein by reference. Alternatively, the antigen can be integrated into the circumferential membrane of the polymeric vesicles of the first polymeric vesicle group, as described in international application WO2014 / 077781. The antigen can also be covalently attached to the outer surface of the polymeric vesicles of the first polymeric vesicle group, as described in co-pending European patent application 18193946.3, filed September 12, 2018, the entire contents of which are incorporated herein by reference.

[0131] Antigens can also be conjugated to the outer surface of polymer vesicles of the first polymer vesicle group via non-covalent bonds. Examples of such non-covalent bonds include electrostatic interactions, such as salt bridges between positively and negatively charged residues on the surface of the polymer vesicle or the antigen. For example, a salt bridge can be formed between a positively charged amino group (NH2 group) and a negatively charged carboxyl group (COOH). Another exemplary example of such non-covalent interaction between the first polymer vesicle group and the antigen is the binding pair between streptavidin and biotin, the binding pair between avidin and biotin, the binding pair between streptavidin and streptavidin-binding peptide, or the binding pair between avidin and avidin-binding peptide. For example, polymer vesicles with biotin groups on their surface can be prepared according to Broz et al., “Celltargeting by a generic receptor-targeted polymer nanocontainer platform”, Journal of Controlled Release. 2005; 102(2): 475–488, and can react with antigens conjugated to streptavidin or avidin. Non-covalent biotin-streptavidin conjugates of polymer vesicles and antigens can also be prepared as described by Egli et al., “Functionalization of BlockCopolymer Vesicle Surfaces Polymers”, 2011, 3(1), 252-280. In this context, the term “antigen associated with a first polymer vesicle group” as used herein does not mean that only one specific antigen is associated with a first polymer vesicle group, but rather that more than one, for example, two or more antigens may be associated with the first polymer vesicle group. As an exemplary example, for instance, two or more immunogenic peptides may be associated with the first polymer vesicle group of the present invention. One or more immunogenic peptides and corresponding nucleic acid molecules encoding these peptides may also be associated with the first polymer vesicle group as used herein. The term “antigen associated with a first polymer vesicle group” as used herein also means two or more first polymer vesicle groups, each carrying a different antigen that can be used in the present invention. For example, two different antigenic peptides may be used, and each of them may be associated with a separate first polymer vesicle group of the present invention.

[0132] The adjuvant can also be associated with the second polymer vesicle group through any possible interaction in the same manner as the antigen and the first polymer vesicle group can be associated. This means that the adjuvant can be encapsulated within the first polymer vesicle group, as described in co-pending PCT application PCT / EP2019 / 051853, filed January 25, 2019, the entire contents of which are incorporated herein by reference. Alternatively, the adjuvant can be integrated into the circumferential membrane of the polymer vesicles of the first polymer vesicle group as described in international application WO2014 / 077781. Exemplary examples of adjuvants that can be introduced / integrated into the circumferential membrane of the polymer vesicles (of the second polymer vesicle group) include synthetic monophosphoryl ester A (see Cluff, “Monophosphoryl Lipid A (MPL) as an Adjuvant for Anti-Cancer Vaccines: Clinical Results” in Lipid A in Cancer Therapy, for which... Jeannin (ed., 2009 Landes Bioscience and Springer), polysorbate 80, α-DL-tocopherol, dioleoyl-3-trimethylammonium propane (DOTAP), cationic lipid 1-[2-(oleoyloxy)ethyl]-2-oleoyl-3-(2-hydroxyethyl)imidazoline chloride (DOTIM) (see Bernstein et al., “The Adjuvant CLDC Increases Protection of a Herpes SimplexType 2 Glycoprotein D Vaccine in Guinea Pig” Vaccine. 2010 May 7; 28(21):3748–3753) or synthetic amphiphilic dimethyl dioctadecylammonium (DDA) (see Smith Korsholm et al., “The adjuvant mechanism of cationic dimethyldioctadecylammonium liposomes” Immunology, 121, 216–226), to name just a few. As will be apparent in this document, one or more adjuvants may be present in the polymer vesicles of the second polymer vesicle group used herein. For example, the second polymer vesicle group may contain an encapsulated adjuvant (such as a CpG oligonucleotide) and an adjuvant (such as monophospholipase A or DOTAP) integrated into the circumferential membrane of the polymer vesicle group (however, according to the above disclosure, the second polymer vesicle group does not contain an antigen, which means that it does not contain any antigen).

[0133] Consistent with the above, adjuvants can also be covalently conjugated to the outer surface of the polymer vesicles of the first polymer vesicle group, as described in co-pending European Patent Application 18193946.3, filed September 12, 2018, the entire contents of which are incorporated herein by reference. Alternatively, the conjugation of the adjuvant to the outer surface of the polymer vesicles can also be achieved through non-covalent bonding, such as biotin-streptavidin interactions. It should be noted that CpG oligonucleotides such as class B CpG oligodeoxynucleotides CpG ODN1826 (5'-tccatgacgttcctgacgtt-3', SEQ ID NO:18) are available in biotinylated form and can therefore readily react with biotinylated polymer vesicles derived from, for example, those described in the "Journal of Controlled Release 2005, modified with streptavidin as described above. Similarly, it is evident from this embodiment that the second polymer vesicle group can carry more than one adjuvant(s), such as CpG oligonucleotides covalently or non-covalently conjugated to the outer surface of the polymer vesicle and additional adjuvants, such as monophospholipase A or DOTAP, integrated into the circumferential membrane of the polymer vesicle. It is further evident that the same adjuvant can be associated with the second polymer vesicle group in different ways; for example, CpG oligonucleotides can be encapsulated within the polymer vesicles and simultaneously covalently or non-covalently conjugated to the outer surface of the polymer vesicles. By doing so, higher quantities of adjuvant can be provided for administration if desired.

[0134] According to the above disclosure, regardless of how the antigen and adjuvant are associated with the first and second polymer vesicle groups, any type of first polymer vesicle group can be used for administration with any type of second polymer vesicle group. For example, the first polymer vesicle group may have an antigen encapsulated within the polymer vesicle, and the second polymer vesicle group may also have an adjuvant encapsulated within the polymer vesicle. Alternatively, the first polymer vesicle group may have an antigen covalently or non-covalently bonded to the outer surface of the polymer vesicle, and the second polymer vesicle group may also have an adjuvant covalently or non-covalently bonded to the outer surface of the polymer vesicle. As a further simple exemplary example, the first polymer vesicle group may have an antigen integrated into the circumferential membrane of the polymer vesicle, and the second polymer vesicle group may also have an adjuvant integrated into the circumferential membrane of the polymer. As a further exemplary example, the first polymer vesicle group may have an antigen encapsulated within the polymer vesicle, while the second polymer vesicle group may have an adjuvant a) covalently or non-covalently bonded to the outer surface of the polymer vesicle, or b) also have an adjuvant integrated into the circumferential membrane of the polymer vesicle. As another exemplary example, the first polymer vesicle group may have an antigen covalently bonded to the outer surface of the polymer vesicle, and the second polymer vesicle group may have an adjuvant encapsulated within the polymer vesicle.

[0135] The administration of the two polymeric vesicle groups of the present invention will now be described in more detail: the first and second polymeric vesicle groups can be administered to the subject simultaneously (i.e., at the same time) or at different times. In the case of simultaneous administration of the two groups, the two polymeric vesicle groups can be administered together (i.e., by co-administration). In this case, the two polymeric vesicle groups are combined or mixed together prior to administration, and thus they are present in the same composition, for example, a pharmaceutically acceptable carrier (e.g., a physiological buffer or solid dosage form suitable for oral administration). In the case of simultaneous administration, each of the two polymeric vesicle groups can also be administered separately. In this case, the two polymeric vesicle groups are obviously not combined with each other prior to administration, and they can be administered, for example, via two or more separate injections.

[0136] Two polymeric vesicles can be administered to selected subjects in any manner known to induce an immune response in subjects and suitable for administering the polymeric vesicles to a given subject. In cases where the subject to immunization is a fish or farm animal (e.g., chicken, pig, or sheep), oral administration, for example, may be advantageous, and compositions containing the two polymeric vesicles of the present invention can be formulated as food additives. Alternatively, intradermal administration via a syringe gun or jet injector can be used for farm animals. For humans, both invasive and non-invasive administration can be used. Suitable routes of administration for humans and non-human animals include, but are not limited to, oral administration, nasal administration, administration to mucosal surfaces, inhalation, intradermal administration, intraperitoneal administration, subcutaneous administration, intravenous administration, or intramuscular administration.

[0137] More specifically, for the conjugation of antigens and / or adjuvants to the outer surface of polymeric vesicles of the first or second polymeric vesicle group, the covalent bond can be any suitable covalent bond capable of conjugating the antigen (e.g., the antigen of the present invention) or adjuvant to the outer surface of the polymeric vesicles of the present invention. Conjugation reactions that generate the covalent bonds of the present invention are well known in the art (e.g., NHS-EDC conjugation, reductive amination conjugation, thiol conjugation, "click" and "photoclick" conjugation, pyrazoline conjugation, etc.). Non-limiting examples of such covalent bonds and methods for generating such covalent bonds are set forth below. Therefore, in some aspects, the covalent bonds by which the antigen or adjuvant of the present invention is conjugated to the outer surface of the polymer vesicles of the present invention include: i) an amide moiety (e.g., as described in the Examples section herein); and / or ii) a secondary amine moiety (e.g., as described in the Examples section herein); and / or iii) a 1,2,3-triazole moiety (e.g., as described in van Dongen et al., 2008, Macromol. Rapid Communications, 2008, 29, pp. 321-325), preferably, the 1,2,3-triazole moiety being a 1,4-disubstituted [1,2,3]triazole moiety or a 1,5-disubstituted [1,2,3]triazole moiety (e.g., as described in Boren et al., 2008); and / or iv) a pyrazoline moiety (e.g., as described in de Hoog et al., Polym. Chem., 2012, 3, 302-306) and / or an ether moiety. In this context, it should be noted that both the polymeric vesicle and the antigen (e.g., a protein) may need to be modified to allow for the covalent bonding / formation between the outer surface of the polymeric vesicle and the antigen. In addition to the classical chemical conjugation chemistry (reaction) described above, covalent bonds can also be formed between the outer surface of the polymeric vesicle and the antigen via enzymatic reactions.

[0138] In some aspects, the present invention relates to NHS-EDC conjugation (i.e., conjugation based on N-hydroxysuccinimide (NHS) and 1-ethyl-3-(3-dimethylaminopropyl)-carbodiimide (EDC), which is one of the exemplary alternatives for conjugating antigens to polymeric vesicles of the present invention. In this method, a carboxylic acid group reacts with EDC to generate an intermediate O-acylisourea, which then reacts with a primary amine to form an amide moiety having the carboxyl group.

[0139] In some aspects, the present invention relates to reductive amination, which is another exemplary alternative to conjugating an antigen or adjuvant to the polymeric vesicles of the present invention. In this method, an aldehyde compound is conjugated with an amine compound to form a Schiff base intermediate, which is then reduced to form a stable secondary amine moiety.

[0140] In some aspects, the present invention relates to thiol conjugation, which is another exemplary alternative to conjugating antigens or adjuvants to the polymeric vesicles of the present invention. In this method, a compound containing a thiol group (-SH) (e.g., present in the side chain of cysteine) is conjugated to a thiol-reactive chemical group (e.g., maleimide) by alkylation or disulfide exchange to form a thioether bond or a disulfide bond, respectively.

[0141] In some aspects, the present invention relates to a so-called “click” reaction (also known as “azide-alkyne cycloaddition”) on the surface of polymer vesicles (e.g., described above by van Dongen et al., 2008, ibid.), which is another exemplary alternative for conjugating antigens to the polymer vesicles of the present invention. According to this method, the 1,2,3-triazole moiety is produced as follows: an aqueous solution of an azide-functionalized antigen (e.g., a polypeptide) is added to a dispersion of polymer vesicles, followed by the addition of a premixed aqueous solution of Cu(II)SO4·5H2O with sodium ascorbate and phenanthroline ligand to the resulting dispersion of polymer vesicles, followed by incubation at 4°C for 60 hours, and then filtration of the dispersion with a 100 nm cutoff and centrifugation to dryness. In this context, it is further important to note that copper-catalyzed azide-alkyne cycloaddition reactions (also known as CuAAC) allow for the specific synthesis of 1,4-disubstituted regioisomers, while ruthenium-catalyzed azide-alkyne cycloaddition reactions (also known as RuAAC) (e.g., using Cp*RuCl(PPh3)2 as a catalyst) allow for the production of 1,5-disubstituted triazoles (see R. Johansson, Johan & Beke-Somfai, Tamás & Said). Anna & Kann, Nina. (2016). Ruthenium-Catalyzed Azide Alkyne Cycloaddition Reaction: Scope, Mechanism, and Applications. Chemical Reviews. 116.10.1021 / acs.chemrev.6b00466).

[0142] In some aspects, the present invention relates to the generation of photoinduced nitrile imine intermediates (e.g., from bisaryl-tetrazole) and their cycloaddition with olefins (so-called photoinduced cycloaddition or "photoclick" reactions, as described by de Hoog et al., ibid., 2011), which is another exemplary alternative for conjugating antigens to the polymer vesicles of the present invention. According to this method, ABA block copolymers are methacrylate (MA)-terminated or hydroxyl-terminated using tetrazolium via a photoinduced nitrile imine intermediate, producing ABA polymer vesicles containing MA-ABA and hydroxyl-terminated ABA copolymers, and then the polymer vesicles are reacted with a tetrazolium containing an antigen (HRP) under UV irradiation to generate a pyrazoline moiety.

[0143] Covalent bonds that conjugate antigens or adjuvants to the outer surface of polymeric vesicles can be formed between atoms / groups of the molecule, such as in amphiphilic polymers that are part of the circumferential membrane of the polymeric vesicle (present within the circumferential membrane of the polymeric vesicle). Alternatively, the covalent bonds between the antigen or the outer surface of the polymer are formed via a linker portion attached to the molecule that is part of the circumferential membrane of the polymeric vesicle (present within the circumferential membrane of the polymeric vesicle). The linker can have any suitable length and can have the length of a main chain atom (e.g., if the linker is simply a carbonyl group (C=O) that forms the covalently linked amide or ester moiety). An exemplary example of such an "atom / linker portion having a main chain atom" is the modification of the amphiphilic polymer BD21 with the Dess-Martin oxidant (periodinane) described in the Examples section to produce BD. 21-CHO (i.e., the terminal aldehyde group) is then used to form an amine bond with the selected antigen (in the experimental section, hemagglutinin is used as a simple exemplary antigen). Alternatively, for example, if a moiety such as polyethylene glycol (PEG) is typically used to conjugate (covalently couple) the polypeptide to the target molecule, the linker moiety may have a length of several hundred or more main chain atoms. As a simple exemplary example, see the distearate phosphatidylethanolamine [DSPE] polyethylene glycol (DSPE-PEG) conjugate discussed below and used in the Examples section of this application. The DSPE-PEG (3000) linker moiety used in the Examples section has about 65 ethylene oxide (CH2-CH2-O)- subunits, thus having about 325 main chain atoms in the PEG moiety alone, for a total length of about 408 main chain atoms. In an exemplary embodiment consistent with the above, the linker portion may comprise 1 to about 550 main chain atoms, 1 to about 500 main chain atoms, 1 to about 450 main chain atoms, 1 to about 350 main chain atoms, 1 to about 300 main chain atoms, 1 to about 250 main chain atoms, 1 to about 200 main chain atoms, 1 to about 150 main chain atoms, 1 to about 100 main chain atoms, 1 to about 50 main chain atoms, 1 to about 30 main chain atoms, 1 to about 20 main chain atoms, 1 to about 15 main chain atoms, or 1 to about 12 main chain atoms, or 1 to about 10 main chain atoms, wherein the main chain atoms are carbon atoms optionally replaced by one or more heteroatoms selected from N, O, P and S.

[0144] Also according to the above disclosure, the linker portion can be a peptide linker or a linear or branched hydrocarbon-based linker. The linker portion can also be a polymer or copolymer with different block lengths. The linker portion used in this invention may include a membrane anchoring domain that integrates the linker portion into the membrane of a polymer vesicle. Such membrane anchoring domains may include lipids such as phospholipids or glycolipids. Glycolipids used in membrane anchoring domains may include glycosylphosphatidylinositol (GPI), which has been widely used in membrane anchoring domains (see, for example, international patent applications WO2009 / 127537 and WO2014 / 057128). Phospholipids used in the linkers of this invention may be sphingomyelin or glycerophospholipids. In an exemplary example of such a linker, the sphingomyelin may include distearate phosphatidylethanolamine [DSPE] (DSPE-PEG), conjugated with polyethylene glycol (PEG), as a membrane anchoring domain. In such conjugates, the DSPE-PEG may contain any suitable number of ethylene oxide, for example, 2 to about 500 ethylene oxide units. Exemplary examples include DSPE-PEG (1000), DSPE-PEG (2000), or DSPE-PEG (3000), to name just a few. Optionally, the phospholipid (sphingomyelin or glycerophospholipid) may contain cholesterol as a membrane anchoring domain. Cholesterol-based membrane anchoring domains are described, for example, in Achalkumar et al., “Cholesterol-based anchors and tethers for phospholipid bilayers and for model biological membranes”, Soft Matter, 2010, 6, 6036-6051. In an exemplary embodiment, the linker portion of such a membrane anchoring domain includes 1 to about 550 main chain atoms, 1 to about 500 main chain atoms, 1 to about 450 main chain atoms, 1 to about 350 main chain atoms, 1 to about 300 main chain atoms, 1 to about 250 main chain atoms, 1 to about 200 main chain atoms, 1 to about 150 main chain atoms, 1 to about 100 main chain atoms, 1 to about 50 main chain atoms, 1 to about 30 main chain atoms, 1 to about 20 main chain atoms, 1 to about 15 main chain atoms, or 1 to about 12 main chain atoms, or 1 to about 10 main chain atoms, wherein the main chain atoms are carbon atoms optionally replaced by one or more heteroatoms selected from N, O, P, and S.

[0145] Any type of polymeric vesicle can be used in this invention, as long as it functions as a carrier for associating antigens or adjuvants. The polymeric vesicles can be, for example, oxidation-sensitive polymeric vesicles, as described in Stano et al., “Tunable T cell immunity towards a protein antigen using polymersomes vs. solid-core nanoparticles,” Biomaterials 34(2013):4339-4346, or Hubbel’s U.S. Patent 8,323,696. Alternatively, the polymeric vesicles can also be oxidation-insensitive. In this invention, without regard to chemical stability (including their possible sensitivity or insensitivity to oxidation), the polymeric vesicles are vesicles with a polymer membrane, which are typically, but not necessarily, formed by the self-assembly of dilute solutions of one or more amphiphilic block copolymers, which can be of different types, such as diblock and triblock (ABA or ABC). The polymeric vesicles of this invention can also be formed from tetrablock or pentablock copolymers. For triblock copolymers, the central block is typically isolated from the environment by its lateral blocks, while diblock copolymers self-assemble into a bilayer by placing the two hydrophobic blocks tail-to-tail, with roughly the same effect. In most cases, the vesicle membrane has an insoluble intermediate layer and a soluble outer layer. The driving force for the formation of polymeric vesicles through self-assembly can be viewed as the microphase separation of the insoluble blocks, which tend to bind together to protect themselves from contact with water. Due to the large molecular weight of the component copolymers, the polymeric vesicles of the present invention exhibit significant properties. Increasing the total molecular weight of the block copolymers favors vesicle formation. Consequently, the diffusion of (polymerized) amphiphilic substances in these vesicles is very low compared to vesicles formed from lipids and surfactants. Due to the low mobility of the polymer chains aggregated in the vesicle structure, a stable polymeric vesicle morphology can be obtained. Unless otherwise explicitly stated, the terms "polymersome" and "vesicle" as used herein are considered similar and can be used interchangeably. Importantly, the polymer vesicles of the present invention can be formed from one pf block copolymer or from two or more block copolymers, meaning that the polymer vesicles can also be formed from mixtures of polymer vesicles, thereby potentially containing two or more block copolymers. In some aspects, the polymer vesicles of the present invention are oxidically stable.

[0146] In some aspects, the present invention relates to a method for inducing an immune response in a subject to a soluble (e.g., solubilized) encapsulated antigen. The method is suitable for injecting a subject with a composition comprising polymeric vesicles (e.g., carriers or mediators) having a membrane of an amphiphilic polymer (e.g., a circumferential membrane). The composition comprises a soluble (e.g., solubilized) antigen encapsulated by a membrane of an amphiphilic polymer (e.g., a circumferential membrane) of the polymeric vesicles of the present invention. The antigen may be one or more of the following: i) polypeptides; ii) carbohydrates; iii) polynucleotides (if the polynucleotide is not an antisense oligonucleotide, preferably, the polynucleotide is a DNA or messenger RNA (mRNA) molecule) or combinations of i) and / or ii) and / or iii).

[0147] In other aspects, the present invention relates to the ability to trigger CD8 (+) Polymer vesicles of T cell-mediated immune responses.

[0148] In some aspects, the present invention relates to polymeric vesicles capable of targeting lymph node-resident macrophages and / or B cells. Exemplary, non-limiting targeting mechanisms contemplated by the invention include: i) delivery of encapsulated antigens (such as peptides, etc.) to dendritic cells (DCs) to activate T cells (CD4 and / or CD8). Another mechanism is: ii) delivery of fully folded antigens (e.g., proteins, etc.) that will translocate to DCs and also trigger titers (B cells).

[0149] In some aspects, the present invention relates to polymeric vesicles encapsulating antigens selected from: i) autoantigens, ii) non-autoantigens, iii) non-autoimmunogens, and iv) autoimmunogens. Therefore, the products and methods of the present invention are suitable for use in environments that induce tolerance (e.g., clinical settings), such as when targeting autoimmune diseases.

[0150] In some aspects, the present invention relates to polymeric vesicles comprising lipid polymers.

[0151] The polymeric vesicles of the present invention may also have one or more adjuvants co-encapsulated (i.e., encapsulated in addition to the antigen). Examples of adjuvants include synthetic oligodeoxynucleotides (ODNs) containing an unmethylated CpG motif that can trigger cells expressing Toll-like receptor 9 (including human plasmacytoid dendritic cells and B cells) to initiate an innate immune response characterized by the production of Th1 and pro-inflammatory cytokines, such as interleukin-1, interleukin-2, or interleukin-12, keyhole hemocyanin (KLH), serum albumin, bovine thyroglobulin, or soybean trypsin inhibitors, to name just a few exemplary examples.

[0152] The polymeric vesicles of the present invention can be of any size, provided they can elicit an immune response. For example, the polymeric vesicles can have a diameter greater than 70 nm. The diameter of the polymeric vesicles can range from about 100 nm to about 1 μm, or from about 100 nm to about 750 nm, or from about 100 nm to about 500 nm. The diameter of the polymeric vesicles can also range from about 125 nm to about 175 nm, or from about 125 nm to about 250 nm, about 140 nm to about 240 nm, about 150 nm to about 235 nm, about 170 nm to about 230 nm, or about 220 nm to about 180 nm, or about 190 nm to about 210 nm. For example, the diameter of the polymeric vesicles can be about 200 nm; about 205 nm or about 210 nm. When used as a (first or second) cluster to elicit an immune response, the cluster of polymeric vesicles is typically a monodisperse cluster. The average diameter of the polymer vesicle clusters used is typically above 70 nm, or above 120 nm, or above 125 nm, or above 130 nm, or above 140 nm, or above 150 nm, or above 160 nm, or above 170 nm, or above 180 nm, or above 190 nm (see also...). Figure 2The average diameter of the polymer vesicle cluster can be, for example, within the range of the individual polymer vesicles described above, i.e., the average diameter of the polymer vesicle cluster can be in the range of 100 nm to about 1 μm, or about 100 nm to about 750 nm, or about 100 nm to about 500 nm, or about 125 nm to about 250 nm, about 140 nm to about 240 nm, about 150 nm to about 235 nm, about 170 nm to about 230 nm, or about 220 nm to about 180 nm, or about 190 nm to about 210 nm. The average diameter of the polymer vesicle cluster can also be, for example, about 200 nm, about 205 nm, or about 210 nm. The diameter can be determined, for example, by a dynamic light scattering (DLS) instrument using the Z-mean value (d, nm) (a preferred DLS parameter). The Z-mean size is the intensity-weighted harmonic mean particle diameter (see Examples 1 and 2). In this context, it should be noted that, according to U.S. Patent 8,323,696 to Hubbel et al., aggregates / clusters of polymeric vesicles must have an average diameter of less than 70 nm to elicit an immune response. Similarly, Stano et al., ibid., 2013, while desiring to use smaller polymeric vesicles, used polymeric vesicles with a diameter of 125 nm ± 15 nm due to technological limitations to elicit an immune response. Therefore, it is surprising that aggregates / clusters of the polymeric vesicles of the present invention, having an average diameter, for example, greater than 150 nm, are able to induce both cellular and humoral immune responses (see the Examples section). Such aggregates of polymeric vesicles may be in forms suitable for eliciting an immune response, for example, by injection or oral administration.

[0153] In some aspects, the present invention relates to compositions suitable for intradermal, intraperitoneal, subcutaneous, intravenous, or intramuscular injection or non-invasive administration of the antigens of the present invention, such as oral, inhalation, or nasal administration. The compositions may include polymeric vesicles (e.g., carriers) of the present invention having a membrane (e.g., a circumferential membrane) of an amphiphilic polymer. The compositions further comprise a soluble (e.g., solubilized) antigen encapsulated by the membrane of the amphiphilic polymer of the polymeric vesicles. The compositions of the present invention may be used for therapeutic purposes (e.g., to treat or prevent a subject from having a disease by means of, for example, vaccination) or for antibody discovery, vaccine discovery, or targeted delivery.

[0154] In some aspects, the polymer vesicles of the present invention have hydroxyl groups on their surface. In other aspects, the polymer vesicles of the present invention do not have hydroxyl groups on their surface.

[0155] In the context of this invention, the term "encapsulated" means encapsulated by a membrane (e.g., the membrane of the polymer vesicles of this invention, as if embedded within the cavity of the polymer vesicle). For an antigen, the term "encapsulated" further means that the antigen is neither integrated into, covalently bound to, nor conjoined to (e.g., the membrane of the polymer vesicles of this invention). Regarding the compartmentalization of the vesicle structure of polymer vesicles as described herein, the term "encapsulated" means that the inner vesicle is completely contained within the outer vesicle and surrounded by the vesicle membrane of the outer vesicle. The closed space surrounded by the vesicle membrane of the outer vesicle forms one compartment. The closed space surrounded by the vesicle membrane of the inner vesicle forms another compartment.

[0156] In this context, the term "antigen" refers to any substance that can be specifically bound by components of the immune system. Only antigens capable of triggering (or causing or inducing) an immune response are considered immunogenic and are referred to as "immunogens". Examples of non-restrictive antigens are polypeptides derived from soluble portions of proteins, hydrophobic polypeptides that can become soluble for encapsulation, and aggregated polypeptides that can be soluble as aggregates. The antigens can originate from within the body ("self-antigens") or from the external environment ("non-self").

[0157] Membrane proteins form a class of antigens that typically elicit low levels of immune response. Notably, soluble (e.g., solubilized) membrane proteins (MPs) and membrane-associated peptides (MAPs), and their fragments (i.e., portions) (such as the antigens mentioned herein), are encapsulated by polymeric vesicles that allow them to fold in a physiologically relevant manner. This greatly enhances the immunogenicity of such antigens, thus requiring a smaller amount of the corresponding antigen to produce the same level of immune response compared to free antigens. Furthermore, the larger size of the polymeric vesicles (compared to free membrane proteins) allows the immune system to detect them more easily.

[0158] In the context of this invention, the term "B16 peptide" refers to any neoantigenic polypeptide derived from a spontaneously C57BL / 6-derived B16 melanoma model (e.g., a melanoma B16-F10 mouse model). Non-limiting examples include peptides SEQ ID NO: 9, 10, and 11.

[0159] In the context of this invention, the term "MC38 peptide" refers to any neoantigen polypeptide derived from the MC38 mouse model of colon cancer. Non-limiting examples include peptides SEQ ID NO: 1, 2, and 3.

[0160] In the context of this invention, the term "influenza hemagglutinin (HA)" refers to a glycoprotein found on the surface of influenza viruses. HA has at least 18 different antigens, all of which are within the scope of this invention. These subtypes are named H1 to H18. Non-limiting examples of the "influenza hemagglutinin (HA)" subtype H1 include polypeptides SEQ ID NO: 5, 6, 7, and 8.

[0161] In the context of this invention, the term "swine influenza hemagglutinin (HA)" refers to a glycoprotein found on the surface of swine influenza viruses, a family of influenza viruses circulating in pigs. Non-limiting examples of "swine influenza hemagglutinin (HA)" include subtype H1 SEQ ID NO:6.

[0162] In the context of this invention, the term "coronavirus" refers to a family of viruses in the subfamily Coronaviridae, which are enveloped, positive-sense single-stranded RNA viruses. Coronaviruses can cause disease in mammals and birds. There are four genera within this subfamily: alpha coronaviruses, beta coronaviruses, gamma coronaviruses, and delta coronaviruses. In humans, coronaviruses can cause mild respiratory infections as well as other fatal respiratory infections such as SARS, MERS, and COVID-19. Human pathogenic coronaviruses generally belong to the alpha or beta coronavirus genus. Viruses belonging to the alpha coronavirus genus include, for example, PEDV, transmissible gastroenteritis virus (TGEV), feline coronavirus (FCoV) (including feline enteric coronavirus (FECV) and feline infectious peritonitis virus (FIPV)), canine coronavirus (CCoV), or human pathogenic coronaviruses human coronavirus 229E (HCoV-229E) and human coronavirus NL63 (HCoV-NL63). Within the genus *β-coronavirus*, the subgenuses *Sarbecovirus* and *Merbecovirus* are most relevant to the present invention, including SARS-CoV-1, SARS-CoV-2, and MERS-CoV. Other human pathogenic β-coronaviruses include human coronavirus OC43 (HCoV-OC43) and human coronavirus HKU1 (HCoV-HKU1). A review of human pathogenic coronaviruses is provided in Corman VM, Muth D, Niemeyer D, Drosten C., *Hosts and Sources of Endemic Human Coronaviruses*. *Adv Virus Res.* 2018; 100:163-188.

[0163] In the context of this invention, the term "SPIKE protein" refers to a glycoprotein present on the surface of a viral capsid or viral envelope. SPIKE proteins bind to receptors on host cells, and are therefore important for both host specificity and viral infectivity.

[0164] In the context of this invention, the term "PEDv S protein" refers to the SPIKE glycoprotein present on the surface of porcine epidemic diarrhea virus (PEDV), which belongs to the porcine coronavirus family. Non-limiting examples of soluble "PEDv S protein" that can be used in this invention include a complete soluble fragment of the porcine epidemic diarrhea virus (PEDV) spike protein (S protein) (UniProtKB accession number: V5TA78) consisting of the S1 and S2 regions having the amino acid sequence SEQ ID NO:12, a soluble fragment of the S1 region SEQ ID NO:13, or a soluble fragment of the S2 region SEQ ID NO:14. Of course, shorter fragments of the complete soluble fragments of the S1 and S2 regions can also be used, or only the S1 region or the S2 region can be used (see [reference] for this). Figure 12 Of course, fragments comprising portions of S1 and S2, such as amino acids 500 to 939 of the deposited sequence of the spike protein, can also be used in the polymer vesicles of the present invention. It should also be noted that the polymer vesicles of the present invention may have one or more different soluble fragments of the encapsulated spike protein, such as the S1 region, the S2 region, and / or the complete S1 and S2 regions. In exemplary embodiments of the polymer vesicles of the present invention, the polymer vesicles encapsulate one type of soluble fragment (e.g., S1 region only), two different types of soluble fragments (e.g., S1 and S2 regions), three different types of soluble fragments (the complete soluble fragments of S1 and S2 of SEQ ID NO:12 (amino acid residues 19 to 1327) of S1, S2, and S1 and S2 of SEQ ID NO:12 (amino acid residues 19 to 1327), or even four different types of fragments (e.g., the complete soluble fragments of S1 and S2 of S1, S2, and S1 and S2 of SEQ ID NO:12 (amino acid residues 19 to 1327), and as a fourth type, the above-described fragments containing a portion of S1 and a portion of S2, for example, amino acids 500 to 939 of the spike protein sequence). It should also be noted that, in a preferred embodiment, the polymer vesicles of the present invention, in which one or more different spike protein soluble fragments are encapsulated, are used as an oral vaccine against porcine epidemic diarrhea virus.

[0165] In the context of this invention, the term "MERS-CoV S protein" or "MERS-CoV SPIKE protein" refers to the SPIKE glycoprotein present on the surface of Middle East Respiratory Syndrome-associated Coronavirus (MERS-CoV), a human pathogenic coronavirus. The MERS-CoV spike protein of this invention has the sequence shown in SEQ ID NO: 42, UniProtKB accession number: K0BRG7, February 26, 2020, version 40 (GenBank accession number No. AFS88936, version AFS88936.1). Non-limiting examples of soluble "MERS-CoV S protein" that can be used in this invention include complete soluble fragments of the S1 and S2 regions of the MERS-CoV spike protein (S protein), which may correspond to positions 1 to 1297 of the MERS-CoV spike protein or have the amino acid sequence shown in SEQ ID NO: 43. Non-limiting examples of the soluble "MERS-CoV S protein" that can be used in this invention also include the S1 region, which corresponds to positions 18 to 725 of the MERS-CoV spike protein (S protein) or has the amino acid sequence of SEQ ID NO:44. Non-limiting examples of the soluble "MERS-CoV S protein" that can be used in this invention also include soluble fragments of the S2 region, which may correspond to positions 726 to 1296 of the MERS-CoV spike protein (S protein) or have the amino acid sequence of SEQ ID NO:45. Of course, shorter fragments of the complete soluble fragments of the S1 and S2 regions may also be used, or only the S1 or S2 region may be used; for example, the fragment may include a receptor-binding domain (RBD), which corresponds to positions 377-588 of the MERS-CoV spike protein or has the amino acid sequence of SEQ ID NO:46. It should also be noted that the polymer vesicles of the present invention may have one or more different soluble fragments of the encapsulated spike protein, such as the S1 region, the S2 region or soluble fragments thereof, intact soluble fragments of the S1 and S2 regions and / or RBDs. In exemplary embodiments of the polymer vesicles of the present invention, the polymer vesicles encapsulate one type of soluble fragment (e.g., intact soluble fragments of only the S1 and S2 regions), two different types of soluble fragments (e.g., intact soluble fragments of the S1 and S2 regions and soluble fragments of either the S1 or S2 region), three different types of soluble fragments (soluble fragments of the S1 and S2 regions and intact soluble fragments of the S1 and S2 regions of SEQ ID NO:42 (amino acid residues 1 to 1297)), or even four different types of fragments (e.g., soluble fragments of the S1 and S2 regions, intact soluble fragments of the S1 and S1 regions of SEQ ID NO:42 (amino acid residues 1 to 1297) and as a fourth type of RBD).In a preferred embodiment, the polymer vesicles of the present invention encapsulate a soluble fragment comprising, or substantially comprising, an S1 region corresponding to amino acid residues 18 to 725 of the full-length MERS-CoV SPIKE protein. In a preferred embodiment, the polymer vesicles of the present invention encapsulate a soluble fragment comprising, or substantially comprising, an S2 region corresponding to amino acid residues 726 to 1296 of the full-length MERS-CoV SPIKE protein. In a preferred embodiment, the polymer vesicles of the present invention encapsulate a soluble fragment comprising, or substantially comprising, an S1 region corresponding to amino acid residues 1 to 1297 of the full-length MERS-CoV SPIKE protein. In a preferred embodiment, the polymer vesicles of the present invention encapsulate a fragment comprising, or substantially comprising, an S1 region corresponding to amino acid residues 1 to 1327 of the full-length MERS-CoV SPIKE protein. In this context, "consistently composed of..." means that the N-terminal and / or C-terminal endpoints of the fragment can vary to a limited extent, such as up to 25 amino acid positions, up to 20 amino acid positions, up to 15 amino acid positions, up to 10 amino acid positions, up to 5 amino acid positions, up to 4 amino acid positions, up to 3 amino acid positions, up to 2 amino acid positions, or up to 1 amino acid position. As an exemplary example, a fragment consisting essentially of amino acids 726 to 1296 of the full-length MERS-CoV SPIKE protein can be composed of positions 716 to 1296, 736 to 1296, 726 to 1286, or 726 to 1306, 716 to 1286, 736 to 1286, 736 to 1306, or 716 to 1306 of the full-length MERS-CoV SPIKE protein.

[0166] The MERS-CoV spike protein of the present invention may also comprise variants of the above-described sequence, including native variants of other isolates of MERS-CoV and artificial modifications that can be introduced into the sequence of the MERS-CoV S protein. As an exemplary example, mutations can be introduced to alter the formation of the expressed protein. For this purpose, the furin cleavage site located at positions 754 to 757 of SEQ ID NO:42 can be mutated. By reducing the basicity of this amino acid sequence, post-expression cleavage can be reduced. For example, arginine residues 754 and / or 757 can be mutated to weakly basic amino acids, such as glycine (position number corresponding to the amino acid sequence shown in SEQ ID NO:42), or other weakly basic amino acids. Thus, the furin cleavage site having the native RSVR sequence (SEQ ID NO:58) can be mutated to the sequence GSVG (SEQ ID NO:59). Further modifications may include the addition of a trimerizing domain, preferably added to the C-terminus of the protein, which facilitates increased native folding of the S1 and / or S2 domains. Such trimerizing domains may include foldon domains (e.g., SEQ ID NO: 54), GCN4-based trimerizing domains (e.g., SEQ ID NO: 55 or 56), or other motifs well known to those skilled in the art. Furthermore, secretory leader sequences that can improve production and / or downstream processing (e.g., isolation and purification) may be added to the N-terminus of the protein. An exemplary example of such leader sequences is the bee venom peptide leader sequence (SEQ ID NO: 57). Other useful leader sequences are well known to those skilled in the art. Therefore, soluble fragments of the spike protein of the present invention also include highly identical variants of specific sequences of soluble fragments of the spike protein explicitly or implicitly disclosed herein. For example, variants having at least about 95%, at least about 96%, at least about 97%, at least about 98%, or at least about 99% sequence identity with soluble fragments of the spike protein of the present invention, particularly soluble fragments of the MERS-CoV S protein of the present invention. As an exemplary example, the soluble fragment of the S fragment of the present invention may comprise, substantially comprise, or comprise a sequence having at least about 95%, at least about 96%, at least about 97%, at least about 98%, or at least about 99% sequence identity with a sequence selected from SEQ ID NO:43-46.

[0167] Optionally or additionally, the polymer vesicles of the present invention may encapsulate one or more nucleic acids, such as mRNA, self-amplifying mRNA, or DNA encoding one or more MERS-CoV spike proteins or soluble fragments thereof as described in the present invention.

[0168] It is also noted here that, in a preferred embodiment, the polymer vesicles of the present invention, wherein soluble fragments of one or more different MERS-CoV spike proteins and / or nucleic acids encoding their or the full-length MERS-CoV spike proteins are used as vaccines against human diseases, particularly those caused by human pathogenic coronaviruses, especially Middle East Respiratory Syndrome (MERS). Therefore, the polymer vesicles of the present invention, wherein soluble fragments of one or more different MERS-CoV spike proteins and / or nucleic acids encoding their or the full-length MERS-CoV spike proteins are used to treat (including prevent) fever, cough, sputum production, shortness of breath, pneumonia, and / or acute respiratory distress syndrome (ARDS).

[0169] In one preferred embodiment, polymeric vesicles containing soluble fragments of one or more different MERS-CoV spike proteins and / or nucleic acids encoding them or the full-length MERS-CoV spike protein are administered intramuscularly. In one preferred embodiment, polymeric vesicles containing soluble fragments of one or more different MERS-CoV spike proteins and / or nucleic acids encoding them or the full-length MERS-CoV spike protein are administered nasally. In one preferred embodiment, polymeric vesicles containing soluble fragments of one or more different MERS-CoV spike proteins and / or nucleic acids encoding them or the full-length MERS-CoV spike protein are administered by inhalation.

[0170] In the context of this invention, the term "SARS-CoV-2 S protein" or "SARS-CoV-2 SPIKE protein" refers to the SPIKE glycoprotein present on the surface of severe acute respiratory syndrome coronavirus 2 (SARS-CoV-2), a human pathogenic coronavirus. The SARS-CoV-2 spike protein of this invention has the sequence shown in SEQ ID NO: 19, UniProtKB accession number: P0DTC2, April 22, 2020, version 1 (GenBank accession number MN908947, version MN908947.3). Non-limiting examples of soluble "SARS-CoV-2 S protein" that can be used in this invention include complete soluble fragments consisting of the S1 and S2 regions of the SARS-CoV-2 spike protein (S protein), corresponding to positions 16 to 1213, 14 to 1204, or 19 to 1204 of the SARS-CoV-2 spike protein, or having the amino acid sequence shown in SEQ ID NO: 34, SEQ ID NO: 35, or SEQ ID NO: 65. Non-limiting examples of soluble "SARS-CoV-2 S protein" that can be used in this invention also include the S1 region, which corresponds to positions 16 to 685 of the SARS-CoV-2 spike protein (S protein) or has the amino acid sequence of SEQ ID NO:37. Non-limiting examples of soluble "SARS-CoV-2 S protein" that can be used in this invention also include the S2 region, which corresponds to positions 686 to 1213 or 646 to 1204 of the SARS-CoV-2 spike protein (S protein) or has the amino acid sequence of SEQ ID NO:38 or 39. Of course, shorter fragments of the complete soluble fragments of the S1 and S2 regions can also be used, or only the S1 or S2 region can be used, for example, by using the amino acid sequence of SARS-CoV-2 protein 318-524 as the receptor-binding domain (SEQ ID NO:41, see herefor details). Figure 23A). As an exemplary example, a shorter fragment of the S2 region may comprise amino acids corresponding to positions 686 to 1204 of SEQ ID NO:19, and is substantially composed of or composed of said amino acids. In an exemplary example, a soluble fragment of the spike protein may comprise amino acids corresponding to positions 646 to 1204 of SEQ ID NO:19, and is substantially composed of or composed of said amino acids. In an exemplary example, a soluble fragment of the spike protein may comprise any of the sequences shown in SEQ ID NO:34-36 and 65, and is substantially composed of or composed of said sequences. It should also be noted that the polymeric vesicles of the present invention may encapsulate one or more different soluble fragments of the spike protein, such as the S1 region or a fragment thereof, the S2 region or a fragment thereof, and / or the complete S1 and S2 regions or fragments thereof comprising portions of the S1 and S2 regions. In an exemplary embodiment of the polymer vesicle of the present invention, the polymer vesicle encapsulates one type of soluble fragment (e.g., only the S1 region or a fragment thereof), two different types of soluble fragments (e.g., S1 and S2 regions or fragments of S1 and / or S2 regions), three different types of soluble fragments (S1 region or a fragment thereof, S2 region or a fragment thereof, and the complete soluble fragments of S1 and S2 of SEQ ID NO:19), or even four different types of fragments (e.g., S1 region or a fragment thereof, S2 region or a fragment thereof, the complete soluble fragments of S1 and S2 of SEQ ID NO:19 or a fragment thereof containing portions of S1 and S2 regions, and the above-mentioned fragments containing portions of S1 and S2 as a fourth type, such as amino acids 14 to 1204 of the spike protein sequence).

[0171] Several variants of the SARS-CoV-2 S protein are known in the art, such as GeneBank accession number QII57278.1 (SEQ ID NO:20), GeneBank accession number YP_009724390.1 (SEQ ID NO:21), GeneBank accession number QIO04367.1 (SEQ ID NO:22), GeneBank accession number QHU79173.2 (SEQ ID NO:23), GeneBank accession number QII87830.1 (SEQ ID NO:24), GeneBank accession number QIA98583.1 (SEQ ID NO:25), GeneBank accession number QIA20044.1 (SEQ ID NO:26), GeneBank accession number QIK50427.1 (SEQ ID NO:27), GeneBank accession number QHR84449.1 (SEQ ID NO:28), and GeneBank accession number QIQ08810.1 (SEQ ID NO:27). SEQ ID NO:29), GeneBank accession number QIJ96493.1 (SEQ ID NO:30), GeneBank accession number QIC53204.1 (SEQ ID NO:31), GeneBank accession number QHZ00379.1 (SEQ ID NO:32), and GeneBank accession number QHS34546.1 (SEQ ID NO:33). Compared with SEQ ID NO:19, mutations corresponding to sequence positions 28, 49, 74, 145, 157, 181, 221, 307, 408, 528, 614, 655, 797, and 930 can be found in these variants. Further modifications can be introduced into the sequence of the SARS-CoV-2 S protein. As an exemplary example, mutations can be introduced to alter the formation of the expressed protein. For this purpose, the furin cleavage site located at positions 679 to 685 of SEQ ID NO:19 can be mutated. Post-expression cleavage can be reduced by decreasing the basicity of the amino acid sequence. For example, residues Pro 681, Arg 682, and / or Arg 683 can be mutated to weaker basic amino acids, such as Pro681->Asn, Arg 682->Gln, and / or Arg 683->Ser (corresponding to the position numbers of the amino acid sequence shown in SEQ ID NO:19), or other weaker basic amino acids. Therefore, the furin cleavage site having the native NSPRRAR sequence (SEQ ID NO:52) can be mutated to the NSNQSAR sequence (SEQ ID NO:53).SEQ ID NO:65 illustrates an exemplary example of a soluble fragment of the SARS-CoV-2 spike protein with a mutated furin cleavage site. SEQ ID NO:66 illustrates an exemplary example of the SARS-CoV-2 spike protein with a mutated furin cleavage site. Further modifications may include the addition of a trimerizing domain, preferably added to the C-terminus of the protein, which facilitates increased native folding of the S1 and / or S2 domains. Such trimerizing domains may include foldon domains (GYIPEAPRDG QAYVRKDGEW VLLSTFL, SEQ ID NO:54, e.g., described in Güthe et al., J.Mol.Biol. (2004) 337, 905–915), GCN4-based trimerizing domains including their immune-silencing variants (e.g., GGGTGGGGTG RMKQIEDKIEE ILSKIYHIEN EIARIKKLIG ERGGR, SEQ ID NO:55, or GGGTGGNGTGRMKQIEDKIE NITSKIYNITN EIARIKKLIG NRTGGR, SEQ ID NO:56, as described in Sliepen et al., J.Biol.Chem. (2015) 290(12):7436–7442), or other motifs well known to those skilled in the art. Furthermore, secretory leader sequences that can improve production and / or downstream processing (such as isolation and purification) can be added to the N-terminus of the protein. An exemplary example of such a leader sequence is the bee venom peptide leader sequence (MKFLVNVALVFMVVYISYIY A, SEQ ID NO:57). Other useful leader sequences are well known to those skilled in the art. Therefore, the soluble fragments of the spike protein of the present invention also include highly identical variants of specific sequences of soluble fragments of the spike protein explicitly or implicitly disclosed herein. For example, variants having at least about 95%, at least about 96%, at least about 97%, at least about 98%, or at least about 99% sequence identity with the soluble fragments of the spike protein of the present invention, particularly the soluble fragments of the SARS-CoV-2 S protein of the present invention. As an exemplary example, the soluble fragment of the S fragment of the present invention may comprise a sequence having at least about 95%, at least about 96%, at least about 97%, at least about 98%, or at least about 99% sequence identity with a sequence selected from the following sequences, substantially consisting of or composed of the following sequences: sequences corresponding to positions 16 to 1213, 16 to 685, 686 to 1213, 686 to 1204, 646 to 1204, or 14 to 1204 of SEQ ID NO:19 (SARS-CoV-2 spike protein).As another exemplary example, the soluble fragment of the S fragment of the present invention may have at least about 95%, at least about 96%, at least about 97%, at least about 98%, or at least about 99% sequence identity with sequences selected from SEQ ID NO:34-41 and 65.

[0172] In a preferred embodiment, the polymer vesicles of the present invention encapsulate a soluble fragment comprising, substantially composed of, or consisting of, amino acid residues 16 to 685 of the full-length SARS-CoV-2 SPIKE protein shown in SEQ ID NO:19, or having the amino acid sequence of SEQ ID NO:37. In a preferred embodiment, the polymer vesicles of the present invention encapsulate a soluble fragment comprising, substantially composed of, or consisting of, amino acid residues 686 to 1213 of the full-length SARS-CoV-2 SPIKE protein shown in SEQ ID NO:19, or having the amino acid sequence of SEQ ID NO:38. In a preferred embodiment, the polymer vesicles of the present invention encapsulate a soluble fragment comprising, substantially composed of, or consisting of, amino acid residues 16 to 1213 of the full-length SARS-CoV-2 SPIKE protein shown in SEQ ID NO:19, or having the amino acid sequence of SEQ ID NO:34. In a preferred embodiment, the polymer vesicles of the present invention encapsulate a soluble fragment comprising, substantially comprising, or consisting of, amino acid residues 686 to 1204 of the full-length SARS-CoV-2 SPIKE protein shown in SEQ ID NO:19. In a preferred embodiment, the polymer vesicles of the present invention encapsulate a soluble fragment comprising, substantially comprising, or consisting of, amino acid residues 646 to 1204 of the full-length SARS-CoV-2 SPIKE protein shown in SEQ ID NO:19, or having the amino acid sequence of SEQ ID NO:39. In a preferred embodiment, the polymer vesicles of the present invention encapsulate a soluble fragment comprising, substantially comprising, or consisting of, amino acid residues 14 to 1204 of the full-length SARS-CoV-2 SPIKE protein shown in SEQ ID NO:19, or having the amino acid sequence of SEQ ID NO:35. In a preferred embodiment, the polymer vesicles of the present invention encapsulate a soluble fragment comprising, substantially comprising, or consisting of, the amino acid residues 19 to 1204 of the full-length SARS-CoV-2 SPIKE protein shown in SEQ ID NO:19, or having the amino acid sequence of SEQ ID NO:65.In a preferred embodiment, the polymer vesicles of the present invention encapsulate a soluble fragment comprising, substantially comprising, or consisting of, a sequence having at least about 95%, at least about 96%, at least about 97%, at least about 98%, or at least about 99% sequence identity with a sequence selected from the group consisting of: positions 16 to 1213, 16 to 685, 686 to 1213, 686 to 1204, 646 to 1204, 14 to 1204, or 19 to 1204 of SEQ ID NO:19 (SARS-CoV-2 spike protein). In a preferred embodiment, the polymer vesicles of the present invention encapsulate a soluble fragment comprising, substantially comprising, or consisting of a sequence having at least about 95%, at least about 96%, at least about 97%, at least about 98%, or at least about 99% sequence identity with a sequence selected from SEQ ID NO: 36, 40, and / or 65. In this context, “substantially comprising” means that the N-terminal and / or C-terminal endpoints of the fragment can vary to a limited extent, such as up to 25 amino acid positions, up to 20 amino acid positions, up to 15 amino acid positions, up to 10 amino acid positions, up to 5 amino acid positions, up to 4 amino acid positions, up to 3 amino acid positions, up to 2 amino acid positions, or up to 1 amino acid position. As an example, a fragment consisting essentially of amino acids 646 to 1204 of the full-length SARS-CoV-2 SPIKE protein can be composed of positions 641 to 1204, 651 to 1204, 646 to 1209, or 646 to 1199, 641 to 1209, or 651 to 1199 of the full-length SARS-CoV-2 SPIKE protein.

[0173] Optionally or additionally, the polymer vesicles of the present invention may encapsulate one or more nucleic acids, such as mRNA, self-amplifying mRNA, or DNA encoding one or more SARS-CoV-2 spike proteins or soluble fragments thereof as described in the present invention.

[0174] It is also noted here that, in a preferred embodiment, the polymer vesicles of the present invention, wherein one or more soluble fragments of different SARS-CoV-2 spike proteins and / or nucleic acids encoding thereof are used as vaccines against human diseases, particularly those caused by human pathogenic coronavirus infection, coronavirus disease 2019 (COVID-19). Therefore, the polymer vesicles of the present invention, wherein one or more soluble fragments of different SARS-CoV-2 spike proteins and / or nucleic acids encoding thereof are used to treat (including prevent) fever, cough, shortness of breath, pneumonia, organ failure, acute respiratory distress syndrome (ARDS), fatigue, muscle pain, diarrhea, sore throat, loss of smell, and / or abdominal pain.

[0175] In one preferred embodiment, polymeric vesicles containing soluble fragments of one or more different SARS-CoV-2 spike proteins and / or nucleic acids encoding them or the full-length SARS-CoV-2 spike protein are administered intramuscularly. In one preferred embodiment, polymeric vesicles containing soluble fragments of one or more different SARS-CoV-2 spike proteins and / or nucleic acids encoding them or the full-length SARS-CoV-2 spike protein are administered nasally. In one preferred embodiment, polymeric vesicles containing soluble fragments of one or more different SARS-CoV-2 spike proteins and / or nucleic acids encoding them or the full-length SARS-CoV-2 spike protein are administered by inhalation.

[0176] In the context of this invention, the term "SARS-CoV-1 S protein" or "SARS-CoV-1 Spike protein" refers to the spike glycoprotein present on the surface of the severe acute respiratory syndrome coronavirus (SARS-CoV or SARS-CoV-1), a human pathogenic coronavirus. The SARS-CoV-1 spike protein of this invention has the sequence shown in UniProtKB accession number: P59594, December 11, 2019, version 134, or SEQ ID NO:48. Non-limiting examples of soluble "SARS-CoV-1 S protein" that can be used in this invention include complete soluble fragments of the S1 and S2 regions of the SARS-CoV-1 spike protein (S protein), corresponding to positions 14 to 1195 of the SARS-CoV-1 spike protein, or having the amino acid sequence shown in SEQ ID NO:48. Non-limiting examples of the soluble "SARS-CoV-1 S protein" that can be used in this invention also include the S1 region, which corresponds to amino acid positions 14 to 667 of the SARS-CoV-1 spike protein (S protein) or has the amino acid sequence of SEQ ID NO:49. Non-limiting examples of the soluble "SARS-CoV-1 S protein" that can be used in this invention also include the S2 region, which corresponds to amino acid positions 668 to 1198 of the SARS-CoV-1 spike protein (S protein) or has the amino acid sequence of SEQ ID NO:50. Of course, shorter fragments of the complete soluble segments of the S1 and S2 regions can also be used, or only the S1 or S2 region can be used; for example, the fragment may include a receptor-binding domain (RBD), which corresponds to amino acid positions 306-527 of the SARS-CoV-1 spike protein or has the amino acid sequence of SEQ ID NO:51. It should also be noted that the polymeric vesicles of this invention can encapsulate one or more different soluble fragments of the spike protein, such as the S1 region, the S2 region or fragments thereof, complete soluble fragments of the S1 and S2 regions and / or the RBD. In an exemplary embodiment of the polymer vesicle of the present invention, the polymer vesicle encapsulates one type of soluble fragment (e.g., a complete soluble fragment of only the S1 and S2 regions), two different types of soluble fragments (e.g., a complete soluble fragment of the S1 and S2 regions and a soluble fragment of either the S1 or S2 region), three different types of soluble fragments (a soluble fragment of the S1 region, a soluble fragment of the S2 region, and a complete soluble fragment of the S1 and S2 regions of SEQ ID NO:47 (amino acid residues 14 to 1195)), or even four different types of fragments (e.g., a soluble fragment of the S1 region, a soluble fragment of the S2 region, a complete soluble fragment of the S1 and S2 regions of SEQ ID NO:47 (amino acid residues 14 to 1195), and as a fourth type of RBD).In a preferred embodiment, the polymer vesicles of the present invention encapsulate a soluble fragment comprising, substantially comprising, or consisting of, an S1 region corresponding to amino acid residues 14 to 667 of the full-length SARS-CoV-1 spike protein. In a preferred embodiment, the polymer vesicles of the present invention encapsulate a soluble fragment comprising, substantially comprising, or consisting of, an S2 region corresponding to amino acid residues 668 to 1195 of the full-length SARS-CoV-1 spike protein. In a preferred embodiment, the polymer vesicles of the present invention encapsulate a soluble fragment comprising, substantially comprising, or consisting of, both S1 and S2 regions corresponding to amino acid residues 14 to 1255 of the full-length SARS-CoV-1 spike protein. In this context, “consistently made up of” means that the N-terminal and / or C-terminal endpoints of the fragment can vary to a limited extent, such as up to 25 amino acid positions, up to 20 amino acid positions, up to 15 amino acid positions, up to 10 amino acid positions, up to 5 amino acid positions, up to 4 amino acid positions, up to 3 amino acid positions, up to 2 amino acid positions, or up to 1 amino acid position.

[0177] The SARS-CoV-1 spike protein of the present invention may also comprise variants of the above-described sequence, including native variants of other isolates of SARS-CoV-1 and artificial modifications that can be introduced into the sequence of the SARS-CoV-1 S protein. As an exemplary example, mutations can be introduced to alter the formation of the expressed protein. For this purpose, the furin cleavage site located at positions 761 to 767 of SEQ ID NO:47 can be mutated. By reducing the basicity of this amino acid sequence, post-expression cleavage can be reduced. For example, arginine residues 764 and / or 767 can be mutated to weakly basic amino acids, such as Gly (position number corresponding to the amino acid sequence shown in SEQ ID NO:47), or other weakly basic amino acids. Thus, the furin cleavage site having the native EQDRNTR sequence (SEQ ID NO:60) can be mutated to the sequence EQDGNTG (SEQ ID NO:61). Further modifications may include the addition of a trimerizing domain, preferably added to the C-terminus of the protein, which facilitates increased native folding of the S1 and / or S2 domains. Such trimerizing domains may include foldon domains (e.g., SEQ ID NO: 54), GCN4-based trimerizing domains (e.g., SEQ ID NO: 55 or 56), or other motifs well known to those skilled in the art. Furthermore, secretory leader sequences that can improve production and / or downstream processing (e.g., isolation and purification) may be added to the N-terminus of the protein. An exemplary example of such leader sequences is the bee venom peptide leader sequence (SEQ ID NO: 57). Other useful leader sequences are well known to those skilled in the art. Therefore, soluble fragments of the spike protein of the present invention also include highly identical variants of specific sequences of soluble fragments of the spike protein explicitly or implicitly disclosed herein. For example, variants having at least about 95%, at least about 96%, at least about 97%, at least about 98%, or at least about 99% sequence identity with soluble fragments of the spike protein of the present invention, particularly soluble fragments of the SARS-CoV-1S protein of the present invention. As an exemplary example, the soluble fragment of the S fragment of the present invention may comprise, substantially comprise, or comprise a sequence having at least about 95%, at least about 96%, at least about 97%, at least about 98%, or at least about 99% sequence identity with a sequence selected from SEQ ID NO:48-51.

[0178] Optionally or additionally, the polymer vesicles of the present invention may encapsulate one or more nucleic acids, such as mRNA, self-amplifying mRNA, or DNA encoding one or more SARS-CoV-1 spike proteins or soluble fragments thereof as described in the present invention.

[0179] It is also noted here that, in a preferred embodiment, the polymer vesicles of the present invention, wherein one or more soluble fragments of different SARS-CoV-1 spike proteins and / or nucleic acids encoding their or the full-length SARS-CoV-1 spike proteins are used as vaccines against human diseases, particularly those caused by human pathogenic coronaviruses, especially severe acute respiratory syndrome (SARS). Therefore, the polymer vesicles of the present invention, wherein one or more soluble fragments of different SARS-CoV-1 spike proteins and / or nucleic acids encoding their or the full-length SARS-CoV-1 spike proteins, can be used to treat (including prevent) fever, muscle pain, drowsiness, cough, sore throat, shortness of breath, pneumonia, and / or acute respiratory distress syndrome (ARDS).

[0180] In one preferred embodiment, polymeric vesicles containing soluble fragments of one or more different SARS-CoV-1 spike proteins and / or nucleic acids encoding them or the full-length SARS-CoV-1 spike protein are administered intramuscularly. In one preferred embodiment, polymeric vesicles containing soluble fragments of one or more different SARS-CoV-1 spike proteins and / or nucleic acids encoding them or the full-length MERS-CoV spike protein are administered nasally. In one preferred embodiment, polymeric vesicles containing soluble fragments of one or more different SARS-CoV-1 spike proteins and / or nucleic acids encoding them or the full-length SARS-CoV-1 spike protein are administered by inhalation.

[0181] In the context of this invention, the term "oxidatively stable" refers to a measure of the antioxidant properties of polymeric vesicles (or corresponding polymers or membranes) using methods such as those described by Scott et al., 2012. In this method, polymeric vesicles containing encapsulated antigens are incubated in a 0.5% hydrogen peroxide solution, and the amount of free (released) antigen is quantified by UV / fluorescent HPLC. Polymeric vesicles that release a significant amount or all of the encapsulated antigen under these oxidizing conditions are considered oxidatively sensitive. Another method for determining whether a block copolymer and the resulting polymeric vesicles are oxidatively stable or oxidatively sensitive is described in column 16 of U.S. Patent 8,323,696. According to this method, a polymer with oxidatively sensitive functional groups is chemically altered by a mild oxidant, the test being enhanced solubility against 10% hydrogen peroxide for up to 20 hours in vitro. For example, poly(propylene sulfuride) (PPS) is an oxidation-sensitive polymer (see, for example, Scott et al., 2012, ibid. and US 8,323,696). PPS can be used as a reference to determine whether a target polymer and the corresponding target polymer vesicles are oxidation-sensitive or oxidation-stable. For example, if the same or higher amount of antigen is released from the target polymer vesicle compared to the amount of antigen released from a PPS polymer vesicle encapsulating the same antigen, or about 90% or more of that amount, or about 80% or more of that amount, or about 70% or more of that amount, or about 60% or more of that amount, then the polymer vesicle is considered to be oxidation-sensitive. If, compared to the amount of antigen released from a PPS polymeric vesicle encapsulating the same antigen, only about 0.5% or less, or only about 1.0% or less, or about 2% or less, or about 5% or less, or about 10% or less, or about 20% or less, or about 30% or less, or about 40% or less, or about 50% or less of antigen, the target polymeric vesicle is considered oxidically stable. Therefore, consistent with this, PPS polymeric vesicles as described in U.S. Patent 8,323,696, or PPS-bl-PEG polymeric vesicles as described by Stano et al., composed of poly(propylene sulfuride) (PPS) and poly(ethylene glycol) (PEG) as components, are not oxidically stable polymeric vesicles in the sense of this invention. Similarly, PPS30-PEG17 polymeric vesicles are not oxidically stable polymeric vesicles in the sense of this invention. Other non-limiting examples of measuring oxidative stability include, for example, measurements of stability in the presence of serum components (such as mammalian serum, such as human serum components) or stability within the nucleus.

[0182] In the context of this invention, the term "reduction-stable" refers to a measure of the resistance of polymer vesicles to reduction in a reducing environment.

[0183] In the context of this invention, the term "serum" refers to plasma from which coagulation proteins have been removed.

[0184] In the context of this invention, the term "oxidation-independent release" refers to the release of the contents of a polymer vesicle without or substantially without oxidation of the polymer forming the vesicle.

[0185] In this document, the term "peptide" is used interchangeably with the term "protein." A protein (including its fragments, preferably biologically active fragments, and peptides, typically having fewer than 30 amino acids) comprises one or more amino acids linked together by covalent peptide bonds (thus forming an amino acid chain). The term "peptide" as used herein describes a group of molecules consisting of, for example, more than 30 amino acids. Peptides can further form polymers such as dimers, trimers, and higher oligomers, i.e., composed of more than one polypeptide molecule. The polypeptide molecules forming such dimers or trimers, etc., can be identical or different. The higher-order structures corresponding to such polymers are therefore called homodimers or heterodimers, homotrimers or heterotrimers, etc. An example of a heteropolymer is an antibody molecule, which in its naturally occurring form consists of two identical light polypeptide chains and two identical heavy polypeptide chains. The terms "peptide" and "protein" also refer to naturally modified polypeptides / proteins, where said modifications are achieved by post-translational modifications such as glycosylation, acetylation, phosphorylation, etc. These modifications are well known in the art.

[0186] In this context, the term "carbohydrate" refers to a substance with the stoichiometric formula C2. n (H2O) n Compounds (e.g., hence also called "carbon hydrates"), such as aldoses and ketoses. The superordinate term "carbohydrate" includes, but is not limited to, monosaccharides, oligosaccharides, and polysaccharides, as well as substances derived by carbonyl reduction (aldolols), by oxidation of one or more terminal groups to a carboxylic acid, or by substitution of one or more hydroxyl groups with hydrogen atoms, amino groups, thiols, or similar groups. Derivatives of these compounds are also included.

[0187] In this context, the term "polynucleotide" (also known as "nucleic acid," which is used interchangeably with the term "polynucleotide") refers to a macromolecule composed of nucleotide units that can be hydrolyzed into certain pyrimidine or purine bases (typically adenine, cytosine, guanine, thymine, uracil), d-ribose or 2-deoxy-d-ribose, and phosphate. Non-limiting examples of "polynucleotide" include DNA molecules (such as cDNA or genomic DNA), RNA (mRNA), combinations thereof, or hybrid molecules composed of DNA and RNA. Nucleic acids can be double-stranded or single-stranded and can contain both double-stranded and single-stranded segments. The most preferred examples of polynucleotides are double-stranded DNA molecules and mRNA molecules.

[0188] In this context, the term "antisense oligonucleotide" refers to a nucleic acid polymer that is at least partially complementary to a nucleic acid present in normal or affected cells. Exemplary "antisense oligonucleotides" include antisense RNA, siRNA, and RNAi.

[0189] In this context, the term "CD8" (+) "T cell-mediated immune response" refers to the immune response mediated by cytotoxic T cells (also known as TC, cytotoxic T lymphocytes, CTL, T killer cells, cytolytic T cells, CD8+). (+) T cell-mediated immune responses (or cytotoxic T cell-mediated immune responses). Examples of cytotoxic T cells include, but are not limited to, antigen-specific effector CD8 cells. (+) T cells. For the T cell receptor (TCR) to bind to class I MHC molecules, the receptor must be accompanied by a glycoprotein called CD8, which binds to a constant portion of the class I MHC molecule. Therefore, these T cells are called CD8 cells. (+) T cells. Once activated, T cells undergo "clonal expansion" with the help of the cytokine interleukin-2 (IL-2), a growth and differentiation factor for T cells. This increases the number of cells that are specific to the target antigen, and these cells can then search for antigen-positive somatic cells throughout the body.

[0190] In this context, the term "antigen-specific CD8" (+) "Clonal expansion of T cells" refers to CD8 cells that are specific to target antigens. (+) The number of T cells increases.

[0191] In this context, the term "cellular immune response" refers to an immune response that involves not antibodies but rather the activation of phagocytes, antigen-specific cytotoxic T lymphocytes, and the release of various cytokines in response to an antigen.

[0192] In this context, the term "antigen-specific CD8" (+) "T cell cytotoxic phenotype" refers to antigen-specific CD8+. (+) A set of observable characteristics of T cells that are associated with their cytotoxic function.

[0193] In this context, the term "lymph node-resident macrophages" refers to macrophages, which are large white blood cells that are an integral part of our immune system. These macrophages use the phagocytic process to engulf and digest particles present in lymph nodes, which are small, bean-shaped glands distributed throughout the body.

[0194] In this context, the term "humoral immune response" refers to an immune response mediated by macromolecules found in the extracellular fluid, such as secreted antibodies, complement proteins, and certain antimicrobial peptides. The aspect involving antibodies is generally referred to as antibody-mediated immunity.

[0195] In this context, the term "B cell" also refers to B lymphocytes, a subtype of white blood cell. They play a role in the humoral immune component of the adaptive immune system by secreting antibodies.

[0196] As used herein, an "antibody" is a protein comprising one or more polypeptides (containing one or more binding domains, preferably antigen-binding domains) encoded substantially or partially by immunoglobulin genes or segments thereof. The terms "immunoglobulin" (Ig) and "antibody" are used interchangeably herein. Recognized immunoglobulin genes include κ, λ, α, γ, δ, ε, and μ constant region genes, as well as numerous immunoglobulin variable region genes. Specifically, an "antibody" as used herein is typically a tetrameric glycosylated protein composed of two light (L) chains (each approximately 25 kDa) and two heavy (H) chains (each approximately 50 kDa). Two types of light chains, referred to as λ and κ, can be found in antibodies. Immunoglobulins can be classified into five main classes based on the amino acid sequence of the heavy chain constant domain: A, D, E, G, and M. Several of these classes can be further subdivided into subclasses (isotypes), such as IgG1, IgG2, IgG3, IgG4, IgA1, and IgA2, with IgG being preferred in the context of this invention. Antibodies related to this invention are also envisioned, having an IgE constant domain or a portion thereof that binds to Fcε receptor I. IgM antibodies consist of five basic heterotetrameric units linked to an additional polypeptide called the J chain and contain 10 antigen-binding sites, while IgA antibodies contain 2-5 basic 4-chain units that can polymerize to form a multivalent assembly, combined with the J chain. In the case of IgG, the 4-chain unit is typically about 150,000 Daltons. Each light chain includes an N-terminal variable (V) domain (VL) and a constant (C) domain (CL). Each heavy chain includes an N-terminal V domain (VH), three or four C domains (CH), and a hinge region. The constant domain does not directly participate in antibody-antigen binding but can exhibit various effector effects, such as participation in antibody-dependent cytotoxicity (ADCC). If the antibody is to exert ADCC, it is preferably an IgG1 subclass, while the IgG4 subclass does not have the ability to exert ADCC.

[0197] The term "antibody" also includes, but is not limited to, monoclonal, monospecific, poly- or multi-specific antibodies such as bispecific antibodies, humanized, camel-like, human, single-chain, chimeric, synthetic, recombinant, hybrid, mutant, transplanted, and in vitro generated antibodies, with chimeric or humanized antibodies being preferred. The term "humanized antibody" is generally defined as an antibody in which the specific encoding CDRs of HC and LC have been transferred to a suitable human variable framework ("CDR transplantation"). The term "antibody" also includes scFv, single-chain antibodies, dimer or tetramers, domain antibodies (dAbs), and nanobodies. For the purposes of this invention, the term "antibody" should also include bimeric, trimeric, or multimeric antibodies or bimeric, trimeric, or multifunctional antibodies having several antigen-binding sites.

[0198] Furthermore, the term "antibody" as used herein also refers to derivatives of the antibodies (including fragments) described herein. An antibody "derivative" comprises an amino acid sequence altered by the introduction of amino acid residue substitutions, deletions, or additions. Additionally, derivatives encompass antibodies modified by covalently linking any type of molecule to an antibody or protein. Examples of such molecules include, but are not limited to, sugars, PEGylations, hydroxyl groups, ethoxy groups, carboxyl groups, or amino groups. Indeed, covalent modification of the antibodies results in glycosylation, polyethylene glycolation, acetylation, phosphorylation, and amidation, but is not limited to these.

[0199] The antibodies involved in this invention are preferably “isolated” antibodies. “Isolated” as used herein to describe the disclosed antibodies means antibodies that have been identified, isolated, and / or recovered from components of their production environment. Preferably, the isolated antibody is not associated with all other components from its production environment. Contaminant components of its production environment, such as those caused by recombinant transfected cells, are typically materials that interfere with the diagnostic or therapeutic use of the peptide and may include enzymes, hormones, and other protein- or non-protein-like solutes. In a preferred embodiment, the antibody will be purified (1) to a degree sufficient to obtain at least 15 residues of the N-terminal or internal amino acid sequence using a rotary cup sequencer, or (2) to homogenize by SDS-PAGE under non-reducing or reducing conditions using Coomassie blue or preferably silver staining. However, typically isolated antibodies are prepared by at least one purification step.

[0200] The term "substantially non-immunogenic" means that the block copolymer or amphiphilic polymer of the present invention does not elicit an adaptive immune response, that is, the block copolymer or amphiphilic polymer exhibits an immune response of less than 30%, preferably 20%, more preferably 10%, particularly preferably less than 9, 8, 7, 6 or 5% compared to the encapsulated immunogen.

[0201] The term "substantially non-antigenic" means that the block copolymer or amphiphilic polymer of the present invention does not specifically bind to certain product groups (such as T cell receptors or antibodies) that have adaptive immunity, i.e., the block copolymer or amphiphilic polymer shows less than 30%, preferably 20%, more preferably 10%, particularly preferably less than 9, 8, 7, 6 or 5% binding compared to the encapsulated antigen.

[0202] Typically, when the binding affinity is higher than 10 -6 When M is present, the binding is considered specific. Preferably, the binding affinity is approximately 10. -11 Up to 10 -8 M(KD), preferably about 10 -11 Up to 10 -9 In case M, binding is considered specific. If necessary, non-specific binding can be reduced by changing the binding conditions, without significantly affecting specific binding.

[0203] The term “amino acid” or “amino acid residue” generally refers to an amino acid having its well-known definition in the art, such as amino acids selected from the following: alanine (Ala or A); arginine (Arg or R); asparagine (Asn or N); aspartic acid (Asp or D); cysteine ​​(Cys or C); glutamine (Gln or Q); glutamic acid (Glu or E); glycine (Gly or G); histidine (His or H); isoleucine (He or I); leucine (Leu or L); lysine (Lys or K); methionine (Met or M); phenylalanine (Phe or F); proline (Pro or P); serine (Ser or S); threonine (Thr or T); tryptophan (Trp or W); tyrosine (Tyr or Y); and valine (Val or V), although modified, synthetic, or rare amino acids may be used as needed. Amino acids can typically be grouped based on the presence of nonpolar side chains (e.g., Ala, Cys, He, Leu, Met, Phe, Pro, Val); negatively charged side chains (e.g., Asp, Glu); positively charged side chains (e.g., Arg, His, Lys); or uncharged polar side chains (e.g., Asn, Cys, Gln, Gly, His, Met, Phe, Ser, Thr, Trp, and Tyr).

[0204] "Effective cells," preferably human effector cells, are leukocytes that express one or more FcRs and perform effector functions. Preferably, the cells express at least FcyRm and perform ADCC effector functions. Examples of human leukocytes mediating ADCC include peripheral blood mononuclear cells (PBMCs), natural killer (NK) cells, monocytes, cytotoxic T cells, and neutrophils. Effector cells can be isolated from natural sources such as blood.

[0205] The term "immunity" refers to one or more of the following steps: administering one or more antigens to a human or non-human animal so that antibodies can be produced in that animal.

[0206] Specifically, non-human animals are preferably immunized at least twice, more preferably three times, with the polypeptide (antigen) optionally mixed with an adjuvant. An "adjuvant" is a non-specific immune response stimulant. An adjuvant may be in the form of a composition comprising any one or two of the following components: (a) a substance designed to form a reservoir that protects (multiple) antigens from rapid metabolism (e.g., mineral oil, alum, aluminum hydroxide, liposomes, or surfactants such as pluronic polyol); and (b) a substance that non-specifically stimulates the immune response of the host animal undergoing immunization (e.g., by increasing lymphokine levels therein).

[0207] As used in this article, “cancer” refers to a large class of diseases characterized by the uncontrolled growth of abnormal cells in the body. Unregulated cell division can lead to the formation of malignant tumors or cells that invade adjacent tissues and can metastasize to distant parts of the body via the lymphatic system or bloodstream.

[0208] Non-limiting examples of cancer include squamous cell carcinoma, small cell lung cancer, non-small cell lung cancer, squamous non-small cell lung cancer (NSCLC), non-NSCLC, glioma, gastrointestinal cancer, kidney cancer (such as clear cell carcinoma), ovarian cancer, liver cancer, colorectal cancer, endometrial cancer, kidney cancer (such as renal cell carcinoma (RCC)), prostate cancer (such as hormone-resistant prostate adenocarcinoma), thyroid cancer, neuroblastoma, pancreatic cancer, glioblastoma (glioblastoma multiforme), cervical cancer, stomach cancer, bladder cancer, hepatocellular carcinoma, breast cancer, colon cancer and head and neck cancer (or tumors), and gastric cancer. Cancer, germ cell tumors, pediatric sarcomas, sinus natural killer tumors, melanomas (e.g., metastatic malignant melanomas, such as cutaneous or ocular malignant melanomas), bone cancer, skin cancer, uterine cancer, anal cancer, testicular cancer, fallopian tube cancer, endometrial cancer, cervical cancer, vaginal cancer, vulvar cancer, esophageal cancer, small bowel cancer, endocrine system cancers, parathyroid cancer, adrenal cancer, soft tissue sarcomas, urethral cancer, penile cancer, pediatric solid tumors, ureteral cancer, renal pelvis cancer, central nervous system (CNS) tumors, primary CNS lymphomas, tumor angiogenesis, spinal cord tumors, brainstem gliomas, pituitary adenomas, Kaposi's sarcoma, epidermoid carcinoma, squamous cell carcinoma, T-cell lymphoma, environmentally induced cancers, including asbestos-induced cancers, virus-associated cancers (e.g., human papillomavirus (HPV)-associated tumors), and blood malignancies originating from either of the two major blood cell lineages (the two major blood cell lineages are not included in the provided text). Cell lineages, namely myeloid cell lineages (which produce granulocytes, erythrocytes, platelets, macrophages, and mast cells) or lymphoid cell lineages (which produce B, T, NK, and plasma cells), include all types of leukemia, lymphoma, and myeloma, such as acute, chronic, lymphocytic, and / or myeloid leukemia, including acute leukemia (ALL), acute myeloid leukemia (AML), chronic lymphocytic leukemia (CLL), chronic myeloid leukemia (CML), undifferentiated AML (MO), myeloblastic leukemia (M1), myeloblastic leukemia (M2; mature cells), promyelocytic leukemia (M3 or M3 variant [M3V]), myelomonocytic leukemia (M4 or eosinophilic M4 variant [M4E]), monocytic leukemia (M5), erythroleukemia (M6), megakaryoblastic leukemia (M7), dissociated granulocytic sarcoma, and green carcinoma;Lymphomas, such as Hodgkin's lymphoma (HL), non-Hodgkin's lymphoma (NHL), B-cell lymphoma, T-cell lymphoma, lymphoplasmacytic lymphoma, monocytic B-cell lymphoma, mucosa-associated lymphoid tissue (MALT) lymphoma, anaplastic (e.g., Ki 1+) large cell lymphoma, adult T-cell lymphoma / leukemia, mantle cell lymphoma, angioimmunoblastic T-cell lymphoma, angiocentric lymphoma, intestinal T-cell lymphoma, primary mediastinal B-cell lymphoma, precursor T-lymphoblastic lymphoma, T-lymphoblastic lymphoma; and lymphoma / leukemia (T-Lbly / T-ALL), peripheral T-cell lymphoma, lymphoblastic lymphoma, post-transplant, lymphoproliferative disorders, true histiocytic lymphoma, primary central nervous system lymphoma. Tumors, primary exudative lymphoma, lymphoblastic lymphoma (LBL), lymphoid spectrum hematologic malignancies, acute lymphoblastic leukemia, diffuse large B-cell lymphoma, Burkitt's lymphoma, follicular lymphoma, diffuse histiocytic lymphoma (DHL), immunoblastic large cell lymphoma, precursor B-cell lymphoma, cutaneous T-cell lymphoma (CTLC) (also known as mycosis fungoides or Sezary syndrome), and those with W Lymphoplasmacytic lymphoma (LPL) of Aldenstrom's macroglobulinemia; myeloma, such as IgG myeloma, light chain myeloma, non-secreting myeloma, condensing myeloma (also known as painless myeloma), solitary, plasmacytoma and multiple myeloma, chronic lymphocytic leukemia (CLL), pilocellular lymphoma; myeloid hematologic malignancies, mesenchymal tumors, including fibrosarcoma and rhabdomyosarcoma; seminoma, teratoma, central and peripheral nerve tumors, including astrocytomas. Neuroblastoma; schwannomas; mesenchymal tumors, including fibrosarcoma, rhabdomyosarcoma, and osteosarcoma; and other tumors, including melanoma, xeroderma pigmentosum, keratoacanthoma, seminoma, thyroid follicular carcinoma and teratoma; lymphoid lineage hematologic malignancies, such as T-cell and B-cell tumors, including but not limited to T-cell diseases such as pre-T lymphocytic leukemia (T-PLL), including small cell and brain cell types; large granular lymphocytic leukemia (LGL), preferably T-cell type; a / d T-NHL hepatosplenic lymphoma; peripheral / postthymic T-cell lymphoma (polymorphic and immunoblastic subtypes); vascular center (nasal) T-cell lymphoma; head or neck cancer, kidney cancer, rectal cancer, thyroid cancer; acute myeloid lymphoma, and any combination of the above cancers. The methods described in this article can also be used to treat metastatic cancers, refractory cancers (e.g., cancers refractory to previous immunotherapies, such as those using antibodies that block CTLA-4, PD-1, or PD-L1), and recurrent cancers.

[0209] The term "subject" is intended to include a living organism. Examples of subjects include mammals such as humans, dogs, cattle, horses, pigs, sheep, goats, cats, mice, rabbits, rats, and transgenic non-human animals. However, subjects (animals) can be non-mammals such as birds or fish. In some preferred embodiments of the invention, the subject is a human, while in other preferred embodiments, the subject can be a farm animal, which can be either a mammal or a non-mammal. Examples of such non-mammals are birds (such as poultry like chickens, ducks, geese, or turkeys), fish (such as fish farmed in aquaculture such as salmon, trout, or tilapia), or crustaceans (such as shrimp or prawns). Examples of mammals (livestock) include goats; sheep; cattle; horses; pigs; or donkeys. Other mammals include, for example, cats, dogs, mice, and rabbits. In illustrative embodiments, the polymer vesicles of the invention are used for vaccination or immunization of the aforementioned farm animals (mammal farm animals and non-mammal farm animals (birds, fish, crustaceans)) to resist viral infection (see the Examples section for this). Therefore, in this case, soluble full-length viral protein or soluble fragments of full-length viral protein can be encapsulated in the polymer vesicles of the present invention.

[0210] When used for vaccination in humans or non-human animals, the polymeric vesicles of the present invention, or compositions comprising polymeric vesicles, may be orally administered to the appropriate subjects simply dissolved in a suitable (pharmaceutically acceptable) buffer solution (such as phosphate-buffered saline (PBS) or 0.9% physiological saline solution (an isotonic solution of 0.90% w / v NaCl with a molar osmotic pressure of 308 mOsm / L)) (see also the Examples section). The polymeric vesicles may be further mixed with an adjuvant. If administered orally, the adjuvant may help protect the polymeric vesicles against the acidic environment in the stomach. Such adjuvants may be water-miscible or capable of forming water-oil emulsions, such as oil-in-water emulsions or water-in-oil emulsions. Exemplary examples of such adjuvants are oil-in-water emulsions, water-in-oil emulsions, monophosphoyl ester A, and / or trehalose dicorynomycolate, wherein the oil preferably comprises mineral oil, dimethicone, Span 80, squalene, or combinations thereof, substantially composed of, or composed of, such oils. Other illustrative examples are monophosphoester A (e.g., from Salmonella Minnesota), trehalose dicorynomycolate, or mixtures thereof, which may be in the form of an oil-in-water emulsion (e.g., squalene). The emulsion may contain an emulsifier (e.g., polysorbate, such as polysorbate 80). Alternatively, polymer vesicles may be modified by, for example, by coating with a natural polymer, or the polymer vesicles may be formulated in particles of a natural polymer, such as alginate or chitosan, and the synthetic polymer, such as poly(d,l-lactide-co-glycolic acid) (PLG), poly(d,l-lactic acid-co-hydroxyacetic acid) (PLGA), poly(g-glutamic acid) (g-PGA) [31,32], or poly(ethylene glycol) (PEG). These particles may be micron-sized particles (“macrobeads”) or nanoparticles, or nanoparticles incorporated into macrobeads, all of which are well known in the art.See, for example, Hari et al., “Chitosan / calcium–alginate beads for oral delivery of insulin”, Applied Polymer Science, Volume 59, Issue 11, 14 March 1996, 1795-1801; Sosnik, “Alginate Particles as Platform for Drug Delivery by the Oral Route: State-of-the-Art”, ISRN Pharmaceutics Volume 2014, Article ID 926157; Machado et al., “Encapsulation of DNA in Macroscopic and Nanosized Calcium Alginate Gel Particles”, Langmuir 2013, 29, 15926-15935; International Patent Application WO 2015 / 110656; Liang Zhao et al., “Nanoparticle vaccines” (Vaccine 32(2014) 327-337); or Li et al., “Chitosan-Alginate Nanoparticles as a "Novel Drug Delivery System for Nifedipine" Int J Biomed Sci vol.4no.3September 2008, 221-228. In exemplary embodiments of these polymeric vesicles and oral formulations, the polymeric vesicles for vaccination have viral antigens encapsulated therein, said viral antigens including influenza hemagglutinin, swine influenza hemagglutinin, foot-and-mouth disease (FMD) virus proteins (such as VP1, VP2, or VP3 capsid proteins (VP1 capsid protein contains the major antigenic determinants of the FMD virion, therefore changes in its sequence should be the reason for the high antigenic variability of the virus)), ovalbumin (OVA), SPIKE proteins (such as porcine epidemic diarrhea (PED) virus SPIKE proteins), and SPIKE proteins of human pathogenic coronaviruses (such as MERS-CoV SPIKE proteins, SARS-CoV-2 SPIKE proteins, or SARS-CoV-1 SPIKE proteins). SPIKE protein). The use of polymeric vesicles containing soluble portions of influenza hemagglutinin or foot-and-mouth disease (FMD) virus proteins (such as VP1, VP2, or VP3 capsid proteins) clearly demonstrates that viral diseases can affect any animal, including birds and mammals, which can also be humans.

[0211] The term "effective dose" or "effective amount" is defined as an amount sufficient to achieve or at least partially achieve the desired effect. The term "therapeutic effective dose" is defined as an amount sufficient to cure or at least partially prevent the disease and its complications in a patient already suffering from the disease. The effective amount for this purpose will depend on the severity of the infection and the general state of the subject's own immune system. The term "patient" includes persons receiving preventative or therapeutic treatment and other mammalian subjects.

[0212] The appropriate dose or therapeutically effective amount of the antibody or its antigen-binding moiety will depend on the condition to be treated, the severity of the condition, prior therapy, and the patient's clinical history and response to the therapeutic agent. The dosage may be adjusted according to the attending physician's judgment so that it can be administered to the patient once or in a series of doses. The pharmaceutical composition may be administered as the sole therapeutic agent or, as needed, in combination with other therapies.

[0213] If the pharmaceutical composition has been lyophilized, the lyophilized material should first be reconstituted in a suitable liquid before administration. The lyophilized material can be reconstituted in a liquid such as water for injection (BWFI), physiological saline, phosphate-buffered saline (PBS), or a formulation identical to the one in which the protein was in before lyophilization.

[0214] The injectable pharmaceutical compositions can be present in unit dosage forms, such as in ampoules or multi-dose containers, with preservatives added. Furthermore, various recent drug delivery methods have been developed, and the pharmaceutical compositions of the present invention are suitable for administration using these new methods, such as Inject-ease, Genject, syringe pens like Genen, and needle-free devices like MediJector and BioJector. The pharmaceutical compositions of the present invention are also applicable to administration methods yet to be discovered. See also Langer, 1990, Science, 249:1527-1533.

[0215] Pharmaceutical compositions can be prepared for intranasal or inhalation administration, such as local application to the respiratory tract and / or lungs. Means and devices for inhalation administration of substances are well known to those skilled in the art, for example those disclosed in WO 94 / 017784A and Elphick et al., (2015) Expert Opin Drug Deliv, 12, 1375-87. These means and devices include nebulizers, metered-dose inhalers, powder inhalers, and nasal sprays. Other means and devices suitable for guiding the inhalation administration of drugs or vaccines are also well known in the art. A preferred route of local administration to the respiratory tract and / or lungs is via aerosol inhalation. A review of pulmonary drug delivery (i.e., inhalation via a nebulizer (which can also be used in nasal administration) or intratracheal instillation) is given, for example, in Patton, JS, et al., (2004) Proc. Amer. Thoracic Soc., 1, 338-344. Nebulizers can be used to generate aerosols from solutions, while metered-dose inhalers, dry powder inhalers, and the like can effectively generate small particulate aerosols. Therefore, pharmaceutical compositions can be formulated as aerosols (mixtures), sprays, mists, or powders.

[0216] Pharmaceutical compositions targeting mucosal pathogens (such as respiratory coronaviruses, like SARS-CoV-2, MERS, or SARS-CoV-1) should confer sustained protective immunity at both the systemic and mucosal levels. Therefore, the pharmaceutical compositions of the present invention are preferably prepared for mucosal administration, such as inhalation or intranasal administration. As shown in Example 14, intranasal administration of a coronavirus vaccine can elicit not only a mucosal immune response but also a systemic immune response. The pharmaceutical compositions of the present invention are also preferably prepared for systemic administration, such as intramuscular administration.

[0217] A nebulizer is a drug delivery device used to administer a drug in the form of a powder mist inhaled into the lungs. Different types of nebulizers are known to those skilled in the art, including jet nebulizers, ultrasonic nebulizers, vibrating mesh nebulizers, and soft mist inhalers. Some nebulizers provide a continuous stream of atomized solution, i.e., they provide continuous nebulization over a long period of time regardless of whether the subject inhales from them, while other nebulizers are respiratory-actuated, i.e., the subject only receives a dose when inhaled from them. Vaccines of the present invention, particularly those for human pathogenic coronavirus infections (such as MERS, COVID-19, or SARS), can be formulated for use in nebulizers, formulated to be contained in nebulizers, or formulated for administration by using a nebulizer.

[0218] A metered-dose inhaler (MDI) is a device that delivers a specific amount of medication to the lungs in the form of short pulses of liquid nebulized medication. Such a metered-dose inhaler typically consists of three main components: a cartridge containing the formulation to be administered, a metering valve that allows the dispensing of a measured amount of formulation with each actuation, and an actuator (or interface) that allows the patient to operate the device and introduce the liquid aerosol into the patient's lungs. Vaccines of the present invention, particularly those for human pathogenic coronavirus infections (such as MERS, COVID-19, or SARS), can be formulated for use in an MDI, formulated to be contained within an MDI, particularly within a cartridge of an MDI, or formulated for administration via the use of an MDI.

[0219] A dry powder inhaler (DPI) is a device that delivers medication to the lungs in the form of dry powder. Dry powder inhalers are an alternative to aerosol-based inhalers, such as metered-dose inhalers. The medication is typically held in a capsule for manual loading or in a proprietary blister pack located inside the inhaler. Vaccines of the present invention, particularly those for human pathogenic coronavirus infections (such as MERS, COVID-19, or SARS), can be formulated for use in DPIs, formulated as contained in DPIs, particularly in capsules or blister packs of MDIs, or formulated for administration via an MDI.

[0220] A nasal spray for nasal administration, which allows medication to be blown into the body cavity through the nose. Vaccines of the present invention, particularly those for human pathogenic coronavirus infections (such as MERS, COVID-19, or SARS), can be formulated as nasal sprays, contained in nasal spray vials, or formulated for administration as nasal sprays.

[0221] Pharmaceutical compositions can also be formulated as depot preparations. Such long-acting preparations can be administered by implantation (e.g., subcutaneously, via ligament or tendon, subsynovial, or intramuscular), subsynovial injection, or intramuscular injection. Thus, for example, the preparation can be modified with suitable polymeric or hydrophobic materials (e.g., as an emulsion in an acceptable oil) or ion exchange resins, or modified into poorly soluble derivatives, such as poorly soluble salts.

[0222] Pharmaceutical compositions can also be in many conventional reservoir forms for administration to provide a reactive composition. These include, for example, solid, semi-solid, and liquid dosage forms, such as liquid solutions or suspensions, slurries, gels, creams, balms, emulsions, lotions, powders, sprays, foams, pastes, ointments, salves, balms, and drops.

[0223] If desired, the pharmaceutical composition may be contained in a vial, package, or dispenser device, which may contain one or more unit dosage forms comprising the active ingredient. In one embodiment, the dispenser device may include a syringe having a single-dose, injectable liquid formulation. The syringe may be accompanied by instructions for use.

[0224] Pharmaceutical compositions may further include other pharmaceutically acceptable components. Other pharmaceutically acceptable carriers, excipients, or stabilizers, such as those described in Remington's Pharmaceutical Sciences 16th edition, Osol, A.Ed. (1980), may also be included in the protein formulations described herein, provided that they do not adversely affect the desired properties of the formulation. As used herein, "pharmaceuticalally acceptable carrier" means any and all solvents, dispersion media, coatings, antimicrobial and antifungal agents, isotonic agents, and absorption delay agents compatible with drug administration. The use of these media and reagents for the active pharmaceutical ingredient is well known in the art. Acceptable carriers, excipients, or stabilizers that are non-toxic to the recipient at the dosage and concentration used include: additional buffers; preservatives; solubilizers; antioxidants, including ascorbic acid and methionine; chelating agents, such as EDTA; metal complexes (such as zinc-protein complexes); biodegradable polymers, such as polyesters; salt-forming counterions, such as sodium, polyols; amino acids, such as alanine, glycine, asparagine, 2-phenylalanine, and threonine; sugars or sugars. Alcohols, such as lactitol, stachyose, mannose, sorbitol, xylose, ribose, ribitol, inositol sugar, inositol, galactose, galactitol, glycerol, cyclic alcohols (such as inositol), polyethylene glycol; sulfur-containing reducing agents, such as glutathione, lipoic acid, sodium thioglycolate, thioglycerol, [α]-monothioglycerol, and sodium thiosulfate; low molecular weight proteins, such as human serum albumin, bovine serum albumin, gelatin, or other immunoglobulins; and hydrophilic polymers, such as polyvinylpyrrolidone.

[0225] The formulations described herein are used as pharmaceutical compositions in patients who require them for the treatment and / or prevention of the pathological medical conditions described herein. The term "treatment" refers to therapeutic treatment and preventive or preventative measures. Treatment includes applying or administering the formulation to the body, isolated tissues, or cells of a patient who has a disease / symptom, symptoms of a disease / symptom, or a predisposition to disease / symptom, with the aim of treating, curing, alleviating, relieving, altering, remedying, improving, improving, or influencing the disease, disease symptoms, or predisposition to disease.

[0226] As used herein, the terms “treatment” and “treatment” refer to the administration of a therapeutically effective amount of the pharmaceutical composition according to the invention to a subject. “Therapeutically effective amount” means an amount of pharmaceutical composition or antibody sufficient to treat or alleviate a disease or symptom, delay the onset of a disease, or provide any therapeutic benefit in the treatment or management of a disease.

[0227] As used herein, the term "prevention" refers to the use of a pharmaceutical agent to prevent the onset of a disease or symptom. "Preventative effective amount" defines the amount of an active ingredient or pharmaceutical agent sufficient to prevent the onset or recurrence of a disease.

[0228] As used herein, the terms “symptom” and “disease” are used interchangeably to refer to the symptoms of the subject. In particular, the terms “cancer” and “tumor” are used interchangeably.

[0229] The kits of the present invention will typically include the aforementioned container and one or more other containers containing materials required from a commercial and user perspective, including buffers, diluents, filters, needles, syringes, and packaging inserts with instructions for use.

[0230] In this context, the term "liposome" refers to a spherical vesicle having at least one lipid bilayer.

[0231] In this context, the term "endosome" refers to a membrane-bound compartment (i.e., a vacuole) inside a eukaryotic cell where substances taken in through endocytosis are delivered.

[0232] In this context, the term "late endosome" refers to a prelysosomal endocytic organelle that differentiates from early endosomes by a lower luminal pH and a different protein composition. Late endosomes are more spherical than early endosomes and are mostly juxtanuclear, concentrated near the center of microtubule organization.

[0233] In this context, the term "T helper cells" (also known as TH cells or "effective CD4 cells") refers to... (+) T cells (or T lymphocytes) are T lymphocytes that assist other white blood cells in the immunological process, including the maturation of B cells that enter plasma cells and memory B cells, and the activation of cytotoxic T cells and macrophages. These cells are also known as CD4+ cells. (+) Helper T cells are named as such because they express the CD4 glycoprotein on their surface. Helper T cells are activated when MHC class II molecules expressed on the surface of antigen-presenting cells (APCs) present peptide antigens, such as peptide antigens, to them.

[0234] As used herein, the term “autoantigen” refers to any molecule or chemical group of one organism that acts as an antigen in another organism and induces antibody formation, but which is tolerated by the healthy immune system of the parent organism.

[0235] As used herein, the term "% identity" refers to the percentage of identical amino acid residues at corresponding positions within a sequence when using optional sequence alignment (such as the ClustalW or X techniques available at www.clustal.org or examples of equivalent techniques). Therefore, by aligning two sequences (a reference sequence and a target sequence) to identify identical amino acid residues between the two sequences, the total number of identical amino acids is divided by the total number of amino acids (amino acid length). The result of this division is a percentage value, i.e., identity value / percentage of degree.

[0236] The immunization method of the present invention can be carried out in a synthetic environment that allows for proper folding of antigens (such as proteins) or fragments thereof, using full-length soluble encapsulated antigens, thereby increasing the probability of isolating antibodies in vivo capable of detecting the corresponding antigens (such as membrane proteins). Furthermore, immunization and antibody production can be performed without knowledge of the membrane protein structure, whereas peptide-based immunization methods may require knowledge of the membrane protein structure.

[0237] Furthermore, compared to other technologies, the method of this invention can rapidly and economically produce membrane proteins encapsulated in an oxidically stable membrane environment.

[0238] In some aspects, the present invention relates to a method for inducing an immune response against an antigen (such as an immunogen) in a subject. The method may include administering to a subject a composition comprising polymeric vesicles of the present invention having a membrane (such as a peripheral membrane) of an amphiphilic polymer. The composition further comprises a soluble antigen encapsulated by the membrane of the amphiphilic polymer of the polymeric vesicles of the present invention. The immunogen may be a membrane-associated protein. In some other aspects, the polymeric vesicles of the present invention comprise a lipid polymer. Administration may be performed in any suitable manner, such as oral administration, topical administration, respiratory tract topical administration, pulmonary topical administration, inhalation administration, intranasal administration, or injection.

[0239] Depending on the desired level of response, those skilled in the art can determine and adjust the frequency of administration (e.g., oral or injectable). For example, the polymeric vesicles of the present invention can be administered to subjects, including mammals, once a week or every two weeks (e.g., orally or by injection). The immune response is measured by quantifying the blood concentration level (titer) of antibodies in mammals against the initial amount of antigen encapsulated in the polymeric vesicles of the present invention (see Examples section).

[0240] The structure of polymeric vesicles may include amphiphilic block copolymers that self-assemble into vesicle form and encapsulate various antigens (e.g., soluble proteins, etc.), which are encapsulated by solvent rehydration, direct dispersion, or spontaneous self-assembly methods (e.g., Example 1 as described herein).

[0241] In the context of this invention, the term "soluble antigen" as used herein means an antigen that can be dissolved or liquefied. As an exemplary example, a soluble antigen may consist of amino acids from the extracellular and / or intracellular regions of a membrane protein. However, a soluble antigen may also contain amino acids from the extracellular and / or intracellular regions of a membrane protein, as well as one or more amino acids belonging to the transmembrane region of that membrane protein, provided that the antigen remains soluble or liquefied. As an exemplary example, a soluble fragment of the MERS-CoV spike protein of SEQ ID NO:43 is a soluble antigen within the meaning of this invention, containing one amino acid (position 1297) belonging to the transmembrane region. However, it is conceivable that a soluble antigen preferably lacks at least a portion or the entire transmembrane region. The term "soluble antigen" includes antigens that are "solubilized" (especially in water) by the action of detergents or other agents, said solubilization meaning that the antigen becomes soluble or more soluble. Exemplary non-limiting soluble antigens of the present invention include: polypeptides derived from insoluble portions of proteins, hydrophobic polypeptides that become soluble for encapsulation, and aggregated polypeptides that are soluble as aggregates.

[0242] In some respects, the antigens (e.g., membrane proteins) of the present invention are solubilized by means of detergents, surfactants, temperature changes, or pH changes. The vesicle structure provided by the amphiphilic block copolymer allows the antigens (e.g., membrane proteins) to fold in a physiologically correct and functional manner, thereby allowing the immune system of the target mammal to detect the antigens and thus generate a strong immune response.

[0243] In some aspects, the injection of the compositions of the present invention may include intraperitoneal, subcutaneous or intravenous, intramuscular or non-invasive administration. In other aspects, the injection of the compositions of the present invention may include intradermal injection.

[0244] In some other respects, the level of immune response can be further enhanced or strengthened by including an adjuvant in the composition comprising the polymer vesicles of the present invention. The adjuvant may be an encapsulated adjuvant or an unencapsulated adjuvant. The adjuvant may be mixed with the polymer vesicles or composition of the present invention. The adjuvant may be water-soluble or in the form of a water-oil emulsion. In this respect, the polymer vesicles and the adjuvant may be administered simultaneously to the subject.

[0245] In some respects, the block copolymers or amphiphilic polymers of the polymer vesicles of the present invention are neither immunostimulants nor adjuvants.

[0246] In some other respects, the block copolymers or amphiphilic polymers of the polymer vesicles of the present invention are immunostimulants and / or adjuvants.

[0247] In other respects, the polymer vesicles of the present invention are immunogenic.

[0248] In other respects, the polymer vesicles of the present invention are non-immunogenic.

[0249] In some aspects, the adjuvant can be administered separately from the administration of the composition of the invention comprising the polymeric vesicles of the invention. The adjuvant can be administered before, simultaneously with, or after the administration of the composition comprising polymeric vesicles encapsulating the antigen of the invention. For example, the adjuvant can be injected into the subject after injection of the composition comprising polymeric vesicles encapsulating the antigen of the invention. In some aspects, the adjuvant can be encapsulated together with the antigen in the polymeric vesicles. In other preferred aspects, encapsulating the adjuvant in separate polymeric vesicles means that the adjuvant and the antigen are encapsulated separately, so that the antigen is encapsulated in a first type of polymeric vesicle and the adjuvant is encapsulated in a second type of polymeric vesicle. It should be noted that the adjuvant and the polymeric vesicles can be encapsulated in polymeric vesicles formed of the same amphiphilic polymer. Referring to Examples 7 to 9, or 14 or 18 of this application, the corresponding antigen and the CpG oligodeoxynucleotide (e.g., CpG ODN1826:5'-tccatgacgttcctgacgtt-3', SEQ ID NO:18 or CpG ODN 2007:5'-TCGTCGTTGTCGTTTTGTCGTT-3', SEQ ID NO:63) as an exemplary adjuvant are both encapsulated in BD21 polymer vesicles. Alternatively, the amphiphilic polymer used for encapsulating the antigen may be different from the amphiphilic polymer vesicles used for encapsulating the adjuvant. As a simple exemplary example, the antigen may be encapsulated in BD21 polymer vesicles, while the adjuvant may be encapsulated in PDMS. 12 -PEO 46 or PDMS 47 PEO 36 In polymer vesicles.

[0250] Any known adjuvant can be used in this invention, and it will be readily recognized and understood by those skilled in the art that the type of adjuvant to be injected depends on the type of antigen to be used to elicit an immune response. The adjuvant can be an antigen of bacterial, viral, or fungal origin. The adjuvant can be a nucleic acid, such as a CpG oligodeoxynucleotide (also known as “CpG ODN” or herein “CpG”), a naturally occurring oligonucleotide derived from bacteria containing an unmethylated CpG dinucleotide, particularly the sequence in this context (CpG motif). These CpG motifs are present in bacterial DNA at a frequency 20 times higher than in mammalian DNA. CpG ODN is recognized by Toll-like receptor 9 (TLR9), which leads to a strong immunostimulatory effect, and is widely commercially available. Exemplary examples of commercially available CpG ODNs include ODN 2006, a 24-mer having the sequence TCGTCGTTTTGTCGTTTTGTCGTT (SEQ ID NO:62, commercially available from Miltenyi Biotech under catalog number 130-100-106); ODN 2007, a 22-mer having the sequence 5'-TCGTCGTTGTCGTTTTGTCGTT-3' (SEQ ID NO:63); the aforementioned ODN 1826, a 20-mer having the sequence 5'-TCCATGACGTTCCTGACGTT-3' (SEQ ID NO:18); or ODN 2216, a 20-mer having the sequence 5'-GGGGGACGA:TCGTCGGGGGG-3' (SEQ ID NO:64), the latter three of which are available from InvivoGen. As a natural DNA molecule, the bases are linked together by phosphodiester bonds (PO4). However, this bond is readily degraded by nucleases. When used as an adjuvant without any protective element, the natural CpG molecule has a very short half-life in vivo. To avoid this short half-life, the phosphodiester bond can be replaced with a thiophosphate bond by changing one of the oxygen atoms to a sulfur atom. This substitution prevents nuclease degradation and prolongs the half-life of the modified CpG. For example, CpG molecules ODN2006, ODN 2007, or ODN 1826 are provided in the form of a complete thiophosphate backbone to make them nuclease resistant. Alternatively, CpG can be encapsulated in cationic liposomes to avoid nuclease degradation. In this invention, in addition to CpG, many other widely used Toll-like receptor agonists, such as polyinosine:polycytidylic acid (poly(I:C)) (TLR3), lipopolysaccharide (LPS) (TLR4), and monophospholipid (MPL) (TLR5), can be used as one or more adjuvants. Furthermore...Components derived from the cell walls of bacteria and mycobacteria, such as those present in the Sigma adjuvant system or Freund's adjuvant, or proteins such as keyhole hemocyanin (KLH), are further exemplary examples of adjuvants that can also be used in this invention. Other exemplary examples of suitable adjuvants that can be used in this invention include the Sigma adjuvant system (SAS), simethicone, or α-tocopherol. Other antigen-adjuvant pairs are also suitable for the methods of this invention.

[0251] In this context, the term "adjuvant" as used herein is not limited to pharmacological or immunological agents that modify the effects of other agents (e.g., as adjuvants as described above), but rather refers to "any substance that stimulates the action of the immune system." Therefore, checkpoint inhibitors that stimulate the action of the immune system are also included in the meaning of the term adjuvant as used herein. For example, PD-L1, present on the cell surface, binds to PD1 on the surface of immune cells, thus inhibiting immune cell activity. Therefore, antibodies that, for example, bind to PD-1 or PD-L1 and block the interaction between PD1 and PD-L1 are "such positive checkpoint inhibitors" because they allow T cells to attack tumors.

[0252] In some aspects, the membrane protein used as an antigen in this invention may include fragments or extracellular domains of transmembrane proteins. The antigen may also be a (full-length) transmembrane protein, a G protein-coupled receptor, a neurotransmitter receptor, a kinase, a porin, an ABC transporter, an ion transporter, an acetylcholine receptor, and a cell adhesion receptor. The membrane protein may also be fused to or coupled with a tag, or it may be untagged. If the membrane protein is tagged, the tag may, for example, be selected from well-known affinity tags, such as VSV, His-tags, etc. Flag-tags, Intein-tags, or GST-tags, or the parent proteins of high-affinity binding pairs, such as biotin or avidin, or selected from labels such as fluorescent labels, enzyme labels, NMR labels, or isotope labels.

[0253] In some respects, membrane proteins or fragments (or portions) thereof may be presented prior to encapsulation or encapsulated simultaneously with protein production via a cell-free expression system. Cell-free expression systems may be in vitro transcription and translation systems.

[0254] Cell-free expression systems can be eukaryotic cell-free expression systems, such as TNT systems based on rabbit reticulocytes, wheat germ extracts, or insect extracts, or they can be prokaryotic cell-free expression systems or ancient cell-free expression systems.

[0255] The antigens or fragments (or portions) thereof of the present invention can be generated in vivo. The antigens or fragments (or portions) thereof can be generated, for example, in a bacterial or eukaryotic host organism, and then isolated from that host organism or its culture. The antigens or fragments (or portions) thereof can also be generated in vitro, for example, using an in vitro translation system. A preferred expression system is a baculovirus expression system. The use of baculovirus protein expression systems is often overlooked because it is considered slow and expensive. However, one of the main advantages of baculovirus systems is that cell lines can be generated and maintained independently of the virus. Given the rapid changes in viral sequences such as MERS-CoV and SARS-CoV-1, this allows for the rapid generation of new subunit antigens without the need for regulatory approval of new cell lines as useful tools. Furthermore, baculovirus systems produce antigens with novel glycosylation signatures compared to mammalian systems that have already shown enhanced immune responses. For example, the fully soluble (S1-S2) domains of the spike proteins of SARS-CoV-1 and MERS-CoV can both be expressed in Sf9 cells. Whether administered alone or with alum Matrix M1 adjuvant, these proteins exhibited high viral neutralizing titers once immunized into Balb / c mice, and this neutralization persisted for at least 45 days. Therefore, the antigens of the present invention are preferably produced using eukaryotic host cells, preferably insect cells such as Sf9 cells, or preferably using a baculovirus expression system.

[0256] As described above, polymer vesicles can be formed from amphiphilic diblock or triblock copolymers. In various aspects, the amphiphilic polymer may include at least one monomer unit of a carboxylic acid, amide, amine, alkylene, dialkylsiloxane, ether, or alkylene sulfide.

[0257] In some aspects, the amphiphilic polymer can be a polyether block selected from the following: oligo(oxyethylene) block, poly(oxyethylene) block, oligo(oxypropylene) block, poly(oxypropylene) block, oligo(oxybutene) block, and poly(oxybutene) block. Other examples of blocks that may be included in the polymer include, but are not limited to: poly(acrylic acid), poly(methyl acrylate), polystyrene, poly(butadiene), poly(2-methyloxazoline), poly(dimethylsiloxane), poly(ε-caprolactone), poly(propylene sulfide), poly(N-isopropylacrylamide), poly(2-vinylpyridine), poly(2-(diethylamino)ethyl methacrylate), poly(2-(diisopropylamino)ethyl methacrylate), poly(2-methacryloyloxy)ethylphosphorylcholine, poly(isoprene), poly(isobutylene), poly(ethylene-co-butene), and poly(lactic acid). Examples of suitable amphiphilic polymers include, but are not limited to: poly(ethylene ethyl)-b-poly(ethylene oxide) (PEE-b-PEO), poly(butadiene)-b-poly(ethylene oxide) (PBD-b-PEO), poly(styrene)-b-poly(acrylic acid) (PS-PAA), poly(dimethylsiloxane)-poly(ethylene oxide) (referred to herein as PDMS-PEO), also known as poly(dimethylsiloxane-b-ethylene oxide), poly(dimethylsiloxane)-poly(acrylic acid) (PDMA-PAA), poly(2-methyloxazoline)-b-poly(dimethylsiloxane)-b-poly(2-methyloxazoline) (PMOXA-bPDMS-bPMOXA) (including, for example, triblock copolymers, such as PMOXA used by May et al. 2013). 20 -PDMS 54 -PMOXA 20 (ABA)), poly(2-methyloxazoline)-b-poly(dimethylsiloxane)-b-poly(ethylene oxide) (PMOXA-b-PDMS-b-PEO), poly(ethylene oxide)-b-poly(propylene sulfuride)-b-poly(ethylene oxide) (PEO-b-PPS-b-PEO), and poly(ethylene oxide)-poly(butene oxide) block copolymers. The block copolymers can be further determined by the average block length of each block contained in the copolymer. Therefore, PB M PEO N This indicates the presence of polybutadiene blocks (PB) of length M and polyethylene oxide (PEO) blocks of length N. M and N are independently selected from integers, for example, integers in the range of about 6 to about 60. Therefore, PB... 35 PEO 18 This indicates the presence of polybutadiene blocks with an average length of 35 and polyethylene oxide blocks with an average length of 18. In some aspects, PB-PEO diblock copolymers comprise 5-50 blocks of PB and 5-50 blocks of PEO. Similarly, PB... 10 PEO24 This indicates the presence of polybutadiene blocks with an average length of 10 and polyethylene oxide blocks with an average length of 24. Exemplary examples of suitable PB-PEO diblock copolymers that can be used in this invention include the diblock copolymer PBD. 21 -PEO 14 (It is also available commercially) and [PBD] 21 -[PEO] 12 (See WO2014 / 077781A1 and Nallani et al., 2011). As a further example, E O B p This indicates the presence of an ethylene oxide block (E) of length O and a butadiene block (B) of length P. Therefore, O and P are independently selected from integers, such as those in the range of about 10 to about 120. Thus, E... 16 E 22 This indicates the presence of ethylene oxide blocks with an average length of 16 and butadiene blocks with an average length of 22.

[0258] For another preferred block copolymer used to form the polymer vesicles of the present invention, poly(dimethylsiloxane-b-ethylene oxide) (PDMS-PEO), it should be noted that both linear and comb-type PDMS-PEO can be used herein (see Gaspard et al., “Mechanical Characterization of Hybrid Vesicles Based on Linear Poly(Dimethylsiloxane-b-Ethylene Oxide) and Poly(Butadiene-b-Ethylene Oxide) Block Copolymers” Sensors 2016, 16(3), 390, which describes polymer vesicles formed from PDMS-PEO).

[0259] The structure of linear PDMS-PEO is shown in equation (I):

[0260]

[0261] The structure of the comb-type PDMS-PEO is shown in the following formula (II):

[0262]

[0263] According to structure (I), the term "PDMS" is used. n -PEO mThis indicates the presence of a polydimethylsiloxane (PDMS) block of length n and a polyethylene oxide (PEO) block of length m. m and n are independently selected from integers, each of which may be selected, for example, from about 5 or about 6 to about 100, about 5 to about 60, or about 6 to about 60, or an integer in the range of about 5 to 50. For example, PDMS can be commercially available from Polymer Source Inc., Dorval (Montreal) Quebec, Canada. 12 -PEO 46 or PDMS 47 PEO 36 Linear PDMS-PEO. Therefore, PDMS-PEO block copolymers may contain 5-100 blocks of PDMS and 5-100 blocks of PEO, 6-100 blocks of PDMS and 6-100 blocks of PEO, 5-100 blocks of PDMS and 5-60 blocks of PEO, or 5-60 blocks of PDMS and 5-60 blocks of PEO.

[0264] Based on the above description, one aspect of the present invention relates to a method for inducing an immune response in a subject, the method comprising administering to the subject a polymeric vesicle formed from PDMS-PEO carrying an antigen. The antigen can be associated / physically linked to the PDMS-PEO polymeric vesicle in any suitable manner. For example, the PDMS-PEO polymeric vesicle may have a soluble antigen encapsulated therein as described in the present invention. Optionally or additionally, the polymeric vesicle may have an antigen integrated into / introduced into the circumferential membrane of the polymeric vesicle as described in WO2014 / 077781A1. In this case, the antigen is a membrane protein integrated into the circumferential membrane of the PDMS-PEO polymeric vesicle with one or more of its transmembrane domains. The above integration can be achieved following the description in WO2014 / 077781A1 or Nallani et al., "Proteopolymersomes: in vitro production of amembrane protein in polymersome membranes", Biointerphases, 1 December 2011, page 153. If the antigen is encapsulated in PDMS-PEO polymer vesicles, it can be a soluble antigen selected from polypeptides, carbohydrates, polynucleotides, and combinations thereof. The invention further relates to a method for producing polymer vesicles formed from PDMS-PEO in which antigens are encapsulated, and to the polymer vesicles produced by said method.

[0265] The present invention further relates to compositions comprising PDMS-PEO polymer vesicles carrying antigens. Furthermore, in these compositions, the antigen can be associated / physically linked to the PDMS-PEO polymer vesicles in any suitable manner. For example, the PDMS-PEO polymer vesicles may have soluble antigens encapsulated therein as described in the present invention. Optionally or additionally, the polymer vesicles may have antigens integrated into / introduced into the circumferential membrane of the polymer vesicle as described in WO2014 / 077781A1. The present invention also relates to vaccines comprising such PDMS-PEO polymer vesicles carrying antigens, methods for inducing an immune response, and methods for treating, improving, preventing, or diagnosing cancer, autoimmune diseases, or infectious diseases, such methods comprising providing PDMS-PEO polymer vesicles carrying antigens to a subject in need.

[0266] Based on the foregoing, the present invention also relates to the application, in vitro or in vivo, of PDMS-PEO polymer vesicles carrying (or transporting) antigens in a manner suitable for inducing an immune response. The antigens may be encapsulated within the PDMS-PEO polymer vesicles, or introduced into the circumferential membrane of the polymer vesicles, for example, as described in WO2014 / 077781A1.

[0267] Another preferred block copolymer is poly(dimethylsiloxane)-poly(acrylic acid) (PDMS-PAA). PDMS-PAA can be PDMS. M -PAA N This indicates the presence of poly(dimethylsiloxane) (PDMS) blocks of length M and poly(acrylic acid) (PAA) blocks of length N. M and N are independently selected from integers, which may be selected, for example, from an integer ranging from about 5 to about 100, and represent the average length of the blocks. The PDMS-PAA preferably comprises 5-100 PDMS blocks and 5-100 PAA blocks. Preferably, the PDMS-PAA comprises 5-50, preferably 10-40 PDMS blocks and / or 5-30, preferably 5-25, preferably 5-20 PAA blocks. The PDMS-PAA is preferably selected from PDMS. 30 -PAA 14 PDMS 15 -PAA7 or PDMS 34 -PAA 16 .

[0268] In some aspects, the polymer vesicles of the present invention may comprise one or more compartments (or, as “multi-compartment”). The compartmentalization of the vesicle structure of the polymer vesicles allows for the coexistence of complex reaction pathways in living cells and facilitates the spatial and temporal separation of many intracellular activities. Therefore, the polymer vesicles of the present invention can encapsulate more than one type of antigen. Different antigens may have the same or different isotypes. Each compartment may also be formed from the same or different amphiphilic polymers. In various aspects, two or more different antigens are integrated into the circumferential membrane of the amphiphilic polymer. Each compartment may encapsulate at least one of a peptide, protein, and nucleic acid. The peptide, protein, polynucleotide, or carbohydrate may be immunogenic.

[0269] Further details of suitable multi-compartment polymer vesicles can be found in WO20121018306, the entire contents of which are incorporated herein by reference for all purposes.

[0270] Polymer vesicles can also be freestanding or fixed on a surface, such as those described in WO2010 / 1123462, the entire contents of which are incorporated herein by reference for all purposes.

[0271] If the polymer vesicle carrier comprises more than one compartment, the compartment may contain an outer block copolymer vesicle and at least one inner block copolymer vesicle, wherein the at least one inner block copolymer vesicle is encapsulated within the outer block copolymer vesicle. In some aspects, each of the block copolymers of the outer vesicle and the inner vesicle comprises a polyether block, such as a poly(ethylene oxide) block, a poly(propylene oxide) block, and a poly(butylene oxide) block. Other examples of blocks that may be included in copolymers include, but are not limited to: poly(acrylic acid), poly(methyl acrylate), polystyrene, poly(butadiene), poly(2-methyloxazoline), poly(dimethylsiloxane), poly(L-isocyanoalanine (2-thiophene-3-yl-ethyl)amide), poly(ε-caprolactone), poly(propylene sulfide), poly(N-isopropylacrylamide), poly(2-vinylpyridine), poly(2-(diethylamino)ethyl methacrylate), poly(2-(diisopropylamino)ethyl methacrylate), poly(2-(methacryloyloxy)ethylphosphorylcholine), and poly(lactic acid). Examples of suitable external and internal vesicles include, but are not limited to: poly(ethylene ethyl)-b-poly(ethylene oxide) (PEE-b-PEO), poly(butadiene)-b-poly(ethylene oxide) (PBD-b-PEO), poly(styrene)-b-poly(acrylic acid) (PS-b-PAA), poly(ethylene oxide)-poly(caprolactone) (PEO-b-PCL), poly(ethylene oxide)-poly(lactic acid) (PEO-b-PLA), poly(isoprene)-poly(ethylene oxide) (PI-b-PEO), poly(2-vinylpyridine)-poly(ethylene oxide) (P2VP-b-PEO), poly(ethylene oxide)-poly(N-isopropylacrylamide) (PEO-b-PNIPAm), poly(ethylene glycol)-poly(propylene sulfuride) (PEG-b-PPS), and poly(dimethylsiloxane)-poly(acrylic acid) (PD). The following block copolymers are mentioned: MS-PAA, poly(methylphenylsilane)-poly(ethylene oxide) (PMPS-b-PEO-b-PMPS-b-PEO-b-PMPS), poly(2-methyloxazoline)-b-poly-(dimethylsiloxane)-b-poly(2-methyloxazoline) (PMOXA-b-PDMS-b-PMOXA), poly(2-methyloxazoline)-b-poly(dimethylsiloxane)-b-poly(ethylene oxide) (PMOXA-b-PDMS-b-PEO), poly[styrene-b-poly(L-isocyanoalanine (2-thiophene-3-yl-ethyl)amide)] (PS-b-PIAT), poly(ethylene oxide)-b-poly(propylene sulfuride)-b-poly(ethylene oxide) (PEO-b-PPS-b-PEO), and poly(ethylene oxide)-poly(butene oxide) (PEO-b-PBO). The block copolymers can be further determined by the average length of each block contained within the copolymer. Therefore, PS M PIATN This indicates the presence of polystyrene (PS) blocks with M repeating units and poly(L-isocyanoalanine (2-thiophene-3-yl-ethyl)amide (PIAT) blocks with N repeating units. Therefore, M and N are independently selected from integers, for example, integers in the range of about 5 to about 95. Thus, PS 40 PIAT 50 This indicates the existence of PS blocks with an average of 40 repeating units and PIAT blocks with an average of 50 repeating units.

[0272] In some aspects, the polymeric vesicles of the present invention comprise lipids, which are preferably mixed with block copolymers or amphiphilic polymers. The lipid content is typically low compared to the amount of block copolymers or amphiphilic polymers. Generally, the lipids constitute at most about 50%, at most about 45%, at most about 40%, at most about 35%, at most about 30%, at most about 20%, at most about 15%, at most about 10%, at most about 5%, at most about 2%, at most about 1%, at most about 0.5%, at most about 0.2%, or at most about 0.1% of the components (percentages given by weight) that form the polymeric vesicle membrane. The addition of lipids can improve encapsulation efficiency. The lipids can be synthetic lipids, natural lipids, mixtures of lipids, or combinations of synthetic and natural lipids. Non-limiting examples of lipids are phospholipids, such as phosphatidylcholine, such as POPC, lecithin, cephalin, or phosphatidylinositol, or mixtures of lipids containing phospholipids (such as soybean phospholipids, such as asolectin). Other non-limiting examples of lipids include cholesterol, cholesterol sulfate, and 1,2-dioleoyl-3-trimethylammonium propane (DOTAP). Lipids are preferably non-antigenic. In some aspects, the polymeric vesicles of the present invention contain less than about 20%, less than about 15%, less than about 10%, less than about 5%, less than about 2%, less than about 1%, less than about 0.5%, less than about 0.2%, less than about 0.1%, or substantially free of saponins (percentages given by weight).

[0273] In some aspects, the present invention relates to a method for producing polymeric vesicles in which an antigen is encapsulated, the method comprising: i) dissolving an amphiphilic polymer of the present invention in chloroform, preferably, the amphiphilic polymer being polybutadiene-polyethylene oxide (BD); ii) drying the dissolved amphiphilic polymer to form a polymer membrane; iii) adding a solubilized antigen to the dried amphiphilic polymer membrane of step ii), wherein the antigen is selected from: (a) a polypeptide; preferably, the polypeptide being an antigen according to the present invention; (b) a carbohydrate; (c) a combination of a) and / or b) and / or c); iv) rehydrating the polymer membrane of step iii) to form polymeric vesicles; v) optionally, filtering the polymeric vesicles of step iv) to purify the polymeric vesicles into monodisperse vesicles; and / or vi) optionally, separating the polymeric vesicles of step iv) or v) from the unencapsulated antigen.

[0274] In some other aspects, the present invention relates to additional methods for producing polymeric vesicles in which antigens are encapsulated, including methods based on mixing a non-aqueous solution of a polymer in an aqueous solution of an antigen, sonicating a mixture of the respective polymer and antigen, or extruding a mixture of the respective polymer and antigen. Exemplary methods include those described in Rameez et al., Langmuir 2009 and Neil et al., Langmuir 2009, 25(16), 9025–9029.

[0275] Compared with existing ingestion and cross-presentation media and methods based thereon, the polymer vesicles of the present invention offer particular advantages, which are also aspects of the present invention:

[0276] - Polymer vesicles are very effective in uptake and cross-presentation to the immune system;

[0277] - Immune response includes CD8 (+) T cell-mediated immune response;

[0278] - Polymer vesicles are oxidatively stable;

[0279] -The humoral response is stronger compared to the humoral response generated by free antigen-based techniques with or without adjuvants;

[0280] - The use of adjuvants can further enhance the immune response induced by the polymer vesicles of the present invention;

[0281] - The polymer vesicles of the present invention are inherently robust and can be customized or functionalized to increase their circulation time in vivo.

[0282] -The polymer vesicles of the present invention are stable in the presence of serum components;

[0283] - Polymer vesicles are made from inexpensive polymers and can be synthesized rapidly;

[0284] - Compared to techniques based on free antigens with or without adjuvants, the polymer vesicles of the present invention require less antigen to elicit an immune response via the method of the present invention.

[0285] The invention is further characterized by the following items:

[0286] 1. A polymer vesicle (such as an oxidically stable polymer vesicle), said polymer vesicle comprising a soluble encapsulating antigen, wherein said soluble encapsulating antigen is selected from:

[0287] i) Polypeptides;

[0288] ii) Carbohydrates;

[0289] iii) Polynucleotide, preferably, the polynucleotide is not an antisense oligonucleotide, and more preferably, the polynucleotide is a DNA or mRNA molecule;

[0290] Combinations of iv)i) and / or ii) and / or iii).

[0291] 2. The polymer vesicle according to any one of the foregoing items, wherein the polymer vesicle is capable of inducing CD8. (+) T cell-mediated immune responses, preferably, are initiated in vivo, in vitro, or ex vivo.

[0292] 3. The polymeric vesicle according to any one of the foregoing items, wherein the antigen comprises a soluble portion of a membrane protein (MP) or a membrane-associated peptide (MAP), preferably, the antigen comprises a soluble portion of influenza hemagglutinin, swine influenza hemagglutinin, ovalbumin (OVA), a SPIKE protein such as the SPIKE protein of porcine epidemic diarrhea virus, a SPIKE protein such as the SPIKE protein of MERS-CoV, SARS-CoV-2, or SARS-CoV-1, a SPIKE protein of human pathogenic coronavirus, a B16 peptide, or an MC38 peptide, more preferably, the antigen comprises a polypeptide, the polypeptide being combined with a soluble portion selected from SEQ ID NO:1, SEQ ID NO:2, SEQ ID NO:3, SEQ ID NO:4, SEQ ID NO:5, SEQ ID NO:6, SEQ ID NO:7, SEQ ID NO:8, SEQ ID NO:9, SEQ ID NO:10, SEQ ID NO:11, SEQ ID NO:12-14, SEQ ID NO:43-46, and SEQ ID NO:34-41, SEQ ID NO:48-51 and SEQ ID NO:48-51. The polypeptide sequence of NO:65 has at least 60% or higher (e.g., at least 65%, at least 70%, at least 75%, at least 80%, at least 85%, at least 90%, at least 95%, at least 96%, at least 97%, at least 98%, at least 99%, or 100%) identity.

[0293] 4. The polymer vesicles according to any one of the preceding items, wherein the polymer vesicles are stable in the presence of serum components, preferably, the stability is in vivo, in vitro or in vitro stable.

[0294] 5. The polymer vesicle according to any one of the preceding items, wherein the polymer vesicle is stable within the endosome, preferably, the stability is in vivo, in vitro or ex vivo stable.

[0295] 6. The polymer vesicle according to any one of the preceding items, wherein the polymer vesicle has improved oxidative stability compared with the corresponding oxidative stability of liposomes, preferably, the improved stability is in vivo, in vitro or extracorporeal improved stability.

[0296] 7. The polymer vesicle according to any one of the foregoing items, wherein the polymer vesicle is capable of releasing its contents containing the soluble encapsulated antigen in an oxidation-independent manner and triggering CD8. (+) T cell-mediated immune response, preferably, the release is in vivo, in vitro or ex vivo.

[0297] 8. The polymer vesicle according to any one of the preceding items, wherein the polymer vesicle is capable of eliciting a cellular immune response, wherein the cellular immune response comprises CD8+. (+) T cell-mediated immune response, preferably, is an in vivo, in vitro, or ex vivo immune response.

[0298] 9. The polymer vesicle according to any one of the preceding items, wherein the polymer vesicle is capable of eliciting a cellular and / or humoral immune response, wherein the cellular immune response comprises CD8+. (+) T cell-mediated immune response, preferably an in vivo, in vitro, or ex vivo immune response.

[0299] 10. The polymer vesicles according to any one of the preceding items, wherein the humoral immune response includes the production of specific antibodies, and more preferably, the immune response is an in vivo, in vitro, or ex vivo immune response.

[0300] 11. The polymer vesicle according to any one of the foregoing items, wherein the polymer vesicle is capable of enhancing the CD4 effect. (+) The frequency of T cells, preferably, is enhanced in vivo, in vitro, or ex vivo.

[0301] 12. The polymer vesicles according to any one of the preceding items, wherein the cellular immune response comprises a T cell-mediated immune response, preferably, the immune response is an in vivo, in vitro, or ex vivo immune response.

[0302] 13. The polymeric vesicles according to any one of the preceding items, wherein the polymeric vesicles are capable of enhancing antigen specificity CD8 compared to free antigen. (+) Clonal expansion of T cells, preferably, is in vivo, in vitro, or ex vivo expansion.

[0303] 14. The polymer vesicle according to any one of the preceding items, wherein the polymer vesicle is capable of inducing an antigen-specific effect CD8. (+) T cells, preferably, are induced in vivo, in vitro, or outside the body.

[0304] 15. The polymer vesicles according to any one of the preceding items, wherein the polymer vesicles are capable of enhancing antigen-specific CD8. (+) The cytotoxic phenotype of T cells, preferably, is enhanced in vivo, in vitro, or ex vivo.

[0305] 16. The polymer vesicle according to any one of the preceding items, wherein the polymer vesicle is capable of targeting lymph node-resident macrophages and / or B cells, preferably, the targeting is in vivo, in vitro or ex vivo.

[0306] 17. The polymer vesicle according to any one of the preceding items, wherein the polymer vesicle is reductively stable, preferably, the polymer vesicle is reductively stable in the presence of serum components, and more preferably, the reductive stability is in vivo, in vitro or in vitro reductively stable.

[0307] 18. The polymer vesicle according to any one of the preceding items, wherein the polymer vesicle has reduced permeability, preferably, the reduced permeability is compared with the corresponding permeability of liposomes, and more preferably, the permeability is in vivo, in vitro or extracorporeal permeability.

[0308] 19. The polymer vesicle according to any one of the preceding items, wherein the polymer vesicle is capable of releasing its contents within an endosome, preferably, the endosome is a late endosome, and more preferably, the release is in vivo, ex vivo, or in vitro.

[0309] 20. The polymer vesicle according to any one of the preceding items, wherein the polymer vesicle is capable of performing one or more of the following:

[0310] i) Inducing a cellular immune response; preferably, the cellular immune response includes CD8. (+) T cell-mediated immune response; more preferably, the cellular immune response is CD8. (+) T cell-mediated immune response; most preferably, the cellular immune response targets influenza hemagglutinin, swine influenza hemagglutinin, ovalbumin (OVA), SPIKE protein such as porcine epidemic diarrhea virus SPIKE protein, SPIKE protein of human pathogenic coronavirus such as MERS-CoV SPIKE protein, SARS-CoV-2 SPIKE protein or SARS-CoV-1 SPIKE protein, soluble fraction of B16 peptide or MC38 peptide, and more preferably, the cellular immune response targets a polypeptide, the polypeptide being selected from SEQ ID NO:1, SEQ ID NO:2, SEQ ID NO:3, SEQ ID NO:4, SEQ ID NO:5, SEQ ID NO:6, SEQ ID NO:7, SEQ ID NO:8, SEQ ID NO:9, SEQ ID NO:10, SEQ ID NO:11, SEQ ID NO:12-14, SEQ ID NO:43-46, SEQ ID NO:34-41, SEQ ID NO:48-51 and SEQ ID NO:48-51. The polypeptide sequence of NO:65 has at least 60% or higher (e.g., at least 65%, at least 70%, at least 75%, at least 80%, at least 85%, at least 90%, at least 95%, at least 96%, at least 97%, at least 98%, at least 99%, or 100%) identity.

[0311] ii) Releasing polymeric vesicle contents within an endosome, preferably a late endosome; more preferably, the contents comprise a soluble portion of influenza hemagglutinin, swine influenza hemagglutinin, ovalbumin (OVA), a SPIKE protein such as that of porcine epidemic diarrhea virus, a SPIKE protein of a human pathogenic coronavirus such as that of MERS-CoV, SARS-CoV-2, or SARS-CoV-1, a B16 peptide, or an MC38 peptide; most preferably, the contents comprise a polypeptide, the polypeptide being combined with a portion selected from SEQ ID NO:1, SEQ ID NO:2, SEQ ID NO:3, SEQ ID NO:4, SEQ ID NO:5, SEQ ID NO:6, SEQ ID NO:7, SEQ ID NO:8, SEQ ID NO:9, SEQ ID NO:10, SEQ ID NO:11, SEQ ID NO:12-14, SEQ ID NO:43-46, SEQ ID NO:34-41, SEQ ID NO:48-51, and SEQ ID NO:43-46. The polypeptide sequence of NO:65 has at least 60% or higher (e.g., at least 65%, at least 70%, at least 75%, at least 80%, at least 85%, at least 90%, at least 95%, at least 96%, at least 97%, at least 98%, at least 99%, or 100%) identity.

[0312] iii) Release of polymeric vesicle contents in an oxidation-independent manner and trigger CD8 (+)T cell-mediated immune response; preferably, the contents comprise influenza hemagglutinin, swine influenza hemagglutinin, ovalbumin (OVA), SPIKE protein such as porcine epidemic diarrhea virus SPIKE protein, SPIKE protein of human pathogenic coronavirus such as MERS-CoV SPIKE protein, SARS-CoV-2 SPIKE protein or SARS-CoV-1 SPIKE protein, B16 peptide or MC38 peptide, more preferably, the contents comprise a polypeptide, the polypeptide being combined with a soluble portion selected from SEQ ID NO:1, SEQ ID NO:2, SEQ ID NO:3, SEQ ID NO:4, SEQ ID NO:5, SEQ ID NO:6, SEQ ID NO:7, SEQ ID NO:8, SEQ ID NO:9, SEQ ID NO:10, SEQ ID NO:11, SEQ ID NO:12-14, SEQ ID NO:43-46, SEQ ID NO:34-41, SEQ ID NO:48-51 and SEQ ID NO:43-46. The polypeptide sequence of NO:65 has at least 60% or higher (e.g., at least 65%, at least 70%, at least 75%, at least 80%, at least 85%, at least 90%, at least 95%, at least 96%, at least 97%, at least 98%, at least 99%, or 100%) identity.

[0313] iv) Stimulate an immune response to the antigen; preferably, the antigen comprises a soluble portion of influenza hemagglutinin, swine influenza hemagglutinin, ovalbumin (OVA), a SPIKE protein such as that of porcine epidemic diarrhea virus, a SPIKE protein of a human pathogenic coronavirus such as that of MERS-CoV, SARS-CoV-2, or SARS-CoV-1, a B16 peptide, or an MC38 peptide; more preferably, the antigen comprises a polypeptide, the polypeptide being combined with a protein selected from SEQ ID NO:1, SEQ ID NO:2, SEQ ID NO:3, SEQ ID NO:4, SEQ ID NO:5, SEQ ID NO:6, SEQ ID NO:7, SEQ ID NO:8, SEQ ID NO:9, SEQ ID NO:10, SEQ ID NO:11, SEQ ID NO:12-14, SEQ ID NO:43-46, SEQ ID NO:34-41, SEQ ID NO:48-51, and SEQ ID NO:43-46. The polypeptide sequence of NO:65 has at least 60% or higher (e.g., at least 65%, at least 70%, at least 75%, at least 80%, at least 85%, at least 90%, at least 95%, at least 96%, at least 97%, at least 98%, at least 99%, or 100%) identity.

[0314] v) Triggered by CD8 (+)Cross-protection induced by T cell-mediated immune responses; preferably, the response targets influenza hemagglutinin, swine influenza hemagglutinin, SPIKE proteins such as those of porcine epidemic diarrhea virus, SPIKE proteins of human pathogenic coronaviruses such as those of MERS-CoV, SARS-CoV-2, or SARS-CoV-1, ovalbumin (OVA), B16 peptide, or MC38 peptide; more preferably, the response targets a polypeptide, the polypeptide being selected from SEQ ID NO:1, SEQ ID NO:2, SEQ ID NO:3, SEQ ID NO:4, SEQ ID NO:5, SEQ ID NO:6, SEQ ID NO:7, SEQ ID NO:8, SEQ ID NO:9, SEQ ID NO:10, SEQ ID NO:11, SEQ ID NO:12-14, SEQ ID NO:43-46, SEQ ID NO:34-41, SEQ ID NO:48-51, and SEQ ID NO:43-46. The polypeptide sequence of NO:65 has at least 60% or higher (e.g., at least 65%, at least 70%, at least 75%, at least 80%, at least 85%, at least 90%, at least 95%, at least 96%, at least 97%, at least 98%, at least 99%, or 100%) identity.

[0315] vi) Delivering a peptide or protein to antigen-presenting cells (APCs); preferably, the peptide or protein comprises or is derived from influenza hemagglutinin, swine influenza hemagglutinin, ovalbumin (OVA), SPIKE protein such as porcine epidemic diarrhea virus SPIKE protein, SPIKE protein of human pathogenic coronavirus such as MERS-CoV SPIKE protein, SARS-CoV-2 SPIKE protein or SARS-CoV-1 SPIKE protein, a soluble portion of B16 peptide or MC38 peptide, more preferably, the peptide or protein comprises or is derived from a polypeptide, the polypeptide being selected from SEQ ID NO:1, SEQ ID NO:2, SEQ ID NO:3, SEQ ID NO:4, SEQ ID NO:5, SEQ ID NO:6, SEQ ID NO:7, SEQ ID NO:8, SEQ ID NO:9, SEQ ID NO:10, SEQ ID NO:11, SEQ ID NO:12-14, SEQ ID NO:43-46, SEQ ID NO:34-41, SEQ ID NO:48-51 and SEQ ID NO:48-51. The polypeptide sequence of NO:65 has at least 60% or higher (e.g., at least 65%, at least 70%, at least 75%, at least 80%, at least 85%, at least 90%, at least 95%, at least 96%, at least 97%, at least 98%, at least 99%, or 100%) identity.

[0316] vii) Triggering an immune response, which includes CD8 (+) T cell-mediated immune responses and / or CD4 (+)T-cell-mediated immune response; preferably, the response targets influenza hemagglutinin, swine influenza hemagglutinin, ovalbumin (OVA), SPIKE protein such as porcine epidemic diarrhea virus SPIKE protein, SPIKE protein of human pathogenic coronavirus such as MERS-CoV SPIKE protein, SARS-CoV-2 SPIKE protein or SARS-CoV-1 SPIKE protein, B16 peptide or MC38 peptide, more preferably, the response targets a polypeptide, the polypeptide being combined with a soluble portion selected from SEQ ID NO:1, SEQ ID NO:2, SEQ ID NO:3, SEQ ID NO:4, SEQ ID NO:5, SEQ ID NO:6, SEQ ID NO:7, SEQ ID NO:8, SEQ ID NO:9, SEQ ID NO:10, SEQ ID NO:11, SEQ ID NO:12-14, SEQ ID NO:43-46, SEQ ID NO:34-41, SEQ ID NO:48-51 and SEQ ID NO:43-46. The polypeptide sequence of NO:65 has at least 60% or higher (e.g., at least 65%, at least 70%, at least 75%, at least 80%, at least 85%, at least 90%, at least 95%, at least 96%, at least 97%, at least 98%, at least 99%, or 100%) identity.

[0317] viii) Stimulating an immune response in a subject; preferably, the response is directed against a soluble portion of influenza hemagglutinin, swine influenza hemagglutinin, ovalbumin (OVA), a SPIKE protein such as that of porcine epidemic diarrhea virus, a SPIKE protein of a human pathogenic coronavirus such as that of MERS-CoV, SARS-CoV-2, or SARS-CoV-1, a B16 peptide, or an MC38 peptide; more preferably, the response is directed against a polypeptide selected from SEQ ID NO:1, SEQ ID NO:2, SEQ ID NO:3, SEQ ID NO:4, SEQ ID NO:5, SEQ ID NO:6, SEQ ID NO:7, SEQ ID NO:8, SEQ ID NO:9, SEQ ID NO:10, SEQ ID NO:11, SEQ ID NO:12-14, SEQ ID NO:43-46, SEQ ID NO:34-41, SEQ ID NO:48-51, and SEQ ID NO:43-46. The polypeptide sequence of NO:65 has at least 60% or higher (e.g., at least 65%, at least 70%, at least 75%, at least 80%, at least 85%, at least 90%, at least 95%, at least 96%, at least 97%, at least 98%, at least 99%, or 100%) identity.

[0318] ix) Immunizing non-human animals; preferably, the immunization is against a soluble portion of influenza hemagglutinin, swine influenza hemagglutinin, ovalbumin (OVA), a SPIKE protein such as the SPIKE protein of porcine epidemic diarrhea virus, a SPIKE protein of human pathogenic coronaviruses such as the SPIKE protein of MERS-CoV, SARS-CoV-2, or SARS-CoV-1, a B16 peptide, or an MC38 peptide; more preferably, the immunization is against a polypeptide, the polypeptide being combined with a protein selected from SEQ ID NO:1, SEQ ID NO:2, SEQ ID NO:3, SEQ ID NO:4, SEQ ID NO:5, SEQ ID NO:6, SEQ ID NO:7, SEQ ID NO:8, SEQ ID NO:9, SEQ ID NO:10, SEQ ID NO:11, SEQ ID NO:12-14, SEQ ID NO:43-46, SEQ ID NO:34-41, SEQ ID NO:48-51, and SEQ ID NO:43-46. The polypeptide sequence of NO:65 has at least 60% or higher (e.g., at least 65%, at least 70%, at least 75%, at least 80%, at least 85%, at least 90%, at least 95%, at least 96%, at least 97%, at least 98%, at least 99%, or 100%) identity.

[0319] x) The polymer vesicles have altered antigenicity compared to the corresponding antigenicity of the antigen without the polymer vesicles; preferably, the antigen is influenza hemagglutinin, swine influenza hemagglutinin, ovalbumin (OVA), SPIKE protein such as swine epidemic diarrhea virus SPIKE protein, SPIKE protein of human pathogenic coronavirus such as MERS-CoV SPIKE protein, SARS-CoV-2 SPIKE protein or SARS-CoV-1 SPIKE protein, B16 peptide or MC38 peptide, more preferably, the antigen is a polypeptide, the polypeptide being combined with a soluble portion selected from SEQ ID NO:1, SEQ ID NO:2, SEQ ID NO:3, SEQ ID NO:4, SEQ ID NO:5, SEQ ID NO:6, SEQ ID NO:7, SEQ ID NO:8, SEQ ID NO:9, SEQ ID NO:10, SEQ ID NO:11, SEQ ID NO:12-14, SEQ ID NO:43-46, SEQ ID NO:34-41, SEQ ID NO:48-51 and SEQ ID NO:43-46. The polypeptide sequence of NO:65 has at least 60% or higher (e.g., at least 65%, at least 70%, at least 75%, at least 80%, at least 85%, at least 90%, at least 95%, at least 96%, at least 97%, at least 98%, at least 99%, or 100%) identity.

[0320] xi) The polymer vesicles exhibit altered immunogenicity compared to the corresponding immunogenicity of the antigen in the absence of the polymer vesicles; preferably, the immunogen is influenza hemagglutinin, swine influenza hemagglutinin, ovalbumin (OVA), a SPIKE protein such as the SPIKE protein of porcine epidemic diarrhea virus, a SPIKE protein of human pathogenic coronaviruses such as the SPIKE protein of MERS-CoV, SARS-CoV-2, or SARS-CoV-1, a soluble portion of B16 peptide or MC38 peptide; more preferably, the immunogen is a polypeptide containing a peptide selected from SEQ ID NO:1, SEQ ID NO:2, SEQ ID NO:3, SEQ ID NO:4, SEQ ID NO:5, SEQ ID NO:6, SEQ ID NO:7, SEQ ID NO:8, SEQ ID NO:9, SEQ ID NO:10, SEQ ID NO:11, SEQ ID NO:12-14, SEQ ID NO:43-46, SEQ ID NO:34-41, SEQ ID NO:48-51 and SEQ ID NO:43-46. The polypeptide sequence of NO:65 has at least 60% or higher (e.g., at least 65%, at least 70%, at least 75%, at least 80%, at least 85%, at least 90%, at least 95%, at least 96%, at least 97%, at least 98%, at least 99%, or 100%) identity.

[0321] 21. The polymer vesicle according to any one of the preceding items, wherein the polymer vesicle has one or more of the following properties:

[0322] i) The polymer vesicles comprise an oxidation-stabilized membrane; and / or

[0323] ii) The polymer vesicles are synthetic; and / or

[0324] iii) The polymer vesicles do not contain unencapsulated antigens or are mixed with free unencapsulated antigens; and / or

[0325] iv) The polymer vesicles comprise a membrane of an amphiphilic polymer; and / or

[0326] v) The polymer vesicles comprise an amphiphilic synthetic block copolymer that forms a vesicle membrane; and / or

[0327] vi) The polymer vesicles have a diameter greater than 70 nm, preferably in the range of about 100 nm to about 1 μm, or about 120 nm to about 250 nm, or about 125 nm to about 250 nm, about 140 nm to about 240 nm, about 150 nm to about 235 nm, about 170 nm to about 230 nm, or about 220 nm to about 180 nm, or about 190 nm to about 210 nm; and / or

[0328] vii) The polymer vesicles have a vesicle morphology;

[0329] viii) The polymer vesicles described are self-assembled.

[0330] 22. The polymer vesicles according to item 21, wherein the polymer vesicles are in the form of an aggregate of polymer vesicles, wherein the average diameter of the aggregate of polymer vesicles is in the range of about 100 nm to about 1 μm, or about 100 nm to about 750 nm, or about 100 nm to about 500 nm, or about 120 nm to about 250 nm, or about 125 nm to about 250 nm, about 140 nm to about 240 nm, about 150 nm to about 235 nm, about 170 nm to about 230 nm, or about 220 nm to about 180 nm, or about 190 nm to about 210 nm.

[0331] 23. The polymer vesicle according to any one of the preceding items, wherein the antigen is an immunogen.

[0332] 24. The polymer vesicle according to any one of the preceding items, wherein the antigen is selected from: i) autoantigens, ii) non-autoantigens, iii) non-autoimmunogens and iv) autoimmunogens.

[0333] 25. The polymer vesicles according to any one of the preceding items, wherein the antigen is selected from:

[0334] i) a polypeptide having at least 80% or higher (e.g., at least 85%, at least 90%, at least 95%, at least 96%, at least 97%, at least 98%, at least 99%, or 100%) identity with a viral polypeptide sequence; preferably, the viral polypeptide sequence is influenza hemagglutinin or swine influenza hemagglutinin, and more preferably, the viral polypeptide sequence is selected from: SEQ ID NO:5, SEQ ID NO:6, SEQ ID NO:7, and SEQ ID NO:8;

[0335] ii) A polypeptide having at least 80% or more (e.g., at least 85%, at least 90%, at least 95%, at least 96%, at least 97%, at least 98%, at least 99%, or 100%) identity with a bacterial polypeptide sequence;

[0336] iii) A polypeptide having at least 80% or higher (e.g., at least 85%, at least 90%, at least 95%, at least 96%, at least 97%, at least 98%, at least 99%, or 100%) identity with a mammalian or avian polypeptide sequence; preferably, the mammalian or avian polypeptide sequence is ovalbumin (OVA), and has at least 80% or higher (e.g., at least 85%, at least 90%, at least 95%, at least 96%, at least 97%, at least 98%, at least 99%, or 100%) identity with SPIKE protein, B16 peptide, or MC38 peptide; more preferably, the mammalian or avian polypeptide sequence is selected from: SEQ ID NO:4, SEQ ID NO:1, SEQ ID NO:2, SEQ ID NO:3, SEQ ID NO:9, SEQ ID NO:10, SEQ ID NO:11, SEQ ID NO:12-14, SEQ ID NO:43-46, SEQ ID NO:34-41, SEQ ID NO:4, SEQ ID NO:5, SEQ ID NO:6, SEQ ID NO:7, SEQ ID NO:8, SEQ ID NO:10, SEQ ID NO:11, SEQ ID NO:12-14, SEQ ID NO:43-46, SEQ ID NO:34-41, SEQ ID NO:4 ... NO:48-51 and SEQ ID NO:65.

[0337] 26. The polymer vesicle according to any one of the preceding items, wherein the mammalian polypeptide sequence is selected from human, rodent, rabbit and horse polypeptide sequences.

[0338] 27. The polymer vesicle according to any one of the preceding items, wherein the antigen is an antibody or a fragment thereof.

[0339] 28. The polymer vesicles according to any one of the preceding items, wherein the antigen is selected from:

[0340] i) Influenza hemagglutinin (HA), preferably selected from: SEQ ID NO:5, SEQ ID NO:6, SEQ ID NO:7 and SEQ ID NO:8;

[0341] ii) Swine influenza hemagglutinin (HA), preferably, is SEQ ID NO:6;

[0342] iii) Ovalbumin (OVA), preferably, is SEQ ID NO:4;

[0343] iv) Spike proteins, such as those of porcine epidemic diarrhea virus (PED), or spike proteins of human pathogenic coronaviruses, such as MERS-CoV, SARS-CoV-2, or SARS-CoV-1, preferably SEQ ID NO:12-14, SEQ ID NO:43-46, SEQ ID NO:34-41, SEQ ID NO:48-51, and SEQ ID NO:65;

[0344] v) B16 peptide, preferably selected from: SEQ ID NO:9, SEQ ID NO:10 and SEQ ID NO:11;

[0345] vi) MC38 peptide, preferably selected from: SEQ ID NO:1, SEQ ID NO:2 and SEQ ID NO:3;

[0346] vii) B16 and MC38 peptides, preferably, said peptides are independently selected from: i) SEQ ID NO:1-3 and ii) SEQ ID NO:9-11.

[0347] 29. The polymer vesicle according to any one of the preceding items, wherein the polymer vesicle is selected from cationic polymer vesicles, anionic polymer vesicles, nonionic polymer vesicles, and mixtures thereof.

[0348] 30. The polymer vesicles according to any one of the preceding items, wherein the block copolymer or amphiphilic polymer is substantially non-immunogenic or substantially non-antigenic; preferably, the block copolymer or amphiphilic polymer is non-immunogenic or non-antigenic.

[0349] 31. The polymer vesicles according to any one of the preceding items, wherein the block copolymer or amphiphilic polymer is oxidically stable.

[0350] 32. The polymer vesicles according to any one of the preceding items, wherein the block copolymer or the amphiphilic polymer is neither an immunostimulant nor an adjuvant.

[0351] 33. The polymer vesicles according to any one of the preceding items, wherein the amphiphilic polymer comprises a diblock or triblock (ABA or ABC) copolymer.

[0352] 34. The polymer vesicle according to any one of the preceding items, wherein the amphiphilic polymer comprises copolymer poly(N-vinylpyrrolidone)-b-PLA.

[0353] 35. The polymer vesicle according to any one of the preceding items, wherein the amphiphilic polymer comprises at least one monomer unit of a carboxylic acid, amide, amine, olefin, dialkylsiloxane, ether or alkylene sulfide.

[0354] 36. The polymer vesicle according to any one of the preceding items, wherein the amphiphilic polymer is a polyether block selected from the following: oligo(oxyethylene) block, poly(oxyethylene) block, oligo(oxypropylene) block, poly(oxypropylene) block, oligo(oxybutene) block and poly(oxybutene) block.

[0355] 37. The polymer vesicle according to any one of the preceding items, wherein the amphiphilic polymer is a poly(butadiene)-poly(ethylene oxide) (PB-PEO) diblock copolymer.

[0356] 38. The polymer vesicle according to any one of the preceding items, wherein the PB-PEO diblock copolymer comprises 5-50 blocks of PB and 5-50 blocks of PEO.

[0357] 39. The polymer vesicle according to any one of the preceding items, wherein the amphiphilic polymer is a poly(dimethylsiloxane)-poly(ethylene oxide) (PDMS-PEO) diblock copolymer, wherein preferably, the PB-PEO diblock copolymer preferably comprises 5-100 blocks of PDMS and 5-100 blocks of PEO.

[0358] 40. The polymer vesicle according to any one of the preceding items, wherein the polymer vesicle may comprise only block copolymers or amphiphilic polymers or a mixture of block copolymers or amphiphilic polymers and lipids.

[0359] 41. The polymer vesicles according to any one of the preceding items, wherein the lipid comprises synthetic lipids or natural lipids or a mixture or combination of synthetic lipids and natural lipids.

[0360] 42. The polymer vesicle according to any one of the preceding items, wherein the amphiphilic polymer is a poly(lactide)-poly(ethylene oxide) / 1-palmitoyl-2-oleoyl-sn-glycerol-3-phosphate-L-serine (PLA-PEO / POPC) copolymer, preferably, wherein the PLA-PEO / POPC has a PLA-PEO to POPC (e.g., PLA-PEO / POPC) ratio of 50:50 or more (e.g., 50 / 50 or 75 / 25 or 90 / 10).

[0361] 43. The polymer vesicle according to any one of the preceding items, wherein the amphiphilic polymer is a poly(caprolactone)-poly(ethylene oxide) / 1-palmitoyl-2-oleoyl-sn-glycerol-3-phosphate-L-serine (PCL-PEO / POPC) copolymer, preferably, wherein the PCL-PEO / POPC has a PCL-PEO to POPC (e.g., PCL-PEO / POPC) ratio of 50:50 or more (e.g., 50 / 50 or 75 / 25 or 90 / 10).

[0362] 44. The polymer vesicle according to any one of the preceding items, wherein the amphiphilic polymer is a polybutadiene-polyethylene oxide (BD) or a poly(dimethylsiloxane)-poly(ethylene oxide) (PDMS-PEO) diblock copolymer or a poly(dimethylsiloxane)-poly(acrylic acid) (PDMS-PAA) diblock copolymer.

[0363] 45. The polymer vesicle according to any one of the preceding items, wherein the polymer vesicle comprises a diblock copolymer PBD 21 -PEO 14 (hereinafter referred to as "BD21") PDMS 47 -PEO 36 (PDMS-PEO) or triblock copolymer PMOXA 12 -PDMS 55 -PMOXA 12 .

[0364] 46. ​​The polymer vesicle according to any one of the preceding items, wherein the polymer vesicle comprises one or more compartments.

[0365] 47. The polymer vesicle according to any one of the preceding items, wherein the polymer vesicle comprises one or more compartments, wherein each of the one or more compartments encapsulates at least one peptide, protein and nucleic acid, preferably, at least one of the peptide, protein and nucleic acid is immunogenic or antigenic, and more preferably, each of the one or more compartments is composed of the same or different amphiphilic polymers.

[0366] 48. A polymer vesicle according to any one of the preceding items, wherein the polymer vesicle comprises more than one compartment, wherein the compartment comprises an outer block copolymer vesicle and at least one inner block copolymer vesicle, wherein the at least one inner block copolymer vesicle is encapsulated within the outer block copolymer vesicle, preferably, the outer block copolymer vesicle is a polymer vesicle formed independently of copolymers selected from:

[0367] i) Poly[styrene-b-poly(L-isocyanoalanine (2-thiophene-3-yl-ethyl)amide)] (PS-PIAT),

[0368] ii) Poly(butadiene)-poly(ethylene oxide) (PBD-PEO),

[0369] iii) Poly(ethylene oxide)-poly(caprolactone) (PEO-PCL),

[0370] iv) Poly(ethylene ethylidene)-poly(ethylene oxide) (PEE-PEO),

[0371] v) Poly(ethylene oxide)-poly(lactic acid) (PEO-PLA),

[0372] vi) Poly(isoprene)-poly(ethylene oxide) (PI-PEO),

[0373] vii) Poly(2-vinylpyridine)-poly(ethylene oxide) (P2VP-PEO),

[0374] viii) Poly(ethylene oxide)-poly(N-isopropylacrylamide) (PEO-PNIPAm),

[0375] ix) Poly(styrene)-poly(acrylic acid) (PS-PAA),

[0376] x) Poly(ethylene glycol)-poly(propylene sulfide) (PEG-PPS),

[0377] xi) Poly(2-methyloxazoline)-poly(dimethylsiloxane)-poly(2-methyloxazoline)(PMOXA-PDMS-PMOXA),

[0378] xii) Poly(ethylene oxide)-poly(dimethylsiloxane)-poly(2-methyloxazoline) (PEO-PDMS-PMOXA),

[0379] xiii) Poly(methylphenylsilane)-poly(ethylene oxide) (PMPS-PEO-PMPS-PEO-PMPS); and

[0380] xiv) Poly(dimethylsiloxane)-poly(acrylic acid) (PDMS-PAA);

[0381] More preferably, the at least one internal block copolymer vesicle is a polymer vesicle formed independently of copolymers selected from:

[0382] xv) Poly[styrene-b-poly(L-isocyanoalanine (2-thiophene-3-yl-ethyl)amide)](PS-PIAT),

[0383] xvi) Poly(butadiene)-poly(ethylene oxide) (PBD-PEO),

[0384] xvii) Poly(ethylene oxide)-poly(caprolactone) (PEO-PCL)

[0385] xviii) Poly(ethylene ethylidene)-poly(ethylene oxide) (PEE-PEO),

[0386] xix) Poly(ethylene oxide)-poly(lactic acid) (PEO-PLA),

[0387] xx) Poly(isoprene)-poly(ethylene oxide) (PI-PEO),

[0388] xxi) Poly(2-vinylpyridine)-poly(ethylene oxide) (P2VP-PEO),

[0389] xxii) Poly(ethylene oxide)-poly(N-isopropylacrylamide) (PEO-PNIPAm),

[0390] xxiii) Poly(styrene)-poly(acrylic acid) (PS-PAA),

[0391] xxiv) Poly(ethylene glycol)-poly(propylene sulfide) (PEG-PPS),

[0392] xxv) poly(2-methyloxazoline)-poly(dimethylsiloxane)-poly(2-methyloxazoline)(PMOXA-PDMS-PMOXA),

[0393] xxvi) Poly(ethylene oxide)-poly(dimethylsiloxane)-poly(2-methyloxazoline) (PEO-PDMS-PMOXA),

[0394] xxvii) poly(methylphenylsilane)-poly(ethylene oxide) (PMPS-PEO-PMPS-PEO-PMPS), and

[0395] xxviii) Poly(dimethylsiloxane)-poly(acrylic acid) (PDMS-PAA).

[0396] 49. The polymer vesicle according to any one of the preceding items, wherein the polymer vesicle comprises a lipid polymer.

[0397] 50. The polymer vesicle according to any one of the preceding items, wherein the polymer vesicle further comprises an encapsulated adjuvant.

[0398] 51. A method for producing polymeric vesicles encapsulating antigens therein, the method comprising:

[0399] i) Dissolve the amphiphilic polymer in chloroform, preferably, the amphiphilic polymer is polybutadiene-polyethylene oxide (BD);

[0400] ii) Dry the dissolved amphiphilic polymer to form a polymer film;

[0401] iii) Add a solubilizing antigen to the dried amphiphilic polymer membrane of step ii), wherein the antigen is selected from:

[0402] a) A polypeptide; preferably, the polypeptide antigen is any one of the foregoing items, more preferably, the polypeptide antigen comprises a soluble portion of influenza hemagglutinin, swine influenza hemagglutinin, ovalbumin (OVA), a SPIKE protein such as the SPIKE protein of porcine epidemic diarrhea virus, a SPIKE protein of human pathogenic coronaviruses such as the SPIKE protein of MERS-CoV, SARS-CoV-2, or SARS-CoV-1, a B16 peptide, or an MC38 peptide, most preferably, the polypeptide antigen is combined with a soluble portion selected from SEQ ID NO:1, SEQ ID NO:2, SEQ ID NO:3, SEQ ID NO:4, SEQ ID NO:5, SEQ ID NO:6, SEQ ID NO:7, SEQ ID NO:8, SEQ ID NO:9, SEQ ID NO:10, SEQ ID NO:11, SEQ ID NO:12-14, SEQ ID NO:43-46, SEQ ID NO:34-41, SEQ ID NO:48-51, and SEQ ID NO:43-46. The polypeptide sequence of NO:65 has at least 60% or higher (e.g., at least 65%, at least 70%, at least 75%, at least 80%, at least 85%, at least 90%, at least 95%, at least 96%, at least 97%, at least 98%, at least 99%, or 100%) identity.

[0403] b) Carbohydrates;

[0404] c) A polynucleotide, wherein the polynucleotide is not an antisense oligonucleotide, and preferably, the polynucleotide is a DNA or mRNA molecule;

[0405] d)(a) and / or (b) and / or (c) combinations;

[0406] iv) Rehydrate the polymer membrane from step iii) to form polymer vesicles;

[0407] v) Optionally, filter the polymer vesicles from step iv) to purify the polymer vesicles into monodisperse vesicles; and / or

[0408] vi) Optionally, the polymer vesicles from step iv) or v) are separated from the unencapsulated antigen phase.

[0409] 52. A method for producing polymeric vesicles encapsulating antigens according to any one of the preceding items, wherein the polymeric vesicles are the polymeric vesicles described in any one of the preceding items.

[0410] 53. Polymer vesicles produced by the method for producing polymer vesicles encapsulating antigens according to any one of the preceding items.

[0411] 54. A composition comprising polymeric vesicles according to any one of the preceding items.

[0412] 55. The composition according to any one of the preceding items, wherein the composition is a pharmaceutical or diagnostic composition.

[0413] 56. The composition according to any one of the preceding items, wherein the composition is an immunogenic, antigenic, or immunotherapeutic composition.

[0414] 57. The composition according to any one of the preceding items further comprises one or more immunostimulants and / or one or more adjuvants.

[0415] 58. The composition according to any one of the preceding items, wherein the composition is a vaccine.

[0416] 59. The composition according to any one of the preceding items is formulated for non-invasive administration via intradermal, intraperitoneal, intramuscular, subcutaneous, intravenous injection or mucosal surface administration.

[0417] 60. Isolated antigen-presenting cells or hybridoma cells exposed to the polymer vesicles or composition described in any one of the preceding items.

[0418] 61. The antigen-presenting cell according to any one of the preceding items, wherein the antigen-presenting cell comprises dendritic cells.

[0419] 62. The antigen-presenting cell according to any one of the preceding items, wherein the antigen-presenting cell comprises a macrophage.

[0420] 63. The antigen-presenting cell according to any one of the preceding items, wherein the antigen-presenting cell comprises B cells.

[0421] 64. A vaccine comprising any of the preceding items a polymer vesicle, composition, antigen-presenting cell or hybridoma, and further comprising a pharmaceutically acceptable excipient or carrier.

[0422] 65. The vaccine according to any one of the foregoing items, wherein:

[0423] i) The antigen comprises influenza hemagglutinin (HA), wherein the vaccine is an influenza vaccine, preferably, the influenza hemagglutinin (HA) has at least 60% or higher (e.g., at least 65%, at least 70%, at least 75%, at least 80%, at least 85%, at least 90%, at least 95%, at least 96%, at least 97%, at least 98%, at least 99%, or 100%) identity with a polypeptide selected from SEQ ID NO:5, SEQ ID NO:6, SEQ ID NO:7, and SEQ ID NO:8;

[0424] ii) The antigen comprises swine influenza hemagglutinin (HA), wherein the vaccine is a swine influenza vaccine, preferably, the swine influenza hemagglutinin (HA) has at least 60% or higher (e.g., at least 65%, at least 70%, at least 75%, at least 80%, at least 85%, at least 90%, at least 95%, at least 96%, at least 97%, at least 98%, at least 99%, or 100%) identity with SEQ ID NO:6;

[0425] iii) The antigen comprises ovalbumin (OVA), wherein the vaccine is a cancer vaccine, preferably, the ovalbumin (OVA) has at least 60% or higher (e.g., at least 65%, at least 70%, at least 75%, at least 80%, at least 85%, at least 90%, at least 95%, at least 96%, at least 97%, at least 98%, at least 99%, or 100%) identity with SEQ ID NO:4;

[0426] iv) The antigen contains a SPIKE protein (PEDv S), wherein the vaccine is a PED vaccine, preferably, the porcine epidemic diarrhea virus SPIKE protein (S protein) has at least 80% or higher (e.g., at least 85%, at least 90%, at least 95%, at least 96%, at least 97%, at least 98%, at least 99% or 100%) identity with SEQ ID NO:12-14;

[0427] v) The antigen contains a B16 peptide, wherein the vaccine is a cancer vaccine, and preferably, the peptide is selected from: SEQ ID NO: 9-11;

[0428] vi) The antigen contains the MC38 peptide, wherein the vaccine is a cancer vaccine, and preferably, the peptide is selected from: SEQ ID NO: 1-3;

[0429] vii) The antigen comprises B16 and MC38 peptides, wherein the vaccine is a cancer vaccine, preferably, the peptides are independently selected from: i) SEQ ID NO:1-3 and ii) SEQ ID NO:9-11;

[0430] viii) The antigen described has at least 60% or higher (e.g., at least 65%, at least 70%, at least 75%, at least 80%, at least 85%, at least 90%, at least 95%, at least 96%, at least 97%, at least 98%, at least 99%, or 100%) identity with a polypeptide sequence selected from SEQ ID NO:1, SEQ ID NO:2, SEQ ID NO:3, SEQ ID NO:9, SEQ ID NO:10, SEQ ID NO:11; wherein the vaccine is a cancer vaccine;

[0431] ix) The antigen comprises a SPIKE protein of a human pathogenic coronavirus, such as the MERS-CoV SPIKE protein, the SARS-CoV-2 SPIKE protein, or the SARS-CoV-1 SPIKE protein, which has at least 60% or higher (e.g., at least 65%, at least 70%, at least 75%, at least 80%, at least 85%, at least 90%, at least 95%, at least 96%, at least 97%, at least 98%, at least 99%, or 100%) identity with a polypeptide sequence selected from SEQ ID NO:43-46, SEQ ID NO:34-41, SEQ ID NO:48-51, and SEQ ID NO:65; wherein the vaccine is a vaccine against a human pathogenic coronavirus such as MERS-CoV, SARS-CoV-2, or SARS-CoV-1.

[0432] 66. A kit comprising the polymer vesicles, composition, antigen-presenting cells, hybridoma, or vaccine described in any of the preceding items.

[0433] 67. A method for inducing an immune response in a subject (e.g., a human), the method comprising:

[0434] i) Provide the subject with the polymer vesicles, composition, antigen-presenting cells, hybridoma, or vaccine according to any one of the foregoing items.

[0435] ii) administering the polymer vesicles, composition, antigen-presenting cells, hybridoma, or vaccine to the subject, preferably by intradermal, intraperitoneal, intramuscular, subcutaneous, intravenous injection, or non-invasive administration via mucosal surface.

[0436] 68. The method for inducing an immune response according to any one of the preceding items, wherein the immune response is a broad immune response.

[0437] 69. The method for inducing an immune response according to any one of the preceding items, wherein the immune response comprises CD8 (+) T cell-mediated immune responses and / or CD4 (+) T-cell-mediated immune response.

[0438] 70. A method for treating or preventing an infectious disease, cancer, or autoimmune disease in a subject (e.g., a person) in need of such treatment, the method comprising administering to the subject a therapeutically effective amount of any of the preceding items a polymer vesicle, composition, antigen-presenting cell, hybridoma, or vaccine, preferably, the infectious disease being a viral or bacterial infectious disease.

[0439] 71. A method for immunizing non-human animals, the method comprising the following steps:

[0440] i) Provide any of the polymer vesicles, compositions, antigen-presenting cells, hybridomas, or vaccines described in any of the foregoing items;

[0441] ii) Immunize the non-human animals with the polymer vesicles, composition, antigen-presenting cells, hybridomas, or vaccines.

[0442] 72. A method for preparing antibodies, the method comprising:

[0443] i) Immunizing non-human animals with any of the polymer vesicles, compositions, antigen-presenting cells, hybridomas or vaccines described in any of the preceding items;

[0444] ii) Separate the antibody obtained in step (i).

[0445] 73. The method according to any one of the preceding items, wherein the antibody is a monoclonal antibody (mAb).

[0446] 74. The polymer vesicles, compositions, antigen-presenting cells, hybridomas, or vaccines according to any one of the preceding items, used as pharmaceuticals.

[0447] 75. The polymer vesicles, compositions, antigen-presenting cells, hybridomas, or vaccines according to any one of the preceding items, used in one or more of the following methods:

[0448] i) Used in methods for antibody discovery and / or screening and / or preparation;

[0449] ii) Used in methods for vaccine discovery and / or screening and / or preparation;

[0450] iii) Used in methods for producing or preparing immunogenic or immunostimulatory compositions;

[0451] iv) In a method for targeted delivery of proteins and / or peptides, preferably, the targeted delivery is targeted delivery of antigenic proteins and / or peptides according to any one of the foregoing items; more preferably, the antigenic protein and / or peptide comprises a soluble portion of a membrane protein (MP) or membrane-associated peptide (MAP); most preferably, the antigen comprises a soluble portion of influenza hemagglutinin, swine influenza hemagglutinin, ovalbumin (OVA), a SPIKE protein such as the SPIKE protein of porcine epidemic diarrhea virus, a SPIKE protein of human pathogenic coronaviruses such as the SPIKE protein of MERS-CoV, SARS-CoV-2, or SARS-CoV-1, a B16 peptide, or an MC38 peptide; more preferably, the antigen comprises a soluble portion of a protein selected from SEQ ID NO:1, SEQ ID NO:2, SEQ ID NO:3, SEQ ID NO:4, SEQ ID NO:5, SEQ ID NO:6, SEQ ID NO:7, SEQ ID NO:8, SEQ ID NO:9, SEQ ID NO:10, SEQ ID NO:11, SEQ ID NO:12-14, SEQ ID NO:15, SEQ ID NO:16, SEQ ID NO:7, SEQ ID NO:8, SEQ ID NO:9, SEQ ID NO:10, SEQ ID NO:11, SEQ ID NO:12-14, SEQ ID NO:16, SEQ ID NO:17, SEQ ID NO:18, SEQ ID NO:1 ...8, SEQ ID NO:19, SEQ ID NO:10, SEQ ID NO:11, SEQ ID NO:12-1 The polypeptide sequences of SEQ ID NO:43-46, SEQ ID NO:34-41, SEQ ID NO:48-51 and SEQ ID NO:65 have at least 60% or higher (e.g., at least 65%, at least 70%, at least 75%, at least 80%, at least 85%, at least 90%, at least 95%, at least 96%, at least 97%, at least 98%, at least 99% or 100%) identity; more preferably, the targeted delivery is performed in a subject;

[0452] v) In a method for stimulating an immune response to an antigen, preferably, the antigen is any one of the foregoing items; more preferably, the antigen comprises a soluble portion of influenza hemagglutinin, swine influenza hemagglutinin, ovalbumin (OVA), a SPIKE protein such as the SPIKE protein of porcine epidemic diarrhea virus, a SPIKE protein of human pathogenic coronaviruses such as the SPIKE protein of MERS-CoV, SARS-CoV-2, or SARS-CoV-1, a B16 peptide, or an MC38 peptide; more preferably, the antigen is combined with a soluble portion of SEQ ID NO:1, SEQ ID NO:2, SEQ ID NO:3, SEQ ID NO:4, SEQ ID NO:5, SEQ ID NO:6, SEQ ID NO:7, SEQ ID NO:8, SEQ ID NO:9, SEQ ID NO:10, SEQ ID NO:11, SEQ ID NO:12-14, SEQ ID NO:43-46, SEQ ID NO:34-41, SEQ ID NO:48-51, and SEQ ID NO:43-46. The polypeptide sequence of NO:65 has at least 60% or higher (e.g., at least 65%, at least 70%, at least 75%, at least 80%, at least 85%, at least 90%, at least 95%, at least 96%, at least 97%, at least 98%, at least 99%, or 100%) identity; more preferably, it is used to stimulate an immune response to said antigen in a subject;

[0453] vi) Used to trigger CD8 (+) In methods for cross-protection induced by T cell-mediated immune responses, preferably, it is used to trigger cross-protection by CD8. (+)In a method for cross-protection induced by a T-cell-mediated immune response, the immune response is directed against the antigen described in any one of the foregoing items; more preferably, the antigen comprises a soluble portion of influenza hemagglutinin, swine influenza hemagglutinin, ovalbumin (OVA), a SPIKE protein such as the SPIKE protein of porcine epidemic diarrhea virus, a SPIKE protein of a human pathogenic coronavirus such as the SPIKE protein of MERS-CoV, SARS-CoV-2, or SARS-CoV-1, a B16 peptide, or an MC38 peptide; most preferably, the antigen is combined with a soluble portion of SEQ ID NO:1, SEQ ID NO:2, SEQ ID NO:3, SEQ ID NO:4, SEQ ID NO:5, SEQ ID NO:6, SEQ ID NO:7, SEQ ID NO:8, SEQ ID NO:9, SEQ ID NO:10, SEQ ID NO:11, SEQ ID NO:12-14, SEQ ID NO:43-46, SEQ ID NO:34-41, SEQ ID NO:48-51, and SEQ ID NO:43-46. The polypeptide sequence of NO:65 has at least 60% or higher (e.g., at least 65%, at least 70%, at least 75%, at least 80%, at least 85%, at least 90%, at least 95%, at least 96%, at least 97%, at least 98%, at least 99%, or 100%) identity.

[0454] vii) Used in a method of delivering peptides and / or proteins to antigen-presenting cells (APCs) according to any one of the preceding items; preferably, the peptides and / or proteins are antigens according to any one of the preceding items; more preferably, the antigen comprises a soluble portion of influenza hemagglutinin, swine influenza hemagglutinin, ovalbumin (OVA), a SPIKE protein such as the SPIKE protein of porcine epidemic diarrhea virus, a SPIKE protein of human pathogenic coronaviruses such as the SPIKE protein of MERS-CoV, SARS-CoV-2, or SARS-CoV-1, a B16 peptide, or an MC38 peptide; most preferably, the antigen is combined with a soluble portion selected from SEQ ID NO:1, SEQ ID NO:2, SEQ ID NO:3, SEQ ID NO:4, SEQ ID NO:5, SEQ ID NO:6, SEQ ID NO:7, SEQ ID NO:8, SEQ ID NO:9, SEQ ID NO:10, SEQ ID NO:11, SEQ ID NO:12-14, SEQ ID NO:43-46, SEQ ID NO:34-41, SEQ ID NO:48-51 and SEQ ID NO:43-46. The polypeptide sequence of ID NO:65 has at least 60% or higher (e.g., at least 65%, at least 70%, at least 75%, at least 80%, at least 85%, at least 90%, at least 95%, at least 96%, at least 97%, at least 98%, at least 99%, or 100%) identity.

[0455] viii) Used in methods for triggering an immune response, wherein the immune response includes CD8 (+) T cell-mediated immune responses and / or CD4 (+)T cell-mediated immune response; preferably, the response is directed against the antigen described in any one of the foregoing items; more preferably, the antigen comprises influenza hemagglutinin, swine influenza hemagglutinin, ovalbumin (OVA), a SPIKE protein such as the SPIKE protein of porcine epidemic diarrhea virus, a SPIKE protein of human pathogenic coronaviruses such as the SPIKE protein of MERS-CoV, SARS-CoV-2, or SARS-CoV-1, a soluble portion of B16 peptide or MC38 peptide; even more preferably, the response is directed against the antigen, wherein the antigen is combined with a soluble portion selected from SEQ ID NO:1, SEQ ID NO:2, SEQ ID NO:3, SEQ ID NO:4, SEQ ID NO:5, SEQ ID NO:6, SEQ ID NO:7, SEQ ID NO:8, SEQ ID NO:9, SEQ ID NO:10, SEQ ID NO:11, SEQ ID NO:12-14, SEQ ID NO:43-46, SEQ ID NO:34-41, SEQ ID NO:48-51 and SEQ ID NO:43-46. The polypeptide sequence of NO:65 has at least 60% or higher (e.g., at least 65%, at least 70%, at least 75%, at least 80%, at least 85%, at least 90%, at least 95%, at least 96%, at least 97%, at least 98%, at least 99%, or 100%) identity.

[0456] ix) Used in methods for treating, improving, preventing or diagnosing infectious diseases, preferably, the infectious disease being a viral or bacterial infectious disease; more preferably, the viral infectious disease is selected from: influenza virus infection, respiratory syncytial virus infection, and herpes virus infection;

[0457] x) Used in methods for treating, improving, preventing or diagnosing cancer or autoimmune diseases;

[0458] xi) is used in methods for sensitizing cancer cells to chemotherapy;

[0459] xii) Used in methods for inducing apoptosis in cancer cells;

[0460] xiii) Used in methods for stimulating an immune response in subjects;

[0461] xiv) Used in methods for immunizing non-human animals;

[0462] xv) is used in methods for preparing hybridomas;

[0463] xvi) is used in the method according to any one of the preceding items;

[0464] xvii) is used in any of the preceding i)-xvi), wherein the method is an in vivo and / or ex vivo and / or in vitro method;

[0465] xviii) is used in any of the methods according to i)-xvii), wherein the antigen is heterologous to the environment in which the antigen is used.

[0466] 76. The polymer vesicles, compositions, antigen-presenting cells, hybridomas, or vaccines according to any one of the preceding items are used for one or more of the following purposes:

[0467] i) Used for antibody discovery and / or screening and / or preparation;

[0468] ii) Used for vaccine discovery and / or screening and / or preparation;

[0469] iii) Used in the production or preparation of immunogenic or immunostimulatory compositions;

[0470] iv) Targeted delivery of proteins and / or peptides, preferably, the targeted delivery is the targeted delivery of antigenic proteins and / or peptides; more preferably, the targeted delivery is performed in a subject;

[0471] v) Used to stimulate an immune response to an antigen, preferably used to stimulate an immune response to an antigen in a subject;

[0472] vi) is used to trigger CD8 (+) Cross-protection induced by T cell-mediated immune responses;

[0473] vii) for delivering peptides or proteins to antigen-presenting cells (APCs); preferably, the peptide or protein is an antigen, more preferably, the peptide or protein is immunogenic or immunotherapeutic;

[0474] viii) is used to trigger an immune response, which includes CD8 (+) T cell-mediated immune responses and / or CD4 (+) T cell-mediated immune response;

[0475] ix) In a method for treating, improving, preventing or diagnosing an infectious disease, preferably, the infectious disease is a viral or bacterial infectious disease; more preferably, the viral infectious disease is selected from: influenza virus infection, respiratory syncytial virus infection, and herpes virus infection;

[0476] x) Used for the treatment, improvement, prevention, or diagnosis of cancer or autoimmune diseases;

[0477] xi) is used to sensitize cancer cells to chemotherapy;

[0478] xii) is used to induce apoptosis in cancer cells;

[0479] xiii) Used to stimulate an immune response in subjects;

[0480] xiv) is used to immunize non-human animals;

[0481] xv) is used to prepare hybridomas;

[0482] xvi) in the method according to any one of the foregoing items;

[0483] xvii) is used according to any one of i)-xvi), wherein the use is in vivo and / or in vitro and / or extracorporeal use;

[0484] xviii) is used for any of the preceding i)-xvii), wherein the antigen is heterologous to the environment in which the antigen is used.

[0485] 77. A method for inducing an immune response in a subject, the method comprising administering to the subject polymeric vesicles formed from PDMS-PEO carrying an antigen.

[0486] 78. The method according to item 77, wherein the antigen is encapsulated in the PDMS-PEO polymer vesicles.

[0487] 79. The method according to item 78, wherein the antigen encapsulated in the PDMS-PEO polymer vesicles is a soluble antigen.

[0488] 80. The method according to item 79, wherein the antigen is selected from polypeptides, carbohydrates, polynucleotides, and combinations thereof.

[0489] 81. The method according to item 77, wherein the antigen is integrated into the circumferential membrane of the PDMS-PEO polymer vesicle.

[0490] 82. A PDMS-PEO polymer vesicle carrying an antigen.

[0491] 83. The polymer vesicles according to item 82, wherein the antigen is encapsulated in the PDMS-PEO polymer vesicles.

[0492] 84. The polymer vesicles according to item 83, wherein the antigen encapsulated in the PDMS-PEO polymer vesicles is a soluble antigen.

[0493] 85. The polymer vesicles according to item 84, wherein the antigen is selected from polypeptides, carbohydrates, polynucleotides, and combinations thereof.

[0494] 86. The polymer vesicle according to item 85, wherein the antigen is integrated into the circumferential membrane of the PDMS-PEO polymer vesicle.

[0495] 87. The polymer vesicles according to item 86, wherein the antigen is a membrane-associated protein or a lipid antigen.

[0496] 88. The polymer vesicles according to item 87, wherein the membrane-associated protein is selected from transmembrane proteins, G protein-coupled receptors, neurotransmitter receptors, kinases, porins, ABC transporters, ion transporters, acetylcholine receptors, and cell adhesion receptors.

[0497] 89. A pharmaceutical composition comprising any one of items 82 to 88.

[0498] 90. The in vitro and in vivo use of the PDMS-PEO as defined in any one of items 82 to 88 or the pharmaceutical composition described in item 89 for inducing an immune response.

[0499] 91. Use of a polymer vesicle, preferably any one of items 1-50, for inducing an immune response, said polymer vesicle comprising a soluble encapsulated antigen having a diameter of about 120 nm or greater, wherein said soluble encapsulated antigen is selected from:

[0500] i) Polypeptides;

[0501] ii) Carbohydrates;

[0502] iii) Polynucleotides, preferably not antisense oligonucleotides, more preferably, the polynucleotides are DNA or mRNA molecules; or

[0503] Combinations of iv)i) and / or ii) and / or iii).

[0504] 92. According to the use described in item 91, the diameter of said polymer vesicle is in the range of about 120 nm to about 1 μm, or about 140 nm to about 750 nm, or about 120 nm to about 500 nm, or about 140 nm to about 250 nm, about 120 nm to about 240 nm, about 150 nm to about 235 nm, about 170 nm to about 230 nm, or about 220 nm to about 180 nm, or about 190 nm to about 210 nm.

[0505] 93. Use of an aggregate of polymeric vesicles, preferably an aggregate of polymeric vesicles as described in any one of items 1 to 50, for inducing an immune response, wherein the polymeric vesicles have an average diameter of about 120 nm or greater, and the aggregate of polymeric vesicles contains a soluble encapsulated antigen, wherein the soluble encapsulated antigen is selected from:

[0506] i) Polypeptides;

[0507] ii) Carbohydrates;

[0508] iii) Polynucleotides, preferably not antisense oligonucleotides, more preferably, the polynucleotides are DNA or mRNA molecules; or

[0509] Combinations of iv)i) and / or ii) and / or iii).

[0510] 94. According to the use described in item 93, the average diameter of the aggregate of said polymer vesicles is in the range of about 120 nm to about 1 μm, or about 120 nm to about 750 nm, or about 120 nm to about 500 nm, or about 120 nm to about 250 nm, about 120 nm to about 240 nm, about 150 nm to about 235 nm, about 170 nm to about 230 nm, or about 220 nm to about 180 nm, or about 190 nm to about 210 nm.

[0511] 95. The use of any one of items 91 to 94, wherein the subject is vaccinated against a viral infection.

[0512] 96. Use of any one of items 91 to 95, wherein the polymer vesicle or collection of polymer vesicles is administered via a route of administration selected from: oral administration, intranasal administration, application to a mucosal surface, inhalation, intradermal administration, intraperitoneal administration, subcutaneous administration, intravenous administration, and intramuscular administration.

[0513] 97. The use according to any one of items 91 to 96, wherein the subject is a mammal, including humans or non-mammals.

[0514] 98. As described in item 97, wherein the subject is a mammal and is vaccinated against a disease selected from cancer, viral infection and bacterial infection.

[0515] 99. As described in item 98, wherein the subject is a human being vaccinated against coronavirus infection.

[0516] 100. As described in item 99, wherein the coronavirus is pathogenic to humans.

[0517] 101. As described in item 99 or 100, wherein the coronavirus is a beta-coronavirus.

[0518] 102. The use according to any one of items 99-101, wherein the coronavirus is Sarbecovirus or Merbecovirus.

[0519] 103, 20. The use as described in item 99, wherein the coronavirus is MERS-CoV, SARS-CoV-2 or SARS-CoV-1.

[0520] 104. As described in Item 97, wherein the subject is a non-mammal and is vaccinated against a disease selected from viral and bacterial infections.

[0521] 105. According to the use described in item 104, the non-mammal is a bird (such as poultry, such as chicken, duck, goose or turkey), a fish or a crustacean.

[0522] 106. According to the use described in item 105, the bird is a chicken, duck, goose or turkey.

[0523] 107. As described in item 105, the fish is salmon, trout or tilapia.

[0524] 108. According to the use described in item 105, the crustacean is shrimp, prawn, or crab.

[0525] 109. According to the use described in item 97, the mammal is a goat, sheep, cow or pig.

[0526] 110. According to the use described in item 109, wherein the animal is a pig and the animal is vaccinated against porcine epidemic diarrhea virus.

[0527] 111. According to the use described in item 109, the animal is an ungulate and is vaccinated against foot-and-mouth disease virus.

[0528] The invention is further characterized by the following embodiments.

[0529] 1. A method for inducing an immune response in a subject by administering an antigen and an adjuvant, wherein the antigen is associated with a first polymeric vesicle group, and wherein the adjuvant is associated with a second polymeric vesicle group, and wherein both polymeric vesicle groups are administered to the subject.

[0530] 2. The method according to embodiment 1, wherein the antigen is associated with the first polymer vesicle group by encapsulating the antigen in the first polymer vesicle group, by integrating the antigen into the circumferential membrane of the polymer vesicles of the first polymer vesicle group, by covalently attaching the antigen to the outer surface of the polymer vesicles and / or by non-covalently attaching the antigen to the outer surface of the polymer vesicles.

[0531] 3. The method according to embodiment 1 or 2, wherein the adjuvant is associated with the second polymer vesicle group by encapsulating the adjuvant in the second polymer vesicle group, by integrating the adjuvant into the circumferential membrane of the polymer vesicles of the second polymer vesicle group, by covalently attaching the adjuvant to the outer surface of the polymer vesicles, and / or by non-covalently attaching the adjuvant to the outer surface of the polymer vesicles.

[0532] 4. The method according to embodiment 2 or 3, wherein the first polymer vesicle group has an antigen encapsulated within the polymer vesicles, and the second polymer vesicle group has an adjuvant encapsulated within the polymer vesicles.

[0533] 5. The method according to embodiment 2 or 3, wherein the first polymer vesicle group has an antigen covalently or non-covalently bonded to the outer surface of the polymer vesicle, and wherein the second polymer vesicle group has an adjuvant covalently or non-covalently bonded to the outer surface of the polymer vesicle.

[0534] 6. The method according to embodiment 2 or 3, wherein the first polymer vesicle group has an antigen integrated into the circumferential membrane of the polymer vesicle, and wherein the second polymer vesicle group has an adjuvant integrated into the circumferential membrane of the polymer.

[0535] 7. The method according to embodiment 2 or 3, wherein the first polymer vesicle group has an antigen encapsulated within the polymer vesicles, and the second polymer vesicle group has an adjuvant covalently bonded to the outer surface of the polymer vesicles.

[0536] 8. The method according to embodiment 2 or 3, wherein the first polymer vesicle group has an antigen covalently bonded to the outer surface of the polymer vesicle, and the second polymer vesicle group has an adjuvant encapsulated within the polymer vesicle.

[0537] 9. The method according to any one of the foregoing embodiments, wherein the first polymer vesicle cluster and the second polymer vesicle cluster are applied to the subject simultaneously (at the same time) or at different times.

[0538] 10. The method according to embodiment 9, wherein simultaneous application of the first polymer vesicle group and the second polymer vesicle group includes applying both polymer vesicle groups together (co-application) or applying each of the two polymer vesicle groups separately.

[0539] 11. The method according to any one of the foregoing embodiments, wherein the two polymer vesicle groups are prepared separately.

[0540] 12. The method according to embodiment 11, wherein the two polymer vesicle groups are mixed together before application.

[0541] 13. The method according to any one of embodiments 1 to 12, wherein the two polymer vesicle groups are administered via an administration route selected from the following: oral administration, intranasal administration, application to a mucosal surface, inhalation, intradermal administration, intraperitoneal administration, subcutaneous administration, intravenous administration, and intramuscular administration.

[0542] 14. The method according to any one of the foregoing embodiments, wherein the subject is a mammal, including humans or non-mammals.

[0543] 15. The method according to embodiment 14, wherein the subject is a mammal and is vaccinated against a disease selected from cancer, viral infection and bacterial infection.

[0544] 16. The method according to implementation plan 15, wherein the subject is a human being vaccinated against coronavirus infection.

[0545] 17. The method according to implementation scheme 16, wherein the coronavirus is pathogenic to humans.

[0546] 18. The method according to implementation scheme 16 or 17, wherein the coronavirus is a β-coronavirus.

[0547] 19. The method according to any one of embodiments 16-18, wherein the coronavirus is Sarbecovirus or Merbecovirus.

[0548] 20. The method according to embodiment 19, wherein the coronavirus is MERS-CoV, SARS-CoV-2, or SARS-CoV-1.

[0549] 21. The method according to embodiment 14, wherein the subject is a non-mammal and is vaccinated against a disease selected from viral and bacterial infections.

[0550] 22. The method according to embodiment 21, wherein the non-mammal is a bird (such as poultry, such as a chicken, duck, goose or turkey), a fish or a crustacean.

[0551] 23. The method according to implementation scheme 21, wherein the bird is a chicken, duck, goose or turkey.

[0552] 24. The method according to embodiment 21, wherein the fish is salmon, trout or tilapia.

[0553] 25. The method according to implementation scheme 1621, wherein the crustacean is a shrimp, prawn, or crab.

[0554] 26. The method according to embodiment 14, wherein the mammal is a goat, sheep, cow or pig.

[0555] 27. The method according to embodiment 26, wherein the animal is a pig and the animal is vaccinated against porcine epidemic diarrhea virus.

[0556] 28. The method according to embodiment 26, wherein the animal is an ungulate and the animal is vaccinated against foot-and-mouth disease virus.

[0557] 29. The method according to any one of the foregoing embodiments, wherein the encapsulating antigen is a soluble antigen or a solubilized antigen.

[0558] 30. The method according to any one of the foregoing embodiments, wherein the antigen, preferably the soluble antigen or the solubilized encapsulating antigen, is selected from:

[0559] i) Polypeptides;

[0560] ii) Carbohydrates;

[0561] iii) Polynucleotide, preferably, the polynucleotide is not an antisense oligonucleotide, preferably, the polynucleotide is a DNA or mRNA molecule;

[0562] Combinations of iv)i) and / or ii) and / or iii).

[0563] 31. The method according to embodiment 14, wherein the first polymer vesicle group and / or the second polymer vesicle group are oxidically stable polymer vesicles containing soluble encapsulating antigens or encapsulating adjuvants, or wherein the first polymer vesicle group and / or the second polymer vesicle group are oxidically sensitive polymer vesicles containing soluble encapsulating antigens or encapsulating adjuvants.

[0564] 32. The method according to any one of the foregoing embodiments, wherein the amide moiety; and / or ii) the secondary amine moiety; and / or iii) the 1,2,3-triazole moiety, preferably, the 1,2,3-triazole moiety is a 1,4-disubstituted [1,2,3]triazole moiety or a 1,5-disubstituted [1,2,3]triazole moiety; and / or iv) the pyrazoline moiety; and / or vi) the ester moiety; vii) the carbamate and / or carbonate moiety.

[0565] 33. The method according to embodiment 32, wherein a covalent bond is formed to attach the antigen or adjuvant to the outer surface of the first and / or second polymer vesicle group by reacting a reactive group present on the outer surface of the polymer vesicle with a reactive group of the antigen or adjuvant.

[0566] 34. The method according to embodiment 33, wherein the covalent bond is selected from: i) a formamide bond; ii) a 1,4-disubstituted [1,2,3]triazole moiety or a 1,5-disubstituted [1,2,3]triazole moiety; iii) a substituted pyrazoline bond.

[0567] 35. The method according to embodiment 34, wherein: i) the reactive group present on the outer surface of the polymer vesicle is an aldehyde group and the reactive group of the antigen or adjuvant is an amino group, thereby forming a formamide group; or ii) the reactive group present on the outer surface of the polymer vesicle is an alkyne group and the reactive group of the antigen or adjuvant is an azide group, thereby forming a 1,2,3-triazole group, preferably via a copper or ruthenium-catalyzed azide-alkyne cycloaddition, more preferably, the 1,2,3-triazole is 1,4-disubstituted or 1,5-disubstituted; or iii) the reactive group present on the outer surface of the polymer vesicle is a methacrylate- and / or hydroxyl group and the reactive group of the antigen or adjuvant is a tetrazolium group, thereby forming the pyrazoline group, preferably, the formation of the pyrazoline group includes a nitrile imine intermediate.

[0568] 36. The method according to embodiment 35, wherein the formamide bond has been further reacted with a reducing agent to form a secondary amine.

[0569] 37. The method according to any one of embodiments 32 to 36, wherein the covalent bond is formed via a connector portion.

[0570] 38. The method according to embodiment 37, wherein the linker portion L is a peptide linker or a linear or branched hydrocarbon-based linker.

[0571] 39. The method according to embodiment 37 or 38, wherein the linker portion comprises 1 to about 550 main chain atoms, 1 to about 500 main chain atoms, 1 to about 450 main chain atoms, 1 to about 350 main chain atoms, 1 to about 300 main chain atoms, 1 to about 250 main chain atoms, 1 to about 200 main chain atoms, 1 to about 150 main chain atoms, 1 to about 100 main chain atoms, 1 to about 50 main chain atoms, 1 to about 30 main chain atoms, 1 to about 20 main chain atoms, 1 to about 15 main chain atoms, or 1 to about 12 main chain atoms, or 1 to about 10 main chain atoms, wherein the main chain atoms are carbon atoms optionally replaced by one or more heteroatoms selected from N, O, P and S.

[0572] 40. The method according to any one of embodiments 37 to 39, wherein the connector portion includes a membrane anchoring domain that integrates the connector portion into the membrane of the polymer vesicle.

[0573] 41. The method according to embodiment 40, wherein the membrane anchoring domain comprises lipids.

[0574] 42. The method according to embodiment 41, wherein the lipid is a phospholipid or a glycolipid.

[0575] 43. The method according to embodiment 42, wherein the glycolipid comprises glycosylphosphatidylinositol (GPI).

[0576] 44. The method according to embodiment 42, wherein the phospholipid is sphingomyelin or glycerophospholipid.

[0577] 45. The method according to embodiment 44, wherein the sphingomyelin comprises distearate phosphatidylethanolamine [DSPE] (DSPE-PEG) conjugated with polyethylene glycol (PEG) or a cholesterol-based conjugate.

[0578] 46. ​​The method according to embodiment 45, wherein the DSPE-PEG comprises 2 to about 500 ethylene oxide units.

[0579] 47. The method according to any one of embodiments 32 to 46, wherein the linker is non-hydrolyzable and / or non-oxidizable under physiological conditions.

[0580] 48. The method according to any one of embodiments 2 to 47, wherein the antigen integrated into the circumferential membrane of the polymer vesicle is a membrane-associated protein or a lipid antigen.

[0581] 49. The method according to embodiment 48, wherein the membrane-associated protein comprises an extracellular segment or domain of a transmembrane protein.

[0582] 50. The method according to embodiment 48 or 49, wherein the membrane-associated protein is a transmembrane protein, a G protein-coupled receptor, a neurotransmitter receptor, a kinase, a porin, an ABC transporter, an ion transporter, an acetylcholine receptor, or a cell adhesion receptor.

[0583] 51. The method according to any one of embodiments 48 to 50, wherein the lipid antigen is a synthetic lipid or a natural lipid.

[0584] 52. The method according to any one of embodiments 2 to 51, wherein the non-covalent bonds for conjugating the antigen and / or the adjuvant to the outer surface of the polymer vesicles of the first polymer vesicle group and / or the second polymer vesicle group comprise binding pairs selected from: streptavidin and biotin, avidin and biotin, streptavidin and streptavidin-binding peptide, and avidin and avidin-binding peptide, or the non-covalent bonds are electrostatic interactions.

[0585] 53. The method according to any one of embodiments 1 to 52, wherein the first polymer vesicle group and the second polymer vesicle group comprise the same at least one amphiphilic polymer or are formed from the same at least one amphiphilic polymer.

[0586] 54. The method according to any one of embodiments 1 to 52, wherein the first polymer vesicle group and the second polymer vesicle group comprise at least one different amphiphilic polymer or are formed from at least one different amphiphilic polymer.

[0587] 55. The method according to any one of the foregoing embodiments, wherein the first and / or second polymer group is oxidically stable.

[0588] 56. The method according to any one of the foregoing embodiments, wherein the application of the first polymer vesicle group and / or the second polymer vesicle group is capable of triggering CD8. (+) T cell-mediated immune responses, preferably, are initiated in vivo, in vitro, or ex vivo.

[0589] 57. The method according to any one of the foregoing embodiments, wherein the encapsulating antigen comprises a soluble portion of a membrane protein (MP) or a membrane-associated peptide (MAP), preferably, the antigen comprises a soluble portion of influenza hemagglutinin, swine influenza hemagglutinin, a SPIKE protein such as the SPIKE protein of porcine epidemic diarrhea virus, a SPIKE protein such as the SPIKE protein of MERS-CoV, the SPIKE protein of SARS-CoV-2, or the SPIKE protein of SARS-CoV-1, an ovalbumin (OVA), a B16 peptide, or an MC38 peptide, more preferably, the antigen comprises a polypeptide, the polypeptide being combined with a soluble portion selected from SEQ ID NO:1, SEQ ID NO:2, SEQ ID NO:3, SEQ ID NO:4, SEQ ID NO:5, SEQ ID NO:6, SEQ ID NO:7, SEQ ID NO:8, SEQ ID NO:9, SEQ ID NO:10, SEQ ID NO:11, SEQ ID NO:12, SEQ ID NO:13, SEQ ID NO:14, SEQ ID NO:43-46, and SEQ ID NO:34-41, SEQ ID NO:43-46, and SEQ ID NO:44-46, SEQ ID NO:45, SEQ ID NO:16, SEQ ID NO:46, SEQ ID NO:47, SEQ ID NO:8, SEQ ID NO:9, SEQ ID NO:10, SEQ ID NO:11, SEQ ID NO:12, SEQ ID NO:13, SEQ ID NO:14, SEQ ID NO:43-46, and SEQ ID NO:34-41, SEQ ID NO:46, SEQ ID NO:47, SEQ ID NO:48, SEQ ID NO:9, SEQ ID NO:10, SEQ ID NO:11, SEQ ID NO:12, SEQ ID NO:13, SEQ ID NO:14, SEQ ID NO:4 The polypeptide sequences of NO:48-51 and SEQ ID NO:65 have at least 60% or higher (e.g., at least 65%, at least 70%, at least 75%, at least 80%, at least 85%, at least 90%, at least 95%, at least 96%, at least 97%, at least 98%, at least 99%, or 100%) identity.

[0590] 58. The method according to any one of the foregoing embodiments, wherein the encapsulating antigen comprises a fragment of a viral SPIKE protein, wherein the fragment comprises the S1 portion of the SPIKE protein, the S2 portion of the SPIKE protein, a combination of the S1 and S2 portions of the SPIKE protein, a receptor-binding domain (RBD) of the SPIKE protein, or a combination thereof, substantially consisting of or consisting of thereof. 59. The method according to any one of the foregoing embodiments, wherein the first and / or second polymeric vesicle groups are oxidatively stable in the presence of serum components, preferably, the oxidative stability is in vivo, in vitro, or extracorporeal oxidative stability.

[0591] 60. The method according to any one of the foregoing embodiments, wherein the first and / or second polymer vesicle groups are stable within the endosome, preferably, the stability is in vivo, in vitro, or ex vivo.

[0592] 61. The method according to any one of the foregoing embodiments, wherein the first and / or second polymer vesicle groups have improved oxidative stability compared to the corresponding oxidative stability of liposomes, preferably, the improved stability is in vivo, in vitro or extracorporeal improved stability.

[0593] 62. The method according to any one of the foregoing embodiments, wherein the first and / or second polymeric vesicle clusters are capable of releasing their contents containing the soluble encapsulated antigen in an oxidation-independent manner and triggering CD8. (+) T cell-mediated immune response, preferably, the release is in vivo, in vitro or ex vivo.

[0594] 63. The method according to any one of the foregoing embodiments, wherein the first and / or second polymer vesicle clusters are capable of inducing a cellular immune response, wherein the cellular immune response comprises CD8 (+) T cell-mediated immune response, preferably, is an in vivo, in vitro, or ex vivo immune response.

[0595] 64. The method according to any one of the foregoing embodiments, wherein the first and / or second polymer vesicle clusters are capable of inducing cellular and / or humoral immune responses, wherein the cellular immune response comprises CD8 (+) T cell-mediated immune response, preferably an in vivo, in vitro, or ex vivo immune response.

[0596] 65. The method according to embodiment 64, wherein the humoral immune response includes the production of specific antibodies, and more preferably, the immune response is an in vivo, in vitro, or ex vivo immune response.

[0597] 66. The method according to any one of the foregoing embodiments, wherein the first and / or second polymer vesicle clusters are capable of enhancing the CD4 effect. (+) The frequency of T cells, preferably, is enhanced in vivo, in vitro, or ex vivo.

[0598] 67. The method according to embodiment 64, wherein the cellular immune response includes a T cell-mediated immune response, preferably, the immune response is an in vivo, in vitro, or ex vivo immune response.

[0599] 68. The method according to any one of the foregoing embodiments, wherein the first and / or second polymeric vesicle clusters are capable of enhancing antigen specificity CD8 compared to free antigen. (+) Clonal expansion of T cells, preferably, is in vivo, in vitro, or ex vivo expansion.

[0600] 69. The method according to any one of the foregoing embodiments, wherein the first and / or second polymeric vesicle clusters are capable of inducing an antigen-specific effect CD8. (+) T cells, preferably, are induced in vivo, in vitro, or outside the body.

[0601] 70. The method according to any one of the foregoing embodiments, wherein the first and / or second polymeric vesicle clusters are capable of enhancing antigen-specific CD8. (+) The cytotoxic phenotype of T cells, preferably, is enhanced in vivo, in vitro, or ex vivo.

[0602] 71. The method according to any one of the foregoing embodiments, wherein the first and / or second polymer vesicle groups are capable of targeting lymph node-resident macrophages and / or B cells, preferably, the targeting is in vivo, in vitro or ex vivo targeting.

[0603] 72. The method according to any one of the foregoing embodiments, wherein the first and / or second polymer vesicle groups are reductively stable, preferably, the first and / or second polymer vesicle groups are reductively stable in the presence of serum components, and more preferably, the reductive stability is in vivo, in vitro or in vitro reductively stable.

[0604] 73. The method according to any one of the foregoing embodiments, wherein the first and / or second polymer vesicle clusters have reduced permeability, preferably, the reduced permeability is compared with the corresponding permeability of liposomes, and more preferably, the permeability is in vivo, in vitro, or extracorporeal permeability.

[0605] 74. The method according to any one of the foregoing embodiments, wherein the first and / or second polymer vesicle clusters are capable of releasing their contents within the endosome, preferably, the endosome is a late endosome, and more preferably, the release is in vivo, ex vivo, or in vitro.

[0606] 75. The method according to any one of the foregoing embodiments, wherein the first and / or second polymer vesicle groups are capable of performing one or more of the following:

[0607] i) Inducing a cellular immune response; preferably, the cellular immune response includes CD8. (+) T cell-mediated immune response; more preferably, the cellular immune response is CD8. (+)T cell-mediated immune response; most preferably, the cellular immune response targets influenza hemagglutinin, swine influenza hemagglutinin, SPIKE protein such as porcine epidemic diarrhea virus SPIKE protein, SPIKE protein of human pathogenic coronavirus such as MERS-CoV SPIKE protein, SARS-CoV-2 SPIKE protein or SARS-CoV-1 SPIKE protein, ovalbumin (OVA), B16 peptide or MC38 peptide, and more preferably, the cellular immune response targets a polypeptide, the polypeptide being selected from SEQ ID NO:1, SEQ ID NO:2, SEQ ID NO:3, SEQ ID NO:4, SEQ ID NO:5, SEQ ID NO:6, SEQ ID NO:7, SEQ ID NO:8, SEQ ID NO:9, SEQ ID NO:10, SEQ ID NO:11, SEQ ID NO:12-14, SEQ ID NO:43-46, SEQ ID NO:34-41, SEQ ID NO:48-51 and SEQ ID NO:43-46. The polypeptide sequence of NO:65 has at least 60% or higher (e.g., at least 65%, at least 70%, at least 75%, at least 80%, at least 85%, at least 90%, at least 95%, at least 96%, at least 97%, at least 98%, at least 99%, or 100%) identity.

[0608] ii) Releasing polymeric vesicle contents within an endosome, preferably a late endosome; more preferably, the contents comprise influenza hemagglutinin, swine influenza hemagglutinin, a SPIKE protein such as that of porcine epidemic diarrhea virus, a SPIKE protein of human pathogenic coronaviruses such as that of MERS-CoV, SARS-CoV-2, or SARS-CoV-1, ovalbumin (OVA), a soluble portion of B16 peptide or MC38 peptide; most preferably, the contents comprise a polypeptide, the polypeptide being combined with a portion selected from SEQ ID NO:1, SEQ ID NO:2, SEQ ID NO:3, SEQ ID NO:4, SEQ ID NO:5, SEQ ID NO:6, SEQ ID NO:7, SEQ ID NO:8, SEQ ID NO:9, SEQ ID NO:10, SEQ ID NO:11, SEQ ID NO:12-14, SEQ ID NO:43-46, SEQ ID NO:34-41, SEQ ID NO:48-51 and SEQ ID NO:43-46. The polypeptide sequence of NO:65 has at least 60% or higher (e.g., at least 65%, at least 70%, at least 75%, at least 80%, at least 85%, at least 90%, at least 95%, at least 96%, at least 97%, at least 98%, at least 99%, or 100%) identity.

[0609] iii) Release of polymeric vesicle contents in an oxidation-independent manner and trigger CD8 (+)T cell-mediated immune response; preferably, the contents comprise influenza hemagglutinin, swine influenza hemagglutinin, SPIKE protein such as porcine epidemic diarrhea virus SPIKE protein, SPIKE protein of human pathogenic coronavirus such as MERS-CoV SPIKE protein, SARS-CoV-2 SPIKE protein or SARS-CoV-1 SPIKE protein, ovalbumin (OVA), B16 peptide or MC38 peptide, more preferably, the contents comprise a polypeptide, the polypeptide being combined with a peptide selected from SEQ ID NO:1, SEQ ID NO:2, SEQ ID NO:3, SEQ ID NO:4, SEQ ID NO:5, SEQ ID NO:6, SEQ ID NO:7, SEQ ID NO:8, SEQ ID NO:9, SEQ ID NO:10, SEQ ID NO:11, SEQ ID NO:12-14, SEQ ID NO:43-46, SEQ ID NO:34-41, SEQ ID NO:48-51 and SEQ ID NO:43-46. The polypeptide sequence of NO:65 has at least 60% or higher (e.g., at least 65%, at least 70%, at least 75%, at least 80%, at least 85%, at least 90%, at least 95%, at least 96%, at least 97%, at least 98%, at least 99%, or 100%) identity.

[0610] iv) Stimulate an immune response to the antigen; preferably, the antigen comprises a soluble portion of influenza hemagglutinin, swine influenza hemagglutinin, a SPIKE protein such as the SPIKE protein of porcine epidemic diarrhea virus, a SPIKE protein of human pathogenic coronaviruses such as the SPIKE protein of MERS-CoV, SARS-CoV-2, or SARS-CoV-1, ovalbumin (OVA), B16 peptide, or MC38 peptide; more preferably, the antigen comprises a polypeptide, the polypeptide being combined with a protein selected from SEQ ID NO:1, SEQ ID NO:2, SEQ ID NO:3, SEQ ID NO:4, SEQ ID NO:5, SEQ ID NO:6, SEQ ID NO:7, SEQ ID NO:8, SEQ ID NO:9, SEQ ID NO:10, SEQ ID NO:11, SEQ ID NO:12-14, SEQ ID NO:43-46, SEQ ID NO:34-41, SEQ ID NO:48-51, and SEQ ID NO:43-46. The polypeptide sequence of NO:65 has at least 60% or higher (e.g., at least 65%, at least 70%, at least 75%, at least 80%, at least 85%, at least 90%, at least 95%, at least 96%, at least 97%, at least 98%, at least 99%, or 100%) identity.

[0611] v) Triggered by CD8 (+) Cross-protection induced by T cell-mediated immune response; preferably, the response is against a soluble fraction of influenza hemagglutinin, swine influenza hemagglutinin, SPIKE protein such as porcine epidemic diarrhea virus SPIKE protein, ovalbumin (OVA), B16 peptide, or MC38 peptide; more preferably, the response is against a polypeptide, the polypeptide being selected from SEQ ID NO:1, SEQ ID NO:2, SEQ ID NO:3, SEQ ID NO:4, SEQ ID NO:5, SEQ ID NO:6, SEQ ID NO:7, SEQ ID NO:8, SEQ ID NO:9, SEQ ID NO:10, SEQ ID NO:11, SEQ ID NO:12, 13 and 14, SEQ ID NO:43-46, SEQ ID NO:34-41, SEQ ID NO:48-51, and SEQ ID NO:14. The polypeptide sequence of NO:65 has at least 60% or higher (e.g., at least 65%, at least 70%, at least 75%, at least 80%, at least 85%, at least 90%, at least 95%, at least 96%, at least 97%, at least 98%, at least 99%, or 100%) identity.

[0612] vi) Delivering a peptide or protein to antigen-presenting cells (APCs); preferably, the peptide or protein comprises or is derived from influenza hemagglutinin, swine influenza hemagglutinin, a SPIKE protein such as the SPIKE protein of porcine epidemic diarrhea virus, a SPIKE protein of human pathogenic coronaviruses such as the SPIKE protein of MERS-CoV, SARS-CoV-2, or SARS-CoV-1, ovalbumin (OVA), B16 peptide, or MC38 peptide; more preferably, the peptide or protein comprises or is derived from a polypeptide, the polypeptide being combined with a portion selected from SEQ ID NO:1, SEQ ID NO:2, SEQ ID NO:3, SEQ ID NO:4, SEQ ID NO:5, SEQ ID NO:6, SEQ ID NO:7, SEQ ID NO:8, SEQ ID NO:9, SEQ ID NO:10, SEQ ID NO:11, SEQ ID NO:12, 13 and 14, SEQ ID NO:43-46, SEQ ID NO:34-41, SEQ ID NO:48-51 and SEQ ID NO:14. The polypeptide sequence of NO:65 has at least 60% or higher (e.g., at least 65%, at least 70%, at least 75%, at least 80%, at least 85%, at least 90%, at least 95%, at least 96%, at least 97%, at least 98%, at least 99%, or 100%) identity.

[0613] vii) Triggering an immune response, which includes CD8 (+) T cell-mediated immune responses and / or CD4 (+)T-cell-mediated immune response; preferably, the response targets influenza hemagglutinin, swine influenza hemagglutinin, ovalbumin (OVA), SPIKE protein such as porcine epidemic diarrhea virus SPIKE protein, SPIKE protein of human pathogenic coronavirus such as MERS-CoV SPIKE protein, SARS-CoV-2 SPIKE protein or SARS-CoV-1 SPIKE protein, B16 peptide or MC38 peptide, more preferably, the response targets a polypeptide, the polypeptide being combined with a soluble portion selected from SEQ ID NO:1, SEQ ID NO:2, SEQ ID NO:3, SEQ ID NO:4, SEQ ID NO:5, SEQ ID NO:6, SEQ ID NO:7, SEQ ID NO:8, SEQ ID NO:9, SEQ ID NO:10, SEQ ID NO:11, SEQ ID NO:12, 13 and 14, SEQ ID NO:43-46, SEQ ID NO:34-41, SEQ ID NO:48-51 and SEQ ID NO:14. The polypeptide sequence of NO:65 has at least 60% or higher (e.g., at least 65%, at least 70%, at least 75%, at least 80%, at least 85%, at least 90%, at least 95%, at least 96%, at least 97%, at least 98%, at least 99%, or 100%) identity.

[0614] viii) Stimulating an immune response in a subject; preferably, the response is directed against influenza hemagglutinin, swine influenza hemagglutinin, SPIKE protein such as swine epidemic diarrhea virus SPIKE protein, SPIKE protein of human pathogenic coronavirus such as MERS-CoV SPIKE protein, SARS-CoV-2 SPIKE protein or SARS-CoV-1 SPIKE protein, ovalbumin (OVA), B16 peptide or MC38 peptide, more preferably, the response is directed against a polypeptide, the polypeptide being selected from SEQ ID NO:1, SEQ ID NO:2, SEQ ID NO:3, SEQ ID NO:4, SEQ ID NO:5, SEQ ID NO:6, SEQ ID NO:7, SEQ ID NO:8, SEQ ID NO:9, SEQ ID NO:10, SEQ ID NO:11, SEQ ID NO:12, 13 and 14, SEQ ID NO:43-46, SEQ ID NO:34-41, SEQ ID NO:48-51 and SEQ ID NO:14. The polypeptide sequence of NO:65 has at least 60% or higher (e.g., at least 65%, at least 70%, at least 75%, at least 80%, at least 85%, at least 90%, at least 95%, at least 96%, at least 97%, at least 98%, at least 99%, or 100%) identity.

[0615] ix) Immunizing non-human animals; preferably, the immunization is against a soluble portion of influenza hemagglutinin, swine influenza hemagglutinin, a SPIKE protein such as the SPIKE protein of porcine epidemic diarrhea virus, a SPIKE protein of human pathogenic coronaviruses such as the SPIKE protein of MERS-CoV, SARS-CoV-2, or SARS-CoV-1, ovalbumin (OVA), B16 peptide, or MC38 peptide; more preferably, the immunization is against a polypeptide, the polypeptide being combined with a protein selected from SEQ ID NO:1, SEQ ID NO:2, SEQ ID NO:3, SEQ ID NO:4, SEQ ID NO:5, SEQ ID NO:6, SEQ ID NO:7, SEQ ID NO:8, SEQ ID NO:9, SEQ ID NO:10, SEQ ID NO:11, SEQ ID NO:12, SEQ ID NO:13, SEQ ID NO:14, SEQ ID NO:43-46, SEQ ID NO:34-41, SEQ ID NO:48-51, and SEQ ID NO:43-46, SEQ ID NO:34-41, SEQ ID NO:48-51, and SEQ ID NO:43-46. The polypeptide sequence of NO:65 has at least 60% or higher (e.g., at least 65%, at least 70%, at least 75%, at least 80%, at least 85%, at least 90%, at least 95%, at least 96%, at least 97%, at least 98%, at least 99%, or 100%) identity.

[0616] x) The first and / or second polymer vesicle groups have altered antigenicity compared to the corresponding antigenicity of the antigen without the polymer vesicles; preferably, the antigen is an influenza hemagglutinin, swine influenza hemagglutinin, a SPIKE protein such as the SPIKE protein of swine epidemic diarrhea virus, a SPIKE protein of human pathogenic coronaviruses such as the SPIKE protein of MERS-CoV, SARS-CoV-2, or SARS-CoV-1, ovalbumin (OVA), a soluble portion of B16 peptide or MC38 peptide; more preferably, the antigen is a polypeptide, the polypeptide being combined with a protein selected from SEQ ID NO:1, SEQ ID NO:2, SEQ ID NO:3, SEQ ID NO:4, SEQ ID NO:5, SEQ ID NO:6, SEQ ID NO:7, SEQ ID NO:8, SEQ ID NO:9, SEQ ID NO:10, SEQ ID NO:11, SEQ ID NO:12, 13 and 14, SEQ ID NO:43-46, SEQ ID NO:34-41, SEQ ID NO:48-51 and ... The polypeptide sequence of ID NO:65 has at least 60% or higher (e.g., at least 65%, at least 70%, at least 75%, at least 80%, at least 85%, at least 90%, at least 95%, at least 96%, at least 97%, at least 98%, at least 99%, or 100%) identity.

[0617] xi) The first and / or second polymer vesicle groups have altered immunogenicity compared to the corresponding immunogenicity of the antigen without the polymer vesicles; preferably, the immunogen is influenza hemagglutinin, swine influenza hemagglutinin, a SPIKE protein such as the SPIKE protein of porcine epidemic diarrhea virus, a SPIKE protein of human pathogenic coronavirus such as the SPIKE protein of MERS-CoV, SARS-CoV-2, or SARS-CoV-1, ovalbumin (OVA), a soluble portion of B16 peptide or MC38 peptide; more preferably, the immunogen is a polypeptide, the polypeptide being combined with a protein selected from SEQ ID NO:1, SEQ ID NO:2, SEQ ID NO:3, SEQ ID NO:4, SEQ ID NO:5, SEQ ID NO:6, SEQ ID NO:7, SEQ ID NO:8, SEQ ID NO:9, SEQ ID NO:10, SEQ ID NO:11, SEQ ID NO:12, SEQ ID NO:13, SEQ ID NO:14, SEQ ID NO:43-46, SEQ ID NO:15, SEQ ID NO:16, SEQ ID NO:17, SEQ ID NO:8, SEQ ID NO:9, SEQ ID NO:10, SEQ ID NO:11, SEQ ID NO:12, SEQ ID NO:13, SEQ ID NO:14, SEQ ID NO:43-46, SEQ ID NO:17, SEQ ID NO:18, SEQ ID NO:19, SEQ ID NO:10, SEQ ID NO:11, SEQ ID NO:12, SEQ ID NO:13, SEQ ID NO:14, SEQ ID NO:43-46 ... The polypeptide sequences of NO:34-41, SEQ ID NO:48-51 and SEQ ID NO:65 have at least 60% or higher (e.g., at least 65%, at least 70%, at least 75%, at least 80%, at least 85%, at least 90%, at least 95%, at least 96%, at least 97%, at least 98%, at least 99% or 100%) identity.

[0618] 76. The method according to any one of the foregoing embodiments, wherein the first and / or second polymer vesicle groups have one or more of the following properties:

[0619] i) The first and / or second polymer vesicle clusters comprise an oxidation-stabilized membrane; and / or

[0620] ii) The first and / or second polymer vesicle groups are synthetic; and / or

[0621] iii) The first and / or second polymer vesicle clusters do not contain unencapsulated antigens or are mixed with unencapsulated antigens; and / or

[0622] iv) The first and / or second polymer vesicle clusters comprise a membrane of an amphiphilic polymer; and / or

[0623] v) The first and / or second polymer vesicle clusters comprise amphiphilic synthetic block copolymers that form vesicle membranes; and / or

[0624] vi) The diameter of the first and / or second polymer vesicle clusters is greater than 70 nm, wherein preferably, the diameter is in the range of about 100 nm to about 1 μm, or about 100 nm to about 750 nm, or about 100 nm to about 500 nm, or about 125 nm to about 250 nm, about 140 nm to about 240 nm, about 150 nm to about 235 nm, about 170 nm to about 230 nm, or about 220 nm to about 180 nm, or about 190 nm to about 210 nm; most preferably, the diameter is about 200 nm; and / or

[0625] vii) The first and / or second polymer vesicle groups have a vesicle morphology;

[0626] viii) The first and / or second polymer vesicle groups are self-assembled.

[0627] 77. The method according to any one of the foregoing embodiments, wherein the average diameter of the aggregate of the first and / or second polymer vesicles is in the range of about 100 nm to about 1 μm, or about 100 nm to about 750 nm, or about 100 nm to about 500 nm, or about 125 nm to about 250 nm, about 140 nm to about 240 nm, about 150 nm to about 235 nm, about 170 nm to about 230 nm, or about 220 nm to about 180 nm, or about 190 nm to about 210 nm.

[0628] 78. The method according to any one of the foregoing embodiments, wherein the antigen is an immunogen.

[0629] 79. The method according to any one of the foregoing embodiments, wherein the antigen is selected from: i) autoantigens, ii) non-autoantigens, iii) non-autoimmunogens and iv) autoimmunogens.

[0630] 80. The method according to any one of the foregoing embodiments, wherein the antigen is selected from:

[0631] i) a polypeptide having at least 80% or higher (e.g., at least 85%, at least 90%, at least 95%, at least 96%, at least 97%, at least 98%, at least 99%, or 100%) identity with a viral polypeptide sequence; preferably, the viral polypeptide sequence is influenza hemagglutinin, swine influenza hemagglutinin, swine epidemic diarrhea virus SPIKE protein, MERS-CoV SPIKE protein, or SARS-CoV-2 SPIKE protein; more preferably, the viral polypeptide sequence is selected from: SEQ ID NO:5, SEQ ID NO:6, SEQ ID NO:7 and SEQ ID NO:8, SEQ ID NO:12, 13 and 14, SEQ ID NO:43-46, SEQ ID NO:34-41, SEQ ID NO:48-51 and SEQ ID NO:65;

[0632] ii) A polypeptide having at least 80% or more (e.g., at least 85%, at least 90%, at least 95%, at least 96%, at least 97%, at least 98%, at least 99%, or 100%) identity with a bacterial polypeptide sequence;

[0633] iii) A polypeptide having at least 80% or higher (e.g., at least 85%, at least 90%, at least 95%, at least 96%, at least 97%, at least 98%, at least 99%, or 100%) identity with a mammalian or avian polypeptide sequence; preferably, the mammalian or avian polypeptide sequence is ovalbumin (OVA), B16 peptide, or MC38 peptide; more preferably, the mammalian or avian polypeptide sequence is selected from: SEQ ID NO:4, SEQ ID NO:1, SEQ ID NO:2, SEQ ID NO:3, SEQ ID NO:9, SEQ ID NO:10, and SEQ ID NO:11.

[0634] 81. The method according to any one of embodiments 3 to 80, wherein the mammalian antigen comprises a polypeptide sequence selected from human, rodent, rabbit and horse polypeptide sequences.

[0635] 82. The method according to any one of the foregoing embodiments, wherein the antigen is an antibody or a fragment thereof.

[0636] 83. The method according to any one of the foregoing embodiments, wherein the antigen is selected from:

[0637] i) Influenza hemagglutinin (HA), preferably selected from: SEQ ID NO:5, SEQ ID NO:6, SEQ ID NO:7 and SEQ ID NO:8;

[0638] ii) Swine influenza hemagglutinin (HA), preferably, is SEQ ID NO:6;

[0639] iii) Ovalbumin (OVA), preferably, is SEQ ID NO:4;

[0640] iv) B16 peptide, preferably selected from: SEQ ID NO:9, SEQ ID NO:10 and SEQ ID NO:11;

[0641] v) MC38 peptide, preferably selected from: SEQ ID NO:1, SEQ ID NO:2 and SEQ ID NO:3;

[0642] vi) B16 and MC38 peptides, preferably, said peptides are independently selected from: i) SEQ ID NO:1-3 and ii) SEQ ID NO:9-11;

[0643] vii) Porcine epidemic diarrhea virus SPIKE protein and its soluble fragments, preferably fragments of SEQ ID NO: 12, 13 or 14;

[0644] viii) MERS-CoV SPIKE protein and its soluble fragments, preferably the spike protein (fragment) of any one of SEQ ID NO:42-46;

[0645] ix) SARS-CoV-2 SPIKE protein and its soluble fragments, preferably the spike protein (fragment) of any one of SEQ ID NO: 19-41 and 65-66; and

[0646] x) SARS-CoV-1 SPIKE protein and its soluble fragments, preferably the spike protein (fragment) of any one of SEQ ID NO:47-51.

[0647] 84. The method according to any one of the foregoing embodiments, wherein the first and / or second polymer vesicle groups are selected from cationic polymer vesicles, anionic polymer vesicles, nonionic polymer vesicles, and mixtures thereof.

[0648] 85. The method according to any one of the foregoing embodiments, wherein the block copolymer or amphiphilic polymer is substantially non-immunogenic or substantially non-antigenic; preferably, the block copolymer or amphiphilic polymer is non-immunogenic or non-antigenic.

[0649] 86. The method according to embodiment 85, wherein the block copolymer or the amphiphilic polymer is neither an immunostimulant nor an adjuvant.

[0650] 87. The method according to any one of the foregoing embodiments, wherein the first and / or second polymer vesicle groups comprise or are formed of an amphiphilic polymer, wherein the amphiphilic polymer comprises or is composed of a diblock or triblock (ABA or ABC) copolymer.

[0651] 88. The method according to any one of embodiments 21 to 87, wherein the amphiphilic polymer comprises copolymer poly(N-vinylpyrrolidone)-b-PLA.

[0652] 89. The method according to any one of embodiments 21 to 88, wherein the amphiphilic polymer comprises at least one monomer unit of a carboxylic acid, amide, amine, olefin, dialkylsiloxane, ether, or alkylene sulfide.

[0653] 90. The method according to any one of embodiments 21 to 89, wherein the amphiphilic polymer is a polyether block selected from the following: oligo(oxyethylene) block, poly(oxyethylene) block, oligo(oxypropylene) block, poly(oxypropylene) block, oligo(oxybutene) block and poly(oxybutene) block.

[0654] 91. The method according to any one of embodiments 21 to 90, wherein the amphiphilic polymer is a poly(butadiene)-poly(ethylene oxide) (PB-PEO) diblock copolymer, or wherein the amphiphilic polymer is a poly(dimethylsiloxane)-poly(ethylene oxide) (PDMS-PEO) diblock copolymer, or a poly(dimethylsiloxane)-poly(acrylic acid) (PDMS-PAA).

[0655] 92. The method according to embodiment 91, wherein the PB-PEO diblock copolymer comprises 5-50 blocks of PB and 5-50 blocks of PEO, or wherein the PB-PEO diblock copolymer preferably comprises 5-100 blocks of PDMS and 5-100 blocks of PEO.

[0656] 93. The method according to any one of embodiments 21 to 92, wherein the amphiphilic polymer is a poly(lactide)-poly(ethylene oxide) / 1-palmitoyl-2-oleoyl-sn-glycerol-3-phosphate-L-serine (PLA-PEO / POPC) copolymer, preferably, the PLA-PEO / POPC has a PLA-PEO to POPC (e.g., PLA-PEO / POPC) ratio of 75:25 (e.g., 75 / 25).

[0657] 94. The method according to any one of embodiments 21 to 93, wherein the amphiphilic polymer is a poly(caprolactone)-poly(ethylene oxide) / 1-palmitoyl-2-oleoyl-sn-glycerol-3-phosphate-L-serine (PCL-PEO / POPC) copolymer, preferably, the PCL-PEO / POPC has a PCL-PEO to POPC (e.g., PCL-PEO / POPC) ratio of 75:25 (e.g., 75 / 25).

[0658] 95. The method according to any one of embodiments 21 to 94, wherein the amphiphilic polymer is polybutadiene-polyethylene oxide (BD).

[0659] 96. The method according to any one of embodiments 21 to 95, wherein the first and / or second polymer vesicle groups comprise a diblock copolymer PBD. 21 -PEO 14 (BD21) and / or triblock copolymer PMOXA 12 -PDMS 55 -PMOXA 12 .

[0660] 97. The method according to any one of the foregoing embodiments, wherein the first and / or second polymer vesicle clusters comprise one or more compartments.

[0661] 98. The method according to any one of the foregoing embodiments, wherein the first and / or second polymer vesicle cluster comprises one or more compartments, wherein each of the one or more compartments encapsulates at least one peptide, protein, and nucleic acid, preferably, at least one of the peptide, protein, and nucleic acid is immunogenic or antigenic, and more preferably, each of the one or more compartments is composed of the same or different amphiphilic polymers.

[0662] 99. The method according to any one of the foregoing embodiments, wherein the first and / or second polymer vesicle group comprises more than one compartment, wherein the compartment comprises an outer block copolymer vesicle and at least one inner block copolymer vesicle, wherein the at least one inner block copolymer vesicle is encapsulated within the outer block copolymer vesicle, preferably, the outer block copolymer vesicle is a polymer vesicle formed independently of copolymers selected from:

[0663] i) Poly[styrene-b-poly(L-isocyanoalanine (2-thiophene-3-yl-ethyl)amide)] (PS-PIAT),

[0664] ii) Poly(butadiene)-poly(ethylene oxide) (PBD-PEO),

[0665] iii) Poly(ethylene oxide)-poly(caprolactone) (PEO-PCL),

[0666] iv) Poly(ethylene ethylidene)-poly(ethylene oxide) (PEE-PEO),

[0667] v) Poly(ethylene oxide)-poly(lactic acid) (PEO-PLA),

[0668] vi) Poly(isoprene)-poly(ethylene oxide) (PI-PEO),

[0669] vii) Poly(2-vinylpyridine)-poly(ethylene oxide) (P2VP-PEO),

[0670] viii) Poly(ethylene oxide)-poly(N-isopropylacrylamide) (PEO-PNIPAm),

[0671] ix) Poly(styrene)-poly(acrylic acid) (PS-PAA),

[0672] x) Poly(ethylene glycol)-poly(propylene sulfide) (PEG-PPS),

[0673] xi) Poly(2-methyloxazoline)-poly(dimethylsiloxane)-poly(2-methyloxazoline)(PMOXA-PDMS-PMOXA),

[0674] xii) Poly(ethylene oxide)-poly(dimethylsiloxane)-poly(2-methyloxazoline) (PEO-PDMS-PMOXA),

[0675] xiii) Poly(methylphenylsilane)-poly(ethylene oxide) (PMPS-PEO-PMPS-PEO-PMPS); and

[0676] xiv) Poly(dimethylsiloxane)-poly(acrylic acid) (PDMS-PAA);

[0677] More preferably, the at least one internal block copolymer vesicle is a polymer vesicle formed independently of copolymers selected from:

[0678] i) Poly[styrene-b-poly(L-isocyanoalanine (2-thiophene-3-yl-ethyl)amide)] (PS-PIAT),

[0679] ii) Poly(butadiene)-poly(ethylene oxide) (PBD-PEO),

[0680] iii) Poly(ethylene oxide)-poly(caprolactone) (PEO-PCL),

[0681] iv) Poly(ethylene ethylidene)-poly(ethylene oxide) (PEE-PEO),

[0682] v) Poly(ethylene oxide)-poly(lactic acid) (PEO-PLA),

[0683] vi) Poly(isoprene)-poly(ethylene oxide) (PI-PEO),

[0684] vii) Poly(2-vinylpyridine)-poly(ethylene oxide) (P2VP-PEO),

[0685] viii) Poly(ethylene oxide)-poly(N-isopropylacrylamide) (PEO-PNIPAm),

[0686] ix) Poly(styrene)-poly(acrylic acid) (PS-PAA),

[0687] x) Poly(ethylene glycol)-poly(propylene sulfide) (PEG-PPS),

[0688] xi) Poly(2-methyloxazoline)-poly(dimethylsiloxane)-poly(2-methyloxazoline)(PMOXA-PDMS-PMOXA),

[0689] xii) Poly(ethylene oxide)-poly(dimethylsiloxane)-poly(2-methyloxazoline) (PEO-PDMS-PMOXA),

[0690] xiii) Poly(methylphenylsilane)-poly(ethylene oxide) (PMPS-PEO-PMPS-PEO-PMPS), and

[0691] xiv) Poly(dimethylsiloxane)-poly(acrylic acid) (PDMS-PAA).

[0692] 100. The method according to any one of the foregoing embodiments, wherein the first and / or second polymer vesicle groups comprise lipid polymers.

[0693] 101. The method according to any one of the foregoing embodiments, wherein the adjuvant associated in the second polymer vesicle group is selected from CpG oligodeoxynucleotides (or CpG ODN), components and proteins derived from bacterial and mycobacterial cell walls.

[0694] 102. A method for producing polymeric vesicles encapsulating an antigen or an adjuvant therein, the method comprising:

[0695] i) Dissolve the amphiphilic polymer in chloroform, preferably, the amphiphilic polymer is polybutadiene-polyethylene oxide (BD);

[0696] ii) Dry the dissolved amphiphilic polymer to form a polymer film;

[0697] iii) Add a solubilizing antigen or a soluble adjuvant to the dried amphiphilic polymer membrane of step ii), wherein, preferably, the adjuvant is selected from CpG oligodeoxynucleotides (or CpG ODN), components and proteins derived from bacterial and mycobacterial cell walls, and wherein the antigen is selected from:

[0698] a) A polypeptide; preferably, the polypeptide antigen is any of the foregoing embodiments, more preferably, the polypeptide antigen comprises a soluble portion of influenza hemagglutinin, swine influenza hemagglutinin, a SPIKE protein such as the SPIKE protein of porcine epidemic diarrhea virus, a SPIKE protein of human pathogenic coronaviruses such as the SPIKE protein of MERS-CoV or SARS-CoV-2, ovalbumin (OVA), B16 peptide or MC38 peptide, most preferably, the polypeptide antigen is combined with a portion selected from SEQ ID NO:1, SEQ ID NO:2, SEQ ID NO:3, SEQ ID NO:4, SEQ ID NO:5, SEQ ID NO:6, SEQ ID NO:7, SEQ ID NO:8, SEQ ID NO:9, SEQ ID NO:10, SEQ ID NO:11, SEQ ID NO:12-14, SEQ ID NO:43-46, SEQ ID NO:34-41, SEQ ID NO:48-51 and SEQ ID NO:43-46. The polypeptide sequence of NO:65 has at least 60% or higher (e.g., at least 65%, at least 70%, at least 75%, at least 80%, at least 85%, at least 90%, at least 95%, at least 96%, at least 97%, at least 98%, at least 99%, or 100%) identity.

[0699] b) Carbohydrates;

[0700] c) A polynucleotide, wherein the polynucleotide is not an antisense oligonucleotide, and preferably, the polynucleotide is a DNA or mRNA molecule;

[0701] d)(a) and / or (b) and / or (c) combinations;

[0702] iv) Rehydrate the polymer membrane from step iii) to form polymer vesicles;

[0703] v) Optionally, filter the polymer vesicles from step iv) to purify the polymer vesicles into monodisperse vesicles; and / or

[0704] vi) Optionally, the polymer vesicles from step iv) or v) are separated from the unencapsulated antigen phase.

[0705] 103. A method for producing polymer vesicles according to any one of embodiments 1 to 101, wherein an antigen or adjuvant is encapsulated.

[0706] 104. A polymer vesicle produced by a method according to embodiment 102 or 13 for producing polymer vesicles in which an antigen or adjuvant is encapsulated.

[0707] 105. A composition comprising first and second polymeric vesicle clusters according to any one of embodiments 1 to 102.

[0708] 106. The composition according to embodiment 105, wherein the composition is a pharmaceutical or diagnostic composition.

[0709] 107. The composition according to embodiment 105 or 106, wherein the composition is an immunogenic, antigenic, or immunotherapeutic composition.

[0710] 108. The composition according to embodiment 105 or 106, wherein the composition is a vaccine.

[0711] 109. The composition according to any one of embodiments 105 to 108 is formulated for oral, intranasal, inhalation, intradermal, intraperitoneal, intramuscular, subcutaneous, intravenous or mucosal surface application.

[0712] 110. A vaccine comprising a first and / or second polymeric vesicle cluster as described in any one of embodiments 1 to 101 or a composition as defined in embodiments 105 to 109, and further comprising a pharmaceutically acceptable excipient or carrier.

[0713] 111. The vaccine according to implementation plan 110, wherein:

[0714] i) The antigen comprises influenza hemagglutinin (HA), wherein the vaccine is an influenza vaccine, preferably, the influenza hemagglutinin (HA) has at least 60% or higher (e.g., at least 65%, at least 70%, at least 75%, at least 80%, at least 85%, at least 90%, at least 95%, at least 96%, at least 97%, at least 98%, at least 99%, or 100%) identity with a polypeptide selected from SEQ ID NO:5, SEQ ID NO:6, SEQ ID NO:7, and SEQ ID NO:8;

[0715] ii) The antigen comprises swine influenza hemagglutinin (HA), wherein the vaccine is a swine influenza vaccine, preferably, the swine influenza hemagglutinin (HA) has at least 60% or higher (e.g., at least 65%, at least 70%, at least 75%, at least 80%, at least 85%, at least 90%, at least 95%, at least 96%, at least 97%, at least 98%, at least 99%, or 100%) identity with SEQ ID NO:6;

[0716] iii) Porcine epidemic diarrhea virus SPIKE protein, wherein the vaccine is a PED vaccine, preferably, the SPIKE protein has at least 60% or higher (e.g., at least 65%, at least 70%, at least 75%, at least 80%, at least 85%, at least 90%, at least 95%, at least 96%, at least 97%, at least 98%, at least 99%, or 100%) identity with the polypeptide of SEQ ID NO:12, 13, or 14;

[0717] iv) The antigen comprises ovalbumin (OVA), wherein the vaccine is a cancer vaccine, preferably, the ovalbumin (OVA) has at least 60% or higher (e.g., at least 65%, at least 70%, at least 75%, at least 80%, at least 85%, at least 90%, at least 95%, at least 96%, at least 97%, at least 98%, at least 99%, or 100%) identity with SEQ ID NO:4;

[0718] v) The antigen contains a B16 peptide, wherein the vaccine is a cancer vaccine, and preferably, the peptide is selected from: SEQ ID NO: 9-11;

[0719] vi) The antigen contains the MC38 peptide, wherein the vaccine is a cancer vaccine, and preferably, the peptide is selected from: SEQ ID NO: 1-3;

[0720] vii) The antigen comprises B16 and MC38 peptides, wherein the vaccine is a cancer vaccine, preferably, the peptides are independently selected from: i) SEQ ID NO:1-3 and ii) SEQ ID NO:9-11;

[0721] viii) The antigen described has at least 60% or higher (e.g., at least 65%, at least 70%, at least 75%, at least 80%, at least 85%, at least 90%, at least 95%, at least 96%, at least 97%, at least 98%, at least 99%, or 100%) identity with a polypeptide sequence selected from SEQ ID NO:1, SEQ ID NO:2, SEQ ID NO:3, SEQ ID NO:9, SEQ ID NO:10, SEQ ID NO:11; wherein the vaccine is a cancer vaccine;

[0722] ix) The antigen contains the MERS-CoV SPIKE protein or a fragment thereof, wherein the vaccine is a MERS vaccine, preferably, the SPIKE protein has at least 60% or higher (e.g., at least 65%, at least 70%, at least 75%, at least 80%, at least 85%, at least 90%, at least 95%, at least 96%, at least 97%, at least 98%, at least 99%, or 100%) identity with any of the polypeptides in SEQ ID NO:42-46;

[0723] x) The antigen contains the SARS-CoV-2 SPIKE protein or a fragment thereof, wherein the vaccine is a COVID-19 vaccine, preferably, the SPIKE protein has at least 60% or higher (e.g., at least 65%, at least 70%, at least 75%, at least 80%, at least 85%, at least 90%, at least 95%, at least 96%, at least 97%, at least 98%, at least 99%, or 100%) identity with any polypeptide in SEQ ID NO:19-41 and 65-66; or

[0724] xi) The antigen contains the SARS-CoV-1 SPIKE protein or a fragment thereof, wherein the vaccine is a COVID-19 vaccine, preferably, the SPIKE protein has at least 60% or higher (e.g., at least 65%, at least 70%, at least 75%, at least 80%, at least 85%, at least 90%, at least 95%, at least 96%, at least 97%, at least 98%, at least 99%, or 100%) identity with any of the polypeptides in SEQ ID NO:19-41.

[0725] 112. A kit comprising first and second polymer vesicle groups as described in any one of embodiments 1 to 101 or a composition as defined in embodiments 105 to 109.

[0726] 113. A method for treating or preventing an infectious disease, cancer, or autoimmune disease in a subject (e.g., a person) in need of such treatment, the method comprising administering to the subject a therapeutically effective amount of a first or second polymeric vesicle cluster as defined in embodiments 1 to 101 or a composition as defined in embodiments 105 to 109, wherein preferably, the infectious disease is a viral or bacterial infectious disease.

[0727] 114. A method for immunizing humans or non-human animals, the method comprising the following steps:

[0728] i. Providing first and second polymer vesicle clusters as defined in embodiments 1 to 101 or compositions as defined in embodiments 105 to 109;

[0729] ii. Administer the first and second polymer vesicle groups or compositions to the non-human animal.

[0730] 115. The first and second polymeric vesicle groups as defined in any one of embodiments 1 to 101, or the compositions as defined in embodiments 105 to 109, used as a pharmaceutical.

[0731] 116. The first and second polymer vesicle groups as defined in any one of embodiments 1 to 101, or the compositions as defined in embodiments 105 to 109, used in one or more of the following methods:

[0732] i) Used in methods for antibody discovery and / or screening and / or preparation;

[0733] ii) Used in methods for vaccine discovery and / or screening and / or preparation;

[0734] iii) Used in methods for producing or preparing immunogenic or immunostimulatory compositions;

[0735] iv) In a method for targeted delivery of proteins and / or peptides, preferably, the targeted delivery is the targeted delivery of antigenic proteins and / or peptides according to any one of the foregoing embodiments; more preferably, the antigenic protein and / or peptide comprises a soluble portion of a membrane protein (MP) or membrane-associated peptide (MAP); most preferably, the antigen comprises a soluble portion of influenza hemagglutinin, swine influenza hemagglutinin, a SPIKE protein such as the SPIKE protein of porcine epidemic diarrhea virus, a SPIKE protein of human pathogenic coronaviruses such as the SPIKE protein of MERS-CoV, SARS-CoV-2, or SARS-CoV-1, ovalbumin (OVA), B16 peptide, or MC38 peptide; more preferably, the antigen comprises a soluble portion of a protein selected from SEQ ID NO:1, SEQ ID NO:2, SEQ ID NO:3, SEQ ID NO:4, SEQ ID NO:5, SEQ ID NO:6, SEQ ID NO:7, SEQ ID NO:8, SEQ ID NO:9, SEQ ID NO:10, SEQ ID NO:11, SEQ ID NO:12, SEQ ID NO:13, SEQ ID NO:14, SEQ ID NO:5, SEQ ID NO:6, SEQ ID NO:7, SEQ ID NO:8, SEQ ID NO:9, SEQ ID NO:10, SEQ ID NO:11, SEQ ID NO:12, SEQ ID NO:13, SEQ ID NO:14, SEQ ID NO:15, SEQ ID NO:1 ...17, SEQ ID NO:18, SEQ ID NO:9, SEQ ID NO:10, SEQ ID NO:11, SEQ ID NO The polypeptide sequences of NO:14, SEQ ID NO:43-46, SEQ ID NO:34-41, SEQ ID NO:48-51 and SEQ ID NO:65 have at least 60% or higher (e.g., at least 65%, at least 70%, at least 75%, at least 80%, at least 85%, at least 90%, at least 95%, at least 96%, at least 97%, at least 98%, at least 99% or 100%) identity; more preferably, the targeted delivery is performed in a subject;

[0736] v) In a method for stimulating an immune response to an antigen, preferably, the antigen is as described in any of the foregoing embodiments; more preferably, the antigen comprises a soluble portion of influenza hemagglutinin, swine influenza hemagglutinin, a SPIKE protein such as the SPIKE protein of porcine epidemic diarrhea virus, a SPIKE protein of human pathogenic coronaviruses such as the SPIKE protein of MERS-CoV, SARS-CoV-2, or SARS-CoV-1, ovalbumin (OVA), B16 peptide, or MC38 peptide; more preferably, the antigen is combined with a soluble portion selected from SEQ ID NO:1, SEQ ID NO:2, SEQ ID NO:3, SEQ ID NO:4, SEQ ID NO:5, SEQ ID NO:6, SEQ ID NO:7, SEQ ID NO:8, SEQ ID NO:9, SEQ ID NO:10, SEQ ID NO:11, SEQ ID NO:12, SEQ ID NO:13, SEQ ID NO:14, SEQ ID NO:43-46, SEQ ID NO:34-41, SEQ ID NO:48-51, and SEQ ID NO:43-46, SEQ ID NO:34-41, SEQ ID NO:48-51, and SEQ ID NO:43-46. The polypeptide sequence of NO:65 has at least 60% or higher (e.g., at least 65%, at least 70%, at least 75%, at least 80%, at least 85%, at least 90%, at least 95%, at least 96%, at least 97%, at least 98%, at least 99%, or 100%) identity; more preferably, it is used to stimulate an immune response to said antigen in a subject;

[0737] vi) Used to trigger CD8 (+) In methods for cross-protection induced by T cell-mediated immune responses, preferably, it is used to trigger cross-protection by CD8. (+)In the method of cross-protection induced by T cell-mediated immune response, the immune response is directed against the antigen described in any of the foregoing embodiments; more preferably, the antigen comprises influenza hemagglutinin, swine influenza hemagglutinin, a SPIKE protein such as the SPIKE protein of porcine epidemic diarrhea virus, a SPIKE protein of human pathogenic coronavirus such as the SPIKE protein of MERS-CoV, SARS-CoV-2, or SARS-CoV-1, ovalbumin (OVA), B16 peptide, or MC38 peptide; most preferably, the antigen is combined with a soluble portion selected from SEQ ID NO:1, SEQ ID NO:2, SEQ ID NO:3, SEQ ID NO:4, SEQ ID NO:5, SEQ ID NO:6, SEQ ID NO:7, SEQ ID NO:8, SEQ ID NO:9, SEQ ID NO:10, SEQ ID NO:11, SEQ ID NO:12, SEQ ID NO:13, SEQ ID NO:14, SEQ ID NO:43-46, SEQ ID NO:34-41, SEQ ID NO:48-51, and SEQ ID NO:43-46, SEQ ID NO:34-41, SEQ ID NO:48-51, and SEQ ID NO:43-46. The polypeptide sequence of NO:65 has at least 60% or higher (e.g., at least 65%, at least 70%, at least 75%, at least 80%, at least 85%, at least 90%, at least 95%, at least 96%, at least 97%, at least 98%, at least 99%, or 100%) identity.

[0738] vii) Used in a method of delivering peptides and / or proteins to antigen-presenting cells (APCs) according to any one of the foregoing embodiments; preferably, the peptides and / or proteins are antigens according to any one of the foregoing embodiments; more preferably, the antigen comprises a soluble portion of influenza hemagglutinin, swine influenza hemagglutinin, a SPIKE protein such as the SPIKE protein of porcine epidemic diarrhea virus, a SPIKE protein of human pathogenic coronaviruses such as the SPIKE protein of MERS-CoV, SARS-CoV-2, or SARS-CoV-1, ovalbumin (OVA), B16 peptide, or MC38 peptide; most preferably, the antigen is combined with a soluble portion selected from SEQ ID NO:1, SEQ ID NO:2, SEQ ID NO:3, SEQ ID NO:4, SEQ ID NO:5, SEQ ID NO:6, SEQ ID NO:7, SEQ ID NO:8, SEQ ID NO:9, SEQ ID NO:10, SEQ ID NO:11, SEQ ID NO:12, 13 and 14, SEQ ID NO:43-46, SEQ ID NO:34-41, SEQ ID NO: ... The polypeptide sequences of NO:48-51 and SEQ ID NO:65 have at least 60% or higher (e.g., at least 65%, at least 70%, at least 75%, at least 80%, at least 85%, at least 90%, at least 95%, at least 96%, at least 97%, at least 98%, at least 99%, or 100%) identity.

[0739] viii) Used in methods for triggering an immune response, wherein the immune response includes CD8 (+) T cell-mediated immune responses and / or CD4 (+)T-cell-mediated immune response; preferably, the response is directed against the antigen described in any of the foregoing embodiments; more preferably, the antigen comprises influenza hemagglutinin, swine influenza hemagglutinin, a SPIKE protein such as the SPIKE protein of porcine epidemic diarrhea virus, a SPIKE protein of human pathogenic coronaviruses such as the SPIKE protein of MERS-CoV, SARS-CoV-2, or SARS-CoV-1, ovalbumin (OVA), a soluble portion of B16 peptide, or MC38 peptide; even more preferably, the response is directed against the antigen, wherein the antigen is combined with a portion selected from SEQ ID NO:1, SEQ ID NO:2, SEQ ID NO:3, SEQ ID NO:4, SEQ ID NO:5, SEQ ID NO:6, SEQ ID NO:7, SEQ ID NO:8, SEQ ID NO:9, SEQ ID NO:10, SEQ ID NO:11, SEQ ID NO:12, 13 and 14, SEQ ID NO:43-46, SEQ ID NO:34-41, SEQ ID NO:48-51 and SEQ ID NO:14. The polypeptide sequence of NO:65 has at least 60% or higher (e.g., at least 65%, at least 70%, at least 75%, at least 80%, at least 85%, at least 90%, at least 95%, at least 96%, at least 97%, at least 98%, at least 99%, or 100%) identity.

[0740] ix) Used in methods for treating, improving, preventing or diagnosing infectious diseases, preferably, the infectious disease is a viral or bacterial infectious disease; more preferably, the viral infectious disease is selected from: influenza virus infection, PED virus infection, foot-and-mouth disease virus infection, respiratory syncytial virus infection, and herpes virus infection;

[0741] x) Used in methods for treating, improving, preventing or diagnosing cancer or autoimmune diseases;

[0742] xi) is used in methods for sensitizing cancer cells to chemotherapy;

[0743] xii) Used in methods for inducing apoptosis in cancer cells;

[0744] xiii) Used in methods for stimulating an immune response in subjects;

[0745] xiv) Used in methods for immunizing humans or non-human animals;

[0746] xv) is used in methods for preparing hybridomas;

[0747] xvi) is used in the method according to any one of the foregoing embodiments;

[0748] xvii) is used in any of the preceding i)-xvi), wherein the method is an in vivo and / or ex vivo and / or in vitro method;

[0749] xviii) is used in any of the methods according to i)-xvii), wherein the antigen is heterologous to the environment in which the antigen is used.

[0750] 117. The first and second polymer vesicle groups as defined in any one of embodiments 1 to 101, or the compositions as defined in embodiments 105 to 109, are used for one or more of the following purposes:

[0751] i) Used for antibody discovery and / or screening and / or preparation;

[0752] ii) Used for vaccine discovery and / or screening and / or preparation;

[0753] iii) Used in the production or preparation of immunogenic or immunostimulatory compositions;

[0754] iv) Targeted delivery of proteins and / or peptides, preferably, the targeted delivery is the targeted delivery of antigenic proteins and / or peptides; more preferably, the targeted delivery is performed in a subject;

[0755] v) Used to stimulate an immune response to an antigen, preferably used to stimulate an immune response to an antigen in a subject;

[0756] vi) is used to trigger CD8 (+) Cross-protection induced by T cell-mediated immune responses;

[0757] vii) for delivering peptides or proteins to antigen-presenting cells (APCs); preferably, the peptide or protein is an antigen, more preferably, the peptide or protein is immunogenic or immunotherapeutic;

[0758] viii) is used to trigger an immune response, which includes CD8 (+) T cell-mediated immune responses and / or CD4 (+) T cell-mediated immune response;

[0759] ix) In a method for treating, improving, preventing or diagnosing an infectious disease, preferably, the infectious disease is a viral or bacterial infectious disease; more preferably, the viral infectious disease is selected from: influenza virus infection, PED virus infection, respiratory syncytial virus infection, and herpes virus infection;

[0760] x) Used for the treatment, improvement, prevention, or diagnosis of cancer or autoimmune diseases;

[0761] xi) is used to sensitize cancer cells to chemotherapy;

[0762] xii) is used to induce apoptosis in cancer cells;

[0763] xiii) Used to stimulate an immune response in subjects;

[0764] xiv) is used to immunize humans or non-human animals;

[0765] xv) is used to prepare hybridomas;

[0766] xvi) In the method according to any one of the foregoing embodiments;

[0767] xvii) is used according to any one of i)-xvi), wherein the use is in vivo and / or in vitro and / or extracorporeal use;

[0768] xviii) is used for any of the preceding i)-xvii), wherein the antigen is heterologous to the environment in which the antigen...

Claims

1. A vaccine comprising first and second polymeric vesicle groups, and further comprising a pharmaceutically acceptable excipient or carrier, wherein an antigen is associated with the first polymeric vesicle group, and wherein an adjuvant is associated with the second polymeric vesicle group, wherein the first and second polymeric vesicle groups comprise amphiphilic synthetic block copolymers forming vesicle membranes; and wherein the first polymeric vesicle group has an antigen encapsulated within the polymeric vesicles, and the second polymeric vesicle group has an adjuvant encapsulated within the polymeric vesicles, wherein the amphiphilic polymer is a poly(butadiene)-poly(ethylene oxide) (PB-PEO) diblock copolymer, or wherein the amphiphilic polymer is a poly(dimethylsiloxane)-poly(ethylene oxide) (PDMS-PEO) diblock copolymer.

2. A first and second polymer vesicle group, characterized in that, It is used as a drug, wherein an antigen is associated with a first polymeric vesicle group, and wherein an adjuvant is associated with a second polymeric vesicle group, wherein the first and second polymeric vesicle groups comprise an amphiphilic synthetic block copolymer forming a vesicle membrane; and wherein the first polymeric vesicle group has an antigen encapsulated within the polymeric vesicles, and the second polymeric vesicle group has an adjuvant encapsulated within the polymeric vesicles, wherein the amphiphilic polymer is a poly(butadiene)-poly(ethylene oxide) (PB-PEO) diblock copolymer, or wherein the amphiphilic polymer is a poly(dimethylsiloxane)-poly(ethylene oxide) (PDMS-PEO) diblock copolymer.

3. The first and second polymer vesicle clusters for use according to claim 2, wherein the use comprises treating or preventing infectious diseases, cancer, or autoimmune diseases in a subject in need of such treatment.

4. The first and second polymer vesicle groups for use according to claim 3, wherein the infectious disease is a viral or bacterial infectious disease.

5. Use of first and second polymeric vesicle groups in the preparation of medicaments for treating diseases, wherein an antigen is associated with the first polymeric vesicle group, and wherein an adjuvant is associated with the second polymeric vesicle group, wherein the first and second polymeric vesicle groups comprise amphiphilic synthetic block copolymers forming vesicle membranes; and wherein the first polymeric vesicle group has an antigen encapsulated within the polymeric vesicles, and the second polymeric vesicle group has an adjuvant encapsulated within the polymeric vesicles, wherein the amphiphilic polymer is a poly(butadiene)-poly(ethylene oxide) (PB-PEO) diblock copolymer, or wherein the amphiphilic polymer is a poly(dimethylsiloxane)-poly(ethylene oxide) (PDMS-PEO) diblock copolymer; The diseases mentioned are selected from cancer, autoimmune diseases, and infectious diseases.

6. The use according to claim 5, wherein the infectious disease is a viral or bacterial infectious disease.

Images