Tumor treatment combining recombinant oncolytic viruses and low-molecular-weight anticancer drugs
The combination of recombinant oncolytic viruses and low-molecular-weight anticancer drugs addresses safety and efficacy challenges, achieving enhanced tumor treatment through improved tumor targeting and immune stimulation.
Patent Information
- Authority / Receiving Office
- JP · JP
- Patent Type
- Applications
- Current Assignee / Owner
- JOINT BIOSCIENCES (SH) LTD
- Filing Date
- 2024-03-18
- Publication Date
- 2026-04-14
AI Technical Summary
Oncolytic viruses face safety concerns due to pathogenic risks, and small molecule anticancer drugs encounter challenges like drug resistance and low efficacy, limiting their clinical application and therapeutic effectiveness.
Combining recombinant oncolytic viruses with low-molecular-weight anticancer drugs, incorporating cytokines and specific protein mutations, to enhance tumor targeting and immune stimulation, thereby improving therapeutic efficacy.
The combination therapy demonstrates superior tumor growth inhibition compared to individual treatments, offering a synergistic effect that enhances therapeutic outcomes.
Smart Images

Figure 2026511570000001_ABST
Abstract
Description
Technical Field
[0001] This application relates to the field of biomedical technology, and specifically to a tumor treatment method combining recombinant oncolytic virus and small molecule anti-cancer drugs.
Background Art
[0002] Oncolytic virus is a tumor-killing virus with replication ability and is currently widely accepted as an important field of tumor immunotherapy. Oncolytic virus specifically targets infected tumor cells. For example, due to the inactivation or deficiency of oncolytic virus inhibitory genes in tumor cells, it selectively infects tumor cells. After infecting tumor cells, oncolytic virus replicates in large quantities within the tumor cells and finally destroys the tumor cells, thus killing the tumor cells. At the same time, oncolytic virus can also provide immune stimulation signals necessary for the host's own anti-cancer reaction, attract more immune cells, and continue to kill the remaining tumor cells.
[0003] Oncolytic virus has good application potential in the field of tumor immunotherapy, but wild-type oncolytic virus may always cause problems such as damage and dysfunction of body tissues and organs, and there is still a great pathogenic risk in the process of using wild-type virus to infect tumor cells. Therefore, in order to further promote the clinical application of oncolytic virus, it is necessary to modify wild-type oncolytic virus to obtain attenuated oncolytic virus. Using attenuated oncolytic virus in clinical applications can thus reduce the pathogenic risk of oncolytic virus and improve the safety of oncolytic virus.
[0004] However, in the process of modifying oncolytic virus, random gene modification can be performed on wild-type oncolytic virus to reduce its toxicity, but the modified oncolytic virus may have a low cure rate and may not be packaged even if it is a modified oncolytic virus, which is disadvantageous for promoting the clinical application of oncolytic virus.
[0005] With the advancements in modern molecular biology and the application of cutting-edge technologies such as computer-aided drug design, structural biology, and combinatorial chemistry, small molecule anticancer drugs are entering a period of rapid development. To date, the FDA (United States Food and Drug Administration) and NMPA (National Medical Products Administration) have approved 89 types of small molecule anticancer drugs for the treatment of various cancers. Thousands of targeted drugs for cancer treatment are currently undergoing clinical trials. Among these, many promising drugs have entered Phase III trials. In 2021, the global anticancer drug market is projected to reach US$200 billion, with targeted drugs expected to be the "mainstay." Despite significant progress, small molecule anticancer drugs still face several challenges.
[0006] The first major challenge is drug resistance. Almost all targeted anticancer drugs encounter drug resistance problems after a period of clinical use. Drug resistance involves many mechanisms, including gene mutations, proliferation, cancer stem cells, efflux transporters, apoptosis dysregulation, and autophagy. Gene mutations are the main cause of antitumor drug resistance. Low efficacy is another major challenge for targeted anticancer drugs. Targeted anticancer drugs are effective in only a limited number of patients. For example, less than 20% of non-small cell lung cancer patients are sensitive to EGFR inhibitors (e.g., gefitinib and erlotinib). [Overview of the Initiative] [Problems that the invention aims to solve]
[0007] This application provides a tumor therapy method that combines recombinant oncolytic viruses with low-molecular-weight anticancer drugs to further improve the therapeutic effect of tumor cells. [Means for solving the problem]
[0008] Oncolytic viruses are tumor-killing viruses with replication capabilities and are now widely accepted as an important area of tumor immunotherapy. Oncolytic viruses specifically target infected tumor cells, selectively infecting them, for example, by inactivating or deleting oncolytic virus inhibitor genes in tumor cells. After infecting tumor cells, oncolytic viruses replicate rapidly within the tumor cells, ultimately destroying and killing them. At the same time, oncolytic viruses can also attract more immune cells by providing the necessary immune stimulating signals to enhance the host's own anti-cancer response, thus continuing to kill the remaining tumor cells. Therefore, oncolytic viruses have the ability to disrupt the tumor tissue microenvironment and transform "cold tumors" into "hot tumors."
[0009] At the same time, small molecule anticancer drugs have entered a rapid development phase, and although thousands of targeted drugs for cancer treatment are in clinical trials, despite significant progress, small molecule anticancer drugs still face challenges such as drug resistance and low efficiency. In the therapeutic method of this application, recombinant oncolytic virus and a small molecule anticancer drug are used in combination to attack and kill tumor cells, thereby achieving an effect where 1+1 is greater than 2.
[0010] Furthermore, to improve therapeutic efficacy, cytokines may be inserted into and expressed within the oncolytic virus. The synergistic effect of the antitumor mechanisms of the oncolytic virus, cytokines, and low-molecular-weight anticancer drugs results in a stronger antitumor effect.
[0011] The tumor therapy method provided in this application, which combines recombinant oncolytic viruses with low-molecular-weight anticancer drugs, employs the following technical solutions.
[0012] This is a tumor treatment method that combines recombinant oncolytic viruses with low-molecular-weight anticancer drugs, and treats tumors by using low-molecular-weight anticancer drugs and recombinant oncolytic viruses in combination.
[0013] The aforementioned small molecule anticancer agents include small molecule anticancer agents targeting ALK, small molecule anticancer agents targeting BTK, small molecule anticancer agents targeting EGFR, small molecule anticancer agents targeting FGFR, small molecule anticancer agents targeting HER2, small molecule anticancer agents targeting Parp, small molecule anticancer agents targeting PI3K, small molecule anticancer agents targeting VEGFR, small molecule anticancer agents targeting CDK4 / 6, and small molecule anticancer agents targeting KRAS.
[0014] The recombinant oncolytic virus includes M protein, G protein, N protein, P protein, and L protein.
[0015] Compared to the amino acid sequence shown in Sequence ID No. 1, the site mutation of the M protein includes one or more of M51R, V221F, and S226R, or the site mutation of the M protein includes one or more of N32S, N49D, M51R, H54Y, V221F, V225I, and S226R, or the site mutation of the M protein includes N32S, N49D, M51R, H54Y, and the leucine coding base at the 111th site. The M protein contains one or more of the following: Quat, V221F, V225I, S226R, or the site mutation of the M protein contains one or more of the following: N32S, N49D, M51R, H54Y, L111A, V221F, V225I, S226R, or the site mutation of the M protein contains one or more of the following: G21E, N32S, N49D, M51R, H54Y, V221F, V225I, S226R, or the M The site mutation of the protein includes one or more of the following: G21E, N32S, M33A, N49D, M51R, H54Y, V221F, V225I, S226R, or the site mutation of the M protein includes one or more of the following: G21E, N32S, M33A, N49D, M51R, H54Y, A133T, V221F, V225I, S226R, or the site mutation of the M protein includes N32S, M33A, N49D, M51R, The site mutation of the M protein includes one or more of H54Y, V221F, V225I, and S226R, or the site mutation of the M protein includes one or more of N32S, M33A, N49D, M51R, H54Y, A133T, V221F, V225I, and S226R, or the site mutation of the M protein includes one or more of N32S, N49D, M51R, H54Y, A133T, V221F, V225I, and S226R.
[0016] Compared to the amino acid sequence shown in Sequence ID No. 12, the site mutations of the G protein include one or more of the following: V53I, A141V, D172Y, K217E, D232G, V331A, V371E, G436D, T438S, F453L, T471I, and Y487H.
[0017] Compared with the amino acid sequence shown in SEQ ID NO: 14, the site mutation of the N protein includes any one or more of I14V, R155K, and S353N.
[0018] Compared with the amino acid sequence shown in SEQ ID NO: 16, the site mutation of the P protein includes any one or more of R50K, V76A, D99E, L126S, L140S, H151Y, I168M, K170E, Y189S, and N237D.
[0019] Compared with the amino acid sequence shown in SEQ ID NO: 18, the site mutation of the L protein includes any one or more of S87P and I487T.
[0020] In the present application, the M protein of the wild-type VSV virus Indiana MuddSummer subtype contains the amino acid sequence shown in SEQ ID NO: 1.
[0021] In a specific embodiment, the M protein contains the amino acid sequence shown in SEQ ID NO: 2.
[0022] In a specific embodiment, the M protein contains the amino acid sequence shown in SEQ ID NO: 3.
[0023] In a specific embodiment, the M protein contains the amino acid sequence shown in SEQ ID NO: 4.
[0024] In a specific embodiment, the M protein contains the amino acid sequence shown in SEQ ID NO: 5.
[0025] In a specific embodiment, the M protein contains the amino acid sequence shown in SEQ ID NO: 6.
[0026] In a specific embodiment, the M protein contains the amino acid sequence shown in SEQ ID NO: 7.
[0027] In a specific embodiment, the M protein comprises the amino acid sequence shown in SEQ ID NO: 8.
[0028] In a specific embodiment, the M protein comprises the amino acid sequence shown in SEQ ID NO: 9.
[0029] In a specific embodiment, the M protein comprises the amino acid sequence shown in SEQ ID NO: 10.
[0030] In a specific embodiment, the M protein comprises the amino acid sequence shown in SEQ ID NO: 11.
[0031] In the present application, the G protein of the wild-type VSV virus Indiana MuddSummer subtype comprises the amino acid sequence shown in SEQ ID NO: 12.
[0032] In a specific embodiment, the G protein comprises the amino acid sequence shown in SEQ ID NO: 13.
[0033] In the present application, the N protein of the wild-type VSV virus Indiana MuddSummer subtype comprises the amino acid sequence shown in SEQ ID NO: 14.
[0034] In a specific embodiment, the N protein comprises the amino acid sequence shown in SEQ ID NO: 15.
[0035] In the present application, the P protein of the wild-type VSV virus Indiana MuddSummer subtype comprises the amino acid sequence shown in SEQ ID NO: 16.
[0036] In a specific embodiment, the P protein comprises the amino acid sequence shown in SEQ ID NO: 17.
[0037] In the present application, the L protein of the wild-type VSV virus Indiana MuddSummer subtype comprises the amino acid sequence shown in SEQ ID NO: 18.
[0038] In one specific embodiment, the L protein includes the amino acid sequence shown in SEQ ID NO: 19.
[0039] Preferably, the recombinant oncolytic virus includes one or more of the following: baculovirus, poxvirus, herpes simplex virus, measles virus, Semryki forest virus, poliovirus, reovirus, Seneca Valley virus, echotype enterovirus, coxsackievirus, Newcastle disease virus, and Malabar virus.
[0040] In some specific embodiments, the recombinant oncolytic virus is obtained by site-directed mutation based on a baculovirus.
[0041] In some specific embodiments, the recombinant oncolytic virus is obtained by site-directed mutation based on Vesicular Stomatitis Virus (VSV virus).
[0042] In some specific embodiments, the recombinant oncolytic virus is obtained by site-directed mutation based on the VSV Indiana MuddSummer subtype.
[0043] Furthermore, the recombinant oncolytic virus further comprises an antigen encoded by an exogenous gene.
[0044] Furthermore, the antigen is selected from solid tumor antigens or hematopoietic tumor antigens.
[0045] Furthermore, the solid tumor antigens include 5T4, ROR1, EGFR, FcγRI (CD64), FcγRIIa (CD32a), FcγRIIb (CD32b), CD28, CD137 (4-1BB), CTLA-4, HER2, HER3, FAS, FAP (fibroblast activating protein), LGR5, C5aR1, A2AR, fibroblast growth factor receptor 1 (FGFR1), FGFR2, FGFR3, FGFR4, glucocorticoid-induced TNFR-related (GITR) protein, lymphotoxin-β receptor (LTβR), and tumor necrosis factor-associated apoptosis-inducible lignan. TRAIL receptor 1, TRAIL receptor 2, prostate-specific membrane antigen (PSMA) protein, prostate stem cell antigen (PSCA) protein, tumor-associated protein carbonic anhydrase IX (CAIX), epidermal growth factor receptor 1 (EGFR1), EGFRvIII, ErbB3 (HER3), folate receptor, ephrin receptor, PDGFRa, ErbB-2, CD2, CD40, CD74, CD80, CD86, CCAM5 (CD66e), CCAM6 (CD66c), p53, MET (tyrosine protein kinase Met), HGFR, MAGE-A1, MAG E-A2, MAGE-A3, MAGE-A4, MAGE-A6, MAGE-A10, MAGE-A12, BACE, DAM-6, DAM-10, GAGE-1, GAGE-2, GAGE-8, GAGE-3, GAGE-4, GAGE-5, GAGE-6, GAGE-7B, NA88-A, NY-ESO-1, BRCA1, BRCA2, MART-1, MC1R, Gp100, PSA, PSM, tyrosinase, TRP-1, TRP-2, ART-4, CAMEL, Cyp-B, hTERT, hTRT, iCE, MUC2, P-cadherin, myostatin (My ostatin)(GDF8), Cripto(TDGF1), MUC5AC, PRAME, P15, RU1, RU2, SART-1, SART-3, AFP, β-catenin / m, caspase-8 / m, CDK-4 / m, ELF2M, GnT-V, G250, HSP70-2M, HST-2, KIAA0205, MUM-1, MUM-2, MUM-3, myosin / m, RAGE, SART-2, TRP-2 / INT2, 707-AP, Annexin II, CDC27 / m, TPI / mbcr-abl, ETV6 / AML, LDLR / FUT, Pml / RARα,This includes, but is not limited to, TEL / AML1, CD28, CD137, CanAg, Mesothelin (MSLN), DR5, PD-1, PD-L1, IGF-1R, CXCR4, Neuropilin 1 (NRP-1), Phosphatidylinositol proteoglycans (glypican2 / 3, GPC2 / 3), EphA2, B7-H3, B7-H4, gpA33, GPC3, SSTR2, GD2, VEGF-A, VEGFR-2, PDGFR-a, ANKL, RANKL, MSLN, EBV, TROP2, FOLR1, AXL, Claude 18.2, MUC1, TPBG, CEA, and EpCAM.
[0046] Furthermore, the aforementioned hematopoietic tumor antigens include BCMA (TNFRSF17), CD4, CD5 (Leu-1), CD7, CD10, FcγRIIIa (CD16a), FcγRIIIb (CD16b), CD19, CD20 (MS4A1), CD22 (Siglec-2), CD23, CD30 (TNFRSF8), CD33 (Siglec-3), CD34, CD37, CD38, CD44, CD47, CD56 (NCAM1), CD70, CD117, CD123 (IL3RA), and CD138 (SDC 1) Includes, but is not limited to, CD174, CLL-1, ROR1, NKG2DL1 / 2 (ULBP1 / 2), IL1R3 (IL-1-RAP), FCRL5, GPRC5D, CLEC12A, WT1, FLT3, TLR8, SHP2, KAT6A / B, CSNK1A1, FLI1, IKZF1 / 3, PI3K, c-Kit, SLAMF3 (CD229), SLAMF7 (CD319), TCRB-chain, ITGB7, k-1gG, TACI, TRBCI, LeY, and MUC1.
[0047] Furthermore, the antigen is selected from one or more of the following: CD19, CD22, BCMA, MUC1, NY-ESO-1, MAGE A4, MET, Claude 18.2, MSLN, EGFR, VEGFR2, HER2, TPBG, AFP, and MAGE A10.
[0048] In one specific embodiment, the antigen CD19 includes the amino acid sequence shown in SEQ ID NO: 20.
[0049] In one specific embodiment, the antigen CD22 includes the amino acid sequence shown in SEQ ID NO: 21.
[0050] In one specific embodiment, the antigen NY-ESO-1 includes the amino acid sequence shown in SEQ ID NO: 22.
[0051] In one specific embodiment, the antigen MAGE A4 includes the amino acid sequence shown in SEQ ID NO: 23.
[0052] In one specific embodiment, the antigen Claude 18.2 includes the amino acid sequence shown in SEQ ID NO: 24.
[0053] In one specific embodiment, the antigen EGFR includes the amino acid sequence shown in SEQ ID NO: 25.
[0054] In one specific embodiment, the antigen HER2 includes the amino acid sequence shown in SEQ ID NO: 26.
[0055] Furthermore, the aforementioned small molecule anticancer drug is selected from one or more of the following:
[0056] Small molecule anticancer drugs that target ALK include, but are not limited to, Alectinib, Brigatinib, Ceritinib, Crizobtinib, Entrectinib, Lorlatinib, and Ensartinib.
[0057] Small molecule anticancer agents that target BTK include, but are not limited to, Acalabrutinib, Ibrutinib, Zanubrutinib, and Orelabrutinib.
[0058] Small molecule anticancer drugs that target EGFR include, but are not limited to, Afatinib, Dacomitinib, Erlotinib, Gefitinib, Icotinib, Lapatinib, Mobocertinib, Osimertinib, Rybrevant, Befortinib, Lazetinib, Dasatinib, Brigatinib, Vandetanib, Almonetinib, and Furmonertinib.
[0059] Small molecule anticancer drugs that target FGFR include, but are not limited to, Erdafitinib, Infigratinib, Pemazyre, Pemigatinib, Lenvatinib, Pazopanib, Anlotinib, and Ponatinib.
[0060] Small molecule anticancer drugs that target HER2 include, but are not limited to, neratinib, pyrotinib, tucatinib, and mobocertinib.
[0061] Small molecule anticancer drugs that target Parp include, but are not limited to, avapritinib, fluzoparib, niraparib, olaparib, and rucaparib.
[0062] Small molecule anticancer drugs that target PI3K include, but are not limited to, duvelisib and linperlisib.
[0063] Small molecule anticancer drugs that target VEGFR include, but are not limited to, apatinib, axitinib, lenvatinib, pazopanib, regorafenib, anlotinib, cabozantinib, sunitinib, vandetanib, ponatinib, sorafenib, donafenib, surufatinib, and fruquintinib.
[0064] Small molecule anticancer drugs that target CDK4 / 6 include, but are not limited to, Abemaciclib, Dalpiciclib, Palbociclib, and Ribociclib.
[0065] Small molecule anticancer agents targeting KRAS include, but are not limited to, small molecule anticancer agents targeting KRAS G12A, KRAS G12C, KRAS G12D, KRAS G12R, KRAS G12V, KRAS G13D, KRAS Q61L, and KRAS Q61H.
[0066] Small molecule anticancer agents that target KRAS G12C include, but are not limited to, sotorasib and adagrasib.
[0067] Low-molecular-weight anticancer drugs indicated for malignant melanoma include, but are not limited to, Vemurafenib, Dabrafenib, Encorafenib, Trametinib, Binimetmib, and Cobimetinib.
[0068] Low-molecular-weight anticancer drugs whose indication is cytomas or sarcomas include, but are not limited to, pexidartinib, tazemetostat, pazopanib, and anlotinib.
[0069] Low-molecular-weight anticancer drugs indicated for leukemia include, but are not limited to, Imatinib, Bosutinib, Nilotinib, Gilteritinib, and Ivosidenib.
[0070] Small molecule anticancer drugs indicated for NSCLC include, but are not limited to, Sotorasib, Capmatinib, Tepotinib, Savolitinib, Pralsetinib, Selpercatinib, Alectinib, Brigatinib, Ceritinib, Crizobtinib, Entrectinib, Lorlatinib, Afatinib, Dacomitinib, Erlotinib, Gefitinib, Icotinib, Mobocertinib, Osimertinib, Rybrevant, and Befortinib.
[0071] Furthermore, the small molecule anticancer agent is selected from one or more of the following: tivazanib, Everolimus, Sirolimus, Temsirolimus, Midostaurin, Ripretinib, Selumetinib, Larotrectinib, Lurbinectedin, and Oliverembatinib.
[0072] Furthermore, the aforementioned low-molecular-weight anticancer drug is selected from one or more of the following:
[0073] These are single-target small molecule anticancer drugs. Examples include: Lorlatinib, Acalabrutinib, Ibrutinib, Zanubrutinib, Erlotinib, Gefitinib, Icotinib, Osimertinib, Rybrevant, Befortinib, Lazetinib, Erdafitinib, Infigratinib, Pemazyre, Pemigatinib, Pyrotinib, Tucatinib, Avapritinib, Fluzoparib, Niraparib, Olaparib, Rucaparib, linperlisib, Apatinib, Abemaciclib, Dalpiciclib, Palbociclib, Ribociclib. This includes, but is not limited to, vemurafenib, dabrafenib, encorafenib, trametinib, binimetmib, cobimetinib, pexidartinib, tazemetostat, giltritinib, ivosidenib, sotorasib, capmatinib, tepotinib, savolitinib, praletstinib, selpercatinib, everolimus, sirolimus, temsirolimus, midostaurin, ripretinib, selumetinib, larotrectinib, and lurbinectedin.
[0074] Multitargeted small molecule anticancer agents include, but are not limited to, Alectinib, Brigatinib, Ceritinib, Crizobtinib, Entrectinib, Afatinib, Dacomitinib, Lapatinib, Mobocertinib, Dasatinib, Neratinib, duvelisib, Axitinib, Lenvatinib, Pazopanib, Regorafenib, Anlotinib, Cabozantinib, Sunitinib, Vandetanib, Ponatinib, Sorafenib, Imatinib, Bosutinib, Nilotinib, and tivazanib.
[0075] Furthermore, the small molecule anticancer agent is selected from one or more of the following: Ceritinib, Ibrutinib, Afatinib, Dacomitinib, Icotinib, Lenvatinib, Pazopanib, Anlotinib, Pyrotinib, Niraparib, Olaparib, Regorafenib, Palbociclib, Vemurafenib, Savolitinib, Everolimus, Mobocertinib, and Sotorasib.
[0076] Furthermore, the recombinant oncolytic virus further contains cytokines encoded by exogenous genes.
[0077] Furthermore, the cytokines are selected from interleukins, interferons, tumor necrosis factor, colony-stimulating factor, transforming growth factor β, and the chemokine family.
[0078] Furthermore, the cytokines are selected from one or more of the following: GM-CSF, G-CSF, M-CSF, IL-1, IL-2, IL-4, IL-5, IL-6, IL-9, IL-10, IL-12, IL-13, IL-15, IL-17, IL-18, IL-23, IL-27, IFN-α, IFN-β, IFN-γ, IFN-β, TGF-β, and TNF-α.
[0079] Furthermore, the cytokine is selected from one or more of the following: GM-CSF, IL-2, IL-12, IL-15, IL-18, TNF-α, and IFN-β.
[0080] In one specific embodiment, the cytokine IL-12A includes the amino acid sequence shown in SEQ ID NO: 27.
[0081] In one specific embodiment, the cytokine IL-12B includes the amino acid sequence shown in SEQ ID NO: 28.
[0082] In one specific embodiment, the cytokine IL-18 includes the amino acid sequence shown in SEQ ID NO: 29.
[0083] In some specific embodiments, The recombinant oncolytic virus comprises a nucleic acid molecule, the nucleic acid molecule comprising a nucleic acid sequence encoding the M protein having site mutations, a nucleic acid sequence encoding the G protein having site mutations, a nucleic acid sequence encoding the N protein having site mutations, a nucleic acid sequence encoding the P protein having site mutations, and a nucleic acid sequence encoding the L protein having site mutations.
[0084] In one specific embodiment, the ALK includes the amino acid sequence shown in SEQ ID NO: 30.
[0085] In one specific embodiment, the BTK includes the amino acid sequence shown in SEQ ID NO: 31.
[0086] In one specific embodiment, the FGFR1 includes the amino acid sequence shown in SEQ ID NO: 32.
[0087] In one specific embodiment, the VEGFR includes the amino acid sequence shown in SEQ ID NO: 33.
[0088] In one specific embodiment, The aforementioned CDK4 contains the amino acid sequence shown in SEQ ID NO: 34.
[0089] In one specific embodiment, the CDK6 includes the amino acid sequence shown in SEQ ID NO: 35.
[0090] In one specific embodiment, the BRAF comprises the amino acid sequence shown in SEQ ID NO: 36.
[0091] In one specific embodiment, the MET includes the amino acid sequence shown in SEQ ID NO: 37.
[0092] In one specific embodiment, the KRAS G12C includes the amino acid sequence shown in SEQ ID NO: 38.
[0093] In one specific embodiment, the nucleic acid molecule further includes a nucleic acid sequence encoding a cytokine.
[0094] In one specific embodiment, the nucleic acid molecule further includes a nucleic acid sequence encoding an antigen.
[0095] In one specific embodiment, the nucleic acid sequence encoding the cytokine is located between the nucleic acid sequence encoding the G protein having a site mutation and the nucleic acid sequence encoding the L protein having the site mutation.
[0096] In one specific embodiment, the nucleic acid sequence encoding the antigen is located between the nucleic acid sequence encoding the G protein having a site mutation and the nucleic acid sequence encoding the L protein having the site mutation.
[0097] The antigen sequence inserted into the recombinant oncolytic virus may be a complete sequence or a partially specific sequence. Similarly, the target sequence inserted into the recombinant oncolytic virus may be a complete sequence or a partially specific sequence. Similarly, the cytokine inserted into the recombinant oncolytic virus may be a complete sequence or a partially specific sequence.
[0098] In some specific embodiments, the tumor therapy combining the recombinant oncolytic virus with a low-molecular-weight anticancer drug is used to continuously kill abnormally proliferating cells.
[0099] In some specific embodiments, the abnormally proliferating cells are selected from tumor cells or tumor tissue-associated cells.
[0100] In some specific embodiments, the tumor includes a solid tumor or a hematoma.
[0101] In some specific embodiments, the tumor is acute lymphoblastic leukemia, acute B-cell lymphoblastic leukemia, chronic non-lymphoblastic leukemia, non-Hodgkin lymphoma, anal cancer, astrocytoma, basal cell carcinoma, cholangiocarcinoma, bladder cancer, breast cancer, cervical cancer, chronic myeloproliferative neoplasm, colorectal cancer, endometrial cancer, ependymal tumor, esophageal cancer, diffuse large B-cell lymphoma (DLBCL), sensory neuroblastoma, Ewing's sarcoma, fallopian tube cancer, gallbladder cancer, gastric cancer, gastrointestinal carcinoid tumor. This includes, but is not limited to, hepatocellular carcinoma, hypopharyngeal carcinoma, Kaposi's sarcoma, renal carcinoma, Langhans cell proliferative disorder, pharyngeal carcinoma, liver cancer, lung cancer, malignant melanoma, Merkel cell carcinoma, mesothelioma, oral cancer, neuroblastoma, non-small cell lung cancer, osteosarcoma, ovarian cancer, pancreatic cancer, pancreatic neuroendocrine tumor, pharyngeal carcinoma, pituitary tumor, prostate cancer, rectal cancer, renal cell carcinoma, retinoblastoma, skin cancer, small cell lung cancer, small intestine cancer, squamous cell carcinoma, testicular cancer, thymoma, thyroid cancer, uterine cancer, vaginal cancer, and hemangiomas.
[0102] This application further provides compositions comprising the above-described oncolytic virus vaccine and low-molecular-weight anticancer agent. [Effects of the Invention]
[0103] In short, this application has the following beneficial effects.
[0104] The method of treating tumors by combining recombinant oncolytic viruses and low-molecular-weight anticancer drugs provided in this application exhibits a significant inhibitory effect on tumor growth. Furthermore, the test results of treating tumors by directly combining recombinant oncolytic viruses with low-molecular-weight anticancer drugs are superior to the test results of treating tumors with recombinant oncolytic viruses alone or with low-molecular-weight anticancer drugs alone. Moreover, the test results of treating tumors by inserting recombinant oncolytic viruses into antigen fragments and expressing them, and then combining them with low-molecular-weight anticancer drugs, are superior to the test results of directly combining recombinant oncolytic viruses with low-molecular-weight anticancer drugs or the test results of directly treating tumors by inserting recombinant oncolytic viruses into antigen fragments and expressing them. Therefore, the method of treating tumors by combining recombinant oncolytic viruses and low-molecular-weight anticancer drugs provided in this application further enhances the therapeutic effect on tumor cells.
[0105] The method for treating tumors using recombinant oncolytic viruses and low-molecular-weight anticancer drugs provided in this application exhibits good inhibitory activity against tumor cell growth. Furthermore, the method for treating tumors using recombinant oncolytic viruses and low-molecular-weight anticancer drugs provided in this application exhibits good inhibitory activity against other cancer cells and has potential for broad clinical application. [Brief explanation of the drawing]
[0106] [Figure 1] Figure 1 shows the results of an animal study in which tumors were treated with recombinant oncolytic virus in combination with the low-molecular-weight anticancer drug Mobocertinib. [Figure 2] Figure 2 shows the results of an animal study in which tumors were treated with recombinant oncolytic virus in combination with the low-molecular-weight anticancer drug ceritinib. [Figure 3] Figure 3 shows the results of an animal study in which tumors were treated with recombinant oncolytic virus in combination with the low-molecular-weight anticancer drug ibrutinib. [Figure 4] Figure 4 shows the results of an animal study in which tumors were treated with recombinant oncolytic virus in combination with the low-molecular-weight anticancer drug afatinib. [Figure 5] Figure 5 shows the results of an animal study in which tumors were treated with recombinant oncolytic virus in combination with the low-molecular-weight anticancer drug dacomitinib. [Figure 6] Figure 6 shows the results of an animal study in which tumors were treated with recombinant oncolytic virus in combination with the low-molecular-weight anticancer drug Icotinib. [Figure 7] Figure 7 shows the results of an animal study in which tumors were treated with recombinant oncolytic virus in combination with the low-molecular-weight anticancer drug Lenvatinib. [Figure 8] Figure 8 shows the results of an animal study in which tumors were treated with recombinant oncolytic virus in combination with the low-molecular-weight anticancer drug pazopanib. [Figure 9] Figure 9 shows the results of an animal study in which tumors were treated with recombinant oncolytic virus in combination with the low-molecular-weight anticancer drug anlotinib. [Figure 10] Figure 10 shows the results of an animal study in which tumors were treated with recombinant oncolytic virus in combination with the low-molecular-weight anticancer drug pyrotinib. [Figure 11] Figure 11 shows the results of an animal study in which tumors were treated with recombinant oncolytic virus in combination with the low-molecular-weight anticancer drug niraparib. [Figure 12] Figure 12 shows the results of an animal study in which tumors were treated with recombinant oncolytic virus in combination with the low-molecular-weight anticancer drug olaparib. [Figure 13] Figure 13 shows the results of an animal study in which tumors were treated with recombinant oncolytic virus in combination with the low-molecular-weight anticancer drug Regorafenib. [Figure 14] Figure 14 shows the results of an animal study in which tumors were treated with recombinant oncolytic virus in combination with the low-molecular-weight anticancer drug palbociclib. [Figure 15] Figure 15 shows the results of an animal study in which tumors were treated with recombinant oncolytic virus in combination with the low-molecular-weight anticancer drug Vemurafenib. [Figure 16] Figure 16 shows the results of an animal study in which tumors were treated with recombinant oncolytic virus in combination with the low-molecular-weight anticancer drug savolitinib. [Figure 17] Figure 17 shows the results of an animal study in which a recombinant oncolytic virus was used in combination with the low-molecular-weight anticancer drug Sotorasib to treat tumors.
[0107] Those skilled in the art will readily understand other aspects and advantages of this application from the following detailed description. Only exemplary embodiments of this application are shown and described in the following detailed description. As those skilled in the art will understand, depending on the content of this application, those skilled in the art may modify the specific embodiments disclosed without departing from the spirit and scope of the invention. Correspondingly, the drawings and description of this application are illustrative and not limiting. [Modes for carrying out the invention]
[0108] The embodiments of the present invention will be described below with specific examples, but those skilled in the art will be able to easily understand the other advantages and effects of the present invention from the information disclosed herein. Term definition
[0109] In this application, the term “oncolytic virus” typically refers to a virus that can replicate in tumor cells and kill them. Oncolytic viruses include, but are not limited to, Vesicular Stomatitis Virus (abbreviated as “VSV virus”), poxvirus, herpes simplex virus (HSV), measles virus, Semryki Forest virus, poliovirus, reovirus, Seneca Valley virus (SVV), echotype enterovirus, coxsackievirus, Newcastle disease virus (NDV), and Malabar virus. In some embodiments, the oncolytic virus is modified to improve its selectivity for tumor cells. In some embodiments, the oncolytic virus is modified to reduce its immunogenicity.
[0110] In some embodiments, the VSV virus is a variant of the VSV virus Indiana MuddSummer subtype strain and can be used to treat tumors. Such viruses do not interact with endogenous IFN-β in normal cells and can selectively proliferate and grow only in tumor cells.
[0111] VSV viruses can express a variety of cell surface molecules, including low-density lipoprotein receptors, phosphatidylserine, salivary lipids (sialolipid), and heparan sulfate, which allow them to adhere to the cell surface. Compared to other oncolytic virus platforms currently under development, VSV viruses have the following advantages: (1) a small genome, short replication time, and fast transsynaptic rate; (2) very high exogenous gene expression, resulting in high titers and the ability to mass-produce them; and (3) an independent cell cycle, eliminating the risk of transformation within the host cell cytoplasm. Such oncolytic viruses do not integrate into DNA and, after detoxification, can avoid the development of neurological inflammation caused by wild-type viruses. Given these characteristics, VSV holds great potential in tumor immunotherapy.
[0112] In some embodiments, site-directed gene mutations may be performed on the M protein and / or G protein and / or N protein and / or P protein and / or L protein of the VSV virus.
[0113] In one embodiment, the recombinant oncolytic virus described in this application is genetically modified, for example, by modification of one or more genes, thereby improving its tumor selectivity and / or preferentially replicating in dividing cells. The genetically modified gene may be a modification of a gene involved in the processes of DNA / RNA replication, nucleic acid metabolism, host orientation, surface adhesion, toxicity, lysis, and diffusion, or it may be a modification that incorporates an exogenous gene. The exogenous gene may include an exogenous immunomodulatory gene, an exogenous screening gene, an exogenous reporter gene, etc. The modified oncolytic virus is an amino acid-level modified oncolytic virus, for example, by insertion, deletion, or substitution of one or more amino acids.
[0114] In this application, the term "M protein" usually refers to the VSV virus matrix protein. The M protein is an important toxic factor of the VSV virus and is also a protein known to interfere with the mouse innate immune response to the VSV virus. The term "M protein" further includes its homologs, orthologous forms, variations, functionally active fragments, etc. In this application, the M protein of the wild-type VSV virus Indiana MuddSummer subtype may include the amino acid sequence shown in SEQ ID NO: 1. In this application, the M protein of the oncolytic virus may include the amino acid sequences shown in SEQ ID NOs: 2 to 11.
[0115] In this application, the term "G protein" usually refers to the glycoprotein of the VSV virus, also known as the envelope protein. The term "G protein" further includes its homologs, orthologous forms, variations, functionally active fragments, etc. In this application, the G protein of the wild-type VSV virus Indiana MuddSummer subtype may include the amino acid sequence shown in SEQ ID NO: 12. In this application, the G protein of the oncolytic virus may include the amino acid sequence shown in SEQ ID NO: 13.
[0116] In this application, the term “N protein” typically refers to the nucleocapsid protein of the VSV virus. The term “N protein” further includes its homologs, orthologous forms, variations, functionally active fragments, etc. In this application, the N protein of the wild-type VSV virus Indiana MuddSummer subtype may include the amino acid sequence shown in SEQ ID NO: 14. In this application, the N protein of the oncolytic virus may include the amino acid sequence shown in SEQ ID NO: 15.
[0117] In this application, the term "P protein" generally refers to the phosphoprotein of the VSV virus. The term "P protein" further includes its homologs, orthologous forms, variations, functionally active fragments, etc. In this application, the P protein of the wild-type VSV virus Indiana MuddSummer subtype may include the amino acid sequence shown in SEQ ID NO: 16. In this application, the P protein of the oncolytic virus may include the amino acid sequence shown in SEQ ID NO: 17.
[0118] In this application, the term “L protein” typically refers to the VSV virus RNA polymerase protein. The L gene of the VSV virus encodes the RNApoly E protein. The term “L protein” further includes its homologs, orthologous forms, variations, functionally active fragments, etc. In this application, the L protein of the wild-type VSV virus Indiana MuddSummer subtype may include the amino acid sequence shown in SEQ ID NO: 18. In this application, the L protein of the oncolytic virus may include the amino acid sequence shown in SEQ ID NO: 19.
[0119] In this application, protein mutation sites are typically expressed as "amino acid + number of amino acid sites + mutated amino acid". In this application, such mutations include, but are not limited to, the addition, substitution, deletion, and / or deletion of amino acids. For example, the term "M51R" typically refers to a mutation from methionine M to arginine R at site 51.
[0120] In this application, the term "amino acid substitution" usually means replacing one amino acid residue present in a parent sequence with another amino acid residue. The amino acids in the parent sequence may be substituted, for example, by chemical synthesis or by recombination methods known to those skilled in the art. Therefore, "substitution at position xx" usually means replacing the amino acid present at position xx with an alternative amino acid residue. In this application, such amino acid substitution may include amino acid mutations.
[0121] In this application, the term "mutation" generally means altering the nucleotide or amino acid sequence of a wild-type molecule. Amino acid changes may include substitution, deletion, insertion, addition, cleavage, or modification or cutting of proteins.
[0122] In this application, the recombinant oncolytic virus performs site-directed mutagenesis on the M protein and / or G protein and / or N protein and / or P protein and / or L protein of the VSV virus, while simultaneously integrating a foreign gene. The foreign gene is specifically a gene encoding an antigen and / or cytokine.
[0123] In this application, the term "low molecular weight anticancer agent" refers to a chemical substance or peptide, which is typically a signal transduction inhibitor and is referred to as a low molecular weight anticancer agent because of its small molecular weight. Low molecular weight anticancer agents are typically manufactured in an orally administered form. When taken by a patient, they dissolve quickly in the intestines and, after being absorbed into the body, inhibit the activity of certain kinases through active conformational binding, thereby preventing the growth of cancer cells or blocking the passage of signals mediated by tumor cells, and inhibiting the action of abnormal protein activity, thereby preventing the growth and spread of cancer cells.
[0124] ALK is a receptor tyrosine kinase. Activated ALK activates the downstream ALK / PLCV, JAK / STAT, MEK / ERK, and PI3K / AKT pathways, thereby promoting cell cycle progression, proliferation, angiogenesis, and ultimately tumor development. Small molecule anticancer drugs targeting ALK inhibit ALK phosphorylation and the activation of ALK-mediated downstream signaling proteins STAT3 and AKT, inhibiting ALK fusion and proliferation, and reducing tumor cell vitality.
[0125] BTK is a tyrosine kinase present in B cells and is central to the transmission of B cell growth signals. Research has shown that BTK is a key protein in the rapid increase of malignant B cells. Small molecule anticancer drugs that target BTK inactivate BTK, inhibit B cell growth signaling, and relatively accurately inhibit the growth of malignant B cells, thereby controlling the number of malignant B cells.
[0126] EGFR is a glycoprotein belonging to the tyrosine kinase receptor class. It penetrates the cell membrane, binds to a ligand, and is activated. After activation, it is converted from monomer to dimer, activating downstream intracellular pathways and inducing cell proliferation. Studies have indicated that solid tumors require high or abnormal expression of EGFR. EGFR-activating mutations lead to tyrosine kinase structural activation, phosphorylation of downstream pathways, and ultimately uncontrolled cell proliferation. Small molecule anticancer drugs targeting EGFR can block EGFR activity and thus block activation of related pathways.
[0127] Modifications to the FGFR molecule can trigger abnormal FGF / FGFR signaling, promoting cell proliferation, angiogenesis, invasion, metastasis, and anti-apoptosis, which contributes to the diversification of human malignancies. Common types of FGFR mutations include gene amplification / fusion / deletion mutations. The FGFR family mainly consists of four subtypes: FGFR1, FGFR2, FGFR3, and FGFR4, as well as several isomer molecules. Each subtype has structural features including an extracellular domain bound to a ligand, a transmembrane domain, and an intracellular domain for receptor phosphorylation, and is part of the tyrosine kinase signaling pathway responsible for cell proliferation and differentiation. By forming a ternary complex with 18 different fibroblast growth factors (FGFs), they further activate a series of signaling pathways and participate in the regulation of physiological processes in living organisms, such as embryonic and fetal development, wound healing, and angiogenesis. Small molecule anticancer drugs that target FGFR inhibit FGFR activity and block related signaling pathways.
[0128] The transmembrane tyrosine kinase receptor protein encoded by HER2 consists of three parts: an extracellular ligand-binding domain, a single-strand transmembrane domain, and an intracellular protein tyrosine kinase active domain. The extracellular domain forms homodimers (HER2-HER2) or heterodimers (HER2-EGFR), mediating phosphorylation of the intracellular tyrosine kinase active domain and further activating downstream signaling pathways, thereby promoting cell proliferation and angiogenesis. The HER2 protein, the product of the gene encoding HER2, is normally expressed only in fetuses and, after adulthood, is expressed at low levels in only a very small number of tissues. The HER2 receptor on the surface of HER2-positive cells is 10 to 100 times higher than in normal cells. Studies have shown that HER2 gene proliferation / overexpression is present in more than 30% of human tumors, including breast cancer, ovarian cancer, endometrial cancer, fallopian tube cancer, gastric cancer, and prostate cancer. Small molecule anticancer drugs targeting HER2 are oral non-peptide anilinoquinazolone compounds homologous to ATP. This similarity allows for competition for the ATP-binding domain of protein kinases, thereby inhibiting phosphorylation and subsequent activation of signaling pathways, further inducing apoptosis and suppressing cell proliferation.
[0129] Parp is a DNA damage repair enzyme that plays a crucial role in the single-strand DNA repair pathway. Specifically, when DNA is damaged, Parp is activated, which recognizes and binds to the DNA break site. Furthermore, it activates and catalyzes the poly(ADP-ribosylation) of the receptor protein, participating in the DNA repair process. Small molecule anticancer drugs that target Parp can disrupt the above repair process, preventing the repair of damaged DNA and causing cell death. In normal cells, after single-strand repair is disrupted, another repair pathway, namely homologous recombination repair, may be activated. Therefore, small molecule anticancer drugs that target Parp are not very toxic to normal cells. However, if homologous recombination repair function is also impaired in certain tumor cells, small molecule anticancer drugs that target Parp can selectively kill BRCA1 / 2 gene-deficient tumor cells, which is known as "synthetic lethality."
[0130] The PI3K / Akt / mTOR signaling pathway is involved in processes such as the proliferation, survival, transcription, translation, and metabolism of malignant tumor cells. Small molecule anticancer agents targeting PI3K can act on lymphoma cells, inhibiting PI3K expression and reducing the phosphorylation level of AKT protein, thereby inducing apoptosis in malignant B lymphocytes and inhibiting their proliferation.
[0131] VEGFR is a receptor for VEGF and is expressed in lymphatic vessels and vascular endothelium. VEGFR1 / 2 / 3 regulates the proliferation and migration of endothelial cells, is highly expressed in many tumors, plays an important role in tumor angiogenesis, and inhibition of VEGFR is an effective treatment for many cancers. Small molecule anticancer drugs that target VEGFR block the VEGF signaling pathway by binding to VEGF or interfering with different VEGFR domains, thereby inhibiting the proliferation and migration of endothelial cells.
[0132] CDK4 / 6 are protein kinases discovered for their regulatory roles in the cell cycle, and are also recognized for their involvement in transcriptional regulation, mRNA processing, and neuronal differentiation. In cyclin-dependent kinases, CDK4 and CDK6 can form complexes with cyclin D, thereby promoting cell proliferation by phosphorylating the RB protein (retinoblastoma protein) and releasing the transcription factor E2F1. Small molecule anticancer drugs targeting CDK4 / 6 effectively reduce the phosphorylation of the Rb protein, downregulating E2F expression, thus arresting the cell cycle and inhibiting cell proliferation.
[0133] More than 0% of chronic myeloid leukemia (CML) patients have their condition caused by the formation of the Philadelphia chromosome, a chromosomal abnormality. The Philadelphia chromosome is a translocation of chromosomes 9 and 22. This translocation causes the abl oncogene, originally located on chromosome 9, to bind with the bcr gene on chromosome 22, forming a bcr-abl fusion gene. The protein originally expressed by the abl gene is an intracellular tyrosine kinase. After the translocation, the bcr gene affects the regulation of the abl gene, and the bcr-abl fusion protein, by binding with the GRB2 and SRC proteins, further activates the Ras-Raf pathway, causing growth factor-independent cell proliferation, activating the PI3K pathway to inhibit programmed cell death, activating the CRKL-FAK-PYK2 pathway to reduce cell surface viscosity, thereby enhancing the transportability of cancer cells, and participating in the JAK-STAT pathway for signal transduction and transcriptional activation. Ultimately, cancer cells with the abnormal bcr-abl gene continue to proliferate and metastasize, further exhibiting leukemia. Small molecule anticancer drugs indicated for leukemia can inhibit not only ABL kinase but also related signaling pathways such as Kit and the growth factor PDGFR.
[0134] JAK is a non-receptor tyrosine protein kinase with four subtypes: JAK1, JAK2, JAK3, and TYK2. Three subtypes, JAK1, JAK2, and TYK2, are widely distributed in various tissues and cells throughout the body, while JAK3 is distributed only in the bone marrow and lymphoid system. The JAK-STAT signaling pathway is essential for both immune and hematopoietic functions, and various different inflammatory factors activate this intracellular signaling pathway, triggering inflammatory responses. Currently, JAK is a novel target in the fields of immuno-inflammatory diseases and oncology. Small molecule anticancer drugs that target JAK inhibit the aforementioned JAK-STAT signaling pathway.
[0135] The KRAS protein, through its GTP hydrolysis activity, can act as a downstream binary switch for cell surface receptors during signal transduction. Simply put, the nucleotide binding state of KRAS determines its activation state. In the absence of mitotic signaling, the KRAS protein is primarily bound to GDP and in an inactive conformation. This inactive state is maintained by endogenous GTP hydrolysis activity and interaction with GTPase enzyme-activating protein (GAP), thus accelerating the conversion of GTP to GDP. When cell surface receptors are activated by mitotic signaling, they recruit guanine nucleotide exchange factors (GEFs) to bind to inactive KRAS, effluxing GDP from the active site and passively loading GTP. The binding of GTP to KRAS converts the active site from an open conformation to a closed conformation, which facilitates subsequent interactions between KRAS and various effector proteins. KRAS is one of the most common oncogenes in solid tumors, with KRAS mutations found in approximately 30% of tumors, including 90% of pancreatic cancers, 30-40% of colorectal cancers, and 15-20% of lung cancers. Of these KRAS gene mutations, 97% occur at amino acid residues 12 or 13, such as G12C, G12D, and G13D, with the G12C mutation being the most common. KRAS G12C mutations occur in approximately 14% of lung adenocarcinomas (the most common subtype of NSCLC), 4% of colorectal cancers, and 2% of pancreatic cancers. Patients with this mutation have a poor prognosis, are prone to developing drug resistance to standard treatments, and have limited treatment options if chemotherapy or immunotherapy fails. As one of the most difficult targets to overcome, currently approved inhibitors for the KRAS G12C mutation include Lumakras (sotorasib) and Krazati (adagrasib).
[0136] Adagrasib is a specific inhibitor of the KRAS G12C variant and demonstrates excellent therapeutic efficacy in the treatment of non-small cell lung cancer, colorectal cancer, and other solid tumors.
[0137] In some specific embodiments, the low-molecular-weight anticancer agent includes, but is not limited to, the following:
[0138] 1. Small molecule anticancer drugs targeting ALK (anaplastic lymphoma kinase):
[0139] Alectinib (Roche) targets ALK and RET, and its indication may be ALK-positive NSCLC (non-small cell lung cancer).
[0140] Brigatinib (Ariad Pharmaceuticals) targets ALK, ROS1, IGF-1R, FLT3, and EGFR, and may be indicated for ALK-positive NSCLC.
[0141] Ceritinib (Novartis) targets ALK, IGF-1R, InsR, and ROS1, and may be indicated for ALK-positive NSCLC.
[0142] Crizobtinib (Pfizer) targets ALK, c-Met, HGFR, ROS1, and MST1R, and its indication may be ALK and ROS1-positive NSCLC.
[0143] Entrectinib (Roche) targets TRKA / B / C, ROS1, and ALK, and its indications may include ROS1-positive NSCLC and solid tumors expressing NTRK protein fusion.
[0144] Lorlatinib (Pfizer) targets ALK, and its indication may be ALK-positive NSCLC.
[0145] Ensartinib targets ALK.
[0146] 2. Small molecule anticancer drugs that target BTK (tyrosine kinase)
[0147] Acalabrutinib (AstraZeneca) targets BTK and may also be indicated for mantle cell lymphoma, CLL (chronic lymphocytic leukemia), and SLL (small lymphocytic lymphoma).
[0148] Ibrutinib (pharmacyclics) targets BTK and may be indicated for mantle cell lymphoma, CLL, and Waldenstrom's macroglobulinemia.
[0149] Zanubrutinib (BayGene) targets BTK and may be indicated for mantle cell lymphoma.
[0150] Orelabrutinib targets BTK.
[0151] 3. Small molecule anticancer drugs that target EGFR (epidermal growth factor receptor)
[0152] Afatinib (Boehringer Ingelheim) targets EGFR, ERBB2, and ERBB4, and may be indicated for NSCLC2013 and scaly NSCLC2016.
[0153] Dacomitinib (Pfizer) targets EGFR, ERBB, and ERBB4, and its indication may also be NSCLC with EGFR mutations.
[0154] Erlotinib (OSI Pharmaceuticals) targets EGFR and may also be indicated for NSCLC and pancreatic cancer.
[0155] Gefitinib (AstraZeneca) targets EGFR and may be indicated for NSCLC.
[0156] Icotinib (Betta Pharmaceuticals) targets EGFR and may be indicated for NSCLC.
[0157] Lapatinib (SmithKline Beecham) targets EGFR and ErbB2, and its indication may also be breast cancer.
[0158] Mobocertinib (Takeda Pharmaceutical Company) targets EGFR and HER2, and its indication may be locally advanced or metastatic NSCLC with EGFR gene exon 20 insertion mutations.
[0159] Osimertinib (AstraZeneca) targets EGFR T970M, and its indication may also be NSCLC with EGFR-sensitive mutations.
[0160] Rybrevant (Janssen) targets EGFR, and its indication may also be NSCLC with an EGFR gene exon 20 insertion mutation.
[0161] Befortinib (Betta Pharmaceuticals) targets EGFR, and its indication may be EGFR-resistant T790M mutant NSCLC.
[0162] Lazetinib (Verda) targets EGFR and may be indicated for NSCLC.
[0163] Dasatinib (Bristol-Myers Squibb) targets bcr-abl, EGFR, Src, Lck, Yes, Fyn, Kit, EphA2, and PDGFRβ, and may be indicated for chronic myeloid leukemia.
[0164] Almonetinib (ametinib, Hausen Pharmaceuticals) targets EGFR.
[0165] Furmonertinib (bometinib, Ellis Pharmaceuticals) targets EGFR.
[0166] 4. Small molecule anticancer drugs that target FGFR (fibroblast growth factor receptor)
[0167] Erdafitinib (Janssen Biotech) targets FGFR1 / 2 / 3 / 4 and may be indicated for urothelial bladder cancer.
[0168] Infigratinib (QED Therapeutics Co., Ltd.) targets FGFR2 and may be indicated for advanced or metastatic FGFR2 fusion cholangiocarcinoma.
[0169] Pemazyre (pemetinib, Incyte) targets FGFR1 / 2 / 3 and may be indicated for advanced cholangiocarcinoma.
[0170] Pemigatinib (Incyte) targets FGFR1 / 2 / 3 and may be indicated for locally advanced or metastatic cholangiocarcinoma with FGFR2 fusion or rearrangement.
[0171] 5. Small molecule anticancer drugs that target HER2 (human epidermal growth factor receptor)
[0172] Neratinib (Puma Pharmaceuticals) targets ERBB2 and HER2, and its indication may also be HER2-positive breast cancer.
[0173] Pyrotinib (Pirlotinib, Hanrui) targets HER2 and may be indicated for solid tumors.
[0174] Tucatinib (Seattle Genetics) targets HER2 and may be indicated for inoperable or metastatic, previously treated, advanced HER2-positive breast cancer.
[0175] 6. Small molecule anticancer agents that target Parp (poly-ADP-ribose polymerase)
[0176] Avapritinib (Blueprint Medicines Corp) targets Parp and may be indicated for gastrointestinal stromal tumors with PDGFR gene exon 18 mutations.
[0177] Fluzoparib (Hanrui) targets Parp, and its indications may include platinum-sensitive recurrent ovarian cancer, fallopian tube cancer, or primary peritoneal cancer, platinum-sensitive recurrent epithelial ovarian cancer, and fallopian tube cancer with germline BRCA mutations, which have previously received second-line chemotherapy or higher.
[0178] Niraparib (ZEJULATesaro, Inc.) targets Parp and may be indicated for epithelial ovarian cancer, fallopian tube cancer, and primary peritoneal cancer that show a complete or partial response to first-line platinum-based chemotherapy while maintaining treatment.
[0179] Olaparib (AstraZeneca) targets Parp and may be indicated for HRD-positive advanced ovarian cancer, fallopian tube cancer, or primary peritoneal cancer.
[0180] Rucaparib (fluzoparib, Rubraca clovis oncology, Inc.) targets Parp and may be indicated for prostate cancer following androgen receptor and taxane therapy.
[0181] 7. Small molecule anticancer drugs targeting PI3K (phosphatidylinositol 3-hydroxykinase)
[0182] duvelisib (also known as duvelisib) targets both PI3K-δ and PI3K-γ dual inhibitors and may be indicated for relapsed / refractory follicular lymphoma.
[0183] Linperlisib (YL PHARMA) targets PI3K-δ highly selective inhibitors and may be indicated for relapsed / refractory follicular lymphoma.
[0184] 8. Small molecule anticancer drugs that target VEGFR (vascular endothelial growth factor receptor)
[0185] Apatinib (also known as Hanrui) targets VEGFR2, and its indications may include gastric cancer (2014) and liver cancer (2020).
[0186] Axitinib (Pfizer) targets VEGFR1 / 2 / 3 and PDGFRβ, and its indication may also be RCC (renal cell carcinoma).
[0187] Lenvatinib (Alce Pharmaceuticals) targets VEGFR, FGFR, PDGFR, KIT, and RET, and may also be indicated for DTC (differentiated thyroid cancer).
[0188] Pazopanib (GlaxoSmithKline) targets VEGFR1 / 2 / 3, PDGFRα / β, FGFR1 / 3, Kit, LCk, Fms, and Itk, and may be indicated for renal cancer and soft tissue sarcoma.
[0189] Regorafenib (Bayer Group) targets VEGFR1 / 2 / 3, bcr-abl, B-Raf, B-RafyV600E, and Kit, and may also be indicated for CRC (colorectal cancer) and GIST (gastrointestinal stromal tumor).
[0190] Anlotinib is a multi-target tyrosine kinase inhibitor that effectively acts on targets such as VEGFR, PDGFR, FGFR, and c-Kit, possessing a dual action of anti-tumor angiogenesis and tumor growth inhibition. Its indications may include NSCLC, soft tissue sarcoma, and small cell lung cancer. Furthermore, approval for the treatment of medullary thyroid tumor may soon be approved.
[0191] Cabozantinib (Exelixis Biopharmaceuticals) targets RET, Met, VEGFR1 / 2 / 3, Kit, TrkB, Flt3, Axl, Tie2, and ROS1, and may be indicated for metastatic medullary thyroid carcinoma, advanced renal cancer, and hepatic cancer.
[0192] Sunitinib (Pfizer) targets PDGFRa, VEGFR1 / 2 / 3, Kit, Flt3, CSF-1R, and RET, and may also be indicated for RCC, GIST, and PNET (primitive neuroectodermal tumor).
[0193] Vandetanib (IPR Pharma Co., Ltd.) targets EGFRs, VEGFRs, RET, Brk, Tie2, EphRs, and Srcfamily kinases, and may be indicated for medullary thyroid carcinoma.
[0194] Ponatinib (Ariad Pharmaceuticals) targets bcr-abl, bcr-abl T315I, VEGFR, PDGFR, FGFR, EphR, Src, Kit, RET, Tie2, and Flt3, and may be indicated for chronic myeloid leukemia.
[0195] Sorafenib (Bayer Pharmaceuticals) targets B / C-Raf, B-RafV600E, Kit, Flt3, RET, VEGFR1 / 2 / 3, and PDGFRβ, and may be indicated for hepatocellular carcinoma, RCC, and DTC.
[0196] Donafenib targets VEGFR and PDGFR.
[0197] Surufatinib targets VEGFR1 / 2 / 3, FGFR, and CSF-IR.
[0198] Fruquintinib targets VEGFR1 / 2 / 3.
[0199] 9. Small molecule anticancer drugs targeting CDK4 / 6 (cyclin-dependent kinase 4 / 6)
[0200] Abemaciclib (pomacilin, Eli Lilly and Company) targets CDK4 / 6 and may be indicated for HR+ and HER- breast cancer.
[0201] Dalpiciclib (Dalcili, Hanrui) targets CDK4 / 6 and may be indicated for hormone receptor-positive (HR+), HER2-positive recurrent or metastatic breast cancer that has progressed after prior endocrine therapy, used in conjunction with fulvestrant.
[0202] Palbociclib (Pavocini, Pfizer) targets CDK4 / 6 and may be indicated for ER-+ and HER-- breast cancer.
[0203] Ribociclib (Novartis) targets CDK4 / 6 and may be indicated for HR+ and EGFR- breast cancer.
[0204] 10. Low-molecular-weight anticancer drugs whose indication is malignant melanoma
[0205] Vemurafenib (Hoffman) targets BRAF, and its indication may also be malignant melanoma with the B-RafV600E mutation.
[0206] Dabrafenib (GlaxoSmithKline) targets B-Raf, and its indications may include malignant melanoma, NSCLC, and anaplastic thyroid carcinoma with BRAF mutations.
[0207] Encorafenib (Array Technologies) targets B-Raf-V600E / K, and its indication may also be malignant melanoma with B-Raf-V600E / K mutations.
[0208] Trametinib (GlaxoSmithKline) targets MEK1 / 2 and may be indicated for malignant melanoma and BRAF-mutated NSCLC.
[0209] Binimetmib (bemetinib, Array Technologies) targets MEK1 / 2 and may also be indicated for malignant melanoma with B-RafV600E / K mutations.
[0210] Cobimetinib (coblmetinib, Genentech) targets MEK1 / 2, and its indication may also be BRAF-V600E / K mutation-induced malignant melanoma.
[0211] 11. Small molecular weight anticancer drugs whose indication is cell tumor or sarcoma
[0212] Pexidartinib (Daiichi Sankyo) targets CSFR1 / Kit and may be indicated for tenosynovial giant cell tumors.
[0213] Tazemetostat (Epizyme) targets EZH2 mutations, and its indication may also be epithelioid sarcoma / follicular lymphoma.
[0214] 12. Low-molecular-weight anticancer drugs whose indication is leukemia
[0215] Imatinib (Novartis) targets A / B / C-Raf, B-RafV600E, SRMS, ACK1, MAP4K5, and FGR, and may be indicated for chronic myeloid leukemia, aggressive systemic mastocytosis, CEL (chronic eosinophilic leukemia), GIST, and MDS (myelodysplastic syndrome).
[0216] Bosutinib (YS) targets bcr-abl, Src, Lyn, and Hck, and may be indicated for chronic myeloid leukemia.
[0217] Nilotinib (Novartis) targets bcr-abl / PDGFR and DDR1, and its indication may also be chronic myeloid leukemia.
[0218] Gilteritinib (Astellas) targets FLT3, and its indication may be AML (acute myeloid leukemia) with FLT3 mutations.
[0219] Ivosidenib (Seastone Pharmaceuticals) targets mutant isocitrate dehydrogenase and may be indicated for relapsed or refractory IDH1 acute myeloid leukemia.
[0220] 13. Small molecule anticancer drugs whose indication is NSCLC
[0221] Sotorasib (Amgen) targets KRAS G12C, and its indication may be NSCLC with KRAS G12C mutations.
[0222] Capmatinib (Novartis) targets MET, and its indication may be metastatic NSCLC with MET exon 14 deletion mutations.
[0223] Tepotinib (Merck) targets MET, and its indications may include metastatic NSCLC, gastric cancer, and esophageal cancer with MET exon 14 deletion mutations.
[0224] Savolitinib (Hutchison Wampore) targets MET, and its indication may be progressive NSCLC with MET exon 14 deletion mutations.
[0225] Pralsetinib (Precitinib, Blueprint / Seastone Pharmaceuticals) targets RET, and its indication may be RET fusion-positive metastatic non-NSCLC.
[0226] Selpercatinib (Loxo Oncology) targets RET and may be indicated for patients with RET fusion-positive NSCLC or medullary thyroid carcinoma.
[0227] 14. Other small molecule anticancer drugs
[0228] Tivazanib (AVEO) is a multi-enzyme inhibitor, and its indication may also be RCC.
[0229] Everolimus (Novartis) targets FKBP12 / mTOR and may be indicated for HER2-positive breast cancer, PNET, RCC, and RAML (renal angiomyolipoma).
[0230] Sirolimus (YS) targets FKBP12 / mTOR, and its indication may also be renal transplant lymphangioleiomyomatosis.
[0231] Temsirolimus (YS) targets FKBP12 / mTOR and may be indicated for advanced renal cancer.
[0232] Midostaurin (Novartis) targets FLT3, and its indication may be AML with FLT3 mutations.
[0233] Ripretinib (Decifera) targets KIT / PDGFRα and may be indicated for GIST.
[0234] Selumetinib (AstraZeneca) targets MEK1 / 2 and is indicated for neurofibromatosis type 1, even if it is symptomatic and inoperable plexiform neurofibroma.
[0235] Larotrectinib (Eli Lilly and Company) targets NTRKs, and its indications may include solid tumors with NTRK protein fusions.
[0236] Lurbinectedin (GlaxoSmithKline) is an alkylating agent-targeting drug, and may be indicated for metastatic small cell lung cancer in adults with disease progression during or after platinum-based chemotherapy.
[0237] Olverembatinib (Ascentage Pharmaceuticals) is a small molecule protein tyrosine kinase inhibitor that effectively inhibits the activity of wild-type and various mutant forms of Bcr-Abl tyrosine kinase. It inhibits the phosphorylation of Bcr-Abl tyrosine kinase and the downstream proteins STAT5 and Crkl, blocking the activation of downstream pathways and inducing cell cycle arrest and apoptosis in Bcr-Abl-positive and Bcr-Abl T315I mutant cell lines. Indications may include Bcr-Abl, KIT leukemia, and gastrointestinal stromal tumors.
[0238] 15. Small molecule anticancer drugs targeting KRAS
[0239] Sotorasib targets KRAS G12C.
[0240] Adagrasib targets KRAS G12C.
[0241] In this application, the term "antigen" refers to any substance that can trigger the production of antibodies or immune cells, and is capable of inducing an immune response in the body. That is, it is a substance that is specifically recognized and bound by antigen receptors (TCR / BCR) on the surface of T / B lymphocytes, activates T / B cells, causes them to proliferate and differentiate, generates immune response products (sensitized lymphocytes or antibodies), and can specifically bind to the corresponding products inside and outside the body. Therefore, antigenic substances have two important properties: immunogenicity and immunoreactivity. Immunogenicity refers to the ability of an antigen to induce a specific immune response in the body and produce antibodies and / or sensitized lymphocytes, while immunoreactivity refers to the ability to generate a specific binding reaction inside and outside the body with the corresponding immune effector substance (antibody or sensitized lymphocyte).
[0242] In some specific embodiments, the antigen is exogenous, meaning that the antigen originates from a different species.
[0243] In some specific embodiments, the antigen is an endogenous antigen. Specifically, the antigen is an antigen that is typically expressed in tumor cells.
[0244] In one specific embodiment, the antigen is a tumor-associated antigen (TAA) or a tumor-specific antigen (TSA).
[0245] In one specific embodiment, TAA or TSA covers molecules or a portion thereof that are presented on the cell surface (antigens recognized by CAR), within the cell membrane (antigens recognized by TCR), or in the tumor environment (e.g., in the tumor microenvironment).
[0246] In some specific embodiments, the cells are tumor cells.
[0247] In some specific embodiments, the TAA or TSA comprises a tumor-associated antigen or tumor-specific antigen on the cell surface or within the cell membrane.
[0248] In some specific embodiments, the cells are non-tumor cells present in the tumor environment. For example, they may be present in cells within vascular tissue associated with a tumor or cancer, but are not limited to these.
[0249] In some specific embodiments, TAA or TSA is an antigen produced by blood vessels in the tumor microenvironment.
[0250] In some specific embodiments, TAA or TSA is an antigen in the blood vessels of the tumor microenvironment.
[0251] In some specific embodiments, the cells are matrix cells present in the tumor environment.
[0252] In some specific embodiments, TAA or TSA are matrix cell antigens in the tumor microenvironment.
[0253] In some specific embodiments, the TAA or TSA includes an extracellular epitope of a tumor cell surface antigen, an intracellular or extracellular tetramer of the tumor cell membrane, or other structures recognizable by antibodies or immune cells.
[0254] In some specific embodiments, TAA or TSA comprises an extracellular matrix antigen.
[0255] In some specific embodiments, TAA or TSA contains antigens present in the tumor microenvironment (TME).
[0256] In some specific embodiments, TAA or TSA comprises molecules secreted into the TME by tumor cells.
[0257] In some specific embodiments, TAA or TSA comprises effector molecules secreted into the TME by tumor cells.
[0258] In some specific embodiments, TAA or TSA comprises an effector molecule secreted by tumor cells to TME to downregulate or inhibit the activity of cytotoxic spontaneous killer (NK) cells or T cells.
[0259] In some specific embodiments, the TAA or TSA comprises a soluble activating receptor ligand that is secreted by tumor cells to the TME and blocks the recognition of tumor cells by NK cells or T cells.
[0260] In some specific embodiments, examples of TAA or TSA include 5T4, ROR1, EGFR, FcγRI, FcγRIIa, FcγRIIb, FcγRIIIa, FcγRIIIb, CD28, CD137, CTLA-4, FAS, FAP (fibroblast activating protein), LGR5, C5aR1, A2AR, fibroblast growth factor receptor 1 (FGFR1), FGFR2, FGFR3, FGFR4, and glucocorticoid-induced TNFR-related (G ITR) protein, lymphotoxin-β receptor (LTβR), Toll-like receptor (TLR), tumor necrosis factor-associated apoptosis-inducing ligand receptor 1 (TRAIL receptor 1), TRAIL receptor 2, prostate-specific membrane antigen (PSMA) protein, prostate stem cell antigen (PSCA) protein, tumor-associated protein carbonic anhydrase IX (CAIX), epidermal growth factor receptor 1 (EGFR1), EGFRvIII, human epidermal growth factor receptor 2 (HER2 / neu;Erb2, ErbB3 (Her3), folate receptor, ephrin receptor, PDGFRa, ErbB2, CD2, CD20, CD22, CD30, CD33, CD40, CD37, CD38, CD70, CD74, CD56, CD80, CD86, CD123, CCAM5, CCAM6, BCMA, p53, MET (tyrosine protein kinase Met), hepatocyte growth factor receptor (HGFR), MAGE-A1, MAGE-A2, MAGE-A3, MAGE-A4, MAGE-A6, MAG E-A10, MAGE-A12, BAGE, DAM-6, DAM-10, GAGE-1, GAGE-2, GAGE-8, GAGE-3, GAGE-4, GAGE-5, GAGE-6, GAGE-7B, NA88-A, NY-ESO-1, BRCA1, BRCA2, MART-1, MC1R, Gp100, PSA, PSM, tyrosinase, Wilms tumor antigen (WT1), TRP-1, TRP-2, ART-4, CAMEL, Cyp-B, hTERT, hTRT, iCE, MUC1, MU C2, P-cadherin, Myostatin (GDF8), Cripto (TDGF1), MUC5AC, PRAME, P15, RU1, RU2, SART-1, SART-3, WT1, AFP, β-catenin / m, caspase-8 / m, CDK-4 / m, ELF2M, GnT-V, G250, HSP70-2M, HST-2, KIAA0205, MUM-1, MUM-2, MUM-3, Myosin / m, RAGE, SART-2, TRP-2 / INT2, 707-AP This includes, but is not limited to, Annexin II, CDC27 / m, TPI / mbcr-abl, ETV6 / AML, LDLR / FUT, Pml / RARα, TEL / AML1, CD28, CD137, CanAg, Mesothelin, DR5, PD-1, PD-L1, HER-2, IGF-1R, CXCR4, Neuropilin 1, Phosphatidylinositol Proteoglycan, EphA2, CD138, B7-H3, B7-H4, gpA33, GPC3, SSTR2, or VEGF-R2.
[0261] In this application, the term "cytokines" refers to physiologically active substances synthesized and secreted by immune cells (lymphocytes, monocytes, macrophages, etc.) and their related cells (vascular endothelial cells, fibroblasts, etc.) that regulate the function of other immune cells or target cells, and belong to the category of small molecule peptides or glycoproteins. All cytokines with immunomodulatory effects can be expressed by recombinant oncolytic viruses. Depending on their main function, cytokines are classified into interleukins (IL), interferons (IFN), tumor necrosis factor (TNF), colony-stimulating factor (CSF), transforming growth factor-β family (TGF-β family), growth factors (GF), and chemokine family.
[0262] Interleukins include IL-1, IL-2, IL-7, IL-9, IL-15, IL-21, IL-4, IL-12, IL-18.
[0263] Specifically, regarding interleukin-1 (IL-1), IL-1 is a pleiotropic cytokine involved in cortical inflammatory responses, cell growth, and tissue repair. The IL-1 superfamily has 11 members, such as IL-1A, IL-1B, IL-1Ra, and IL-18. IL-1 is a drug target for some cancers and is also used in cell therapy. In cellular immunotherapy, IL-1 stimulates the proliferation of CD4+ T cells in vitro, induces the production of IL-2, and simultaneously stimulates the activation of CD8+ / IL1R+ T cells, thereby stimulating the proliferation of mature B cells and the secretion of immunoglobulin proteins.
[0264] Specifically, regarding interleukin-2 (IL-2), also known as T cell growth factor, it is produced when T cells respond to antigens or are stimulated to promote cell division, and is widely used to promote the activation and proliferation of T cells and NK cells. IL-2 stimulates the proliferation of NK cells, increases their cytotoxicity, and enables NK cells to secrete various cytokines. However, further research has shown that IL-2 causes overdifferentiation of T cells, induces apoptosis of activated T cells, and activates CD4+FoxP3 Treg regulatory cells, thereby inhibiting T cell activation and tumor-killing activity. Therefore, IL-2 is considered to be a T cell regulator rather than simply an activator, and some studies use IL-7, IL-15, or IL-21 instead of IL-2.
[0265] Specifically, regarding interleukin-7 (IL-7), IL-7 is a hematopoietic growth factor secreted by matrix cells in the bone marrow and thymus. It shares a γc receptor subunit with IL-2 and stimulates the proliferation of lymphocyte progenitor cells. IL-7 can provide continuous stimulating signals to naive T cells and memory T cells. As mentioned above, IL-7 does not activate CD4+FoxP3+Treg cells during CD8+ T cell activation. Clinically, IL-7 can also be used to restore T cell counts after chemotherapy or hematopoietic stem cell transplantation. Furthermore, IL-7 can play a major role in influencing the proliferation of B cells at a certain stage of maturation. IL-7 may also act as a regulator of intestinal mucosal lymphocytes.
[0266] Specifically, regarding interleukin-15 (IL-15), IL-15 has a structure similar to IL-2, shares a γc receptor subunit, and possesses four α-helix bundle families (the others being, for example, IL-2, IL-4, IL-7, IL-9, G-CSF, and GM-CSF). IL-15 regulates the activation and proliferation of T cells and NK cells. IL-15 is primarily responsible for killing viral infections in the innate immune system. At the same time, IL-15 can activate NKT cells and γδT cells. In immunotherapy, IL-15 induces apoptosis of activated T cells and does not activate CD8+ effector T cells. IL-15 plays an important role in long-term antitumor activity by maintaining the survival of memory T cells.
[0267] Specifically, regarding interleukin-21 (IL-21), IL-21 also belongs to the IL-2 family, shares a γc receptor subunit, and exerts a very strong regulatory effect on immune system cells, inducing cell division and proliferation in its target cells. In cellular immunotherapy, IL-21 promotes the proliferation of CD4+ and CD8+ T cells, enhances the cytotoxicity of CD8+ T cells and NK cells, and does not cause apoptosis of cells through activation. IL-21 preferentially proliferates "young" CD27+CD28+ CD8+ T cells, and such cells exhibit stronger cytotoxicity. Of course, since IL-21 does not cause Treg proliferation, its application in cellular immunotherapy is becoming increasingly widespread.
[0268] Specifically, regarding interleukin-4 (IL-4), IL-4 activates the proliferation of activated B and T cells and regulates the expression of Fc receptors in lymphocytes and monocytes. IL-4 induces Th1 cells to transform into Th2 cells. IL-4 stimulates Th2 cells to secrete IL-4, IL-5, IL-6, IL-10, and IL-13. IL-4 guides monocytes to differentiate towards dendritic cells by inhibiting macrophage growth. In the absence of additional IL-4 in the culture system, monocytes differentiate into macrophages. IL-4 plays an important role in humoral and adaptive immunity, converting B cell antibody classes to IgE and upregulating the production of MHC class II molecules. When both IL-4 and GM-CSF act, they can selectively differentiate monocytes into immature dendritic cells (DCs). These DCs have strong antigen uptake and processing capabilities but weak antigen presentation capabilities. By sequentially using IL-4 and TNF-α, the maturation of DCs can be promoted.
[0269] Specifically, regarding interleukin-12 (IL-12), IL-12 acts on activated T and NK cells, possesses broad physiological activity, and acts on lymphocytes through the activator of the transcription protein STAT4. IL-12 is necessary for T cell-independent induction of IFN-γ and plays an important role in the differentiation of Th1 and Th2 cells. IL-12B binds with IL-23A to form IL-23 interleukin, which has adaptive immune function. IL-12 is a drug target. In cellular immunotherapy, IL-12 promotes the differentiation of CD4+ T cells into CD4+ Th1 T cells and enhances CD8+ CTL cell activity. The therapeutic effect of IL-12 is related to its dosage, duration of action, and other cytokines that interact with it, and it promotes the tumor-killing activity of immune cells through various mechanisms. In a mouse anti-melanoma model, high doses of IL-12 exert their effects via NK cells, while low doses of IL-12 exert their tumor-killing effects via NKT cells.
[0270] Specifically, regarding interleukin-18 (IL-18), also known as interferon-γ inducer, it belongs to the pro-inflammatory cytokines and is produced by macrophages and other cells. IL-18 can promote the secretion of IFN-γ by NK cells and CD8+ T cells, thereby enhancing the cytotoxic effects of NK cells and CD8+ T cells. IL-18 can also activate macrophages, promote the development of Th1 CD4+ T cells, and encourage lymphocytes to express functions such as FasL. IL-18 offers a potential therapeutic target for allergic diseases. Furthermore, IL-18, IL-12, and IL-15, when acting synergistically, can maintain the Th1 response and monokine production in their own immune diseases.
[0271] Gamma interferons are type II interferons, primarily produced by NK and NKT cells, possessing antiviral, antitumor, and immunomodulatory effects, and include IFN-γ and IFN-β. IFN-γ has an antiproliferative effect on transformed cells and can enhance the antiviral and antitumor effects of type I interferons. IFN-γ induces the expression of MHC I, MHC II, and co-activating molecules in antigen-presenting cells (APCs) by activating macrophages. Furthermore, IFN-γ can enhance antigen-presenting ability by inducing changes in protein enzyme expression. IFN-γ can also promote the differentiation of CD4+ T cells into Th1 cells and inhibit subtype switching of IL-4-dependent B cells. IFN-γ activates the JAK-STAT cell pathway through phosphorylation of JAK1 and JAK2 proteins. In cellular immunotherapy, IFN-γ acts on host immune cells, exhibiting certain effects on macrophages, T cells, B cells, and NK cells. IFN-γ enhances antigen presentation ability by promoting the expression of MHC class II molecules in macrophages or by inducing MHC class II expression in cells that normally do not express MHC class II molecules (e.g., vascular endothelial cells, certain epithelial cells, and connective tissue cells). IFN-γ can promote the differentiation of B cells and CD8+ T cells, but not their proliferation. IFN-γ can enhance the activity and immune function of TH1 cells. IFN-γ can enhance neutrophil phagocytosis, activate NK cells, and enhance their cytotoxic activity. Abnormal IFN-γ expression is associated with many autoinflammatory and autoimmune diseases.
[0272] Tumor necrosis factor (TNF-α) belongs to the TNF superfamily of cytokines and is a multifunctional molecule that regulates biological processes, including cell proliferation, differentiation, apoptosis, lipid metabolism, and coagulation. TNF-α is involved in antitumor activity. In cellular immunotherapy, TNF-α differentiates immature dendritic cells (DCs) into mature DCs. This process is achieved by TNF-α downregulating macropinocytosis and surface Fc receptor expression in immature DCs, while upregulating the expression of cell surface MHC class I, class II molecules, and B7 family molecules (CD80, CD86, etc.). Mature DCs have significantly reduced uptake and processing capabilities, but significantly increased antigen-presenting capabilities, and can strongly activate T cells. TNF-α can influence the production of other cytokines, for example, by stimulating monocytes and macrophages to secrete IL-1, enhancing the proliferative capacity of IL-2-dependent thymocytes and T cells, promoting the production of lymphokines such as IL-2, CSF, and IFN-γ, and enhancing the stimulation of B cell proliferation and Ig secretion by mitogens or exogenous antigens.
[0273] Granule cell macrophage colony-stimulating factor (GM-CSF) plays a crucial role in embryo transfer and development. GM-CSF was one of the first cytokines discovered to act on dendritic cells (DCs). In DC culture, GM-CSF promotes the differentiation of monocytes into macrophage-like cells, enhances the expression of cell surface MHC class II molecules, and strengthens the antigen-presenting function of cells. GM-CSF can also promote DC survival. In cellular immunotherapy, GM-CSF can activate immune responses and generate antitumor activity through the activation of macrophages and DCs. Regarding antigen presentation, GM-CSF can promote the maturation of DC cells, upregulate costimulatory molecules, and promote CD1d receptor expression. Recent research has shown that GM-CSF stimulates hematopoietic progenitor cells to differentiate into monocytes and neutrophils, reducing the risk of febrile neutropenia in cancer patients. Other studies have shown that GM-CSF induces differentiation of bone marrow dendritic cells (DCs), promotes Th1 cell bias towards immune responses, stimulates angiogenesis, and influences the development of allergic inflammation and autoimmune diseases. Therefore, GM-CSF is clinically used in the treatment of malignancies.
[0274] In this application, the term “nucleic acid molecule” usually means a nucleotide of any length. In this application, the term “nucleic acid molecule” can encode a protein contained in the oncolytic virus. In this application, the nucleic acid molecule may include DNA and / or RNA. In some cases, the RNA may include single-stranded RNA (ssRNA) or double-stranded RNA (dsRNA), and the single-stranded RNA may include sense RNA, antisense RNA, or ambisense RNA.
[0275] In this application, the term “prevention” usually means preventing the onset, development, recurrence, and / or spread of a disease or one or more symptoms thereof by taking certain measures in advance. In this application, the term “treatment” usually means eliminating or improving a disease or one or more symptoms associated with a disease. In some embodiments, treatment usually means eliminating or relieving a disease by administering one or more drugs to a patient suffering from the disease. In some embodiments, “treatment” may be the pharmaceutical composition and / or drug product administered after the onset of symptoms of a particular disease, with or without the presence of other drugs. For example, the pharmaceutical composition and / or drug product described in this application may be used to prevent the onset, development, recurrence, and / or progression of a tumor.
[0276] In this application, the term “tumor” generally means any new growth of pathological tissue. Tumors can be benign or malignant. In this application, such tumors may be solid tumors and / or hematopoietic tumors. For research purposes, these tissues can be isolated from readily available sources by methods well known to those skilled in the art.
[0277] In some specific embodiments, the tumor is acute lymphoblastic leukemia, acute B lymphoblastic leukemia, chronic non-lymphoblastic leukemia, non-Hodgkin lymphoma, anal cancer, astrocytoma, basal cell carcinoma, cholangiocarcinoma, bladder cancer, breast cancer, breast cancer (BRCA), cervical cancer, chronic myeloproliferative neoplasm, colorectal cancer, endometrial cancer, ependymal tumor, esophageal cancer, diffuse large B-cell lymphoma (DLBCL), sensory neuroblastoma, Ewing's sarcoma, fallopian tube cancer, gallbladder cancer, gastric cancer, gastrointestinal carcinoma This includes, but is not limited to, tumors such as hepatocellular carcinoma, hypopharyngeal carcinoma, Kaposi's sarcoma, renal carcinoma, Langhans cell proliferative disorder, pharyngeal carcinoma, liver cancer, lung cancer, malignant melanoma, Merkel cell carcinoma, mesothelioma, oral cancer, neuroblastoma, non-small cell lung cancer, osteosarcoma, ovarian cancer, pancreatic cancer, pancreatic neuroendocrine tumor, pharyngeal carcinoma, pituitary tumor, prostate cancer, rectal cancer, renal cell carcinoma, retinoblastoma, skin cancer, small cell lung cancer, small intestine cancer, squamous cell carcinoma, testicular cancer, thymoma, thyroid cancer, uterine cancer, vaginal cancer, and hemangiomas. Details of the invention
[0278] A wild-type VSV virus, specifically, the VSV Indiana strain or the VSV Indiana MuddSummer subtype strain. The amino acid sequence of its M protein is shown in SEQ ID NO: 1, the amino acid sequence of its G protein is shown in SEQ ID NO: 12, the amino acid sequence of its N protein is shown in SEQ ID NO: 14, the amino acid sequence of its P protein is shown in SEQ ID NO: 16, and the amino acid sequence of its L protein is shown in SEQ ID NO: 18. In the present application, any of the M protein, G protein, N protein, P protein, and L protein can be modified.
[0279] A recombinant oncolytic virus, which is obtained by mutating sites in the amino acid sequences of its M protein, G protein, N protein, P protein, and L protein based on the above wild-type VSV virus.
[0280] Specifically, the present application provides a tumor treatment method combining a recombinant oncolytic virus and a small molecule anticancer agent, which includes a step of treating tumors by combining the recombinant oncolytic virus and the small molecule anticancer agent.
[0281] The small molecule anticancer agents include small molecule anticancer agents targeting ALK, small molecule anticancer agents targeting BTK, small molecule anticancer agents targeting EGFR, small molecule anticancer agents targeting FGFR, small molecule anticancer agents targeting HER2, small molecule anticancer agents targeting Parp, small molecule anticancer agents targeting PI3K, small molecule anticancer agents targeting VEGFR, small molecule anticancer agents targeting CDK4 / 6, and small molecule anticancer agents targeting KRAS.
[0282] The recombinant oncolytic virus includes an M protein, a G protein, an N protein, a P protein, and an L protein.
[0283] Compared with the amino acid sequence shown in SEQ ID NO: 1, the site mutation of the M protein includes any one or more of M51R, V221F, and S226R; or the site mutation of the M protein includes any one or more of N32S, N49D, M51R, H54Y, V221F, V225I, and S226R; or the site mutation of the M protein includes any one or more of N32S, N49D, M51R, H54Y, knockout of the leucine-coding base at the 111st site, V221F, V225I, and S226R; or the site mutation of the M protein includes any one or more of N32S, N49D, M51R, H54Y, L111A, V221F, V225I, and S226R; or the site mutation of the M protein includes any one or more of G21E, N32S, N49D, M51R, H54Y, V221F, V225I, and S226R; or the site mutation of the M protein includes any one or more of G21E, N32S, M33A, N49D, M51R, H54Y, V221F, V225I, and S226R; or the site mutation of the M protein includes any one or more of G21E, N32S, M33A, N49D, M51R, H54Y, A133T, V221F, V225I, and S226R; or the site mutation of the M protein includes any one or more of N32S, M33A, N49D, M51R, H54Y, V221F, V225I, and S226R; or the site mutation of the M protein includes any one or more of N32S, M33A, N49D, M51R, H54Y, A133T, V221F, V225I, and S226R; or the site mutation of the M protein includes any one or more of N32S, N49D, M51R, H54Y, A133T, V221F, V225I, and S226R.
[0284] Compared with the amino acid sequence shown in SEQ ID NO: 12, the site mutation of the G protein includes any one or more of V53I, A141V, D172Y, K217E, D232G, V331A, V371E, G436D, T438S, F453L, T471I, and Y487H.
[0285] Compared to the amino acid sequence shown in Sequence ID No. 14, the site mutations in the N protein include one or more of the following: I14V, R155K, and S353N.
[0286] Compared to the amino acid sequence shown in Sequence ID No. 16, the site mutations of the P protein include one or more of the following: R50K, V76A, D99E, L126S, L140S, H151Y, I168M, K170E, Y189S, and N237D.
[0287] Compared to the amino acid sequence shown in Sequence ID No. 18, the site mutation of the L protein includes one or more of S87P and I487T.
[0288] Furthermore, the recombinant oncolytic virus is obtained by introducing an exogenous gene encoding an antigen based on the recombinant oncolytic virus.
[0289] Furthermore, the small molecule anticancer agent is selected from one or more of the following: Ceritinib, Ibrutinib, Afatinib, Dacomitinib, Icotinib, Lenvatinib, Pazopanib, Anlotinib, Pyrotinib, Niraparib, Olaparib, Regorafenib, Palbociclib, Vemurafenib, Savolitinib, Everolimus, Mobocertinib, and Sotorasib.
[0290] Furthermore, the recombinant oncolytic virus further comprises an antigen encoded by an exogenous gene.
[0291] Furthermore, the antigen is selected from one or more of the following: CD19, CD22, BCMA, MUC1, NY-ESO-1, MAGE A4, MET, Claude 18.2, MSLN, EGFR, VEGFR2, HER2, TPBG, AFP, and MAGE A10.
[0292] Furthermore, the recombinant oncolytic virus further contains cytokines encoded by exogenous genes.
[0293] Furthermore, the cytokine is selected from one or more of the following: GM-CSF, IL-2, IL-12, IL-15, IL-18, TNF-α, and IFN-β.
[0294] In this application, recombinant oncolytic viruses described herein can be obtained by a viral packaging process and a viral rescue process. A specific process may include infecting and inoculating BSR-T7 cells with poxvirus vTF7-3 expressing T7 RNA polymerase, and performing lipofectamine transfection using expression plasmids and backbone plasmids that clone the VSV N, VSV P, and VSV L genes, respectively, to obtain the target oncolytic virus.
[0295] This application provides a composition comprising the above-mentioned recombinant oncolytic virus and a low-molecular-weight anticancer agent.
[0296] In some embodiments, the composition may comprise one or more suitable formulations of pharmaceutically effective adjuvants, stabilizers, excipients, diluents, solubilizers, surfactants, emulsifiers, and / or preservatives. The acceptable components of the composition are preferably non-toxic to subjects at the doses and concentrations used. The compositions of this application include, but are not limited to, liquid, cryogenic, and lyophilized compositions.
[0297] In one embodiment, the pharmaceutically acceptable carrier comprises any and all solvents, dispersions, coatings, isotonic agents, and absorption retarders suitable for drug administration, and is generally safe and non-toxic.
[0298] In some embodiments, the composition comprises a pharmaceutical product for parenteral, transdermal, intraluminal, intra-arterial, intravenous, subarachnoid and / or intranasal administration or direct injection into tissue. For example, the composition may be administered to a patient or subject by infusion or injection. In some embodiments, the composition may be administered by different means, such as intravenous, intraperitoneal, subcutaneous, intramuscular, intradermal or intratissue administration. In some embodiments, the composition may be administered without interruption. Such uninterrupted (or continuous) administration may be achieved by measuring the flow of the therapeutic agent into the patient's body using a small pump system worn by the patient, as described in International Publication No. 2015 / 036583.
[0299] This application further provides uses of the above composition in the preparation of agents for preventing and / or treating diseases and / or illnesses.
[0300] The method of treating tumors by combining recombinant oncolytic viruses and low-molecular-weight anticancer drugs provided in this application exhibits a significant inhibitory effect on tumor growth. Furthermore, test results in treating tumors by directly binding recombinant oncolytic viruses to low-molecular-weight anticancer drugs are superior to test results in treating tumors with recombinant oncolytic viruses alone or with low-molecular-weight anticancer drugs alone. Test results in treating tumors by inserting recombinant oncolytic viruses into antigen fragments and expressing them, with the antigen further combined with low-molecular-weight anticancer drugs, are superior to test results in treating tumors by directly combining recombinant oncolytic viruses with low-molecular-weight anticancer drugs, or by inserting recombinant oncolytic viruses into antigen fragments and expressing them to directly treat tumors. Therefore, the method of treating tumors by combining recombinant oncolytic viruses and low-molecular-weight anticancer drugs provided in this application further enhances the therapeutic effect on tumor cells.
[0301] The method of treating tumors by combining the recombinant oncolytic virus provided in this application with a small molecule anti-cancer agent has good inhibitory ability against the growth of tumor cells. The method of treating tumors by combining the recombinant oncolytic virus provided in this application with a small molecule anti-cancer agent has good inhibitory ability against other cancer cells and has prospects for broad clinical application.
[0302] Hereinafter, this application will be further described in detail by referring to Preparation Examples 1 to 116 and Examples. Preparation Example Preparation Examples 1 to 10
[0303] Each of Preparation Examples 1 to 10 provides a tumor treatment method combining a recombinant oncolytic virus and a small molecule anti-cancer agent.
[0304] This method treats tumors by combining a recombinant oncolytic virus and a small molecule anti-cancer agent.
[0305] Here, the recombinant oncolytic virus contains M protein, G protein, N protein, P protein and L protein. Here, the M protein, G protein, N protein, P protein and L protein are all obtained by point mutation based on the wild-type VSV virus Indiana MuddSummer subtype.
[0306] The difference between each preparation example lies in the different mutation sites of the M protein. The mutation sites of the M protein are the amino acid sequences shown in SEQ ID NO: 2 to SEQ ID NO: 11 respectively. The G protein contains the amino acid sequence shown in SEQ ID NO: 13, the N protein contains the amino acid sequence shown in SEQ ID NO: 15, the P protein contains the amino acid sequence shown in SEQ ID NO: 17, and the L protein contains the amino acid sequence shown in SEQ ID NO: 19.
[0307] The mutation sites of each protein and the types of small molecule anti-cancer agents are shown in Table 1.
[0308] The method for constructing the recombinant oncolytic virus provided in each of the above preparation examples is as follows.
[0309] (1) Construction of vectors
[0310] Using the pRV-core plasmid (BioVectorNTCC plasmid vector cell gene preservation center) as a template, the M protein mutation sites, G protein mutation sites, N protein mutation sites, P protein mutation sites, and L protein mutation sites shown in Table 1 are introduced using PCR technology.
[0311] Gene fragments containing XbaI and MluI restriction enzyme cleavage sites and the aforementioned protein mutation sites are synthesized, and these are used as templates for PCR amplification. Subsequently, the PCR products are subjected to 1% agarose gel electrophoresis, double enzyme cleavage is performed with XbaI and MluI, and then rubber tapping recycling is performed using a gel recovery kit to obtain gene fragments containing M protein mutation sites, G protein mutation sites, N protein mutation sites, P protein mutation sites, and L protein mutation sites, respectively. The RV-core plasmid is double enzyme cleaved with XbaI and MluI, and rubber tapping recycling is performed using a gel recovery kit to obtain pRV-core enzyme cleavage recovered skeleton fragments.
[0312] Gene fragments containing M protein mutation sites, G protein mutation sites, N protein mutation sites, P protein mutation sites, and L protein mutation sites are each converted by connecting and modifying the pRV-core enzyme-cleaved and recovered skeleton fragments, and then coated onto a plate. Monoclonal bacteria are selected and PCR validation is performed to obtain the constructed plasmid pRV-core Mut, which is then sent to a sequencing company for sequencing. Table 1: Recombinant oncolytic viruses and low-molecular-weight anticancer agents in preparation examples 1-10 [Table 1] JPEG2026511570000003.jpg26170
[0313] (2) Virus Rescue
[0314] Using a calcium phosphate transfection kit (Thermo Fisher Scientific), the constructed plasmid pRV-core Mut is transfected into BSR-T7 cells (purchased from the ATCC (American Type Culture Collection), also known as the American Center for Bacteriological Preservation)) via cell transfection technology.
[0315] The four plasmids were mixed according to the mass ratio of pRV-core Mut, pP, pN, and pL, which is 10:5:4:1, resulting in a total plasmid volume of 5 μg. The plasmids were diluted with 200 μl of opti-MEM medium (Thermo Fisher Scientific), and 7.5 μl of transfection reagent Plus Reagent (Life Technologies) was added to obtain a transfection plasmid premix. Here, pP (plasmid carrying the baculovirus phosphoprotein gene), pN (plasmid carrying the baculovirus nucleoprotein gene), and pL (plasmid carrying the baculovirus polymerase protein gene) were used, and the corresponding parent vectors for the three plasmids pN, pP, and pL were all pCAGGS (purchased from ATCC).
[0316] Dilute 10 μl of lipofectamine LTX (Thermo Fisher Scientific) in 200 μl of opti-MEM medium to obtain an LTX mixture.
[0317] Plasmid transfection was performed according to the instructions for use of lipofectamine LTX. After 6 hours, BSR-T7 cells were washed twice with PBS, and then inoculated into 10% fetal bovine serum DMEM medium (Thermo Fisher Scientific) and cultured for 3 days.
[0318] The supernatant obtained from culturing BSR-T7 cells is transferred to Vero cells (Thermo Fisher Scientific), and the Vero cells are cultured for 3 days under environmental conditions of 37°C. The status of virus rescue is identified by observing the green fluorescence within the sacral cells using a fluorescence microscope. Furthermore, the rescued mutant baculovirus library is passaged through Vero cells, and monoclonal virus strains are picked from the constructed plaque screening system.
[0319] (3) Gene sequencing. Viral genomic RNA is extracted using a Trizol kit, and a reverse transcription reaction is performed using random primers. PCR is then performed on the reverse-transcribed cDNA using primers designed for the M protein gene sequence, G protein gene sequence, N protein gene sequence, P protein gene sequence, L protein gene sequence, and antigen-coding gene sequence.
[0320] The primer sequences designed for the M protein gene sequence are: PF:ATGAGTTCCTTAAAGAA, PR:TCATTTGAAGTGG
[0321] The primer sequences designed for the G protein gene sequence are: PF:ATGAAGTGCCTTTTGTACTTAG, PR:TTACTTTCCAAGTCGGTTCATCT
[0322] The primer sequences designed for the N protein gene sequence are: PF:ATGTCTGTTACAGTCAAGAG, PR:TCATTTGTCAAATTCTGACTT
[0323] The primer sequences designed for the P protein gene sequence are: PF:ATGGATAATCTCACAAAAGTTCG, PR:CTACAGAGAATATTTGACTCTCG
[0324] The primer sequences designed for the L protein gene sequence are: PF:ATGGAAGTCCACGATTTTGAGA, PR:TTAATCTCTCCAAGAGTTTTCCT
[0325] The product was recovered by 1% agarose gel electrophoresis and sent to a sequencing company for sequencing. The sequencing results are shown in Table 1. Preparation Examples 11-49
[0326] Each of the preparation examples 11-49 provides a tumor therapy method combining recombinant oncolytic virus and a low-molecular-weight anticancer drug.
[0327] This method treats tumors by using recombinant oncolytic viruses in combination with low-molecular-weight anticancer drugs.
[0328] Here, the recombinant oncolytic virus comprises an M protein, a G protein, an N protein, a P protein, an L protein, and an antigen. Here, the mutation sites of the M protein, G protein, N protein, P protein, and L protein are the same as the corresponding mutation sites in Preparation Example 2.
[0329] The differences lie in the type of antigen and the type of low-molecular-weight anticancer drug. Table 2 shows the mutation sites of each protein, the antigen type, and the type of low-molecular-weight anticancer drug.
[0330] The method for constructing the recombinant oncolytic virus provided in the above preparation example is the same as the method for constructing the virus in Preparation Example 2, and the differences in the construction method are as follows:
[0331] Between the vector construction step (1) and the virus rescue step (2), a further step of inserting an antigen-coding foreign gene is included. Specifically, the plasmid pRV-core Mut obtained in step (1) is subjected to double enzymatic cleavage with Xho I and Mlu I to recover a long fragment. The antigen-coding foreign gene is synthesized by a gene synthesis company, amplified with the corresponding primer, subjected to double enzymatic cleavage with Xho I and Nhe I to recover the target gene fragment, the pRV-core Mut treated by the above double enzymatic cleavage is ligated with the foreign gene fragment to convert it, the monoclonal is selected, PCR or enzymatic cleavage identification is performed, and then it is sent to a sequencing company for sequencing to obtain a plasmid pRV-core Mut carrying the foreign gene. In the virus rescue in step (2), the plasmid pRV-core Mut carrying the foreign gene is used to perform plasmid transfection of BSR-T7 cells.
[0332] Step (3) involves sequencing for each type of antigen. Viral genomic RNA is extracted using a Trizol kit, reverse transcription is performed using random primers, and PCR is performed on the reverse-transcribed cDNA using primers designed for the gene sequence encoding the antigen.
[0333] The primer sequences designed for the gene sequence encoding the antigen are as follows: 1)CD19 F:ACGCTCGAGATGCCACCTCCTGCGCCTCC, CD19 R:TCTGGCTAGCTCATCTTTTCCTCCTCAGG. 2)CD22 F:ATGCATCTCCTCGGCCCCT, CD22 R:TCAGAGCCCACAGATTGCCAGG. 3)NY-ESO-1F:ACGCTCGAGATGCAGGCAGAAGGAAG、 NY-ESO-1R:TCTGGCTAGCTCATCTTCTCTGTCCGCTA。 4)MAGE A4 F:ACGCTCGAGACAGAGGAGCACCAAGGAG、 MAGE A4 R:TCTGGCTAGCATAGACTGAGGCATAAGGC。 5)Claude 18.2F:ACGCTCGAGATGGACCAGTGGAGCACCC、 Claude 18.2R:TCTGGCTAGCTTAGGCGATGCACATCATC。 6)EGFR F:ACGCTCGAGATGCGACCCTCCGGGACGG、 EGFR R:TCTGGCTAGCTTACATGAAGAGGCCGAT。 7)HER2 F:ATGGAGCTGGCGGCCTTGTGCC、 HER2 R:TTAGATGAGGATCCCAAAGACCA。 8)ALK F:AAGCGGGGGCGGCAGCGGT、 ALK R:TTTTAGTCATTACAAAATAAC。 9)BTK F:ATGGCCGCAGTGATTCTGG、 BTK R:GGATTCTTCATCCATGACA。 10)FGFR1 F:ATGTGGAGCTGGAAGTGCC、 FGFR1 R:TCAGCGGCGTTTGAGTCCG。 11)VEGFR F:ACGCTCGAGATGCAGAGCAAGGTGCTG、 VEGFR R:TCTGGCTAGCTCAGATGATGACAAGAAGT。 12)CDK4 F:ATGGCTACCTCTCGATATG、 CDK4 R:TCACTCCGGATTACCTTCA。 13)CDK6 F:ATGGAGAAGGACGGCCTGT、 CDK6 R:TCAGGCTGTATTCAGCTCC. 14)BRAF F:ATGGCGGCGTGAGCGGTG, BRAF R:TCAGTGGACAGGAAACGCA. 15) MET F:ACGCTCGAGATGGAGTGCAAGGAGGCC, MET R:TCTGGCTAGCTTACAGCCACAGGAAGAAG. 16)KRAS G12C F:ATGACTGAATATAAACTTG, KRAS G12C R:TTACATTATAATGCATTTT.
[0334] The product was recovered by 1% agarose gel electrophoresis and sent to a sequencing company for sequencing. The sequencing results are shown in Table 2. Table 2 Recombinant oncolytic viruses and low-molecular-weight anticancer agents in preparation examples 11-49 [Table 2] JPEG2026511570000005.jpg149170 Preparation example 50~83
[0335] Each of the preparation examples 50-83 provides a tumor therapy method combining recombinant oncolytic virus and a low-molecular-weight anticancer drug.
[0336] This method treats tumors by using recombinant oncolytic viruses in combination with low-molecular-weight anticancer drugs.
[0337] The difference between the above preparation example and preparation example 11 is that the recombinant oncolytic virus contains cytokines in addition to the M protein, G protein, N protein, P protein, L protein, and antigen. Here, the mutation sites of the M protein, G protein, N protein, P protein, and L protein are the same as the corresponding mutation sites in preparation example 2.
[0338] The differences lie in the type of cytokine and the type of small molecule anticancer drug. Table 3 shows the mutation sites of each protein, antigen type, cytokine type, and small molecule anticancer drug type.
[0339] The method for constructing the recombinant oncolytic virus provided in the above preparation example is the same as the method for constructing the virus in Preparation Example 2, and the differences in the construction method are as follows:
[0340] Between the vector construction step (1) and the virus rescue step (2), there is further a step of inserting a foreign gene encoding a cytokine, specifically referring to the step of inserting a foreign gene encoding an antigen. The antigen and cytokine are inserted between the G protein and the L protein. The order of insertion may be to insert the cytokine first and then the antigen, or to insert the antigen first and then the cytokine. In this application, the cytokine is inserted first and then the antigen is inserted.
[0341] Step (3) further includes cytokine sequencing. Viral genomic RNA is extracted using a Trizol kit, reverse transcription is performed using random primers, and PCR is performed on the reverse-transcribed cDNA using primers designed for the cytokine gene sequence.
[0342] The primer sequences designed for the cytokine-coding gene sequences are as follows: IL12 F:CCCTCGAGATGTGGCCCCCTGGGT, IL12 R:CGGCTAGCTTAACTGCAGGGCACAGATG. IL-18F: CCCTCGAGATGGCTGCTGAACCAGTAG, IL-18R:CGGCTAGCCTAGTCTTCGTTTTGAAC.
[0343] The product was recovered by 1% agarose gel electrophoresis and sent to a sequencing company for sequencing. The sequencing results are shown in Table 3. Table 3 Recombinant oncolytic viruses and low-molecular-weight anticancer agents in preparation examples 50-83 [Table 3] JPEG2026511570000007.jpg105170 Preparation example 84~91
[0344] Preparations 84-91 and 109 each provide a method for treating tumors using recombinant oncolytic viruses.
[0345] The recombinant oncolytic viruses in the above preparation examples are the same recombinant oncolytic viruses as in Preparation Examples 2, 11, 28, and 45-49, respectively. Specifically, these are shown in Table 4. The differences lie in the types of antigens expressed by the recombinant oncolytic viruses (e.g., Preparation Examples 84-90, 109-116) or in the fact that the recombinant oncolytic viruses do not express antigens at all (e.g., Preparation Example 91). Recombinant oncolytic viruses in preparation examples 71-78 (Table 4) [Table 4] Preparation Examples 92-108
[0346] Preparation examples 92-108 each provide a method for treating tumors with low-molecular-weight anticancer drugs.
[0347] The low-molecular-weight anticancer drugs in the above preparation examples are the same low-molecular-weight anticancer drugs used in preparation examples 11 to 27. Specifically, these are shown in Table 5. The main difference lies in the type of low-molecular-weight anticancer drug used. Table 5: Low molecular weight anticancer agents in preparation examples 92-108 [Table 5] Examples
[0348] In this example, animal studies are conducted using methods to treat tumors with recombinant oncolytic viruses and / or low-molecular-weight anticancer agents provided in Preparation Examples 1 to 116.
[0349] Balb / c mice were prepared and inoculated with H22 cells (mouse liver cancer cells) at an inoculation concentration of 5 × 10^5 / 0.1 mL / animal. The average size of the mouse tumors was 50 mm. 3 Once the target is reached, grouping is initiated, designated as Day 0. The mice are administered the drug on the day of grouping, their weight is measured three times a week, and they are observed once a day. During the experiment, the body weight (g) and tumor volume (mm) of the mice are recorded. 3 Record the changes in ).
[0350] The mice will be euthanized in the following cases: 1. Tumor volume is 2000 mm³ 3 1. The mouse reaches a certain level of weight loss; 2. The mouse loses more than 20% of its body weight; 3. The tumor surface has ulcers; 4. The mouse is paralyzed.
[0351] The administration method for recombinant oncolytic viruses may vary. In this application, the administration methods for wild-type oncolytic viruses and recombinant oncolytic viruses are intratumoral injection (IT) and / or intravenous injection (IV), with a dose of 3e8 PFU / animal and an IT dose volume of 2.5 ml / kg. The IV dose volume is 5 ml / kg, and the administration frequency is 6 consecutive doses every 2 days (Q2D*6).
[0352] The administration method for low-molecular-weight anticancer drugs is oral administration (PO), and the dosage, depending on the type of low-molecular-weight anticancer drug, is 10 ml / kg in volume, administered once every day for 12 consecutive days (QD*12), or administered twice every day for 12 consecutive days (BID*12).
[0353] As a vehicle control, (10% DMSO + 40% PEG300 + 5% Tween-80 + 45% saline) is used instead of low-molecular-weight anticancer drugs. The administration method is oral (PO), the dose is N / A, the volume of administration is 10 ml / kg, and the frequency of administration is once every day for 12 consecutive days (QD*12).
[0354] 1. Animal studies on the low-molecular-weight anticancer drug Mobocertinib
[0355] Animal studies were conducted using the recombinant oncolytic viruses and / or low-molecular-weight anticancer agents provided in Preparation Examples 1-10, 11, 28, 45-49, 50, 67, 84-91, and 92 to treat tumors. The specific details of the studies are shown in Table 6.
[0356] The test results are shown in Figure 1. Table 6 Animal studies of the small molecule anticancer drug Mobocertinib [Table 6] JPEG2026511570000011.jpg89170
[0357] 2. Animal studies on the low-molecular-weight anticancer drug Ceritinib
[0358] Animal studies were conducted using the recombinant oncolytic viruses and / or low-molecular-weight anticancer agents provided in Preparation Examples 12, 29, 51, 68, 87, 109, 91, and 93 to treat tumors. The specific details of the studies are shown in Table 7.
[0359] The test results are shown in Figure 6. Table 7 Animal studies of the small molecule anticancer drug Ceritinib [Table 7]
[0360] 3. Animal studies on the low-molecular-weight anticancer drug Ibrutinib
[0361] Animal studies were conducted using the recombinant oncolytic viruses and / or low-molecular-weight anticancer agents provided in Preparation Examples 13, 30, 52, 69, 87, 110, 91, and 94 to treat tumors. The specific details of the studies are shown in Table 8.
[0362] The test results are shown in Figure 3. Table 8 Animal studies of the small molecule anticancer drug Ibrutinib [Table 8]
[0363] IV. Animal studies on the low-molecular-weight anticancer drug Afatinib
[0364] Animal studies are conducted using the recombinant oncolytic viruses and / or low-molecular-weight anticancer agents provided in Preparation Examples 14, 31, 53, 70, 87, 89, 91, and 95 to treat tumors. The specific details of the studies are shown in Table 9.
[0365] The test results are shown in Figure 4. Table 9 Animal studies of the small molecule anticancer drug Afatinib [Table 9]
[0366] 5. Animal studies on the low-molecular-weight anticancer drug Dacomitinib
[0367] Animal studies were conducted using the recombinant oncolytic viruses and / or low-molecular-weight anticancer agents provided in Preparation Examples 15, 32, 54, 71, 87, 89, 91, and 96 to treat tumors. The specific details of the studies are shown in Table 10.
[0368] The test results are shown in Figure 5. Table 10 Animal studies of the small molecule anticancer drug Dacomitinib [Table 10]
[0369] 6. Animal studies on the low-molecular-weight anticancer drug Icotinib
[0370] Animal studies were conducted using the recombinant oncolytic viruses and / or low-molecular-weight anticancer agents provided in Preparation Examples 16, 33, 55, 72, 87, 89, 91, and 97 to treat tumors. The specific details of the studies are shown in Table 11.
[0371] The test results are shown in Figure 6. Table 11 Animal studies of the small molecule anticancer drug Icotinib [Table 11]
[0372] 7. Animal studies on the low-molecular-weight anticancer drug Lenvatinib
[0373] Animal studies are conducted using the recombinant oncolytic viruses and / or low-molecular-weight anticancer agents provided in Preparation Examples 17, 34, 56, 73, 87, 111, 91, and 98 to treat tumors. The specific details of the studies are shown in Table 12.
[0374] The test results are shown in Figure 7. Table 12 Animal studies of the small molecule anticancer drug Lenvatinib [Table 12]
[0375] 8. Animal studies on the low-molecular-weight anticancer drug Pazopanib
[0376] Animal studies are conducted using the recombinant oncolytic viruses and / or low-molecular-weight anticancer agents provided in Preparation Examples 18, 35, 57, 74, 87, 111, 91, and 99 to treat tumors. The specific details of the studies are shown in Table 13.
[0377] The test results are shown in Figure 8. Table 13 Animal studies of the small molecule anticancer drug Pazopanib [Table 13]
[0378] 9. Animal studies on the low-molecular-weight anticancer drug Anlotinib
[0379] Animal studies are conducted using the recombinant oncolytic viruses and / or low-molecular-weight anticancer agents provided in Preparation Examples 19, 36, 58, 75, 87, 111, 91, and 100 to treat tumors. The specific details of the studies are shown in Table 14.
[0380] The test results are shown in Figure 9. Table 14 Animal studies of the small molecule anticancer drug Anlotinib [Table 14]
[0381] 10. Animal studies on the low-molecular-weight anticancer drug Pyrotinib
[0382] Animal studies were conducted using the recombinant oncolytic viruses and / or low-molecular-weight anticancer agents provided in Preparation Examples 20, 37, 59, 76, 87, 90, 91, and 101 to treat tumors. The specific details of the studies are shown in Table 15.
[0383] The test results are shown in Figure 10. Table 15 Animal studies of the small molecule anticancer drug Pyrotinib [Table 15]
[0384] 11. Animal studies on the low-molecular-weight anticancer drug niraparib
[0385] Animal studies were conducted using the recombinant oncolytic viruses and / or low-molecular-weight anticancer agents provided in Preparation Examples 21, 38, 60, 77, 87, 90, 91, and 102 to treat tumors. The specific details of the studies are shown in Table 16.
[0386] The test results are shown in Figure 11. Table 16 Animal studies of the small molecule anticancer drug niraparib [Table 16]
[0387] 12. Animal studies on the small molecule anticancer drug Olaparib
[0388] Animal studies were conducted using the recombinant oncolytic viruses and / or low-molecular-weight anticancer agents provided in Preparation Examples 22, 39, 61, 78, 87, 90, 91, and 103 to treat tumors. The specific details of the studies are shown in Table 17.
[0389] The test results are shown in Figure 12. Table 17 Animal studies of the small molecule anticancer drug olaparib [Table 17]
[0390] 13. Animal studies on the low-molecular-weight anticancer drug Regorafenib
[0391] Animal studies were conducted using the recombinant oncolytic viruses and / or low-molecular-weight anticancer agents provided in Preparation Examples 23, 40, 62, 79, 87, 112, 91, and 104 to treat tumors. The specific details of the studies are shown in Table 18.
[0392] The test results are shown in Figure 13. Table 18 Animal studies of the small molecule anticancer drug Regorafenib [Table 18]
[0393] 14. Animal studies on the low-molecular-weight anticancer drug Palbociclib
[0394] Animal studies were conducted using the recombinant oncolytic viruses and / or low-molecular-weight anticancer agents provided in Preparation Examples 24, 41, 63, 80, 87, 113, 91, and 105 to treat tumors. The specific details of the studies are shown in Table 19.
[0395] The test results are shown in Figure 14. Table 19 Animal studies of the small molecule anticancer drug Palbociclib [Table 19]
[0396] 15. Animal studies on the low-molecular-weight anticancer drug Vemurafenib
[0397] Animal studies are conducted using the recombinant oncolytic viruses and / or low-molecular-weight anticancer agents provided in Preparation Examples 25, 42, 64, 81, 87, 114, 91, and 106 to treat tumors. The specific details of the studies are shown in Table 20.
[0398] The test results are shown in Figure 15. Table 20 Animal studies of the low-molecular-weight anticancer drug Vemurafenib [Table 20]
[0399] 16. Animal studies on the low-molecular-weight anticancer drug Savolitinib
[0400] Animal studies were conducted using the recombinant oncolytic viruses and / or low-molecular-weight anticancer agents provided in Preparation Examples 26, 43, 65, 82, 87, 115, 91, and 107 to treat tumors. The specific details of the studies are shown in Table 21.
[0401] The test results are shown in Figure 16. Table 21 Animal studies of the small molecule anticancer drug Savolitinib [Table 21]
[0402] 17. Animal studies on the low-molecular-weight anticancer drug sotorasib
[0403] Animal studies were conducted using the recombinant oncolytic viruses and / or low-molecular-weight anticancer agents provided in Preparation Examples 27, 44, 66, 83, 87, 116, 91, and 108 to treat tumors. The specific details of the studies are shown in Table 22.
[0404] The test results are shown in Figure 17. Table 22 Animal studies of the small molecule anticancer drug Sotorasib [Table 22]
[0405] The detection results are shown in Figures 1 to 17.
[0406] As can be seen from the above drawings, the method of treating tumors by combining recombinant oncolytic virus and low-molecular-weight anticancer drugs provided in this application exhibits a significant inhibitory effect on tumor growth. Furthermore, the test results when recombinant oncolytic virus is directly bound to and used in combination with low-molecular-weight anticancer drugs to treat tumors are superior to the test results when recombinant oncolytic virus is used alone or when low-molecular-weight anticancer drugs are used alone. The test results when recombinant oncolytic virus is bound to an antigen and then to a low-molecular-weight anticancer drug to treat tumors are superior to the test results when recombinant oncolytic virus is directly bound to and used in combination with low-molecular-weight anticancer drugs to treat tumors, or when recombinant oncolytic virus is bound to an antigen and treats tumors directly. Therefore, the method of treating tumors by combining recombinant oncolytic virus and low-molecular-weight anticancer drugs provided in this application further effectively improves the therapeutic effect on tumor cells.
[0407] Simultaneously, in the method of treating tumors using recombinant oncolytic viruses and low-molecular-weight anticancer drugs in this application, the test results when the recombinant oncolytic virus has a target that pairs with the low-molecular-weight anticancer drug are superior to the test results when the recombinant oncolytic virus does not have a target that pairs with the low-molecular-weight anticancer drug. Furthermore, the test results when the recombinant oncolytic virus has a target that pairs with the low-molecular-weight anticancer drug and the recombinant oncolytic virus expresses cytokines are superior to the test results when the recombinant oncolytic virus has a target that pairs with the low-molecular-weight anticancer drug but the recombinant oncolytic virus does not express cytokines.
[0408] As can be seen from the above detection results, the method of treating tumors using recombinant oncolytic viruses and low-molecular-weight anticancer drugs provided in this application has good inhibitory ability against tumor cell growth. The method of treating tumors using recombinant oncolytic viruses and low-molecular-weight anticancer drugs provided in this application also has good inhibitory ability against other cancer cells and has prospects for broad clinical application.
[0409] This specific embodiment is merely a description of the present application and does not limit it. Those skilled in the art may, after reading this specification, make amendments to this embodiment as necessary, without making any creative contribution, but all such amendments will be protected under patent law as long as they are within the scope of the claims of this application.
Claims
1. This is a tumor treatment method that combines recombinant oncolytic viruses with low-molecular-weight anticancer drugs. The tumor is treated using a combination of low-molecular-weight anticancer drugs and recombinant oncolytic viruses. The aforementioned small molecule anticancer agents include small molecule anticancer agents targeting ALK, small molecule anticancer agents targeting BTK, small molecule anticancer agents targeting EGFR, small molecule anticancer agents targeting FGFR, small molecule anticancer agents targeting HER2, small molecule anticancer agents targeting Parp, small molecule anticancer agents targeting PI3K, small molecule anticancer agents targeting VEGFR, small molecule anticancer agents targeting CDK4 / 6, and small molecule anticancer agents targeting KRAS. The recombinant oncolytic virus contains M protein, G protein, N protein, P protein, and L protein. Compared to the amino acid sequence shown in Sequence ID No. 1, The site mutations of the aforementioned M protein include one or more of M51R, V221F, and S226R. Alternatively, the site mutation of the M protein includes one or more of the following: N32S, N49D, M51R, H54Y, V221F, V225I, S226R. Alternatively, the site mutations of the M protein include one or more of the following: N32S, N49D, M51R, H54Y, knockout of the leucine coding base at site 111, V221F, V225I, and S226R. Alternatively, the site mutation of the M protein includes one or more of the following: N32S, N49D, M51R, H54Y, L111A, V221F, V225I, S226R. Alternatively, the site mutation of the M protein includes one or more of the following: G21E, N32S, N49D, M51R, H54Y, V221F, V225I, S226R. Alternatively, the site mutation of the M protein includes one or more of the following: G21E, N32S, M33A, N49D, M51R, H54Y, V221F, V225I, S226R. Alternatively, the site mutation of the M protein includes one or more of the following: G21E, N32S, M33A, N49D, M51R, H54Y, A133T, V221F, V225I, S226R. Alternatively, the site mutation of the M protein includes one or more of the following: N32S, M33A, N49D, M51R, H54Y, V221F, V225I, S226R. Alternatively, the site mutation of the M protein includes one or more of the following: N32S, M33A, N49D, M51R, H54Y, A133T, V221F, V225I, S226R. Alternatively, the site mutation of the M protein includes one or more of the following: N32S, N49D, M51R, H54Y, A133T, V221F, V225I, S226R. Compared to the amino acid sequence shown in Sequence ID No. 12, the site mutation of the G protein includes one or more of the following: V53I, A141V, D172Y, K217E, D232G, V331A, V371E, G436D, T438S, F453L, T471I, Y487H. Compared to the amino acid sequence shown in Sequence ID No. 14, the site mutation of the N protein includes one or more of I14V, R155K, and S353N. Compared to the amino acid sequence shown in Sequence ID No. 16, the site mutation of the P protein includes one or more of the following: R50K, V76A, D99E, L126S, L140S, H151Y, I168M, K170E, Y189S, N237D. Compared to the amino acid sequence shown in Sequence ID No. 18, the site mutation in the L protein includes one or more of S87P and I487T. A tumor treatment method combining recombinant oncolytic virus and a low-molecular-weight anticancer drug, characterized by the following features.
2. The recombinant oncolytic virus includes one or more of the following: baculovirus, poxvirus, herpes simplex virus, measles virus, Semryki forest virus, poliovirus, reovirus, Seneca Valley virus, echotype enterovirus, coxsackievirus, Newcastle disease virus, and Malabar virus. A tumor treatment method comprising a recombinant oncolytic virus and a low-molecular-weight anticancer drug as described in claim 1.
3. The aforementioned baculovirus includes vesicular stomatitis virus. A tumor treatment method comprising a recombinant oncolytic virus and a low-molecular-weight anticancer drug as described in feature 2.
4. The recombinant oncolytic virus further comprises an antigen encoded by an exogenous gene. A tumor treatment method comprising a recombinant oncolytic virus and a low-molecular-weight anticancer drug as described in claim 1.
5. The antigen is selected from hematopoietic tumor antigens and solid tumor antigens. A tumor treatment method comprising a recombinant oncolytic virus and a low-molecular-weight anticancer drug as described in claim 1.
6. The solid tumor antigens mentioned above include 5T4, RORl, EGFR, FcγRI, FcγRIIa, FcγRIIb, CD28, CD137, CTLA-4, HER2, HER3, FAS, FAP, LGR5, C5aR1, A2AR, FGFR1, FGFR2, FGFR3, FGFR4, glucocorticoid-induced TNFR-related protein, LTβR, TRAIL receptor 1, TRAIL receptor 2, prostate-specific membrane antigen protein, prostate stem cell antigen protein, tumor-associated protein carbonic anhydrase IX, EGFR1, EGFRvIII, ErbB3, folate receptor, and ephrin receptor. body, PDGFRa, ErbB-2, CD2, CD40, CD74, CD80, CD86, CCAM5, CCAM6, p53, MET, HG FR, MAGE-A1, MAGE-A2, MAGE-A3, MAGE-A4, MAGE-A6, MAGE-A10, MAGE-A12, BA CE, DAM-6, DAM-10, GAGE-1, GAGE-2, GAGE-8, GAGE-3, GAGE-4, GAGE-5, GAGE -6, GAGE-7B, NA88-A, NY-ESO-1, BRCA1, BRCA2, MART-1, MC1R, Gp100, PSA, PS M, tyrosinase, TRP-1, TRP-2, ART-4, CAMEL, Cyp-B, hTERT, hTRT, iCE, MUC2, P-cadherin, myostatin, Cripto, MUC5AC, PRAME, P15, RU1, RU2, SART-1, SART-3, AFP, β-catenin / m, caspase-8 / m, CDK-4 / m, ELF2M, GnT-V, G250, HSP70-2M, HST-2, KIAA0205, MUM-1, MUM-2, MUM-3, myosin / m, RAGE, SART-2, TRP-2 / INT2, 707-AP, Ane Kine II, CDC27 / m, TPI / mbcr-abl, ETV6 / AML, LDLR / FUT, Pml / RARα, TEL / AML1, CD28, CD137, CanAg, Mesothelin (MSLN), DR5, PD-1, PD-L1, IGF-1R, CXCR4, Neuropilin 1, Phosphatidylinositol Proteoglycan, EphA2, B7-H3, B7-H4, gpA33, GPC3, SSTR2, GD2, VEGF-A, VEGF-2, PDGFR-a, ANKL, RANKL, MSLN, EBV, TROP2, FOLR1,This includes, but is not limited to, AXL, Claude 18.2, MUC1, TPBG, CEA, and EpCAM. The aforementioned hematopoietic tumor antigens are BCMA, CD4, CD5, CD7, CD10, FcγRIIIIa, FcγRIIIIb, CD19, CD20, CD22, CD23, CD30, CD33, CD34, CD37, CD38, CD44, CD47, CD56, CD70, CD117, CD123, CD138, CD174, CLL-1, ROR1, NKG2DL1 / 2, IL1R3, FCRL5, GPRC5D, CLEC12A, WT1, FLT3, TLR8, SHP2, KAT6A / B, CSNK1A1, FLI1, IKZF1 / 3, PI3K, c-Kit, SLAMF3, SLAMF7, TCR This includes, but is not limited to, B-chain, ITGB7, k-1gG, TACI, TRBCI, LeY, and MUC1. A tumor treatment method comprising a recombinant oncolytic virus and a low-molecular-weight anticancer drug as described in feature 5.
7. The antigen is selected from one or more of the following: CD19, CD22, BCMA, MUC1, NY-ESO-1, MAGE A4, MET, Claude 18.2, MSLN, EGFR, VEGFR2, HER2, TPBG, AFP, and MAGE-A10. A tumor treatment method comprising a recombinant oncolytic virus and a low-molecular-weight anticancer drug as described in feature 6.
8. The antigen expressed by the recombinant oncolytic virus is at least one or more. A tumor treatment method comprising a recombinant oncolytic virus and a low-molecular-weight anticancer drug as described in feature 4.
9. The aforementioned low-molecular-weight anticancer agent is Small molecule anticancer drugs that target ALK, including but not limited to Alectinib, Brigatinib, Ceritinib, Crizobtinib, Entrectinib, Lorlatinib, and Ensartinib, Small molecule anticancer drugs that target BTK, including but not limited to Acalabrutinib, Ibrutinib, Zanubrutinib, and Orelabrutinib, Small molecule anticancer drugs that target EGFR, including but not limited to Afatinib, Dacomitinib, Erlotinib, Gefitinib, Icotinib, Lapatinib, Mobocertinib, Osimertinib, Rybrevant, Befortinib, Lazetinib, Dasatinib, Brigatinib, Vandetenib, Almonetinib, and Furmonertinib, FGFR-targeting small molecule anticancer drugs, including but not limited to Erdafitinib, Infigratinib, Pemazyre, Pemigatinib, Lenvatinib, Pazopanib, Anlotinib, and Ponatinib, This includes, but is not limited to, neratinib, pyrotinib, tucatinib, and mobocertinib, small molecule anticancer drugs that target HER2. Parp-targeting small molecule anticancer drugs, including but not limited to avapritinib, fluzoparib, niraparib, olaparib, and rucaparib, Small molecule anticancer drugs that target PI3K, including but not limited to duvelisib and linperlisib, Small molecule anticancer drugs that target VEGFR, including but not limited to Apatinib, Axitinib, Lenvatinib, Pazopanib, Regorafenib, Anlotinib, Cabozantinib, Sunitinib, Vandetenib, Ponatinib, Sorafenib, Donafenib, Surufatinib, and Fruquintinib, Small molecule anticancer drugs targeting CDK4 / 6, including but not limited to Abemaciclib, Dalpiciclib, Palbocilib, and Ribocilib, This includes, but is not limited to, small molecule anticancer agents targeting KRAS G12A, KRAS G12C, KRAS G12D, KRAS G12R, KRAS G12V, KRAS G13D, KRAS Q61L, and KRAS Q61H, and other small molecule anticancer agents targeting KRAS. This includes, but is not limited to, sotorasib and adagrasib, small molecule anticancer agents that target KRAS G12C. A tumor treatment method comprising a recombinant oncolytic virus and a low-molecular-weight anticancer drug as described in claim 1.
10. The aforementioned low-molecular-weight anticancer agent is This includes, but is not limited to, Vemurafenib, Dabrafenib, Encorafenib, Trametinib, Binimetmib, and Cobimetinib, and is a small molecule anticancer drug indicated for malignant melanoma. Small molecule anticancer drugs, including but not limited to Pexidartinib, tazemetostat, Pazopanib, and Anlotinib, whose indication is cytomas or sarcomas, Small molecule anticancer drugs, including but not limited to imatinib, boilinib, nilotinib, gilteritinib, and ivosidenib, whose indication is leukemia, One or more of the following small molecule anticancer drugs, including but not limited to Sotorasib, Capmatinib, Tepotinib, Savolitinib, Pralsetinib, Selpercatinib, Alectinib, Brigatinib, Ceritinib, Crizobtinib, Entrectinib, Lorlatinib, Afatinib, Dacomitinib, Erlotinib, Gefitinib, Icotinib, Mobocertinib, Osimertinib, Rybrevant, and Befortinib, whose indication is NSCLC, are selected. A tumor treatment method comprising a recombinant oncolytic virus and a low-molecular-weight anticancer drug as described in claim 1.
11. The aforementioned small molecule anticancer agent is selected from one or more of the following: tivazanib, Everolimus, Sirolimus, Temsirolimus, Midostaurin, Ripretinib, Selumetinib, Larotrectinib, Lurbinectedin, and Olverembatinib. A tumor treatment method comprising a recombinant oncolytic virus and a low-molecular-weight anticancer drug as described in claim 1.
12. The aforementioned low-molecular-weight anticancer agent is Lorlatinib, Acalabrutinib, Ibrutinib, Zanubrutinib, Erlotinib, Gefitinib, Icotinib , Osimertinib, Rybrevant, Befortinib, Lazetinib, Erdafitinib, Infigratinib, Pemazyre, Pemiga tinib, Pyrotinib, Tucatinib, Avapritinib, Fluzoparib, Niraparib, Olaparib, Rucapari b, linperlisib, Apatinib, Abemaciclib, Dalpiciclib, Palbociclib, Ribociclib, Vemuraf This includes, but is not limited to, single-target small molecule anticancer agents such as enib, dabrafenib, encorafenib, trametinib, binimetmib, cobimetinib, pexidartinib, tazemetostat, gilteritinib, ivosidenib, sotorasib, capmatinib, tepotinib, savolitinib, pralsetinib, selpercatinib, everolimus, sirolimus, timsirolimus, midostaurin, ripretinib, selumetinib, larotrectinib, and lurbinectedin. One or more of the following are selected: multi-targeted small molecule anticancer agents, including but not limited to Alectinib, Brigatinib, Ceritinib, Crizobtinib, Entrectinib, Afatinib, Dacomitinib, Lapatinib, Mobocertinib, Dasatinib, Neratinib, duvelisib, Axitinib, Lenvatinib, Pazopanib, Regorafenib, Anlotinib, Cabozantinib, Sunitinib, Vandetenib, Ponatinib, Sorafenib, Imatinib, Bosutinib, Nilotinib, and tivazanib. A tumor treatment method comprising a recombinant oncolytic virus and a low-molecular-weight anticancer drug as described in claim 1.
13. The aforementioned small molecule anticancer agent is selected from one or more of the following: Ceritinib, Ibrutinib, Afatinib, Dacomitinib, Icotinib, Lenovatinib, Pazopanib, Anlotinib, Pyrotinib, Niraparib, Olaparib, Regorafenib, Palbociliclib, Vemurafenib, Savolitinib, Everolimus, Mobocertinib, and Sotorasib. A tumor treatment method comprising a recombinant oncolytic virus and a low-molecular-weight anticancer drug as described in claim 1.
14. The recombinant oncolytic virus further comprises cytokines encoded by exogenous genes. A tumor treatment method comprising a recombinant oncolytic virus and a low-molecular-weight anticancer drug as described in claim 1.
15. The cytokines are selected from interleukins, interferons, tumor necrosis factor, colony-stimulating factor, transforming growth factor β, and the chemokine family. A tumor treatment method comprising a recombinant oncolytic virus and a low-molecular-weight anticancer drug as described in 14.
16. The cytokines are selected from one or more of the following: GM-CSF, G-CSF, M-CSF, IL-1, IL-2, IL-4, IL-5, IL-6, IL-9, IL-10, IL-12, IL-13, IL-15, IL-17, IL-18, IL-23, IL-27, IFN-α, IFN-β, IFN-γ, IFN-β, TGF-β, and TNF-α. A tumor treatment method comprising a recombinant oncolytic virus and a low-molecular-weight anticancer drug as described in 15.
17. The cytokine is selected from one or more of the following: GM-CSF, IL-2, IL-12, IL-15, IL-18, IFN-β, and TNF-α. A tumor treatment method comprising a recombinant oncolytic virus and a low-molecular-weight anticancer drug as described in 16.
18. The recombinant oncolytic virus comprises a nucleic acid molecule, the nucleic acid molecule comprising a nucleic acid sequence encoding the M protein having site mutations, a nucleic acid sequence encoding the G protein having site mutations, a nucleic acid sequence encoding the N protein having site mutations, a nucleic acid sequence encoding the P protein having site mutations, and a nucleic acid sequence encoding the L protein having site mutations. A tumor treatment method comprising a recombinant oncolytic virus and a low-molecular-weight anticancer drug as described in claim 1.
19. The nucleic acid molecule further comprises a nucleic acid sequence encoding a cytokine, and / or the nucleic acid molecule further comprises a nucleic acid sequence encoding an antigen. A tumor treatment method comprising a recombinant oncolytic virus and a low-molecular-weight anticancer drug as described in 18.
20. The nucleic acid sequence encoding the cytokine is located between the nucleic acid sequence encoding the G protein having a site mutation and the nucleic acid sequence encoding the L protein having a site mutation, and / or the nucleic acid sequence encoding the antigen is located between the nucleic acid sequence encoding the G protein having a site mutation and the nucleic acid sequence encoding the L protein having a site mutation. A tumor treatment method comprising a recombinant oncolytic virus and a low-molecular-weight anticancer drug as described in 19.
21. The aforementioned recombinant oncolytic virus combined with a low-molecular-weight anticancer drug is used as a tumor therapy to continuously kill abnormally proliferating cells. A tumor treatment method comprising a recombinant oncolytic virus and a low-molecular-weight anticancer drug as described in claim 1.
22. The abnormally proliferating cells are selected from tumor cells or tumor tissue-associated cells. A tumor treatment method comprising a recombinant oncolytic virus and a low-molecular-weight anticancer drug as described in 21.
23. The aforementioned tumor includes a solid tumor or a hematoma. A tumor treatment method comprising a recombinant oncolytic virus and a low-molecular-weight anticancer drug as described in 21.
24. The aforementioned tumors include acute lymphoblastic leukemia, acute B lymphoblastic leukemia, chronic non-lymphoblastic leukemia, non-Hodgkin lymphoma, anal cancer, astrocytoma, basal cell carcinoma, cholangiocarcinoma, bladder cancer, breast cancer, cervical cancer, chronic myeloproliferative neoplasm, colorectal cancer, endometrial cancer, ependymal tumor, esophageal cancer, diffuse large B cell lymphoma, sensory neuroblastoma, Ewing's sarcoma, fallopian tube cancer, gallbladder cancer, gastric cancer, gastrointestinal carcinoid tumor, hepatocellular carcinoma, hypopharyngeal cancer, and This includes, but is not limited to, Posi's sarcoma, renal cancer, Langhans cell proliferative disorder, pharyngeal cancer, liver cancer, lung cancer, malignant melanoma, Merkel cell carcinoma, mesothelioma, oral cancer, neuroblastoma, non-small cell lung cancer, osteosarcoma, ovarian cancer, pancreatic cancer, pancreatic neuroendocrine tumor, pharyngeal cancer, pituitary tumor, prostate cancer, rectal cancer, renal cell carcinoma, retinoblastoma, skin cancer, small cell lung cancer, small intestine cancer, squamous cell carcinoma, testicular cancer, thymoma, thyroid cancer, uterine cancer, vaginal cancer, and hemangiomas. A tumor treatment method comprising a recombinant oncolytic virus and a low-molecular-weight anticancer drug as described in 21.
25. A composition, The composition comprises the recombinant oncolytic virus and the low molecular weight anticancer agent described in claim 1. A composition characterized by the following features.