Transgenic mammals and methods of use
By introducing engineered canine immunoglobulin loci into non-canine animals and optimizing the genome to increase lambda light chain expression, the problem of difficulty in producing canine-specific antibodies in non-canine animals was solved, and efficient monoclonal antibody production was achieved.
Patent Information
- Application Number
- CN202080059181.9
- Authority / Receiving Office
- CN · China
- Patent Type
- Patents(China)
- Current Assignee / Owner
- Priority Date
- 2019-07-01
- Filing Date
- 2020-06-30
- Publication Date
- 2025-09-12
- Estimated Expiration
- 2040-06-30
AI Technical Summary
Existing technologies make it difficult to efficiently and economically produce canine-specific antibodies in non-canine animals. In particular, due to inefficient recombination and immune tolerance issues in B cell development, it is difficult to prepare effective monoclonal antibodies in canines.
Chimeric B cell receptors or antibodies are expressed by introducing into a non-canine mammal (e.g., a rodent) an engineered portion of a canine immunoglobulin locus comprising canine immunoglobulin variable region gene segments and non-coding sequences of the endogenous immunoglobulin variable region locus of the non-canine host, wherein the genome is optimized to increase expression of lambda light chains and decrease expression of kappa light chains.
The invention realizes the efficient production of canine-specific antibodies in non-canine animals, especially increases the expression ratio of lambda light chain, improves the efficiency and reliability of monoclonal antibody production, and is suitable for the treatment of canine diseases.
Smart Images

Figure CN114502725B_ABST
Abstract
Description
[0001] CROSS-REFERENCE TO RELATED APPLICATIONS
[0002] This application claims priority to U.S. Provisional Application No. 62 / 869,435, filed on July 1, 2019, the disclosure of which is incorporated herein by reference.
[0003] Sequence Listing
[0004] This application includes a sequence listing, which has been submitted electronically in ASCII format and is hereby incorporated by reference in its entirety. The ASCII copy, generated on June 24, 2020, is named 0133-0006WO1_SL.txt and is 219,066 bytes in size. Field of the Invention
[0005] The present invention relates to the production of immunoglobulin molecules, including methods for producing transgenic mammals capable of producing canine antigen-specific antibody-secreting cells for the production of monoclonal antibodies.
[0006] background
[0007] In the following discussion, certain articles and methods are described for background and introductory purposes. Nothing contained herein is to be construed as an admission that the prior art is provided. The applicant expressly reserves the right to demonstrate, as the case may be, that the articles and methods cited herein do not constitute prior art under applicable statutory provisions.
[0008] Antibodies have become important biopharmaceuticals because they (i) exhibit precise binding properties that can target antigens in diverse molecular forms, (ii) are physiological molecules with desirable pharmacokinetics that make them well tolerated in treated humans and animals, and (iii) are associated with potent immune properties that naturally protect against infectious agents. Furthermore, established techniques exist for rapidly isolating antibodies from experimental animals that can readily generate specific antibody responses against virtually any foreign substance that does not naturally occur in the body.
[0009] In its most basic form, an antibody comprises two identical heavy (H) chains, each paired with an identical light (L) chain. The N-termini of both the H and L chains include variable domains (V, L, and L, respectively). H and V L ), which together provide unique antigen-binding specificity for the paired HL chains.
[0010] Encoding antibody V H and V L The exons of the domain are not present in the germline DNA. Instead, each V HThe exons consist of randomly selected V sequences present in the immunoglobulin H chain locus (IGH). H , D and J H Recombination of gene segments; similarly, a single V L Exons are randomly selected from the light chain locus V L and J L Chromosomal rearrangements of gene segments occur.
[0011] The canine genome contains two alleles that can express the H chain (one allele from each parent), two alleles that can express the kappa (κ) L chain, and two alleles that can express the lambda (λ) L chain. There are multiple V H , D and J H gene segments, and the presence of multiple V L and J L Gene segment (Collins and Watson (2018) Immunoglobulin LightChain Gene Rearrangements, Receptor Editing and the Development of a Self-Tolerant Antibody Repertoire. Front. Immunol. 9:2249. (doi:10.3389 / fimmu.2018.02249)).
[0012] In a typical immunoglobulin heavy chain variable region locus, V H The gene segment is located in J H Upstream (5') of the gene segment, where the D gene segment is located at the V H With J H Between gene segments. J of IGH locus H The downstream (3') of the gene segment is the one encoding the antibody constant region (C H ) exon cluster. Each C H Clusters of exons encode different antibody classes (isotypes). In mice, there are eight antibody classes: IgM, IgD, IgG3, IgG1, IgG2a (or IgG2c), IgG2b, IgE, and IgA (at the nucleic acid level, they are called: μ, δ, γ3, γ1, γ2a / c, γ2b, ε, and α, respectively). In canines (e.g., domestic dogs and wolves), the putative isotypes are IgM, IgD, IgG1, IgG2, IgG3, IgG4, IgE, and IgA ( Figure 12A ).
[0013] At the IGK locus in most mammalian species, a cluster of V κ Gene segments are located in a small number of J κ Upstream of the gene segment, where J κ The gene segment cluster is located in a single C κ This organization of the κ locus can be represented as (V κ ) a ...(J κ ) b ...C κ , where a and b are independently integers of 1 or greater. The canine κ locus is unusual in that half of the V κ The gene is located in J κ and C κ gene segment upstream, and half is located in the J κ and C κ Downstream of the gene segment (see Figure 1C The mouse IGK locus and Figure 12C Schematic diagram of the canine IGK locus).
[0014] The IGL locus in most species consists of a set of V sequences located 5' of a variable number of JC tandem cassettes. λ Gene segment, each tandem cassette consists of a J λ gene segment and a C λ Gene segment composition (see Figure 12B Schematic diagram of the canine IGL locus in ). The organization of the lambda locus can be represented as (V λ ) a ...(J λ -C λ ) b , wherein a and b are independently integers of 1 or greater. The mouse IGL locus is unusual in that it contains two units of (V λ ) a ...(J λ -C λ ) b .
[0015] During B cell development, gene rearrangement first occurs on one of the two homologous chromosomes containing the H chain variable gene segment. H Exon splicing at the RNA level to C μ exon for IgM H chain expression. L -J LRearrangement occurs on one L chain allele at a time until a functional L chain is produced, after which the L chain polypeptide can associate with the IgM H chain homodimer to form a fully functional B cell receptor (BCR) for the antigen. In mice and humans, as B cells continue to mature, IgD is co-expressed with IgM in an alternatively spliced form, where IgD is expressed at a level 10-fold higher than IgM in the primary B cell population. This is in contrast to B cell development in dogs, where C δ The exon may be non-functional.
[0016] Experts in this field generally agree that in mice and humans, V L -J L Rearrangement occurs first at the IGK loci on both chromosomes, and then the IGL light chain locus on either chromosome becomes receptive to V L -J L Recombination. This is supported by the observation that in mouse B cells expressing kappa light chains, the lambda loci on both chromosomes are often inactivated by non-productive rearrangement. This could explain the predominant kappa L chain usage of >90% kappa and <10% lambda in mice.
[0017] However, immunoglobulin usage in the canine immune system is dominated by lambda light chains, with estimates of light chain usage ranging from at least 90% lambda to <10% kappa. κ -J κ Is the rearrangement compared to V λ -J λ The rearrangement occurs preferentially first, and the mechanism is unknown.
[0018] After encountering antigen, B cells can undergo another round of DNA recombination at the IGH locus to remove C μ and C δ exon, effectively converting C HThe constant region is converted to one of the downstream isotypes (this process is called class switching). In dogs, although cDNA clones identified as encoding canine IgG1-IgG4 have been isolated (Tang, et al. (2001) Cloning and characterization of cDNAs encoding four different canine immunoglobulinγ chains.Vet.Immunol.and Immunopath.80:259PMID 11457479), only IgG2 constant region genes are physically mapped to the IGH locus on canine chromosome 8 (Martin, et al. (2018) Comprehensive annotation and evolutionary insights into the canine (Canis lupus familiaris) antigen receptor loci.Immunogenet.70:223doi:10.1007 / s00251-017-1028-0).
[0019] The genes encoding various canine and mouse immunoglobulins have been extensively characterized. Priat et al. described whole-genome radiation mapping of the canine genome in Genomics, 54:361-78 (1998), and Bao et al. described V in Canis familiaris in Veterinary Immunology and Immunopathology, 137:64-75 (2010). H Molecular characterization of the repertoire. Martin et al. provide annotations of the canine (Canis lupus familiaris) immunoglobulin kappa and lambda (IGK, IGL) loci, as well as an update of the IGH locus annotation in Immunogenetics, 70(4):223-236 (2018).
[0020] Blankenstein and Krawinkel described the mouse variable heavy chain region locus in Eur. J. Immunol., 17: 1351-1357 (1987). Transgenic animals are routinely used in various research and development applications. For example, the generation of transgenic mice containing immunoglobulin genes is described in International Applications WO 90 / 10077 and WO 90 / 04036. WO 90 / 04036 describes transgenic mice with integrated human immunoglobulin "mini" loci. WO 90 / 10077 describes vectors containing immunoglobulin dominant control regions for use in generating transgenic animals.
[0021] A number of methods have been developed for modifying the endogenous immunoglobulin variable region loci of mice with, for example, human immunoglobulin sequences to generate partially or fully human antibodies for drug discovery purposes. Examples of such mice include those described in, e.g., U.S. Patent Nos. 7,145,056; 7,064,244; 7,041,871; 6,673,986; 6,596,541; 6,570,061; 6,162,963; 6,130,364; 6,091,001; 6,023,010; 5,593,598; 5,877,397; 5,874,299; 5,814,318; 5,789,650; 5,661,016; 5,612,205; and 5,591,669. However, many fully humanized immunoglobulin transgenic mice exhibit suboptimal antibody production because B cell development in these mice is severely hampered by inefficient V(D)J recombination and by the inability of fully human antibodies / BCRs to function optimally with mouse signaling proteins. Other humanized immunoglobulin transgenic mice, in which mouse coding sequences have been "swapped" with human sequences, are very time-consuming and expensive to produce due to the process of replacing individual mouse exons with their syntenic human counterparts.
[0022] The use of antibodies that function as drugs is not limited to the prevention or treatment of human diseases. Companion animals such as dogs suffer from some of the same diseases (affliction) as humans, such as cancer, atopic dermatitis and chronic pain. Monoclonal antibodies targeting IL31, CD20, IgE and nerve growth factor respectively have been used in veterinary medicine as treatments for these conditions. However, before clinical use, these monoclonal antibodies prepared in mice must be caninized, that is, their amino acid sequences must be changed from mice to dogs to prevent immune responses in receiving dogs. Importantly, due to immune tolerance, canine antibodies against canine proteins cannot be easily produced in dogs. Based on the foregoing, it is clear that there is a need for an effective and cost-effective method for producing canine antibodies for treating diseases in dogs. More particularly, there is a need in the art for small, rapidly bred non-canine mammals that can produce antigen-specific canine immunoglobulins. Such non-canine mammals can be used to produce hybridomas that can produce canine monoclonal antibodies on a large scale.
[0023] PCT Publication No. 2018 / 189520 describes rodents and cells having genomes engineered to express exogenous animal immunoglobulin variable region genes from companion animals such as dogs, cats, horses, birds, rabbits, goats, reptiles, fish, and amphibians.
[0024] However, there remains a need for improved methods for generating transgenic non-human animals capable of producing antibodies having canine V regions.
[0025] Overview
[0026] This summary is provided to introduce a selection of concepts in a simplified form that are further described in the detailed description below. This summary is not intended to identify key or essential features of the claimed subject matter, nor is it intended to be used to limit the scope of the claimed subject matter. Other features, details, utilities, and advantages of the claimed subject matter will be apparent from the following written detailed description, including those aspects illustrated in the accompanying drawings and defined in the appended claims.
[0027] Described herein are non-canine mammalian cells and non-canine mammals having genomes comprising exogenously introduced portions of canine immunoglobulin loci, wherein the introduced loci comprise coding sequences for canine immunoglobulin variable region gene segments and non-coding sequences of endogenous immunoglobulin variable region loci based on the non-canine mammalian host. Thus, the non-canine mammalian cell or mammal is capable of expressing a chimeric B cell receptor (BCR) or antibody comprising fully canine H and L chain variable regions bound to respective constant regions native to the non-canine mammalian host cell or mammal. Preferably, the transgenic cells and animals have genomes in which some or all of the endogenous immunoglobulin variable region loci have been removed.
[0028] At a minimum, production of a chimeric canine monoclonal antibody in a non-canine mammalian host requires that the host possess at least one locus that expresses a chimeric canine immunoglobulin H chain or L chain. In most aspects, there is one heavy chain locus and two light chain loci that express the chimeric canine immunoglobulin H and L chains, respectively.
[0029] In some aspects, the portion of the canine immunoglobulin locus comprises a canine V H coding sequences and endogenous V H In these aspects, the portion of the canine immunoglobulin locus further comprises endogenous D and J sequences that are present in the genome of the non-canine mammalian host cell. H Canine D and J genes are bound by noncoding regulatory or scaffold sequences adjacent to the gene segments H In one aspect, a portion of a canine immunoglobulin locus comprises a canine V heavy chain locus embedded within a non-coding regulatory or scaffold sequence present in an endogenous immunoglobulin heavy chain locus of a non-canine mammalian host. H , D and J H In one aspect, a portion of the canine immunoglobulin locus comprises a canine V segment encoding sequence embedded within a non-coding regulatory or scaffold sequence present in an endogenous immunoglobulin heavy chain locus of a rodent, such as a mouse. H , D and J H In other aspects, the portion of the canine immunoglobulin locus comprises a canine V L coding sequences and endogenous V L In one aspect, the canine V LThe exogenously introduced portion of the canine immunoglobulin locus coding sequence further comprises a canine L chain J gene segment coding sequence and a non-coding regulatory or scaffold sequence adjacent to the endogenous L chain J gene segment present in the genome of the non-canine mammalian host cell. In one aspect, the portion of the canine immunoglobulin locus comprises a canine V L chain J gene segment embedded in a non-coding regulatory or scaffold sequence of an immunoglobulin light chain locus in a non-canine mammalian host cell. λ and J λ In one aspect, the portion of the canine immunoglobulin locus comprises a canine V segment encoding sequence embedded in a non-coding regulatory or scaffold sequence of an immunoglobulin locus of a non-canine mammalian host. κ and J κ Gene segment encoding sequence. In one aspect, the endogenous κ locus of the non-canine mammalian host is inactivated or replaced with a sequence encoding a canine λ chain to increase the production of canine λ immunoglobulin light chains compared to canine κ chains. In one aspect, the endogenous κ locus of the non-canine mammalian host is inactivated but not replaced with a sequence encoding a canine λ chain.
[0030] In certain aspects, the non-canine mammal is a rodent, eg, a mouse or a rat.
[0031] In one aspect, the engineered immunoglobulin locus comprises a portion of a canine immunoglobulin light chain locus comprising one or more canine lambda variable region gene segment coding sequences. In one aspect, the engineered immunoglobulin locus is a portion of a canine immunoglobulin light chain locus comprising one or more canine kappa variable region gene segment coding sequences.
[0032] In one aspect, a transgenic rodent or rodent cell is provided, the transgenic rodent or rodent cell having a genome comprising an engineered portion of a canine immunoglobulin locus. In one aspect, a transgenic rodent or rodent cell is provided, the transgenic rodent or rodent cell having a genome comprising an engineered portion of a canine immunoglobulin light chain locus. In one aspect, the portion of the canine immunoglobulin light chain locus of the rodent or rodent cell comprises one or more canine immunoglobulin lambda variable region gene segment coding sequences. In one aspect, the portion of the canine immunoglobulin light chain locus of the rodent or rodent cell comprises one or more canine immunoglobulin kappa variable region gene segment coding sequences. In one aspect, the engineered immunoglobulin locus is capable of expressing immunoglobulins comprising canine variable domains.
[0033] In one aspect, a transgenic rodent is provided that produces more immunoglobulins comprising lambda light chains than immunoglobulins comprising kappa light chains. In one aspect, the transgenic rodent produces at least about 25%, 30%, 35%, 40%, 45%, 50%, 55%, 60%, 65%, 70%, 75%, 80%, 85%, 90% or 95% and up to about 100% lambda light chain immunoglobulins. In one aspect, the transgenic rodent produces at least about 25%, 30%, 35%, 40%, 45%, 50%, 55%, 60%, 65%, 70%, 75%, 80%, 85%, 90% or 95% and up to about 100% lambda light chain immunoglobulins comprising canine variable domains. In one aspect, the likelihood of isolating cells producing lambda light chains from transgenic rodents is greater than isolating cells producing kappa light chains. In one aspect, cells isolated from the transgenic rodent are more likely to produce lambda light chains with canine variable domains than cells that produce kappa light chains with canine variable domains.
[0034] In one aspect, a transgenic rodent cell is provided that is more likely to produce an immunoglobulin comprising a lambda light chain than an immunoglobulin comprising a kappa light chain. In one aspect, the rodent cell is isolated from a transgenic rodent described herein. In one aspect, the rodent cell is recombinantly produced as described herein. In one aspect, the transgenic rodent cell or its progeny has a probability of at least about 25%, 30%, 35%, 40%, 45%, 50%, 55%, 60%, 65%, 70%, 75%, 80%, 85%, 90% or 95%, and up to about 100%, of producing a lambda light chain immunoglobulin. In one aspect, the transgenic rodent cell, or progeny thereof, has a probability of at least about 25%, 30%, 35%, 40%, 45%, 50%, 55%, 60%, 65%, 70%, 75%, 80%, 85%, 90% or 95%, and up to about 100%, of producing a lambda light chain immunoglobulin having a canine variable domain.
[0035] In one aspect, the engineered portion of the canine immunoglobulin locus comprises a canine V λ Gene segment coding sequence and J λ Gene segment coding sequences as well as non-coding sequences such as regulatory or scaffold sequences of the rodent immunoglobulin light chain variable region locus.
[0036] In one aspect, the engineered immunoglobulin locus comprises a canine V sequence embedded within a rodent noncoding regulatory or scaffold sequence of a rodent immunoglobulin lambda light chain variable region locus. λ and J λIn one aspect, the engineered immunoglobulin locus comprises a canine V segment coding sequence embedded in a non-coding regulatory or scaffold sequence of a rodent immunoglobulin kappa light chain variable region locus. λ and J λ In one aspect, the portion of the canine immunoglobulin locus comprises one or more canine V λ Gene segment coding sequence and J λ gene segment coding sequences and one or more rodent immunoglobulin lambda constant region coding sequences.
[0037] In one aspect, the engineered immunoglobulin variable region locus comprises one or more canine V λ gene segment coding sequence and one or more JC units, wherein each JC unit comprises a canine J λ Gene segment coding sequence and rodent C λ In one aspect, the engineered immunoglobulin variable region locus comprises one or more canine V λ gene segment coding sequence and one or more JC units, wherein each JC unit comprises a canine J λ Gene segment coding sequence and rodent C λ In one aspect, the rodent C λ The coding sequence of the region was selected from rodent C λ1 、C λ2 or C λ3 In one aspect, one or more canine V λ The gene segment coding sequence is located upstream of one or more JC units, wherein each JC unit comprises a canine J λ Gene segment coding sequence and rodent C λ In one aspect, one or more canine V λ The gene segment coding sequence is located upstream of one or more JC units, wherein each JC unit comprises a canine J λ Gene segment coding sequence and rodent C λ Gene segment coding sequence and rodent C λ In one aspect, the JC unit comprises a canine JC embedded within a non-coding regulatory or scaffold sequence of a rodent immunoglobulin kappa light chain locus. λ Gene segment coding sequence and rodent C λ Region coding sequence.
[0038] In one aspect, a transgenic rodent or rodent cell is provided having an engineered immunoglobulin locus comprising a rodent immunoglobulin kappa locus wherein one or more rodent V κ Gene segment coding sequence and one or more rodent J κ The gene segment coding sequence has been deleted and replaced by one or more canine V λ Gene segment coding sequence and one or more J λ The gene segment coding sequence is replaced, and wherein the rodent C κ The coding sequence has been identified by one or more rodent C λ1 、C λ2 or C λ3 Coding sequence substitutions.
[0039] In one aspect, the engineered immunoglobulin locus comprises a locus located at one or more canine J λ Gene segment coding sequence upstream and with the one or more canine J λ One or more canine V gene segments encoding sequences in the same transcriptional orientation λ gene segment coding sequence, said one or more canine J λ The gene segment coding sequence is located in one or more rodent C λ coding sequence upstream.
[0040] In one aspect, the engineered immunoglobulin locus comprises a locus located at one or more canine J λ Gene segment coding sequence upstream and with the one or more canine J λ The gene segment coding sequence is in the relative transcriptional orientation of one or more canine V λ gene segment coding sequence, said one or more canine J λ The gene segment coding sequence is located in one or more rodent C λ coding sequence upstream.
[0041] In one aspect, a transgenic rodent or rodent cell is provided in which the endogenous rodent immunoglobulin kappa light chain locus is deleted, inactivated, or rendered non-functional due to one or more of the following:
[0042] a. Deletion or mutation of all endogenous rodent V κ Gene segment coding sequence;
[0043] b. Deletion or mutation of all endogenous rodent J κ Gene segment coding sequence;
[0044] c. Deletion or mutation of endogenous rodent C κ Coding sequence;
[0045] d. Deletion or mutation J κ Gene segment and C κ splice donor sites, pyrimidine tracts, or splice acceptor sites in introns between exons; and
[0046] e. Deletion, mutation or disruption of the endogenous intronic kappa enhancer (iE κ ), 3' enhancer sequence (3'E κ ) or a combination thereof.
[0047] In one aspect, a transgenic rodent or rodent cell is provided in which expression of endogenous rodent immunoglobulin lambda light chain variable domains is suppressed or inactivated by one or more of:
[0048] a. Deletion or mutation of all endogenous rodent V λ gene segments;
[0049] b. Deletion or mutation of all endogenous rodent J λ gene segments;
[0050] c. Deletion or mutation of all endogenous rodent C λ coding sequence; and
[0051] d. Deletion or mutation J λ Gene segment and C λ Splice donor sites, pyrimidine tracts, or splice acceptor sites in introns between exons, or a combination thereof.
[0052] In one aspect, a transgenic rodent or rodent cell is provided, wherein the engineered immunoglobulin locus expresses an immunoglobulin light chain comprising a canine variable domain and a rodent constant domain. In one aspect, a transgenic rodent or rodent cell is provided, wherein the engineered immunoglobulin locus expresses an immunoglobulin light chain comprising a canine lambda variable domain and a rodent lambda constant domain. In one aspect, a transgenic rodent or rodent cell is provided, wherein the engineered immunoglobulin locus expresses an immunoglobulin light chain comprising a canine kappa variable domain and a rodent kappa constant domain.
[0053] In one aspect, a transgenic rodent or rodent cell is provided, wherein the genome of the transgenic rodent or rodent cell comprises a canine V κ and J κ In one aspect, the canine Vκ and J κ The gene segment coding sequence is inserted into the rodent immunoglobulin kappa light chain locus. κ and J κ The gene segment coding sequence is embedded in the rodent non-coding regulatory or scaffold sequence of the rodent immunoglobulin kappa light chain variable region locus. κ and J κ The coding sequence is inserted upstream of the rodent immunoglobulin kappa light chain constant region coding sequence.
[0054] In one aspect, a transgenic rodent or rodent cell is provided, wherein the genome of the transgenic rodent or rodent cell comprises an engineered immunoglobulin locus comprising a canine V inserted into a rodent immunoglobulin lambda light chain locus. κ and J κ In one aspect, the canine V κ and J κ The gene segment coding sequence is embedded in the rodent non-coding regulatory or scaffold sequence of the rodent immunoglobulin lambda light chain variable region locus. In one aspect, the genome of the transgenic rodent or rodent cell comprises an insertion of a canine V κ and J κ In one aspect, the rodent immunoglobulin kappa light chain constant region is inserted into the endogenous rodent C λ In one aspect, the rodent immunoglobulin kappa light chain constant region is inserted upstream of the endogenous rodent C λ2 In one aspect, expression of the endogenous rodent immunoglobulin lambda light chain variable domain is inhibited or inactivated by one or more of the following:
[0055] a. Deletion or mutation of all endogenous rodent V λ Gene segment coding sequence;
[0056] b. Deletion or mutation of all endogenous rodent J λ Gene segment coding sequence;
[0057] c. Deletion or mutation of all endogenous C λ coding sequence; and
[0058] d. Deletion or mutation J λ Gene segment and C λ Splice donor sites, pyrimidine tracts, or splice acceptor sites in introns between exons.
[0059] In one aspect, the engineered portion of the canine immunoglobulin light chain locus comprises the rodent intronic kappa enhancer (iEκ) and 3' kappa enhancer (3'Eκ) regulatory sequences.
[0060] In one aspect, the transgenic rodent or rodent cell further comprises an engineered portion of a canine immunoglobulin heavy chain locus comprising a canine immunoglobulin heavy chain variable region gene segment coding sequence and non-coding regulatory and scaffold sequences of a rodent immunoglobulin heavy chain locus. H , D and J H In one aspect, each canine / rodent chimeric V H , D or J H The gene segment contains V embedded in the noncoding regulatory and scaffold sequences of the rodent immunoglobulin heavy chain locus. H , D or J H Coding sequence. In one aspect, the heavy chain scaffold sequence is separated by one or two functional ADAM6 genes.
[0061] In one aspect, the rodent regulatory and scaffold sequences comprise one or more enhancers, promoters, splice sites, introns, recombination signal sequences, or combinations thereof.
[0062] In one aspect, the endogenous rodent immunoglobulin loci of the transgenic rodent or rodent cell have been inactivated. In one aspect, the endogenous rodent immunoglobulin loci of the transgenic rodent or rodent cell have been deleted and replaced with an engineered portion of the canine immunoglobulin locus.
[0063] On the one hand, rodent is mouse or rat.On the one hand, rodent cell is embryonic stem (ES) cell or early embryonic cell.On the one hand, rodent cell is mouse or rat embryonic stem (ES) cell or mouse or rat early embryonic cell.
[0064] In one aspect, a B lymphocyte lineage cell obtained from a transgenic rodent described herein is provided, wherein the B cell expresses or is capable of expressing a chimeric immunoglobulin heavy or light chain comprising a canine variable region and a rodent immunoglobulin constant region. In one aspect, a hybridoma cell or immortalized cell line derived from a B lymphocyte lineage cell obtained from a transgenic rodent or rodent cell described herein is provided.
[0065] In one aspect, provided are antibodies, or antigen-binding portions thereof, produced by cells from the transgenic rodents or rodent cells described herein.
[0066] In one aspect, V sequences derived from immunoglobulins produced by the transgenic rodents or rodent cells described herein are provided. H , D or J H or V L or J L In one aspect, a method for producing a non-canine mammalian cell comprising a portion of a canine immunoglobulin locus is provided, the method comprising: a) introducing two or more recombinase targeting sites into the genome of the non-canine mammalian host cell, and integrating at least one site upstream and at least one site downstream of a genomic region comprising an endogenous immunoglobulin variable region gene, wherein the endogenous immunoglobulin variable gene comprises a V H , D and J H Gene segment, or V κ and J κ Gene segment, or V λ and J λ Gene segment, or V λ 、J λ and C λ gene segments; and b) introducing an engineered portion of a canine immunoglobulin variable locus into a non-canine mammalian host cell via recombinase-mediated cassette exchange (RMCE), wherein the engineered portion of the canine immunoglobulin variable locus comprises a canine immunoglobulin variable region gene coding sequence and non-coding regulatory or scaffold sequences that correspond to non-coding regulatory or scaffold sequences present in an endogenous immunoglobulin variable region locus of the non-canine mammalian host.
[0067] In another aspect, the method further comprises, prior to step b, deleting the genomic region flanked by the two exogenously introduced recombinase targeting sites.
[0068] In a specific aspect of the method, an exogenously introduced engineered portion of a canine immunoglobulin heavy chain locus is provided, wherein the exogenously introduced engineered portion of a canine immunoglobulin heavy chain locus comprises a canine V H gene segment encoding sequence, and further comprising i) canine D and J H gene segment coding sequence and ii) non-coding regulatory or scaffold sequences upstream of the canine D gene segment (pre-D sequence, Figure 1A ), the non-coding regulatory or scaffold sequences correspond to sequences present upstream of the endogenous D gene segments in the genome of the non-canine mammalian host. In one aspect, these upstream scaffold sequences are separated by non-immunoglobulin genes, such as ADAM6A or ADAM6B ( Figure 1A(Nishimura et al. Developmental Biol. 233(1):204-213(2011)). H Upstream and endogenous J H The recombinase targeting site downstream of the locus introduces part of the canine immunoglobulin heavy chain locus into the host cell. In other aspects, non-coding regulatory or scaffold sequences are (at least in part) derived from other sources, for example, they can be rationally designed artificial sequences or conserved sequences of other unknown functions, sequences of combinations of canine and artificial or other designed sequences, or sequences from other species. As used herein, "artificial sequence" refers to a nucleic acid sequence that is not derived from a naturally occurring sequence at a genetic locus. On the one hand, non-coding regulatory or scaffold sequences are derived from non-coding regulatory or scaffold sequences of rodent immunoglobulin heavy chain variable region loci. On the one hand, non-coding regulatory or scaffold sequences have at least about 75%, 80%, 85%, 90%, 95% or 100% sequence identity to non-coding regulatory or scaffold sequences of rodent immunoglobulin heavy chain variable region loci. On the other hand, non-coding regulatory or scaffold sequences are rodent immunoglobulin heavy chain variable region non-coding or scaffold sequences.
[0069] In yet another specific aspect of the method, the introduced engineered portion of the canine immunoglobulin locus comprises a canine immunoglobulin V L gene segment coding sequence, and further comprising i) a canine L chain J gene segment coding sequence and ii) a non-coding regulatory or scaffold sequence that corresponds to a non-coding regulatory or scaffold sequence present in an endogenous L chain locus in the genome of a non-canine mammalian host cell. In one aspect, an endogenous immunoglobulin V gene segment that has been previously introduced into the same chromosome is used. L Recombinase targeting sites upstream of the canine immunoglobulin locus and downstream of the endogenous J locus introduce the engineered portion of the canine immunoglobulin locus into the host cell.
[0070] In a more specific aspect of the method, an exogenously introduced engineered portion of a canine immunoglobulin light chain locus is provided, wherein the exogenously introduced engineered portion of a canine immunoglobulin light chain locus comprises a canine V λ Gene segment coding sequence and Canis j λ In one aspect, an endogenous immunoglobulin V gene segment encoding sequence that has been previously introduced into the same chromosome is used. λ Upstream and endogenous J λ A recombinase targeting site downstream of the locus introduces a portion of the canine immunoglobulin light chain locus into the host cell.
[0071] In one aspect, the exogenously introduced engineered portion of the canine immunoglobulin light chain locus comprises a canine V κ Gene segment coding sequence and Canis j κ In one aspect, an endogenous immunoglobulin V gene segment encoding sequence that has been previously introduced into the same chromosome is used. κ Upstream and endogenous J κ A recombinase targeting site downstream of the locus introduces a portion of the canine immunoglobulin light chain locus into the host cell.
[0072] In one aspect, the non-coding regulatory or scaffold sequence is derived from a non-coding regulatory or scaffold sequence of a rodent lambda immunoglobulin light chain variable region locus. In one aspect, the non-coding regulatory or scaffold sequence has at least about 75%, 80%, 85%, 90%, 95% or 100% sequence identity to a non-coding regulatory or scaffold sequence of a rodent lambda immunoglobulin light chain variable region locus. In another aspect, the non-coding regulatory or scaffold sequence is a rodent lambda immunoglobulin light chain variable region non-coding or scaffold sequence.
[0073] In one aspect, the non-coding regulatory or scaffold sequence is derived from a non-coding regulatory or scaffold sequence of a rodent immunoglobulin kappa light chain variable region locus. In one aspect, the non-coding regulatory or scaffold sequence has at least about 75%, 80%, 85%, 90%, 95%, or 100% sequence identity to a non-coding regulatory or scaffold sequence of a rodent immunoglobulin kappa light chain variable region locus. In another aspect, the non-coding regulatory or scaffold sequence is a rodent immunoglobulin kappa light chain variable region non-coding or scaffold sequence.
[0074] In one aspect, the engineered portion of the canine immunoglobulin locus is synthesized as a single nucleic acid and introduced into a non-canine mammalian host cell as a single nucleic acid region. In one aspect, the engineered portion of the canine immunoglobulin locus is synthesized in two or more contiguous segments and introduced into a mammalian host cell as discrete segments. In another aspect, the engineered portion of the canine immunoglobulin locus is produced using recombinant methods, isolated, and then introduced into a non-canine mammalian host cell.
[0075] In another aspect, a method for producing a non-canine mammalian cell comprising an engineered portion of a canine immunoglobulin locus is provided, the method comprising: a) introducing two or more sequence-specific recombination sites that are incapable of recombination with each other into the genome of the non-canine mammalian host cell, wherein at least one recombination site is introduced upstream of an endogenous immunoglobulin variable region locus and at least one recombination site is introduced downstream of an endogenous immunoglobulin variable region locus on the same chromosome; b) providing a vector comprising an engineered portion of a canine immunoglobulin locus having i) a canine immunoglobulin capable of recombination; c) introducing the vector of step b) and a site-specific recombinase capable of recognizing the two recombinase sites into the host cell; and d) allowing a recombination event to occur between the genome of the cell of a) and the engineered portion of the canine immunoglobulin variable region locus, thereby replacing the endogenous immunoglobulin variable region locus with the engineered portion of the canine immunoglobulin variable region locus.
[0076] In one aspect, a portion of the canine immunoglobulin locus comprises V H immunoglobulin gene segment coding sequences, and further comprising i) canine D and J H gene segment coding sequence, ii) a separate V endogenously present in the genome of a non-canine mammalian host H , D and J H The recombinase targeting site is introduced into the endogenous immunoglobulin V H Upstream of the locus and endogenous D and J H downstream of the locus.
[0077] In one aspect, a transgenic rodent is provided, the transgenic rodent having a genome deleted from a rodent endogenous immunoglobulin variable locus, wherein the deleted rodent endogenous immunoglobulin variable locus has been replaced by an engineered portion of a canine immunoglobulin locus comprising a canine immunoglobulin variable gene coding sequence and a non-coding regulatory or scaffold sequence based on the rodent endogenous immunoglobulin variable locus, wherein the engineered portion of the canine immunoglobulin locus of the transgenic rodent is functional and expresses immunoglobulin chains having canine variable domains and rodent constant domains. In some aspects, the engineered portion of the canine immunoglobulin locus comprises a canine V H , D and J H coding sequence, and in some aspects, the engineered portion of the canine immunoglobulin locus comprises a canine V L and J L In one aspect, the portion of the canine immunoglobulin locus comprises a canine V λ and J λ In another aspect, the portion of the canine immunoglobulin locus comprises a canine V κ and J κ Coding sequence.
[0078] Some aspects provide B lymphocyte lineage cells from a transgenic rodent, partial or whole immunoglobulin molecules comprising a canine variable domain and a rodent constant domain obtained from a B lymphocyte lineage cell, hybridoma cells derived from a B lymphocyte lineage cell, partial or whole immunoglobulin molecules comprising a canine variable domain and a rodent constant domain obtained from a hybridoma cell, partial or whole immunoglobulin molecules comprising a canine variable domain derived from an immunoglobulin molecule obtained from a hybridoma cell, immortalized cells derived from a B lymphocyte lineage cell, partial or whole immunoglobulin molecules comprising a canine variable domain and a rodent constant domain obtained from an immortalized cell, partial or whole immunoglobulin molecules comprising a canine variable domain derived from an immunoglobulin molecule obtained from an immortalized cell.
[0079] In one aspect, a method is provided wherein the engineered portion of the canine immunoglobulin locus comprises a canine V L and J L A transgenic rodent comprising a canine immunoglobulin locus comprising a canine V H , D and J H or V L and J LA transgenic rodent comprising a coding sequence. In some aspects, the rodent is a mouse. In some aspects, the non-coding regulatory sequences include the following endogenous host-derived sequences: a promoter, introns, splice sites, and a recombination signal sequence for V(D)J recombination preceding each V gene segment coding sequence; in other aspects, the engineered portion of the canine immunoglobulin locus further comprises one or more of the following endogenous host-derived sequences: the ADAM6A or ADAM6B gene, a Pax-5 activated intergenic repeat (PAIR) element, or a CTCF binding site from the heavy chain intergenic control region 1.
[0080] In one aspect, the non-canine mammalian cell used in each of the above methods is a mammalian cell, such as a mammalian embryonic stem (ES) cell. In one aspect, the mammalian cell is an early embryonic cell. In one aspect, the non-canine mammalian cell is a rodent cell. In one aspect, the non-canine mammalian cell is a mouse cell.
[0081] After the cells have undergone replacement of the endogenous immunoglobulin variable region loci with the introduced partial canine immunoglobulin variable region loci, the cells can be selected and isolated. In one aspect, the cells are non-canine mammalian ES cells, e.g., rodent ES cells, and at least one isolated ES cell clone is then used to generate a transgenic non-canine mammal expressing the engineered partial canine immunoglobulin variable region loci.
[0082] In one aspect, a method for producing a transgenic rodent is provided, the method comprising: a) integrating at least one target site for a site-specific recombinase upstream of an endogenous immunoglobulin variable locus and integrating at least one target site for a site-specific recombinase downstream of the endogenous immunoglobulin variable locus in the genome of a rodent cell, wherein the endogenous immunoglobulin variable locus comprises a V H , D and J H Gene segment, or V κ and J κ Gene segment, or V λ and J λ Gene segment, or V λ 、J λ and C λgene segments; b) providing a vector comprising an engineered partial canine immunoglobulin locus, wherein the engineered partial canine immunoglobulin locus comprises chimeric canine immunoglobulin gene segments, wherein each partial canine immunoglobulin gene segment comprises a canine immunoglobulin variable gene coding sequence and a rodent non-coding regulatory or scaffold sequence, wherein the partial canine immunoglobulin variable locus is flanked by target sites for a site-specific recombinase, wherein the target site is capable of recombination with a target site introduced into a rodent cell; c) introducing the vector and the site-specific recombinase capable of recognizing the target site into the cell; d) allowing a recombination event to occur between the genome of the cell and the engineered partial canine immunoglobulin locus, resulting in replacement of the endogenous immunoglobulin variable locus with the engineered partial canine immunoglobulin locus; e) selecting a cell comprising the engineered partial canine immunoglobulin variable locus produced in step d); and using the cell to produce a transgenic rodent comprising the engineered partial canine immunoglobulin variable locus. In some respects, the cell is a rodent embryonic stem (ES) cell, and in some respects, the cell is a mouse embryonic stem (ES) cell. Some aspects of the method are also included in step a) after and step b) before, by introducing a recombinase that identifies the first group of target sites to make the step of endogenous immunoglobulin variable locus deletion, wherein the deletion step leaves at least one group of target sites that can not be recombined with each other in situ (in place) in the rodent cell genome. In some respects, the vector comprises a canine V H , D and J H Coding sequence, and in some aspects, the vector comprises a canine V L and J L In some aspects, the vector further comprises a rodent promoter, introns, splice sites, and a recombination signal sequence for the variable region gene segment.
[0083] In another aspect, a method for producing a transgenic non-canine mammal comprising an exogenously introduced engineered partial canine immunoglobulin variable region locus is provided, the method comprising: a) introducing one or more sequence-specific recombination sites into the genome of a non-canine mammalian host cell, the one or more sequence-specific recombination sites flanking an endogenous immunoglobulin variable region locus and incapable of recombination with each other; b) providing a vector comprising a partial canine immunoglobulin locus having i) a canine variable region gene coding sequence and ii) a non-canine immunoglobulin variable region locus-based sequence. encoding regulatory or scaffold sequences, wherein the coding and non-coding regulatory or scaffold sequences are flanked by sequence-specific recombination sites identical to those introduced into the genome of the host cell of step a); c) introducing the vector of step b) and a site-specific recombinase capable of recombination enzyme recognition of a set of recombinase sites into the cell; d) allowing a recombination event to occur between the genome of the cell of step a) and the engineered partial canine immunoglobulin variable region locus, resulting in replacement of the endogenous immunoglobulin variable region locus with the partial canine immunoglobulin locus; e) selecting cells comprising the partial canine immunoglobulin locus; and f) using the cells to produce a transgenic animal comprising the partial canine immunoglobulin locus.
[0084] In certain aspects, the engineered portion of the canine immunoglobulin locus comprises a canine V H , D and J H Gene segment coding sequences and non-coding regulatory and scaffold pre-D sequences present in the endogenous genome of the non-canine mammalian host (including fertility-enabling genes). In one aspect, sequence-specific recombination sites are then introduced into the endogenous immunoglobulin V H Upstream and endogenous J H downstream of the gene segment.
[0085] In one aspect, a method for producing a transgenic non-canine animal comprising an engineered portion of a canine immunoglobulin locus is provided, the method comprising: a) providing a non-canine mammalian cell having a genome comprising two sets of sequence-specific recombination sites that are incapable of recombination with one another and that flank a portion of an endogenous immunoglobulin variable region locus of the host genome; b) deleting a portion of the endogenous immunoglobulin locus of the host genome by introducing a recombinase that recognizes a first set of sequence-specific recombination sites, wherein such deletion in the genome retains a second set of sequence-specific recombination sites; c) providing a vector comprising an engineered portion of a canine immunoglobulin variable region locus, the engineered portion of the canine immunoglobulin variable region locus being amplified by the vector. The immunoglobulin variable region locus comprises a canine coding sequence and a non-coding regulatory or scaffold sequence based on an endogenous immunoglobulin variable region locus, wherein the coding and non-coding regulatory or scaffold sequences are flanked by a second set of sequence-specific recombination sites; d) introducing the vector of step c) and a site-specific recombinase capable of recognizing the second set of sequence-specific recombination sites into the cell; e) allowing a recombination event to occur between the cell genome and the portion of the canine immunoglobulin locus, resulting in replacement of the endogenous immunoglobulin locus with the engineered portion of the canine immunoglobulin variable region locus; f) selecting cells comprising the portion of the canine immunoglobulin variable region locus; and g) using the cells to produce a transgenic animal comprising the engineered portion of the canine immunoglobulin variable region locus.
[0086] In one aspect, a method for producing a transgenic non-canine mammal comprising an engineered portion of a canine immunoglobulin locus is provided, the method comprising: a) providing a non-canine mammal embryonic stem (ES) cell having a genome comprising two sequence-specific recombination sites that are incapable of recombination with each other and that flank an endogenous immunoglobulin variable region locus; b) providing a vector comprising an engineered portion of a canine immunoglobulin locus comprising a canine immunoglobulin variable gene coding sequence and a non-coding regulatory or endogenous immunoglobulin variable region locus-based sequence. The invention relates to a method for producing a transgenic animal comprising: producing an ES cell comprising: a scaffold sequence in which the portion of the canine immunoglobulin locus is flanked by the same two sequence-specific recombination sites that flank the endogenous immunoglobulin variable region locus in the ES cell; c) contacting the ES cell and the vector with a site-specific recombinase that recognizes the two recombinase sites under appropriate conditions to promote a recombination event that results in replacement of the endogenous immunoglobulin variable region locus in the ES cell with the engineered portion of the canine immunoglobulin variable region locus; d) selecting ES cells that contain the engineered portion of the canine immunoglobulin locus; and e) using the cells to produce a transgenic animal that contains the engineered portion of the canine immunoglobulin locus.
[0087] In one aspect, the transgenic non-canine mammal is a rodent, eg, a mouse or a rat.
[0088] In one aspect, non-canine mammalian cells and non-canine transgenic mammals are provided that express an introduced immunoglobulin variable region locus having a canine variable region gene coding sequence and non-coding regulatory or scaffold sequences based on endogenous non-canine immunoglobulin loci of the host genome, wherein the non-canine mammalian cells and transgenic animals express chimeric antibodies having complete canine H chain or L chain variable domains in conjunction with constant regions native to their respective non-canine mammalian cells or animals.
[0089] In addition, B cells from transgenic animals are provided, the B cells being capable of expressing partial canine antibodies having complete canine variable sequences, wherein such B cells are immortalized to provide a source of monoclonal antibodies specific for a particular antigen. In one aspect, B lymphocyte lineage cells from transgenic animals are provided, the B lymphocyte lineage cells being capable of expressing partial canine heavy or light chain antibodies comprising a canine variable region and a rodent constant region.
[0090] In one aspect, canine immunoglobulin variable region gene sequences cloned from B cells are provided for use in generating or optimizing antibodies for diagnostic, prophylactic, and therapeutic uses.
[0091] In one aspect, a hybridoma cell is provided that is capable of producing a partial canine monoclonal antibody having a complete canine immunoglobulin variable region sequence. In one aspect, a hybridoma or immortalized cell line of a B lymphocyte lineage is provided.
[0092] In another aspect, antibodies or antigen-binding portions thereof produced by transgenic animals or cells described herein are provided. In another aspect, antibodies or antigen-binding portions thereof comprising variable heavy or variable light chain sequences derived from antibodies produced by transgenic animals or cells described herein are provided.
[0093] In one aspect, a method for determining the sequence of the H chain and L chain immunoglobulin variable domains from a hybridoma or primary plasma cells or B cells producing a monoclonal antibody and converting the V H and V L A method for combining sequences with canine constant regions to produce fully canine antibodies that are non-immunogenic when injected into dogs.
[0094] These and other aspects, objects and features are described in more detail below. BRIEF DESCRIPTION OF THE DRAWINGS
[0096] Figure 1A Schematic diagram of the endogenous mouse IGH locus located at the telomeric end of chromosome 12.
[0097] Figure 1B Schematic diagram of the endogenous mouse IGL locus located on chromosome 16.
[0098] Figure 1C Schematic diagram of the endogenous mouse IGK locus located on chromosome 6.
[0099] Figure 2 is a schematic diagram illustrating a targeting strategy for introducing a first set of sequence-specific recombination sites into the upstream region of the H chain variable region locus in the genome of a non-canine mammalian host cell by homologous recombination.
[0100] Figure 3 is another schematic diagram illustrating the targeting strategy for introducing a first set of sequence-specific recombination sites into the upstream region of the H chain variable region locus in the genome of a non-canine mammalian host cell by homologous recombination.
[0101] Figure 4 is a schematic diagram illustrating the introduction of a second set of sequence-specific recombination sites into the downstream region of the H chain variable region locus in the genome of a non-canine mammalian cell via a homologous targeting vector.
[0102] Figure 5 is a schematic diagram illustrating the deletion of the endogenous immunoglobulin H chain variable region locus from the genome of a non-canine mammalian host cell.
[0103] Figure 6 is a schematic diagram illustrating the RMCE strategy for introducing an engineered portion of a canine immunoglobulin H chain locus into a non-canine mammalian host cell genome that has been previously modified to delete the endogenous immunoglobulin H chain variable region locus.
[0104] Figure 7 is a schematic diagram illustrating the RMCE strategy for introducing an engineered portion of a canine immunoglobulin H chain locus comprising additional regulatory sequences into a non-canine mammalian host cell genome that has been previously modified to delete the endogenous immunoglobulin H chain variable region gene.
[0105] Figure 8 is a schematic diagram illustrating the introduction of an engineered portion of a canine immunoglobulin H chain variable region locus into the endogenous immunoglobulin H chain locus of the mouse genome.
[0106] Figure 9is a schematic diagram illustrating the introduction of an engineered portion of a canine immunoglobulin kappa L chain variable region locus into the endogenous immunoglobulin kappa L chain locus in the mouse genome.
[0107] Figure 10 is a schematic diagram illustrating the introduction of an engineered portion of a canine immunoglobulin λ L chain variable region locus into the endogenous immunoglobulin λ L chain locus in the mouse genome.
[0108] Figure 11 This is a diagram of the introduction of canine V via RMCE H Schematic representation of the engineered portion of the canine immunoglobulin locus.
[0109] Figure 12A Schematic diagram of the endogenous canine IGH locus located on chromosome 8, showing an expanded view of the entire Igh locus (1201) and the IGHC region (1202).
[0110] Figure 12B Schematic representation of the endogenous canine IGL locus located on chromosome 26.
[0111] Figure 12C Schematic diagram of the endogenous canine IGK locus located on chromosome 17. The arrow indicates V κ Transcription direction of gene segments. In the native canine IGK locus (1220), some V κ The gene segment is located in C κ Downstream of the exon. In some canine Ig κ In locus (1221), all V κ The gene segment coding sequence is located in C κ Upstream of the exon and with C κ The exons are in the same transcriptional orientation (see Example 4).
[0112] Figure 13 is a schematic diagram illustrating an engineered portion of a canine immunoglobulin light chain variable region locus, wherein one or more canine V λ Insertion of gene segment coding sequence into one or more canine J λ In the rodent immunoglobulin kappa light chain locus upstream of the gene segment coding sequence, the one or more canine J λ The gene segment coding sequence is located in one or more rodent C λ upstream of the coding sequence.
[0113] Figure 14is a schematic diagram illustrating the introduction of an engineered portion of a canine light chain variable region locus, wherein one or more canine V λ The gene segment coding sequence is inserted into the J λ -C λ Tandem cassette array upstream of the rodent immunoglobulin kappa light chain locus, where J λ From canine sources, and C λ From mouse origin, C λ1 、C λ2 or C λ3 .
[0114] Figure 15 The results show that the expression of human CD4 (hCD4), canine IGHV3-5-mouse C μ Membrane IgM b Allotype and attachment to mouse C κ and C λ Various combinations of canine IGLV3-28 / J λ 6(1501) or attached to mouse C κ and C λ Various combinations of canine IGKV2-5 / J κ Flow cytometry profile of 293T / 17 cells transfected with the expression vector of 1(1502). b (1510) Dyeing.
[0115] Figure 16 The results show that the expression of human CD4 (hCD4), canine IGHV3-5-mouse C μ Membrane IgM b Allotype and attachment to mouse C κ and C λ Various combinations of canine IGLV3-28 / J λ 6(1601) or attached to mouse C κ and C λ Various combinations of canine IGKV2-5 / J κ Flow cytometric profiles of 293T / 17 cells transfected with an expression vector encoding mouse λLC (1601) or mouse κLC (1602) on the cell surface.
[0116] Figure 17 The results show that the expression of IGHV4-1 encoding human CD4 (hCD4), canine IGHV4-1-mouse C μ Membrane IgM b Allotype and attachment to mouse C κ and Cλ Various combinations of canine IGLV3-28 / J λ 6(1701) or attached to mouse C κ and C λ Various combinations of canine IGKV2-5 / J κ Flow cytometry profile of 293T / 17 cells transfected with the expression vector of 1(1702). b (1710) Dyeing.
[0117] Figure 18 The results show that the expression of human CD4 (hCD4), canine IGHV3-19-mouse C μ Membrane IgM b Allotype and attachment to mouse C κ and C λ Various combinations of canine IGLV3-28 / J λ 6(1801) or attached to mouse C κ and C λ Various combinations of canine IGKV2-5 / J κ Flow cytometry profile of 293T / 17 cells transfected with the expression vector of 1(1802). b (1810) Dyeing.
[0118] Figure 19A Western blots of culture supernatants are shown, and Figure 19B shows the coding attached to the mouse C γ2α Canine IGHV3-5 (1901), attached to mouse C γ2α IGHV3-19 (1902) or attached to mouse C γ2α IGHV4-1 (1903) and attached to mouse C κ (1907) and C λ Various combinations of canine IGLV3-28 / J (1908-1910) λ Western blot of cell lysates of 293T / 17 cells transfected with the expression vector of 6. The samples were electrophoresed under reducing conditions, and the blots were probed with anti-mouse IgG2a antibody.
[0119] Figure 20A The loading control Myc is shown for Figure 18 Western blot of cell lysates, and Figure 20B The loading control GAPDH is shown for Figure 18 Western blot of cell lysates.
[0120] Figure 21A Western blots of culture supernatants (non-reducing conditions) are shown, and Figure 21B shows the coding attached to the mouse C κ (2102) and C λ Various combinations of canine IGHV3-5 mouse C γ2α and canine IGLV3-28 / J λ 6 expression vector or transfected with a gene encoding the gene attached to the mouse C κ (2105) and C λ Various combinations of canine IGHV3-5-mouse C γ2α and canine IGKV2-5 / J κ Western blot analysis of cell lysates (reducing conditions) of 293T / 17 cells transfected with the expression vector of 1. Figure 21A The blots in the PCR products were probed with antibodies against mouse IgG2a and the Figure 21B The blot in was probed with an antibody against mouse κLC.
[0121] Figure 22 The expression of a vector encoding human CD4 (hCD4) attached to mouse C δ Membrane form of canine IGHV3-5 and canine IGKV2-5 / J attached to mouse CK(2201) κ 1 or attached to mouse C λ1 、C λ2 or C λ3 (2202-2204) Canine IGLV3-28 / J λ Flow cytometric profiles of 293T / 17 cells transfected with the expression vector for 6. The cells were stained for cell surface hCD4 (2205), mouse CD79b (2206), mouse IgD (2207), mouse κ LC (2208), or mouse λ LC (2209).
[0122] Figure 23 The expression of a vector encoding human CD4 (hCD4) attached to mouse C δ Membrane form of canine IGHV3-19 and canine IGKV2-5 / J attached to mouse CK(2301) κ 1 or attached to mouse C λ1 、C λ2 or C λ3 (2302-2304) Canine IGLV3-28 / J λFlow cytometric profiles of 293T / 17 cells transfected with the expression vector for 6. The cells were stained for cell surface hCD4 (2205), mouse CD79b (2206), mouse IgD (2207), mouse κ LC (2208), or mouse λ LC (2209).
[0123] Figure 24 The expression of a vector encoding human CD4 (hCD4) attached to mouse C δ Membrane form of canine IGHV4-1 and canine IGKV2-5 / J attached to mouse CK(2401) κ 1 or attached to mouse C λ1 、C λ2 or C λ3 (2402-2404) Canine IGLV3-28 / J λ Flow cytometric profiles of 293T / 17 cells transfected with the expression vector for 6. The cells were stained for cell surface hCD4 (2405), mouse CD79b (2406), mouse IgD (2407), mouse κ LC (2408), or mouse λ LC (2409).
[0124] definition
[0125] The terms used herein are intended to have their plain and ordinary meanings as understood by one of ordinary skill in the art. The following definitions are intended to aid the reader in understanding the present invention, but are not intended to alter or otherwise limit the meanings of such terms unless specifically indicated.
[0126] As used herein, the term "locus" refers to a chromosomal segment or nucleic acid sequence that is endogenously present in a genome or exogenously (or to be) introduced into a genome, respectively. For example, an immunoglobulin locus may include part or all of the genes (i.e., V, D, J gene segments and constant region genes) and intervening sequences (i.e., introns, enhancers, etc.) that support the expression of immunoglobulin H chain or L chain polypeptides. Thus, a locus (e.g., an immunoglobulin heavy chain variable region locus) may refer to a specific portion of a larger locus (e.g., including V, D, J gene segments and constant region genes). H 、D H and J H Similarly, an immunoglobulin light chain variable region locus can refer to a specific portion of a larger locus (e.g., including V L and J LAs used herein, the term "immunoglobulin variable region gene" refers to a V, D, or J gene segment encoding a portion of an immunoglobulin H chain or L chain variable domain. As used herein, the term "immunoglobulin variable region locus" refers to a portion or the entirety of a chromosomal segment or nucleic acid chain containing a cluster of V, D, or J gene segments, and may include non-coding regulatory sequences or scaffold sequences.
[0127] As used herein, the term "gene segment" refers to a nucleic acid sequence that encodes a portion of a heavy chain or light chain variable domain of an immunoglobulin molecule. A gene segment may include a coding sequence and a non-coding sequence. The coding sequence of a gene segment is a nucleic acid sequence that can be translated into a polypeptide such as a leader peptide and the N-terminal portion of a heavy chain or light chain variable domain. The non-coding sequence of a gene segment is a sequence flanking the coding sequence, which may include a promoter, a 5' non-translated sequence, an intron intervening the leader peptide coding sequence, one or more recombination signal sequences (RSS) and a splice site. The gene segments in the immunoglobulin heavy chain (IGH) locus include V H , D and J H The light chain variable region gene segments in the immunoglobulin kappa and lambda light chain loci can be referred to as V L and J L Gene segment. In the κ light chain, V L and J L Gene segments can be called V κ and J κ Gene segments or IGKV and IGKJ. Similarly, in the lambda light chain, V L and J L Gene segments can be called V λ and J λ gene segments or IGLV and IGLJ.
[0128] The heavy chain constant region may be referred to as C H or IGHC. C encoding IgM, IgD, IgG1-4, IgE, or IgA H The exons in the C μ 、C δ 、C γ1-4 、C ε or C α Similarly, the immunoglobulin kappa or lambda constant regions may be referred to as C κ or C λ District, and IGKC or IGLC.
[0129] As used herein, "partial canine" refers to a nucleic acid strand comprising a sequence corresponding to a sequence found in a given locus of both a canine and a non-canine mammalian host, or its expressed protein and RNA products. As used herein, "partial canine" also refers to an animal comprising nucleic acid sequences from both canine and non-canine mammals (e.g., rodents). In one aspect, a partial canine nucleic acid has a coding sequence for a canine immunoglobulin H chain or L chain variable region gene segment and a sequence based on non-coding regulatory or scaffold sequences of an endogenous immunoglobulin locus of a non-canine mammal.
[0130] When used in reference to endogenous non-coding regulatory or scaffold sequences from the genome of a non-canine mammalian host cell, the term "based on" refers to non-coding regulatory or scaffold sequences present in the endogenous locus of the corresponding mammalian host cell genome. In one aspect, the term "based on" means that the non-coding regulatory or scaffold sequences present in a portion of the canine immunoglobulin locus share a relatively high degree of homology with the non-coding regulatory or scaffold sequences of the host mammal's endogenous locus. In one aspect, the non-coding sequences in the portion of the canine immunoglobulin locus share at least about 80%, 90%, 95%, 96%, 97%, 98%, 99% or 100% homology with the corresponding non-coding sequences found in the host mammal's endogenous locus. In one aspect, the non-coding sequences in the portion of the canine immunoglobulin locus are retained from the immunoglobulin locus of the host mammal. In one aspect, the canine coding sequence is embedded in the non-regulatory sequence or scaffold sequence of the host mammal's immunoglobulin locus. In one aspect, the host mammal is a rodent, such as a rat or a mouse.
[0131] "Non-coding regulatory sequences" refer to sequences known to be essential for (i) V(D)J recombination, (ii) isotype switching, (iii) correct expression of full-length immunoglobulin H or L chains after V(D)J recombination, and (iv) alternative splicing to produce, for example, membrane and secreted forms of immunoglobulin H chains. "Non-coding regulatory sequences" may also include sequences of endogenous origin: enhancers and locus control elements, such as CTCF and PAIR sequences (Proudhon, et al., Adv. Immunol. 128: 123-182 (2015)); promoters preceding each endogenous V gene segment; splice sites; introns; recombination signal sequences flanking each V, D, or J gene segment. In one aspect, a portion of a canine immunoglobulin locus "non-coding regulatory sequence" shares at least about 70%, 75%, 80%, 85%, 90%, 95%, 96%, 97%, 98%, 99%, and up to 100% homology with the corresponding non-coding sequence found in the targeted endogenous immunoglobulin locus of a non-canine mammalian host cell.
[0132] In some aspects, the scaffold sequence is derived from (at least in part derived from) other sources, for example, they can be rationally designed or artificial sequences, sequences present in canine genome immunoglobulin loci, sequences present in another species immunoglobulin loci or combinations thereof. It should be understood that the wording "non-coding regulatory sequence or scaffold sequence" is inclusive (that is, refers to the non-coding regulatory sequence and scaffold sequence present in a given locus) in terms of meaning.
[0133] The term "homologous targeting vector" refers to a nucleic acid sequence used to modify the endogenous genome of a mammalian host cell by homologous recombination; such a nucleic acid sequence may include (i) a targeting sequence having significant homology to a corresponding endogenous sequence flanking a locus to be modified in the genome of a non-canine mammalian host, (ii) at least one sequence-specific recombination site, (iii) non-coding regulatory or scaffold sequences, and (iv) optionally one or more selectable marker genes. Thus, a homology targeting vector can be used to introduce a sequence-specific recombination site into a specific region of the host cell genome.
[0134] "Site-specific recombination" or "sequence-specific recombination" refers to the process of DNA rearrangement between two compatible recombination sequences (also referred to as "sequence-specific recombination sites" or "site-specific recombination sequences"), including any of the following three events: a) deletion of preselected nucleic acids flanking the recombination site; b) inversion of nucleotide sequences flanking the recombination site; and c) reciprocal exchange of nucleic acid sequences adjacent to the recombination site on different nucleic acid strands. It will be appreciated that such reciprocal exchange of nucleic acid segments can be used as a targeted strategy for introducing exogenous nucleic acid sequences into the host cell genome.
[0135] The term "targeting sequence" refers to a sequence that is homologous to a DNA sequence flanking or adjacent to the immunoglobulin locus region to be modified in the cell genome. The flanking or adjacent sequences can be located in the locus itself, or upstream or downstream of the coding sequence in the host cell genome. The targeting sequence is inserted into a recombinant DNA vector for transfection of, for example, ES cells, such that the sequence inserted into the host cell genome (such as the sequence of the recombination site) is flanked by the targeting sequence of the vector.
[0136] As used herein, the term "site-specific targeting vector" refers to a vector comprising a nucleic acid encoding a sequence-specific recombination site, an engineered portion of a canine locus, and optionally a selective marker gene, which is used to modify the endogenous immunoglobulin locus in the host using recombinase-mediated site-specific recombination. The recombination site of the targeting vector is suitable for site-specific recombination with another corresponding recombination site adjacent to the immunoglobulin locus to be modified that has been inserted into the genomic sequence of the host cell (e.g., via a homologous targeting vector). The integration of the engineered portion of the canine sequence into the recombination site in the immunoglobulin locus results in the endogenous locus being replaced by the exogenously introduced portion of the canine region.
[0137] The term "transgene" is used herein to describe genetic material that has been or is to be artificially inserted into the genome of a cell, and particularly the genome of a cell of a mammalian host animal. As used herein, the term "transgene" refers to a portion of a canine nucleic acid, for example, in the form of an engineered expression construct or targeting vector.
[0138] A "transgenic animal" refers to a non-canine animal, typically a mammal, that has an exogenous nucleic acid sequence present as an extrachromosomal element in a portion of its cells or stably integrated into its germline DNA (i.e., in the genomic sequence of most or all of its cells). In one aspect, a portion of a canine nucleic acid is introduced into the germline of such a transgenic animal by genetic manipulation of, for example, an embryo or embryonic stem cell of a host animal according to methods well known in the art.
[0139] "Vector" includes plasmids and viruses, and any DNA or RNA molecule, whether self-replicating or not, that can be used to transform or transfect a cell.
[0140] Note that, as used herein and in the appended claims, the singular forms "a," "an," and "the" include plural referents unless the context clearly dictates otherwise. Thus, for example, reference to "a locus" refers to one or more loci, and reference to "a method" includes reference to equivalent steps and methods known to those skilled in the art, and so forth.
[0141] As used herein, the term "or" may mean "and / or" unless explicitly indicated to refer only to alternatives or the alternatives are mutually exclusive. The terms "including," "includes," and "included" are not limiting.
[0142] Unless defined otherwise, all technical and scientific terms used herein have the same meaning as commonly understood by one of ordinary skill in the art to which this invention belongs. All publications mentioned herein are incorporated by reference for the purpose of describing and disclosing devices, formulations, and methodologies that may be used in connection with the invention described herein.
[0143] Where a range of values is provided, it is understood that each intermediate value between the upper and lower limits of the range and any other specified values or intermediate values within the specified range are included within the present invention. The upper and lower limits of these smaller ranges may independently be included within the smaller ranges and are also included within the present invention, subject to any specifically excluded limits within the specified ranges. Where a specified range includes one or two of the limits, ranges excluding one or both of those included limits are also included within the present invention.
[0144] Unless otherwise noted, the practice of the technology described herein can adopt the conventional techniques and descriptions of organic chemistry, polymer technology, molecular biology (comprising recombinant technology), cell biology, biochemistry and sequencing technology, and these are all within the technology of those skilled in the art.Such conventional technology includes polymer array synthesis, hybridization and connection of polynucleotide, polymerase chain reaction and hybridization detection using markers.The specific description of suitable technology can be obtained by reference to the embodiments of this paper.However, of course, other equivalent conventional procedures can also be used.Such routine techniques and descriptions can be found in standard laboratory manuals such as the following: Green, et al., eds. (1999), Genome Analysis: A Laboratory Manual Series (Volumes I-IV); Weiner, Gabriel, Stephens, eds. (2007), Genetic Variation: A Laboratory Manual; Dieffenbach and Veksler, eds. (2007), PCR Primer: A Laboratory Manual; Bowtell and Sambrook (2003), DNA Microarrays: A Molecular Cloning Manual; Mount (2004), Bioinformatics: Sequence and Genome Analysis; Sambrook and Russell (2006), Condensed Protocols from Molecular Cloning: A Laboratory Manual; and Sambrook and Russell (2002), Molecular Cloning: A Laboratory Manual (all from Cold Spring Harbor Laboratory Press); Stryer, L. (1995) Biochemistry (4th Edition) WH Freeman, New York NY; Gait, "Oligonucleotide Synthesis: A Practical Approach" 1984, IRL Press, London; Nelson and Cox (2000), Lehninger, Principles of Biochemistry, 3rd ed., WH Freeman Pub., New York, NY; and Berg et al. (2002) Biochemistry, 5th ed., WH Freeman Pub., New York, NY, all of which are incorporated herein by reference in their entirety for all purposes.
[0145] Detailed description
[0146] In the following description, numerous specific details are set forth to provide a fuller understanding of the present invention. However, it will be apparent to one skilled in the art that the present invention may be practiced without one or more of these specific details. In other instances, features and procedures well known to those skilled in the art have not been described to avoid obscuring the present invention.
[0147] Described herein is a transgenic rodent or rodent cell having a genome comprising an engineered portion of a canine immunoglobulin heavy or light chain locus. In one aspect, the portion of the canine immunoglobulin heavy chain locus comprises one or more canine immunoglobulin heavy chain variable region gene segments. In one aspect, the portion of the canine immunoglobulin light chain locus comprises one or more canine immunoglobulin lambda light chain variable region gene segments. In one aspect, the portion of the canine immunoglobulin light chain locus comprises one or more canine immunoglobulin kappa light chain variable region gene segments.
[0148] In one aspect, a non-canine mammalian cell is provided, comprising an exogenously introduced engineered portion of a canine nucleic acid sequence comprising a coding sequence for a canine variable region and a non-coding regulatory or scaffold sequence present in an immunoglobulin locus in the mammalian host genome, such as a mouse genome non-coding sequence when the host mammal is a mouse. In one aspect, one or more coding sequences of a canine variable region gene segment are embedded in non-coding regulatory or scaffold sequences corresponding to those sequences of an immunoglobulin locus in the mammalian host genome. In one aspect, the coding sequence of a canine variable region gene segment is embedded in non-coding regulatory or scaffold sequences of a rodent or mouse immunoglobulin locus.
[0149] In one aspect, the portion of the canine immunoglobulin locus is synthetic and comprises canine V H , D or J H or V L or J L In one aspect, the portion of the canine immunoglobulin locus comprises a canine V segment encoding sequence embedded in non-coding regulatory or scaffold sequences corresponding to those of the immunoglobulin locus in the mammalian host genome. H , D or J H or V L or J L Gene segment coding sequence.
[0150] Also provided are methods for producing a transgenic rodent or rodent ES cell comprising an exogenously introduced engineered portion of a canine immunoglobulin locus, wherein the resulting transgenic rodent is capable of producing more immunoglobulins comprising lambda light chains than immunoglobulins comprising kappa light chains.
[0151] There are many challenges in generating non-canine mammals such as transgenic mice or rats capable of producing antigen-specific canine antibodies, which are addressed by the constructs and methods described herein, including but not limited to:
[0152] How to achieve a 90:10 lambda:kappa light chain usage ratio in organisms such as mice or rats that preferentially use 90% kappa light chains?
[0153] 2. The mouse λ locus contains only three functional V λ Can mouse B cells express large amounts of canine V λ The gene segment (canine lambda locus contains at least 70 functional, unique V λ gene segments);
[0154] 3. Given the structural differences between the mouse and dog lambda light chain loci, how can we improve canine V λ Expression and use in non-canine mammals, such as mice.
[0155] a. The mouse λ light chain locus contains two clusters of V λ Gene segment, J λ Gene segments and C λ Exons:
[0156] i. V λ2 - V λ3 - J λ2 - c λ2
[0157] ii. V λ1 - J λ3 - C λ3 - J λ1 - C λ1 ;and
[0158] b. Canine λ locus in J λ -C λ Cluster upstream contains tandem V λ Gene segment.
[0159] 4. Given that canine IgD is nonfunctional and that IgM and IgD are co-expressed in alternatively spliced forms in mouse and rat B cells, if mouse IgD is co-expressed with canine V Hexpression, then whether the mouse B cells can develop normally.
[0160] Immunoglobulin loci in mice and dogs
[0161] In the humoral immune system, a diverse repertoire of antibodies is generated by the combinatorial and joining diversity of the IGH and IGL chain loci through a process called V(D)J recombination. In developing B cells, the first recombination event that occurs is between a D at the heavy chain locus and a J at the heavy chain locus. H Between gene segments, and the DNA between these two gene segments is missing. This DJ H After the reorganization comes the newly formed DJ H A V in the upstream region of the complex H The gene segments are joined to form rearranged V H DJ H Exon. Newly generated V H DJ H The recombined V H All other sequences between the D gene segment and the D gene segment are deleted from the genome of the individual's B cells. The rearranged exons are ultimately expressed on the surface of B cells as the variable region of the H chain polypeptide, which associates with the L chain polypeptide to form the B cell receptor (BCR).
[0162] The light chain repertoire in mice is thought to be shaped by a sequence of gene rearrangements. The IGK light chain loci on both chromosomes are thought to undergo V κ -J κ rearrangement, and the IGL light chain locus on either chromosome becomes receptive to V λ -J λRecombination. If the initial κ rearrangement is ineffective, another round of secondary rearrangement can be performed in a process called receptor editing (Collins and Watson. (2018) Immunoglobulin light chain gene rearrangements, receptor editing and the development of a self-tolerant antibody repertoire. Front. Immunol. 9: 2249). The continuous rearrangement process of the κ chain locus can continue on one chromosome until all possibilities of recombination are exhausted. Recombination will then be performed on the second κ chromosome. After multiple rounds of rearrangement fail to produce an effective rearrangement on the second chromosome, it will be a rearrangement on the λ locus (Collins and Watson (2018) Immunoglobulin light chain gene rearrangements, receptor editing and the development of a self-tolerant antibody repertoire. Front. Immunol. 9: 2249).
[0163] This preference for light chain rearrangement is thought to produce a light chain repertoire of >90% kappa and <10% lambda in mice. However, immunoglobulin usage in the canine immune system is dominated by lambda light chains, estimated to be at least 90% lambda to <10% kappa (Arun et al. (1996) Immunohistochemical examination of light-chain expression (λ / κ ratio) in canine, feline, equine, bovine and porcine plasma cells. Zentralbl Veterinarmed A. 43(9):573-6).
[0164] Murine and canine Ig loci are highly complex in the number of features they contain and how their coding regions diversify through V(D)J rearrangement; however, this complexity does not extend to the basic details of the structure of each variable region gene segment. The V, D, and J gene segments are highly uniform in their composition and organization. For example, the V gene segment has the following features arranged in a substantially invariant order within the immunoglobulin locus: a short transcriptional promoter region (<600 bp in length), exons encoding the 5'UTR and most of the signal peptide of the antibody chain; introns; exons encoding a small portion of the antibody chain signal peptide and most of the antibody variable domain, and a 3' recombination signal sequence required for V(D)J rearrangement. Similarly, the D gene segment has the following necessary and invariant features: a 5' recombination signal sequence, a coding region, and a 3' recombination signal sequence. The J gene segment has the following necessary and invariant features: a 5' recombination signal sequence, a coding region, and a 3' splice donor sequence.
[0165] Canid Genome V H The region includes approximately 39 functional V genes mapped to a 1.46 Mb region on canine chromosome 8. H , 6 functional D and 5 functional J H gene segments. There are also many V H Pseudogene and a J H The IGHJ1 and D gene segments (IGHD5) are considered non-functional due to atypical heptamers in their RSSs. (Such gene segments are called open reading frames (ORFs)). Figure 12A A schematic diagram of the endogenous canine IGH locus (1201) and an expanded view of the IGHC region (1202) are provided. H (1203), D(1204) and J H The canine immunoglobulin heavy chain variable region locus of the gene segment (1205) has all functional genes in the same transcriptional orientation as the constant region genes (1206), with two pseudogenes (IGHV3-4 and IGHV1-4-1) in the reverse transcriptional orientation (not shown). The transcriptional enhancer (1207) and the μ switch region (1208) are located in the J H -C μ In the intron. See Martin et al. (2018) Comprehensive annotation and evolutionary insights into the canine (Canis lupus familiaris) antigen receptor loci. Immunogenetics. 70: 223-236. In the IGHC gene, C δ(1210) is considered non-functional. In addition, although cDNA clones have been isolated and identified as encoding canine IgG1 (1212), IgG2 (1213), IgG3 (1211), and IgG4 (1214) (Tang et al. (2001) Cloning and characterization of cDNAs encoding four different canine immunoglobulin γ chains. Vet. Immunol. and Immunopath. 80:259 PMID 11457479), only the IgG2 constant region gene has been physically mapped to the canine IGHC locus on chromosome 8. μ (1209), C ε (1215) and C α The functional form of (1216) was also physically located herein.
[0166] The sequences of canine IGHC are in Table 4.
[0167] The canine IGL locus is mapped to canine chromosome 26, while the canine IGK coding region is mapped to canine chromosome 17. Figure 12B and Figure 12C Schematic diagrams of the endogenous canine IGL and IGK loci, respectively, are provided.
[0168] The sequences of canine IGKC and IGLC are in Table 4.
[0169] The canine lambda locus (1217) is large (2.6 Mbp) with 162 V λ genes (1218), of which at least 76 are functional. The canine lambda locus also contains 9 tandem cassettes or JC units, each containing a J λ gene segment and a C λ Exon (1219). See Martin et al. (2018) Comprehensive annotation and evolutionary insights into the canine (Canis lupus familiaris) antigen receptor loci. Immunogenetics. 70: 223-236.
[0170] The canine kappa locus (1220) is small (400 Kbp) and has an unusual structure with eight functional V κ The gene segment is located in J κ(1223) gene segment and C κ (1224) exon upstream (1222) and five located downstream (1226). Canine Upstream V κ The area has J κ Gene segments and C κ All functional gene segments with exons in the same transcriptional orientation, including two pseudogenes (IGKV3-3 and IGKV7-2) and one ORF (IGKV4-1) in the reverse transcriptional orientation (not shown). κ The area has J κ Gene segments and C κ The exons are in the opposite transcriptional direction of all functional gene segments and include 6 pseudogenes. The ribose 5-phosphate isomerase A (RPIA) gene (1225) is also located downstream of the V κ Area C κ Found between IGKV2S19. See Martin et al. (2018) Comprehensive annotation and evolutionary insights into the canine (Canis lupus familiaris) antigen receptor loci. Immunogenetics. 70: 223-236.
[0171] The mouse immunoglobulin kappa locus is located on chromosome 6. Figure 1B A schematic diagram of the endogenous mouse IGK locus is provided. The IGK locus (112) spans 3300 Kbp and includes 5 junctions (J κ ) gene segment (114) and a constant (C κ ) gene (115) upstream of more than 100 variable V κ Gene segment (113). The mouse κ locus includes the J κ with C κ Intronic enhancers (iE κ , 116), the intronic enhancer (iE κ , 116) activates κ rearrangement and helps maintain κ earlier or more efficient rearrangement than λ (Inlay et al. (2004) Important Roles for E Protein Binding Sites within the Immunoglobulin κ chain intronic enhancer in activating V κ J κrearrangement. J. Exp. Med. 200(9): 1205-1211). Another enhancer is the 3' enhancer (3'E κ , 117) is located in C κ 9.1 Kb downstream of the exon and also involved in κ rearrangement and transcription; lacks iE κ and 3'E κ The mutant mice of both have no V at the κ locus. κ J κ Rearrangement (Inlay et al. (2002) Essential roles of the kappa light chain intronic enhancer and 3'enhancer in kappa rearrangement and demethylation. Nature Immunol. 3(5): 463-468). However, disruption of iE by, for example, insertion of a neomycin resistance gene κ It is also sufficient to eliminate most V κ J κ Rearrangement (Xu et al. (1996) Deletion of the IgκLight ChainIntronic Enhancer / Matrix Attachment Region Impairs but Does Not Abolish V κ J κ Rearrangement).
[0172] The mouse immunoglobulin λ locus is located on chromosome 16. Figure 1C A schematic diagram of the endogenous mouse IGL locus (118) is provided. The organization of the mouse immunoglobulin lambda locus is different from that of the mouse immunoglobulin kappa locus. The locus spans 240 kb and has three functional variable (V λ ) gene segments (IGLV2, 119; IGLV3, 120 and IGLV1, 123) and the lambda connection (J λ ) gene segments and constant (C λ ) gene segments (IGLJ2, 121; IGLC2, 122; IGLJ3, 124: IGLC3, 125; IGLJ1, 126; IGLC1, 127), wherein V λ The gene segment is located upstream (5') of a variable number of tandem JC boxes. The locus also contains three transcriptional enhancers (E λ2-4 , 128; E λ , 129; E λ3-1 , 130).
[0173] The partial canine nucleic acid sequences described herein allow for the production of transgenic animals comprising a canine V H or V L The invention provides a heavy chain or light chain repertoire containing a plurality of regions while retaining regulatory sequences and other elements that may be found within the intervening sequences of the host genome (e.g., rodent) that help promote efficient antibody production and antigen recognition in the host.
[0174] In one aspect, the synthetic or recombinantly produced portion of the canine nucleic acid is engineered to contain an immunoglobulin V H 、V λ or V κ Both canine coding sequences and non-canine non-coding regulatory or scaffold sequences of a locus (or in some aspects, a combination thereof).
[0175] In one aspect, a transgenic rodent or rodent cell expressing an immunoglobulin having a canine variable region can be produced by introducing one or more canine V H The gene segment coding sequence is inserted into the V of the rodent heavy chain immunoglobulin locus H On the other hand, transgenic rodents or rodent cells expressing immunoglobulins with canine variable regions can be produced by inserting one or more canine V L The gene segment coding sequence is inserted into the V region of the rodent light chain immunoglobulin locus. L Produced from the gene locus.
[0176] The presence of two light chain loci (κ and λ) means that various light chain insertion combinations are possible for generating transgenic rodents or rodent cells expressing immunoglobulins with canine variable regions, including but not limited to: inserting one or more canine V λ or J λ Gene segment coding sequence inserted into rodent V λ locus, one or more Canis V κ or J κ Gene segment coding sequence inserted into rodent V κ locus, one or more Canis V λ or J λ Gene segment coding sequence inserted into rodent V κ locus, and one or more Canis V κ or J κ Gene segment coding sequence inserted into rodent V λ In the gene locus.
[0177] The selection and development of transgenic rodents or rodent cells that express a subset of canine immunoglobulins is complicated by the fact that more than 90% of the light chains produced by mice are kappa and less than 10% are lambda, whereas more than 90% of the light chains produced by dogs are lambda and less than 10% are kappa, and that the canine immunoglobulin lambda locus is large and includes more than 100 V λ gene segments, while mouse immunoglobulin λ only includes 3 functional V λ Facts about gene fragments.
[0178] Since mice primarily produce antibodies containing κ LCs, a reasonable approach to increase the fraction of canine immunoglobulins produced by transgenic rodents containing λ LCs is to introduce one or more canine V λ or J λ The gene segment coding sequence was inserted into the rodent kappa locus. However, as shown in Example 9 below, the canine V λ C κ Exon coupling in the region leads to suboptimal expression of some canine immunoglobulins in vitro.
[0179] Provided herein is a transgenic rodent or rodent cell capable of expressing an immunoglobulin comprising a canine variable domain, wherein the transgenic rodent produces more immunoglobulins comprising a lambda light chain than an immunoglobulin comprising a kappa light chain, or is more likely to produce an immunoglobulin comprising a lambda light chain than an immunoglobulin comprising a kappa light chain. While not wishing to be bound by theory, it is believed that a transgenic rodent or rodent cell that produces more immunoglobulins comprising a lambda light chain or is more likely to produce an immunoglobulin comprising a lambda light chain produces a more complete antibody repertoire for development as a therapy.
[0180] Provided herein is a transgenic rodent or rodent cell having a genome comprising an engineered portion of a canine immunoglobulin light chain locus. In one aspect, the portion of the canine immunoglobulin light chain locus comprises a canine immunoglobulin lambda light chain variable region gene segment. In one aspect, the engineered immunoglobulin locus is capable of expressing immunoglobulins comprising canine variable domains. In one aspect, the engineered immunoglobulin locus is capable of expressing immunoglobulins comprising canine lambda variable domains. In one aspect, the engineered immunoglobulin locus is capable of expressing immunoglobulins comprising canine kappa variable domains. In one aspect, the engineered immunoglobulin locus expresses immunoglobulin light chains comprising canine variable domains and rodent constant domains. In one aspect, the engineered immunoglobulin locus expresses immunoglobulin light chains comprising canine lambda variable domains and rodent lambda constant domains. In one aspect, the engineered immunoglobulin locus expresses immunoglobulin light chains comprising canine kappa variable domains and rodent kappa constant domains.
[0181] In one aspect, the transgenic rodent or rodent cell produces more immunoglobulins comprising lambda light chains than immunoglobulins comprising kappa light chains or is more likely to produce immunoglobulins comprising lambda light chains than to produce immunoglobulins comprising kappa light chains. In one aspect, a transgenic rodent is provided, wherein the likelihood of isolating cells from the rodent producing lambda light chains is greater than isolating cells producing kappa light chains. In one aspect, a transgenic rodent is provided, wherein the transgenic rodent produces at least about 25%, 30%, 35%, 40%, 45%, 50%, 55%, 60%, 65%, 70%, 75%, 80%, 85%, 90% or 95% and up to about 100% of immunoglobulins comprising lambda light chains. In one aspect, a transgenic rodent cell or its progeny is provided, wherein the transgenic rodent cell or its progeny is more likely to produce immunoglobulins with lambda light chains than with kappa light chains. In one aspect, the transgenic rodent cell or its progeny has a probability of at least about 25%, 30%, 35%, 40%, 45%, 50%, 55%, 60%, 65%, 70%, 75%, 80%, 85%, 90% or 95% and up to about 100% to produce an immunoglobulin comprising a lambda light chain. In one aspect, a transgenic rodent or rodent cell is provided in which the endogenous rodent light chain immunoglobulin locus has been deleted and replaced by an engineered portion of a canine light chain immunoglobulin locus. In one aspect, the transgenic rodent is a mouse.
[0182] Immunoglobulin light chain locus
[0183] In one aspect, a transgenic rodent or rodent cell is provided having a genome comprising a portion of a canine immunoglobulin variable region locus produced by recombination. In one aspect, the portion of the canine immunoglobulin variable region locus is a light chain variable region (V L ) locus. In one aspect, the portion of the canine immunoglobulin variable region locus comprises one or more canine V λ Gene segment coding sequence or one or more canine J λ In one aspect, the portion of the canine immunoglobulin variable region locus comprises one or more canine V κ Gene segment coding sequence or one or more canine J κ Gene segment coding sequence. In one aspect, the portion of the canine immunoglobulin variable region locus comprises one or more rodent constant domain genes or coding sequences. In one aspect, the portion of the canine immunoglobulin variable region locus comprises one or more rodent C λ In one aspect, the portion of the canine immunoglobulin variable region locus comprises one or more rodent C κ In one aspect, the endogenous rodent light chain immunoglobulin locus has been inactivated. In one aspect, the endogenous rodent light chain immunoglobulin locus has been deleted and replaced by an engineered portion of the canine light chain immunoglobulin locus.
[0184] In one aspect, the engineered immunoglobulin locus expresses immunoglobulin light chains comprising a canine lambda variable domain and a rodent lambda constant domain. In one aspect, the engineered immunoglobulin locus expresses immunoglobulin light chains comprising a canine kappa variable domain and a rodent kappa constant domain.
[0185] In one aspect, the engineered portion of a canine immunoglobulin variable region locus comprises a gene encoding most or all of the V λ V L In one aspect, the engineered portion of the canine immunoglobulin locus variable region comprises at least 20, 30, 40, 50, 60, 70, and up to 76 canine V λ V L In one aspect, the engineered portion of the canine immunoglobulin variable region locus comprises at least about 50%, 60%, 70%, 80%, 90%, and up to 100% of the V λ V L locus.
[0186] In one aspect, the engineered portion of the canine immunoglobulin locus variable region comprises a variable region containing most or all of the J sequences found in the canine genome. λ V L In one aspect, the engineered portion of the canine immunoglobulin locus variable region comprises at least 1, 2, 3, 4, 5, 6, 7, 8, or 9 canine J λ V L In one aspect, the engineered portion of the canine immunoglobulin variable region locus comprises at least about 50%, 75%, and up to 100% of the J loci found in the canine genome. λ V L locus.
[0187] In one aspect, the engineered portion of the canine immunoglobulin locus variable region comprises a variable region comprising most or all of the V λ and J λ V L In one aspect, the engineered portion of the canine immunoglobulin variable region locus comprises at least about 50%, 60%, 70%, 80%, 90%, and up to 100% of the V λ and J λ V L locus.
[0188] In one aspect, the engineered portion of the canine immunoglobulin locus variable region comprises a variable region comprising most or all of the V κ V L In one aspect, the engineered portion of the canine immunoglobulin locus variable region comprises at least 4, 5, 6, 7, 8, 9, 10, 11, 12, 13, and up to 14 canine V κ V L In one aspect, the engineered portion of the canine immunoglobulin variable region locus comprises at least about 50%, 60%, 70%, 80%, 90%, and up to 100% of the V κ V L locus.
[0189] In one aspect, the engineered portion of the canine immunoglobulin locus variable region comprises a variable region containing most or all of the J sequences found in the canine genome. κV L In one aspect, the engineered portion of the canine immunoglobulin locus variable region comprises at least one, two, three, four, or five canine J κ V L In one aspect, the engineered portion of the canine immunoglobulin variable region locus comprises at least about 50%, 75%, and up to 100% of the J loci found in the canine genome. κ V L locus.
[0190] In one aspect, the engineered portion of the canine immunoglobulin locus variable region comprises a variable region comprising most or all of the V κ and J κ V L In one aspect, the engineered portion of the canine immunoglobulin variable region locus comprises at least about 50%, 60%, 70%, 80%, 90%, and up to 100% of the V κ and J κ V L locus.
[0191] In one aspect, the engineered immunoglobulin locus comprises a canine V L Gene segment coding sequences and rodent non-coding regulatory or scaffold sequences from a rodent immunoglobulin light chain variable region locus. In one aspect, the engineered immunoglobulin locus comprises a canine V λ or J λ Gene segment coding sequence and rodent non-coding regulatory or scaffold sequences from a rodent immunoglobulin light chain variable region locus. In one aspect, the rodent non-coding regulatory or scaffold sequences are from a rodent immunoglobulin lambda light chain variable region locus. In one aspect, the rodent non-coding regulatory or scaffold sequences are from a rodent immunoglobulin kappa light chain variable region locus. In one aspect, the engineered immunoglobulin locus comprises a canine V λ and J λ Gene segment coding sequences and rodent non-coding regulatory or scaffold sequences from a rodent immunoglobulin lambda light chain variable region locus. In one aspect, the portion of the canine immunoglobulin locus comprises one or more rodent immunoglobulin lambda constant regions (C λ ) coding sequence. In one aspect, the portion of the canine immunoglobulin locus comprises one or more canine V λ and J λ Gene segment coding sequence and one or more rodent immunoglobulin Cλ In one aspect, the engineered immunoglobulin locus comprises a canine V coding sequence embedded within a rodent non-coding regulatory or scaffold sequence of a rodent immunoglobulin lambda light chain variable region locus. λ and J λ Gene segment coding sequence and one or more rodent C λ Coding sequence.
[0192] In one aspect, the engineered immunoglobulin locus comprises a canine V λ or J λ Gene segment coding sequence and rodent non-coding regulatory or scaffold sequences from a rodent immunoglobulin kappa light chain variable region locus. In one aspect, the engineered immunoglobulin locus comprises a canine V segment coding sequence embedded in a rodent non-coding regulatory or scaffold sequence of a rodent immunoglobulin kappa light chain variable region locus. λ or J λ In one aspect, the engineered immunoglobulin locus comprises a canine V λ and J λ gene segment coding sequence and one or more rodent immunoglobulin C from a rodent immunoglobulin kappa light chain variable region locus λ In one aspect, the engineered immunoglobulin locus comprises a canine V coding sequence and a rodent non-coding regulatory or scaffold sequence embedded in a rodent immunoglobulin kappa light chain variable region locus. λ and J λ Gene segment coding sequence and one or more rodent immunoglobulin C λ Coding sequence.
[0193] In one aspect, one or more canine V λ Gene segment coding sequence is located in one or more J λ Upstream of the gene segment coding sequence, the one or more J λ The gene segment coding sequence is located in one or more rodent C λ In one aspect, one or more canine V λ Gene segment coding sequence is located in one or more J λ Upstream of the gene segment coding sequence and associated with one or more J λ The gene segment coding sequences are in the same transcriptional direction, and the one or more J λ The gene segment coding sequence is located in one or more rodent λC λ upstream of the gene.
[0194] In one aspect, the engineered immunoglobulin variable region locus comprises one or more canine V λ Gene segment coding sequence, one or more canine J λ Gene segment coding sequence and one or more rodent C λ In one aspect, the engineered immunoglobulin variable region locus comprises one or more canine V λ Gene segment coding sequence, one or more canine J λ gene segment coding sequence and one or more rodent C λ region genes, among which V λ and J λ Gene segment coding sequence and rodent C λ In one aspect, the engineered immunoglobulin variable region locus comprises one or more canine V λ Gene segment coding sequence, one or more canine J λ Gene segment coding sequence and one or more rodent C λ Gene, in which V λ and J λ Gene segment coding sequence and rodent (C λ ) region gene is embedded in the non-coding regulatory or scaffold sequence of the rodent immunoglobulin kappa light chain locus.
[0195] In one aspect, one or more canine V λ Gene segment coding sequence is located in one or more J λ Upstream of the gene segment coding sequence, the one or more J λ The gene segment coding sequence is located in one or more rodent C λ Upstream of the gene, where V λ and J λ Gene segment coding sequence and rodent C λ In one aspect, one or more canine V λ Gene segment coding sequence is located in one or more J λ Upstream of the gene segment coding sequence, the one or more J λ The gene segment coding sequence is located in one or more rodent C λ Upstream of the gene, where V λ and J λ Gene segment coding sequence and rodent C λ The gene is embedded in a noncoding regulatory or scaffold sequence of the rodent immunoglobulin kappa light chain locus.
[0196] In one aspect, rodent C λ The coding sequence was selected from the rodent C λ1 、C λ2 or C λ3 Coding sequence.
[0197] In one aspect, a transgenic rodent or rodent cell is provided wherein the engineered immunoglobulin locus comprises a rodent immunoglobulin kappa locus wherein one or more rodent V κ Gene segment coding sequence and one or more rodent J κ The gene segment coding sequence has been deleted and replaced by one or more canine V λ Gene segment coding sequence and one or more J λ The gene segment coding sequence is replaced, and the rodent C κ The coding sequence has been identified by rodent C λ1 、C λ2 or C λ3 Coding sequence substitutions.
[0198] In one aspect, the engineered immunoglobulin variable region locus comprises one or more canine V λ gene segment coding sequence and one or more JC units, wherein each JC unit comprises a canine J λ Gene segment coding sequence and rodent C λ In one aspect, the engineered immunoglobulin variable region locus comprises one or more canine V λ gene segment coding sequence and one or more JC units, wherein each JC unit comprises a canine J λ Gene segment coding sequence and rodent C λ Region coding sequence, where V λ The gene segment coding sequences and JC units are inserted into a rodent immunoglobulin kappa light chain locus. In one aspect, the engineered immunoglobulin variable region locus comprises one or more canine V λ gene segment coding sequence and one or more JC units, wherein each JC unit comprises a canine J λ Gene segment coding sequence and rodent C λ Coding sequence, where V λ The gene segment coding sequences and JC units are embedded within non-coding regulatory or scaffold sequences of the rodent immunoglobulin kappa light chain locus.
[0199] In one aspect, one or more canine V λThe gene segment coding sequence is located upstream of and in the same transcriptional orientation as one or more JC units, wherein each JC unit comprises a canine JC gene. λ Gene segment coding sequence and rodent C λ In one aspect, one or more Canis V λ The gene segment coding sequence is located upstream of and in the same transcriptional orientation as one or more JC units, wherein each JC unit comprises a canine JC gene. λ Gene segment coding sequence and rodent C λ In one aspect, the engineered immunoglobulin variable region locus comprises one or more canine V coding sequences located upstream of one or more JC units. λ Gene segment coding sequence, wherein each JC unit comprises a canine J λ Gene segment coding sequence and rodent C λ Coding sequence, where V λ The gene segment coding sequence and JC unit are inserted into the rodent immunoglobulin kappa light chain locus. In one aspect, the engineered immunoglobulin variable region locus comprises one or more canine V C units upstream of and in the same transcriptional orientation as one or more JC units. λ Gene segment coding sequence, wherein each JC unit comprises a canine J λ Gene segment coding sequence and rodent C λ Coding sequence, where V λ The gene segment coding sequence and JC unit are embedded in the non-coding regulatory or scaffold sequence of the rodent immunoglobulin kappa light chain locus. λ The coding sequence was selected from the rodent C λ1 、C λ2 or C λ3 Coding sequence.
[0200] In one aspect, the engineered immunoglobulin locus comprises a canine V κ In one aspect, the engineered immunoglobulin locus comprises a canine V κ or J κGene segment coding sequence and rodent non-coding regulatory or scaffold sequences from a rodent immunoglobulin light chain variable region locus. In one aspect, the rodent non-coding regulatory or scaffold sequences are from a rodent immunoglobulin lambda light chain variable region locus. In one aspect, the rodent non-coding regulatory or scaffold sequences are from a rodent immunoglobulin kappa light chain variable region locus. In one aspect, the engineered immunoglobulin locus comprises a canine V κ and J κ Gene segment coding sequences and rodent non-coding regulatory or scaffold sequences from a rodent immunoglobulin kappa light chain variable region locus. In one aspect, the engineered immunoglobulin locus comprises a canine V κ and J κ Gene segment coding sequence and rodent non-coding regulatory or scaffold sequences from a rodent immunoglobulin lambda light chain variable region locus. In one aspect, a portion of the canine immunoglobulin locus comprises a rodent immunoglobulin C κ In one aspect, the portion of the canine immunoglobulin locus comprises one or more rodent immunoglobulin C λ In one aspect, the portion of the canine immunoglobulin locus comprises one or more canine V κ and J κ Gene segment coding sequence and a rodent immunoglobulin C κ In one aspect, the engineered immunoglobulin locus comprises a canine V coding sequence embedded within a rodent non-coding regulatory or scaffold sequence of a rodent kappa light chain variable region locus. κ and J κ Gene segment coding sequence and a rodent immunoglobulin C κ In one aspect, the engineered immunoglobulin locus comprises a canine V coding sequence embedded within a rodent non-coding regulatory or scaffold sequence of a rodent immunoglobulin lambda light chain variable region locus. κ and J κ Gene segment coding sequence and a rodent immunoglobulin C λ Coding sequence.
[0201] Although not wishing to be bound by theory, it is believed that inactivating or rendering non-functional the endogenous rodent κ light chain locus can increase the expression of λ light chain immunoglobulins from some canine immunoglobulin loci. This has been shown to be the case in other conventional mice in which the κ light chain locus has been inactivated in the germline (Zon et al. (1995) Subtle differences in antibody responses and hypermutation of λ light chains in mice with a disrupted κ constant region. Eur. J. Immunol. 25: 2154-2162). On the one hand, inactivating or rendering non-functional the endogenous rodent κ light chain locus can increase the relative amount of immunoglobulins comprising λ light chains relative to the amount of immunoglobulins comprising κ light chains produced by transgenic rodents or rodent cells.
[0202] In one aspect, a transgenic rodent or rodent cell is provided in which the endogenous rodent immunoglobulin kappa light chain locus is deleted, inactivated, or rendered non-functional. In one aspect, the endogenous rodent immunoglobulin kappa light chain locus is inactivated or rendered non-functional by one or more of the following: deletion or mutation of all endogenous rodent V κ Gene segment coding sequence; deletion or mutation of all endogenous rodent J κ Gene segment coding sequence; deletion or mutation of endogenous rodent C κ coding sequence; deletion, mutation or disruption of the endogenous intronic kappa enhancer (iE κ ) and 3' enhancer sequence (3'E κ ); or a combination thereof.
[0203] In one aspect, a transgenic rodent or rodent cell is provided in which the endogenous rodent immunoglobulin lambda light chain variable domain is deleted, inactivated, or rendered non-functional. In one aspect, the endogenous rodent immunoglobulin lambda light chain variable domain is inactivated or rendered non-functional by one or more of the following: deletion or mutation of all endogenous rodent V κ Gene segment; deletion or mutation of all endogenous rodent J λ Gene segment; deletion or mutation of all endogenous rodent C λ coding sequence; or a combination thereof.
[0204] In one aspect, a portion of the canine immunoglobulin locus comprises rodent regulatory or scaffold sequences, including but not limited to enhancers, promoters, splice sites, introns, recombination signal sequences, and combinations thereof. In one aspect, a portion of the canine immunoglobulin locus comprises rodent lambda regulatory or scaffold sequences. In one aspect, a portion of the canine immunoglobulin locus comprises rodent kappa regulatory or scaffold sequences.
[0205] In one aspect, a portion of the canine immunoglobulin locus includes a promoter that drives gene expression. In one aspect, a portion of the canine immunoglobulin locus includes a promoter in the kappa V region. In one aspect, a portion of the canine immunoglobulin locus includes a promoter in the lambda V region. In one aspect, a portion of the canine immunoglobulin locus includes a promoter that drives gene expression in the V region. λ To J λ In one aspect, a portion of the canine immunoglobulin locus comprises a lambda V region promoter that drives expression of one or more lambda LC gene coding sequences generated after gene segment rearrangement. κ To J κ In one aspect, a portion of the canine immunoglobulin locus comprises a lambda V region promoter that drives expression of one or more κLC gene coding sequences generated after gene segment rearrangement. λ To J λ In one aspect, a portion of the canine immunoglobulin locus comprises a kappa V region promoter that drives expression of one or more lambda LC gene coding sequences generated following gene segment rearrangement. κ To J κ A κV region promoter for the expression of one or more κLC gene coding sequences generated following gene segment rearrangement.
[0206] In one aspect, the portion of the canine immunoglobulin locus comprises one or more enhancers. In one aspect, the portion of the canine immunoglobulin locus comprises a mouse κΒ κ or 3'E κ In one aspect, a portion of a canine immunoglobulin locus comprises one or more V λ or J λ Gene segment coding sequence and mouse κiE κ or 3'E κ In one aspect, a portion of a canine immunoglobulin locus comprises one or more V κ or J κ Gene segment coding sequence and κiE κ or 3'E κ enhancer.
[0207] Immunoglobulin heavy chain locus
[0208] In one aspect, a transgenic rodent or rodent cell is provided, wherein the transgenic rodent or rodent cell has a recombinantly produced portion of a canine immunoglobulin heavy chain variable region (V H In one aspect, the portion of the canine immunoglobulin variable region locus comprises one or more canine V H , D or J H In one aspect, the portion of the canine immunoglobulin heavy chain variable region locus comprises one or more rodent constant domains (C H ) gene or coding sequence. In one aspect, the endogenous rodent heavy chain immunoglobulin locus has been inactivated. In one aspect, the endogenous rodent heavy chain immunoglobulin locus has been deleted and replaced by an engineered portion of the canine heavy chain immunoglobulin locus.
[0209] In one aspect, the synthetic H chain DNA segment comprises the ADAM6A or ADAM6B gene required for male fertility, the Pax-5-activated intergenic repeat (PAIR) element involved in Igh locus contraction, and the CTCF binding site from the heavy chain intergenic control region 1 involved in regulating normal VDJ rearrangement (Proudhon, et al., Adv. Immunol., 128:123-182 (2015)), or various combinations thereof. The locations of these endogenous non-coding regulatory and scaffold sequences in the mouse IGH locus are depicted in FIG1 , which illustrates, from left to right: ~100 functional heavy chain variable region gene segments (101); the Pax-5-activated intergenic repeat sequence PAIR involved in IGH locus contraction (102); the disintegrin and metallopeptidase domain 6A gene ADAM6A or ADAM6B required for male fertility (103); the distalmost D H The 21609 bp segment upstream of the gene segment D region IGHD-5D (104); contains the regulatory V H Gene segment uses CTCF insulator site intergenic control region 1 (IGCR1) (106); diversity gene segment D (10-15, depending on mouse strain) (105); four junction J H Gene segment (107); intronic enhancer E involved in VDJ recombination μ (108); μ switch region S for isotype switching μ (109); Eight heavy chain constant region genes: C μ 、C δ 、C γ3 、C γ1 、C γ2b 、C 2γa / c 、Cε and C α (110); 3' regulatory region (3'RR) that controls isotype switching and somatic mutation (111). Figure 1A Modified from a figure taken from Proudhon et al. Adv. Immunol., 128: 123-182 (2015).
[0210] In one aspect, the engineered partial canine region to be integrated into a mammalian host cell comprises all or a substantial portion of a known canine V H However, in some cases, such V H Subsets of gene segments may be desirable, and in certain cases, even as few as one canine V H The coding sequence is introduced into a cell or animal.
[0211] In one aspect, the engineered portion of the canine immunoglobulin locus variable region comprises a variable region comprising most or all of the V H V H In one aspect, the engineered portion of the canine immunoglobulin locus variable region comprises at least 20, 30, and up to 39 functional canine V H V H In one aspect, the engineered portion of the canine immunoglobulin variable region locus comprises at least about 50%, 60%, 70%, 80%, 90%, and up to 100% of the V H V H locus.
[0212] In one aspect, the engineered portion of the canine immunoglobulin locus variable region comprises a variable region comprising most or all of the V H V H In one aspect, the engineered portion of the canine immunoglobulin locus variable region comprises at least 20, 30, 40, 50, 60, 70, and up to 80 canine V H V H In this regard, for example, V can be restored by mutating an in-frame stop codon to a functional codon using methods well known in the art. H In one aspect, the engineered portion of the canine immunoglobulin variable region locus comprises at least about 50%, 60%, 70%, 80%, 90%, and up to 100% of the V region from the canine genome. HV H locus.
[0213] In one aspect, the engineered portion of the canine immunoglobulin locus variable region comprises a V region containing most or all of the D gene segment coding sequence found in the canine genome. H In one aspect, the engineered portion of the canine immunoglobulin locus variable region comprises a V region comprising at least 1, 2, 3, 4, 5, and up to 6 canine D gene segment coding sequences. H In one aspect, the engineered portion of the canine immunoglobulin variable region locus comprises a V region containing at least about 50%, 60%, 70%, 80%, 90%, and up to 100% of the D gene segment coding sequences found in the canine genome. H locus.
[0214] In one aspect, the engineered portion of the canine immunoglobulin locus variable region comprises a variable region containing most or all of the J sequences found in the canine genome. H V H In one aspect, the engineered portion of the canine immunoglobulin locus variable region comprises at least 1, 2, 3, 4, 5, and up to 6 canine J H V H In one aspect, the engineered portion of the canine immunoglobulin variable region locus comprises at least about 50%, 75%, and up to 100% of the J loci found in the canine genome. H V H locus.
[0215] In one aspect, the engineered portion of the canine immunoglobulin locus variable region comprises a variable region comprising most or all of the V H , D and J H V H In one aspect, the engineered portion of the canine immunoglobulin variable region locus comprises at least about 50%, 60%, 70%, 80%, 90%, and up to 100% of the V H , D and J H V H locus.
[0216] In one aspect, a transgenic rodent or rodent cell is provided, comprising an engineered portion of a canine immunoglobulin heavy chain locus comprising a canine immunoglobulin heavy chain variable region gene coding sequence and a rodent immunoglobulin heavy chain locus non-coding regulatory or scaffold sequence. H , D or J H In one aspect, the engineered canine immunoglobulin heavy chain locus comprises a canine V segment coding sequence embedded in a rodent immunoglobulin heavy chain locus non-coding regulatory or scaffold sequence. H , D or J H Gene segment coding sequence.
[0217] In one aspect, non-canine mammals and mammalian cells are provided that comprise an engineered portion of a canine immunoglobulin locus comprising a canine V H , Canidae D and Canidae J H The engineered portion of the canine immunoglobulin locus further comprises non-coding regulatory and scaffold sequences based on the endogenous IGH locus of the non-canine mammalian host, including pre-D sequences. In certain aspects, the exogenously introduced engineered portion of the canine region can comprise fully recombined V(D)J exons.
[0218] In one aspect, the transgenic non-canine mammal is a rodent, such as a mouse, comprising an exogenously introduced engineered portion of a canine immunoglobulin locus comprising a plurality of canine V H , Canidae D and Canidae J H In one aspect, the transgenic rodent further comprises a portion of a canine IGL locus comprising a canine V region bound to an intervening (non-coding regulatory or scaffold) sequence corresponding to an immunoglobulin intervening sequence present in the rodent IGL locus. κ or V λ Gene and J κ or J λ The coding sequence of a gene.
[0219] In an exemplary embodiment, as described in more detail in the Examples section, the entire endogenous V HThe immunoglobulin locus was deleted and subsequently replaced by the 39 canine V H The 39 canine V H The gene segment contains J558 V H The complete exogenously introduced engineered immunoglobulin locus also contains canine D and J H gene segments, and the mouse pre-D region. Thus, the canine V H , D and J H The codon sequences are embedded within rodent intergenic and intronic sequences.
[0220] Preparation of some canine immunoglobulin loci
[0221] In one aspect, a site-specific recombinase is used to reconstitute a H , D and J H or V L and J L The endogenous immunoglobulin locus variable region of a non-canine mammal (such as a rodent, e.g., rat or mouse) is deleted from the gene segment and replaced with an engineered portion of the canine immunoglobulin locus. In one aspect, the portion of the canine immunoglobulin locus is inserted into the genome of the host animal as a single nucleic acid or cassette. Because the cassette containing the portion of the canine immunoglobulin locus is used to replace the endogenous immunoglobulin locus variable region, the canine coding sequence can be inserted into the host genome in a single insertion step, thereby providing a rapid and direct method for obtaining transgenic animals.
[0222] In one aspect, the engineered portion of the canine immunoglobulin locus variable region is modified by making the murine V H , D and J H or V L and J L The coding sequence is deleted from the variable region of the mouse immunoglobulin locus and the murine coding sequence is replaced with the canine coding sequence. In one aspect, the non-coding flanking sequence of the murine immunoglobulin locus, including regulatory sequences and other elements, remains intact.
[0223] On the one hand, the nucleotide sequence of the canine immunoglobulin locus for engineering part is prepared in silico, and the locus is synthesized using known techniques for gene synthesis. On the one hand, the coding sequence from the canine immunoglobulin variable region locus and the sequence of the host animal immunoglobulin locus are identified using a search tool such as BLAST (Basic Local Alignment Search Tool). After obtaining the genomic sequence of the host immunoglobulin locus and the coding sequence of the canine immunoglobulin variable region locus, the host coding sequence can be replaced in silico with the canine coding sequence using known computational methods to locate the endogenous host animal immunoglobulin coding segment and to cause it to be deleted, and the coding sequence is replaced by the canine coding sequence, keeping the endogenous regulatory sequences and flanking sequences intact.
[0224] Homologous recombination
[0225] On the one hand, the combination of homologous recombination and site-specific recombination is used to produce cells and animals described herein. In some embodiments, first, a homology targeting vector is used to introduce a sequence-specific recombination site into the desired position in the endogenous immunoglobulin locus in the mammalian host cell genome. On the one hand, in the absence of recombinase protein, the sequence-specific recombination site inserted into the mammalian host cell genome by homologous recombination does not affect the expression and amino acid codons of any gene in the mammalian host cell. This method maintains the correct transcription and translation of the immunoglobulin genes that produce the desired antibody after inserting the recombination site and optionally any other sequence such as a selective marker gene. However, in some cases, the recombinase site and other sequences are inserted into the immunoglobulin locus sequence so that the amino acid sequence of the antibody molecule is changed by insertion, but it is possible that the antibody still retains enough functions for the desired purpose. The example of the homologous recombination that changes the codon can include introducing polymorphism into the endogenous locus and changing the constant region exon so that different isotypes are expressed by the endogenous locus. On the one hand, the immunoglobulin locus includes one or more such insertions.
[0226] In one aspect, homology targeting vectors can be used to replace certain sequences within the endogenous genome, as well as to insert certain sequence-specific recombination sites and one or more selectable marker genes into the host cell genome. It will be appreciated by those skilled in the art that selectable marker genes as used herein can be used to eliminate individual cells that have not undergone homologous recombination and cells carrying randomly integrated targeting vectors.
[0227] Exemplary methods for homologous recombination are described in U.S. Patent Nos. 6,689,610; 6,204,061; 5,631,153; 5,627,059; 5,487,992; and 5,464,764, each of which is incorporated herein by reference in its entirety.
[0228] Site / sequence-specific recombination
[0229] The difference between site / sequence-specific recombination and general homologous recombination is that the short specific DNA sequence required by recombinase recognition is the unique site of the recombinant location.According to the direction of these sites on specific DNA chain or chromosome, the specialized recombinase of identifying these specific sequences can catalyze i) DNA excision or ii) DNA inversion or rotation.If these sites are not present on the same chromosome, site-specific recombination also can occur between two DNA chains.The site-specific recombination systems (all comprising recombinase and specific homology site separately) of many phage and yeast sources have been proven to work in eukaryotic cells, and are therefore applicable to be combined with method described herein, and these systems comprise the Dre system of the tyrosine family of phage P1 Cre / lox, yeast FLP-FRT system and site-specific recombinase. Such systems and methods of use are described in, for example, U.S. Patent Nos. 7,422,889; 7,112,715; 6,956,146; 6,774,279; 5,677,177; 5,885,836; 5,654,182; and 4,959,317, each of which is incorporated herein by reference for teaching methods of using such recombinases.
[0230] Other systems of the tyrosine family of site-specific recombinases, such as bacteriophage lambda integrase, HK2022 integrase, and additional systems belonging to a separate serine family of recombinases, such as bacteriophage phiC31, R4Tp901 integrase, are known to work in mammalian cells using their respective recombination sites and are also suitable for use in the methods described herein.
[0231] Since site-specific recombination can occur between two different DNA chains, the occurrence of site-specific recombination can be used as a mechanism by which an exogenous locus is introduced into the host cell genome through a process called recombinase-mediated cassette exchange (RMCE). The RMCE process can be utilized by combining wild-type and mutant sequence-specific recombination sites for the same recombinase protein with negative selection. For example, the flanks on one end of the chromosomal locus to be targeted can be wild-type LoxP sites, and the flanks on the other end can be mutant LoxP sites. Similarly, similarly, the flanks on one end of an exogenous vector comprising a sequence inserted into the host cell genome can be wild-type LoxP sites, and the flanks on the other end can be mutant LoxP sites. When this exogenous vector is transfected into a host cell in the presence of Cre recombinase, Cre recombinase catalyzes the RMCE between the two DNA chains, rather than the excision reaction on the same DNA chain, because the wild-type LoxP and mutant LoxP sites on each DNA chain are incompatible for recombination with each other. Thus, LoxP sites on one DNA strand will recombine with LoxP sites on the other DNA strand; similarly, a mutated LoxP site on one DNA strand will only recombine with a similarly mutated LoxP site on the other DNA strand.
[0232] On the one hand, the combination variants of the sequence-specific recombination sites recognized by the same recombinase used for RMCE are used. Examples of such sequence-specific recombination site variants include those comprising a combination of inverted repeats or those comprising a recombination site with a mutant spacer sequence. For example, two types of variant recombinase sites can be used for engineering stable Cre-loxP integration recombination. Both utilize sequence mutations in the Cre recognition sequence within the 8bp spacer or within the 13bp inverted repeat. Spacer mutants such as lox511 (Hoess, et al., Nucleic Acids Res, 14:2287-2300 (1986)), lox5171 and lox2272 (Lee and Saito, Gene, 216:55-65 (1998)), m2, m3, m7 and ml (Langer, et al., Nucleic Acids Res, 30:3067-3077 (2002)) readily recombine with themselves but have a significantly reduced recombination rate with the wild-type site. Such mutants have been exploited for DNA insertion by RMCE using non-interacting Cre-Lox recombination sites and non-interacting FLP recombination sites (Baer and Bode, Curr Opin Biotechnol, 12:473-480 (2001); Albert, et al., Plant J, 7:649-659 (1995); Seibler and Bode, Biochemistry, 36:1740-1747 (1997); Schlake and Bode, Biochemistry, 33:12746-12751 (1994)).
[0233] Inverted repeat mutants represent the second class variant recombinase sites. For example, the LoxP site can include a changed base in the left inverted repeat (LE mutant) or the right inverted repeat (RE mutant). The LE mutant lox71 has a 5bp (Araki et al., Nucleic Acids Res, 25:868-872 (1997)) that is changed from the wild-type sequence to TACCG on the 5' end of the left inverted repeat. Similarly, the RE mutant lox66 has the 5 most 3' bases that are changed to CGGTA. Inverted repeat mutants are used to integrate plasmid inserts into chromosomal DNA, where the LE mutant is designated as the "donor" RE mutant and is recombined into the "target" chromosome loxP site therein. After recombination, the loxP site is located at the cis flank of the insertion segment. The mechanism of recombination is such that after recombination, one loxP site is a double mutant (containing both LE and RE inverted repeat mutations) and the other is wild type (Lee and Sadowski, Prog Nucleic Acid Res Mol Biol, 80: 1-42 (2005); Lee and Sadowski, J Mol Biol, 326: 397-412 (2003)). The double mutant is sufficiently different from the wild type site that it cannot be recognized by the Cre recombinase and the inserted segment cannot be excised.
[0234] In certain aspects, sequence-specific recombination sites can be introduced into introns, as opposed to coding nucleic acid regions or regulatory sequences. This avoids inadvertently disrupting any regulatory sequences or coding regions required for proper antibody expression after the sequence-specific recombination sites are inserted into the animal cell genome.
[0235] The introduction of sequence-specific recombination sites can be achieved by conventional homologous recombination techniques. Such technology is described in the reference, such as, for example, Sambrook and Russell (2001) (Molecular cloning:a laboratory manual the 3rd edition (Cold Spring Harbor, NY:Cold Spring Harbor Laboratory Press) and Nagy, A. (2003). (Manipulating the mouse embryo:a laboratory manual, the 3rd edition (Cold Spring Harbor, NY:Cold Spring Harbor Laboratory Press). Renault and Duchateau, write (2013) (Site-directed insertion of transgenes.Topics in Current Genetics 23.Springer). Tsubouchi, H.Ed. (2011) (DNA recbination, Methods and Protocols.Humana Press).
[0236] Specific recombination in genome can be promoted using the carrier that is designed for positive or negative selection as known in the art. In order to promote the identification of cells that have undergone substitution reaction, appropriate genetic marker system can be used, and cells are selected by, for example, using selection tissue culture medium. However, in order to ensure that the genomic sequence is substantially free of foreign nucleic acid sequence at or near the two end points of the substitution interval, marker system / gene can be removed after the selection of the cell comprising the substituted nucleic acid desirably.
[0237] On the one hand, after being exposed to toxin or medicine, negative selection is carried out to the cell that all or part of endogenous immunoglobulin locus has been replaced.For example, the cell that retains HSV-TK expression can be selected by using nucleoside analogs such as ganciclovir.On the other hand, the cell that comprises endogenous immunoglobulin locus deletion can be by using marker gene and positive selection, and this marker gene can be optionally removed from cell after recombination event or as the result of recombination event.Operable positive selection system is based on the use of two non-functional parts (they are gathered together by recombination event) of marker gene such as HPRT.These two parts functionally associate after carrying out successful substitution reaction, and the flank of the marker gene that wherein functionally reconstructs is other sequence-specific recombination site (it is different from the sequence-specific recombination site used in the substitution reaction) on either side, makes marker gene can use suitable site-specific recombinase to cut off from genome.
[0238] The recombinase can be provided as a purified protein, or as a protein expressed from a vector construct that is transiently transfected into a host cell or stably integrated into the host cell genome. Alternatively, cells can first be used to generate transgenic animals, which can then be crossed with animals expressing the recombinase.
[0239] Because the methods described herein can utilize two or more sets of sequence-specific recombination sites within an engineered genome, multiple rounds of RMCE can be used to insert partial canine immunoglobulin variable region genes into the genome of a non-canine mammalian host cell.
[0240] Although not yet routinely used for inserting large DNA segments, CRISPR-Cas technology is another approach for introducing chimeric canine Ig loci.
[0241] Generation of transgenic animals
[0242] In one aspect, methods are provided for producing a transgenic animal, eg, a rodent, such as a mouse, comprising an introduced portion of a canine immunoglobulin locus.
[0243] On the one hand, the host cell for replacing endogenous immunoglobulin genes is an embryonic stem (ES) cell, which can then be used to produce a transgenic mammal. On the one hand, the host cell is an early embryonic cell. On the one hand, the host cell is a prokaryotic embryo or a zygote. Therefore, according to one aspect, the method described herein also includes: isolating an embryonic stem cell or an early embryonic cell, such as a prokaryotic embryo or a zygote, comprising the portion of the canine immunoglobulin locus introduced, and using the ES cell to produce a transgenic animal comprising the portion of the canine immunoglobulin locus replaced.
[0244] How to use
[0245] In one aspect, a method for producing an antibody comprising a canine variable region is provided. In one aspect, the method comprises providing a transgenic rodent or rodent cell as described herein, and isolating an antibody comprising a canine variable region expressed by the transgenic rodent. In one aspect, a method for producing a monoclonal antibody comprising a canine variable region is provided. In one aspect, the method comprises providing a B cell from a transgenic rodent or cell as described herein, immortalizing the B cell, and isolating an antibody comprising a canine variable domain expressed by the immortalized B cell.
[0246] In one aspect, the antibodies expressed by the transgenic rodents or rodent cells comprise canine HC variable domains. In one aspect, the antibodies expressed by the transgenic rodents or rodent cells comprise mouse HC constant domains. These can be any isotype, IgM, IgD, IgG1, IgG2a / c, IgG2b, IgG3, IgE, or IgA.
[0247] In one aspect, the antibody expressed by the transgenic rodent or rodent cell comprises a canine HC variable domain and a mouse HC constant domain. In one aspect, the antibody expressed by the transgenic rodent or rodent cell comprises a canine LC variable domain and a mouse LC constant domain. In one aspect, the antibody expressed by the transgenic rodent or rodent cell comprises a canine HC variable domain and a canine LC variable domain and a mouse HC constant domain and a mouse LC constant domain.
[0248] In one aspect, the antibodies expressed by the transgenic rodent or rodent cell comprise a canine lambda LC variable domain. In one aspect, the antibodies expressed by the transgenic rodent or rodent cell comprise a mouse lambda constant domain. In one aspect, the antibodies expressed by the transgenic rodent or rodent cell comprise a canine lambda LC variable domain and a mouse lambda constant domain. In one aspect, the antibodies expressed by the transgenic rodent or rodent cell comprise a canine kappa LC variable domain. In one aspect, the antibodies expressed by the transgenic rodent or rodent cell comprise a mouse kappa constant domain. In one aspect, the antibodies expressed by the transgenic rodent or rodent cell comprise a canine kappa LC variable domain and a mouse kappa constant domain.
[0249] In one aspect, a method for producing an antibody or antigen-binding fragment comprising a canine variable region is provided. In one aspect, the method comprises providing a transgenic rodent or rodent cell as described herein and isolating an antibody comprising a canine variable region expressed by the transgenic rodent or rodent cell. In one aspect, the variable region of the antibody expressed by the transgenic rodent or rodent cell is sequenced. Antibodies comprising a canine variable region obtained from an antibody expressed by the transgenic rodent or rodent cell can be produced recombinantly using known methods.
[0250] In one aspect, a method for producing immunoglobulins specific for an antigen of interest is provided. In one aspect, the method comprises immunizing a transgenic rodent as described herein with the antigen and isolating immunoglobulins specific for the antigen expressed by the transgenic rodent or rodent cells. In one aspect, the variable domains of the antibodies expressed by the rodent or rodent cells are sequenced, and antibodies comprising canine variable regions that specifically bind to the antigen of interest are produced recombinantly using known methods. In one aspect, the recombinantly produced antibodies or antigen-binding fragments comprise canine HC and LC, kappa or lambda constant domains.
[0251] Incorporated by Reference
[0252] All references cited herein, including patents, patent applications, articles, textbooks, etc., and references cited therein, to the extent they have not already been cited, are hereby incorporated by reference in their entirety for all purposes. Example
[0253] The following examples are set forth to provide a complete disclosure and description of how to make and use the present invention to one of ordinary skill in the art, and are not intended to limit the scope of what the inventors regard as their invention, nor are they intended to represent or imply that the experiments below are all or only experiments performed. It will be understood by those skilled in the art that many variations or modifications may be made to the invention as shown in the specific embodiments without departing from the spirit or scope of the invention as broadly described. Therefore, the present embodiments are to be considered in all respects as illustrative and not restrictive.
[0254] Efforts have been made to ensure accuracy with respect to the nomenclature and numbers used (e.g., carriers, amounts, temperatures, etc.), but some experimental errors and deviations should be accounted for. Unless indicated otherwise, parts are parts by weight, molecular weight is weight average molecular weight, temperature is in degrees Celsius, and pressure is at or near atmospheric.
[0255] The examples illustrate targeting flanking the recombination site via both a 5' vector and a 3' vector, as well as the introduction of synthetic DNA. It will be apparent to one skilled in the art upon reading this specification that targeting the 5' vector can occur first, followed by the 3' vector, or that targeting the 3' vector can occur first, followed by the 5' vector. In some cases, targeting can be performed simultaneously with a dual detection mechanism.
[0256] Example 1: Introduction of engineered partial canine immunoglobulin variable region loci into non-canine mammals Immunoglobulin H chain variable region loci in the genomes of host cells of dairy animals
[0257] Figure 2-Figure 6 An exemplary method for introducing an engineered portion of a canine immunoglobulin locus into a genomic locus in a non-mammalian ES cell is described in more detail in . Figure 2 In the present invention, a homology targeting vector (201) is provided, which comprises a puromycin phosphotransferase-thymidine kinase fusion protein (puro-TK) (203) flanked by two different recombinase recognition sites (e.g., FRT (207) and loxP (205) for Flp and Cre, respectively) and two different mutant sites (e.g., modified mutant FRT (209) and mutant loxP (211)) that lack the ability to recombine with their respective wild-type counterparts / sites (i.e., wild-type FRT (207) and wild-type loxP (205)). The targeting vector comprises a diphtheria toxin receptor (DTR) cDNA (217) for use in a future step in negative selection of cells containing the introduced construct. The targeting vector also optionally comprises a visual marker, such as green fluorescent protein (GFP) (not shown). Regions 213 and 215 are homologous to the 5' and 3' portions, respectively, of a contiguous region (229) in an endogenous non-canine locus that contains the endogenous non-canine V H A homology targeting vector (201) is introduced (202) into ES cells, the homology targeting vector (201) having an immunoglobulin locus (231) containing an endogenous V H gene segment (219), pre-D region (221), D gene segment (223), J H The site-specific recombination sequence and DTR cDNA from the homologous targeting vector (201) are integrated (204) into the non-canine genome endogenous mouse V HThe 5' site of the locus results in the genomic structure shown at 233. ES cells that have no exogenous vector (201) integrated into their genome can be selected (killed) by including puromycin in the culture medium; only ES cells that have stably integrated the exogenous vector (201) into their genome and constitutively express the puro-TK gene are resistant to puromycin.
[0258] Figure 3 Effectively illustrates the Figure 2 The same method is used except that a set of additional sequence-specific recombination sites are added, such as the Rox site (331) and the modified Rox site (335) for use with the Dre recombinase. Figure 3 In the present invention, a homologous targeting vector (301) is provided, which comprises a puro-TK fusion protein (303) flanked by wild-type recombinase recognition sites for FRT (307), loxP (305) and Rox (331) and mutant sites for FRT (309), loxP (311) and Rox (335) recombinases that lack the ability to recombine with wild-type sites 307, 305 and 331, respectively. The targeting vector also comprises a diphtheria toxin receptor (DTR) cDNA (317). Regions 313 and 315 are respectively bound to the endogenous non-canine locus at the endogenous mouse V H The 5' and 3' portions of the adjacent region (329) 5' to the genomic region of the gene segment (319) are homologous. Homologous targeting is introduced (302) into the mouse immunoglobulin locus (339) containing the endogenous V H gene segment (319), pre-D region (321), D gene segment (323), J H (325) gene segments and constant region genes of the Igh locus (327). The site-specific recombination sequences and DTR cDNA (317) in the homologous targeting vector (301) are integrated (304) into the mouse genome into the endogenous mouse V H At the site 5' of the locus, the genomic structure shown at 333 is generated.
[0259] like Figure 4As shown in FIG, a second homologous targeting vector (401) is provided, which comprises an optional hypoxanthine-guanine phosphoribosyltransferase (HPRT) gene (435) (which can be used for positive selection in HPRT-deficient ES cells); a neomycin resistance gene (437); and recombinase recognition sites FRT (407) and loxP (405) for Flp and Cre, respectively, which have the ability to recombine with the FRT (407) and loxP (405) sites previously integrated into the mouse genome from the first homologous targeting vector. The previous homologous targeting vector also comprises a mutant FRT site (409), a mutant loxP site (411), a puro-TK fusion protein (403), and a loxP site located at the endogenous mouse V H The DTR cDNA (419) is located at the 5' site of the locus. Regions 429 and 439 are located at the endogenous J H The homology to the 5' and 3' portions of the contiguous region (441) in the endogenous mouse non-canine locus downstream of the gene segment (425) and upstream of the constant region gene (427) is introduced (402) into the modified mouse immunoglobulin locus (431) containing the endogenous V H gene segment (419), pre-D region (421), D gene segment (423), J H Gene segment (425) and constant region gene (427). The site-specific recombination sequences (407, 405) of the homologous targeting vector, the HPRT gene (435) and the neomycin resistance gene (437) were integrated (404) into the mouse genome upstream of the endogenous mouse constant region gene (427), resulting in the genomic structure shown at 433.
[0260] After the recombination sites are integrated into the mammalian host cell genome, the endogenous regions of the immunoglobulin domains then undergo recombination by introducing one of the recombinases corresponding to the sequence-specific recombination sites integrated into the genome, such as Flp or Cre. Figure 5 The modified Igh locus of a mammalian host cell genome comprising two integrated DNA fragments is shown in FIG. A fragment comprising a mutant FRT site (509), a mutant LoxP site (511), a puro-TK gene (503), a wild-type FRT site (507), a wild-type LoxP site (505), and a DTR cDNA (517) is integrated in V H Another DNA fragment containing the HPRT gene (535), the neomycin resistance gene (537), the wild-type FRT site (507) and the wild-type LoxP site (505) was integrated between the front D (521), D (523) and JH (525) downstream of the locus, but upstream of the constant region gene (527). In the presence of Flp or Cre (502), all intervening sequences between the wild-type FRT or wild-type LoxP sites, including the DTR gene (517), the endogenous IGH variable region loci (519, 521, 525), and the HPRT (535) and neomycin resistance (537) genes, are deleted, resulting in the genomic structure shown at 539. The procedure relies on the second targeting having occurred on the same chromosome rather than on its homolog (i.e., in cis rather than in trans). If targeting occurs as expected in cis, the cells are insensitive to negative selection by diphtheria toxin introduced into the culture medium after Cre- or Flp-mediated recombination, because the DTR gene that causes sensitivity to diphtheria toxin in rodents should be absent (deleted) in the host cell genome. Similarly, ES cells carrying randomly integrated first or second targeting vectors are conferred sensitivity to diphtheria toxin by the presence of the non-deleted DTR gene.
[0261] ES cells that are insensitive to diphtheria toxin are then screened for deletion of the endogenous variable region loci. Primary screening for deleted endogenous immunoglobulin loci can be performed by Southern blotting or by polymerase chain reaction (PCR), followed by confirmation using secondary screening techniques such as Southern blotting.
[0262] Figure 6 Schematic diagram of the introduction of an engineered partial canine sequence into a non-canine genome that was previously modified to encode a portion of the endogenous Igh locus (V H , D and J H ) and V H With J H All intervening sequences between the loci are deleted. A site-specific targeting vector (629) is introduced (602) into the host cell, the site-specific targeting vector (629) comprising a portion of the canine V H locus (619), endogenous non-canid pre-D gene region (621), partial canid D locus (623), partial canid J H locus (625) and flanked by mutant FRT (609), mutant LoxP (611), wild-type FRT (607) and wild-type LoxP (605) sites. H The locus (619) contains 39 functional canine V genes combined with intervening sequences based on endogenous non-canine genomic sequences. Hcoding sequence; the pre-D region (621) comprises a 21.6 kb mouse sequence with significant homology to the corresponding region of the endogenous canine IGH locus; the D locus (623) comprises the codons of the six D gene segments embedded in intervening sequences surrounding the endogenous non-canine D gene segments; and J H The locus (625) contains six Canis J genes embedded in an intervening sequence based on the endogenous non-canis genome. H The IGH locus (601) of the host cell genome has been previously modified to delete all V H , D and J H Gene segments, including Figure 5 As a result of this modification, the endogenous non-canine host cell Igh locus (601) is left with a puro-TK fusion gene (603) flanked by a mutant FRT site (609) and a mutant LoxP site (611) upstream and a wild-type FRT (607) and wild-type LoxP (605) downstream. Upon introduction of the appropriate recombinase (604), a portion of the canine immunoglobulin locus is integrated into the genome upstream of the endogenous non-canine constant region gene (627), resulting in the genomic structure shown at 631.
[0263] Canine V H , D and J H The sequences of the coding regions of the gene segments are given in Table 1 .
[0264] Primary screening procedures for the introduction of portions of the canine immunoglobulin locus can be performed by Southern blotting or by PCR followed by confirmation by secondary screening methods such as Southern blotting. H , D and J H locus and the presence of all intervening sequences.
[0265] Example 2: Engineered portions of canine immunoglobulins containing additional non-coding regulatory or scaffold sequences Immunoglobulin H chain variable region gene locus introduced into the genome of non-canine mammalian host cells in the seat
[0266] In certain aspects, a portion of the canine immunoglobulin locus comprises elements as described in Example 1, but has additional non-coding regulatory or scaffold sequences, such as sequences strategically added to introduce additional regulatory sequences, ensure desired spacing in the introduced immunoglobulin locus, ensure adequate juxtaposition of certain coding sequences with other sequences adjacent to the replaced immunoglobulin locus, and the like. Figure 7 A second exemplary engineered partial canine sequence is shown. Figure 2-Figure 5and modified non-canine genomes generated in and described in Example 1 above.
[0267] Figure 7 Schematic representation of the introduction of an engineered partial canine sequence into a mouse genome that had been previously modified to encode a portion of the endogenous non-canine IGH locus (V H , D and J H ) and endogenous V H With J H All intervening sequences between the loci are deleted. A site-specific targeting vector (731) is introduced (702) into the genomic region (701), the site-specific targeting vector (731) comprising an engineered portion of the canine immunoglobulin locus to be inserted into the genome of the non-canine host. A site-specific targeting vector (731) is introduced (702) into the host cell, the site-specific targeting vector (731) comprising a portion of the canine V H locus (719), mouse pre-D region (721), part of the canine D locus (723), part of the canine J H locus (725), PAIR element (741) and flanking mutant FRT (709), mutant LoxP (711), wild-type FRT (707) and wild-type LoxP (705) sites. H The locus (719) contains 80 canine V genes combined with intervening sequences based on endogenous non-canine genomic sequences. H gene segment coding region; the pre-D region (721) comprises 21.6 kb of non-canine sequence present upstream of the endogenous non-canine genome; the D region (723) comprises 6 codons of the canine D gene segment embedded in the intervening sequence surrounding the endogenous non-canine D gene segment; and J H The locus (725) contains six Canis J genes embedded in an intervening sequence based on an endogenous non-canis genomic sequence. H The IGH locus (701) of the host cell genome has been previously modified to delete all V H , D and J H Gene segments, including Figure 5As a result of this modification, the endogenous non-canine Igh locus (701) is left with a puro-TK fusion gene (703) flanked by a mutant FRT site (709) and a mutant LoxP site (711) upstream and a wild-type FRT (707) and wild-type LoxP (705) downstream. After introduction of the appropriate recombinase (704), the engineered portion of the canine immunoglobulin locus is integrated into the genome upstream of the endogenous mouse constant region gene (727), resulting in the genomic structure shown at 729.
[0268] The primary screening procedure for the introduction of engineered portions of the canine immunoglobulin locus can be performed by Southern blotting or by PCR with confirmation by a secondary screening method such as Southern blotting. The screening method is designed to detect the inserted PAIR elements, V H , D and J H locus and the presence of all intervening sequences.
[0269] Example 3: Introducing engineered portions of canine immunoglobulin loci into the immunoglobulin loci of the mouse genome Protein heavy chain locus
[0270] Figure 8 The method for replacing a portion of the mouse genome with an engineered portion of the canine immunoglobulin locus is illustrated. The method utilizes the introduction of a first site-specific recombinase recognition sequence into the mouse genome, followed by the introduction of a second site-specific recombinase recognition sequence into the mouse genome. These two sites are located in the mouse endogenous V H , D and J H The flanking region is deleted using the relevant site-specific recombinase as described herein.
[0271] For V in wild-type mouse immunoglobulin locus (801) H (815), D(817) and J H The targeting vectors (803, 805) that introduce site-specific recombinase sequences on either side of the (819) gene segment cluster and upstream of the constant region gene (821) contain additional site-specific recombination sequences that have been modified so that they are still effectively recognized by the recombinase but do not recombine with the unmodified site. The modified mutant site (e.g., lox5171) is located in the targeting vector so that the endogenous V H 、D H and J HFollowing gene segment deletion (802), the modified mutant site can be used for a second site-specific recombination event in which a non-natural DNA segment is moved into the modified IGH locus by RMCE. In this example, the non-natural DNA is a synthetic nucleic acid (809) comprising both canine and non-canine sequences.
[0272] Two gene targeting vectors were constructed to accomplish the method just outlined. One of the vectors (803) contained a H Another vector (805) contains mouse genomic DNA taken from J H Mouse genomic DNA within the locus downstream of the gene segment.
[0273] The key features of the 5' vector (803) from 5' to 3' sequence are as follows: a gene (823) encoding the diphtheria toxin A (DTA) subunit under the transcriptional control of a modified herpes simplex virus type I thymidine kinase gene promoter coupled to two mutant transcription enhancers from polyoma virus; a V H 4.5 Kb of mouse genomic DNA (825) located upstream of the gene segment; an FRT recognition sequence for Flp recombinase (827); a genomic DNA fragment containing the mouse Polr2a gene promoter (829); a translation initiation sequence (methionine codon 835 embedded in a "Kozak" consensus sequence); a mutant loxP recognition sequence for Cre recombinase (lox5171) (831); a transcription termination / polyadenylation sequence (pA.833); a loxP recognition sequence for Cre recombinase (837); a gene (839) encoding a fusion protein having a puromycin resistance-conferring protein fused to a truncated form of thymidine kinase under the transcriptional control of the promoter from the mouse phosphoglycerate kinase 1 gene (pu-TK); and 3 Kb of mouse genomic DNA (841) located adjacent to the 4.5 Kb mouse genomic DNA sequence present near the 5' end of the vector and arranged in the natural relative orientation.
[0274] The key features of the 5' to 3' sequence of the 3' vector (805) are as follows: H with C H3.7 Kb mouse genomic DNA (843) positioned in an intron between the gene loci; the HPRT gene (845) under the transcriptional control of the mouse Polr2a gene promoter; the neomycin resistance gene (847) under the control of the mouse phosphoglycerate kinase 1 gene promoter; a loxP recognition sequence for Cre recombinase (837); 2.1 Kb mouse genomic DNA (849) positioned downstream of a 3.7 Kb mouse genomic DNA fragment present near the 5' end of the vector and arranged in a native relative orientation; and a gene encoding a DTA subunit (823) under the transcriptional control of a modified herpes simplex virus type I thymidine kinase gene promoter coupled to two mutant transcription enhancers from a polyoma virus.
[0275] Mouse embryonic stem (ES) cells (derived from C57B1 / 6NTac mice) were transfected with the 3' vector (805) by electroporation according to a widely used procedure. Prior to electroporation, the vector DNA was linearized with a rare-cutting restriction enzyme that only cuts the prokaryotic plasmid sequence or the polylinker associated therewith. The transfected cells were plated and, after ~24 hours, placed under positive selection for cells that had integrated the 3' vector into their DNA using the neomycin analog drug G418. There was also negative selection for cells that had integrated the vector into their DNA but not by homologous recombination. Non-homologous recombination results in the retention of the DTA gene (823), which kills cells when the gene is expressed, while the DTA gene is deleted by homologous recombination because it is located outside the region of vector homology to the mouse IGH locus. After about a week, colonies of drug-resistant ES cells were physically extracted from their plates after they became visible to the naked eye. These selected colonies are disaggregated, re-plated in microplates, and cultured for several days. Afterwards, each cell clone is divided so that some cells can be frozen as archive material and the rest used for DNA isolation for analytical purposes.
[0276] DNA from ES cell clones was screened by PCR using a widely practiced gene targeting assay design. For this assay, one PCR oligonucleotide primer sequence was positioned outside the region of shared identity between the 3' vector (805) and the genomic DNA, while another PCR oligonucleotide primer sequence was positioned in the new DNA between the two arms of genomic identity in the vector, i.e., the HPRT (845) or neomycin resistance (847) gene. According to standard design, these assays detect DNA fragments that are only present in ES cell clones derived from transfected cells that undergo fully legitimate homologous recombination between the 3' targeting vector and the endogenous mouse IGH locus. Two separate transfections were performed with the 3' vector (805). PCR positive clones from the two transfections were selected for amplification and subsequently further analyzed using Southern blotting.
[0277] Southern blot assays are performed according to a widely used procedure using three probes and genomic DNA digested with a variety of restriction enzymes selected so that the combination of probes and digests allows the structure of the targeted locus in the clone to be identified as appropriately modified by homologous recombination. One of the probes is mapped to a DNA sequence flanking the 5' side of the region of shared identity between the 3' targeting vector and the genomic DNA; a second probe is mapped outside the region of identity, but on the 3' side; and a third probe is mapped to new DNA between the two arms of genomic identity in the vector, i.e., in the HPRT (845) or neomycin resistance (847) gene. Southern blots identify the presence of DNA fragments generated by the expected restriction enzymes, corresponding to a portion of the IGH locus that has been correctly mutated (i.e., by homologous recombination using the 3' Igh targeting vector) as detected by one of the external probes and by the neomycin or HPRT probes. The external probes detect mutant fragments and also detect wild-type fragments from the non-mutant copy of the immunoglobulin Igh locus on the homologous chromosome.
[0278] The karyotypes of the PCR positive clones and the Southern blot positive clones of the ES cells were analyzed using an in situ fluorescence hybridization procedure designed to distinguish the most common chromosomal aberrations that occur in mouse ES cells. Clones with such aberrations were excluded from further use. ES cell clones that had the correct genomic structure expected based on Southern blot data and that did not have detectable chromosomal aberrations based on karyotyping were selected for further use.
[0279] Acceptable clones were then modified with the 5' vector (803) using a procedure and screening assay similar in design to those used with the 3' vector (805), except that puromycin selection was used instead of G418 / neomycin. PCR assays, probes, and digests were also customized to match the genomic region modified by the 5' vector (803).
[0280] After vector targeting and analysis, ES cell clones that have been mutated in the desired manner by both the 3' vector and the 5' vector are isolated, i.e., dually targeted cells carrying both engineered mutations. In contrast to homologous chromosomes, clones must undergo gene targeting on the same chromosome (i.e., the engineered mutations generated by the targeting vector must be in cis on the same DNA strand, rather than in trans on separate homologous DNA strands). Clones with cis arrangements are distinguished from clones with trans arrangements by analytical procedures such as fluorescent in situ hybridization of metaphase spreads using probes that hybridize to the new DNA present between the arms of the two gene targeting vectors (803 and 805) that share genomic identity. The two types of clones can also be distinguished from each other by transfecting them with a vector expressing Cre recombinase (which deletes the pu-TK (839), HPRT (845), and neomycin resistance (847) genes if the targeting vector has been integrated in cis) and then comparing the number of colonies that survive ganciclovir selection against the thymidine kinase gene introduced by the 5' vector (803) and analyzing the drug resistance phenotype of the surviving clones by a "sibling selection" screening procedure in which some cells from the clone are tested for resistance to puromycin or G418 / neomycin. Cells with the cis arrangement of mutations are expected to produce approximately 10 more than cells with the trans arrangement. 3 ganciclovir-resistant clones were obtained. Most of the resulting cis-derived ganciclovir-resistant clones were also sensitive to both puromycin and G418 / neomycin, whereas trans-derived ganciclovir-resistant clones should retain resistance to both drugs. Dual-targeted cell clones with cis arrangements of engineered mutations in the heavy chain locus were selected for further use.
[0281] Dual targeted cell clones were transiently transfected with a vector expressing Cre recombinase, and the transfected cells were subsequently placed under ganciclovir selection, as in the analytical experiments summarized above. Ganciclovir-resistant cell clones were isolated and analyzed by PCR and Southern blot analysis for the presence of the expected deletion between the two engineered mutations produced by the 5' (803) and 3' (805) targeting vectors. In these clones, Cre recombinase causes recombination (802) between the loxP sites (837) introduced into the heavy chain locus by two vectors to produce the genomic DNA configuration shown in 807. Because the loxP sites are arranged in the same relative orientation in the two vectors, recombination causes a DNA circle (a circle of DNA) comprising the entire genomic interval between the two loxP sites to be excised. This circle does not comprise an origin of replication, and therefore is not replicated during mitosis, and therefore is lost from the cell when the cell undergoes proliferation. The resulting clones carry the deletion initially located between the two loxP sites. The clones with the expected deletion are selected for further use.
[0282] An ES cell clone carrying a sequence deletion in one of the two homologous copies of its immunoglobulin heavy chain locus is retransfected (804) with a Cre recombinase expression vector together with a DNA fragment (809) comprising a portion of the canine immunoglobulin heavy chain locus comprising the canine V H , D and J H The key features of the synthetic DNA fragment (809) are as follows: lox5171 site (831); neomycin resistance gene open reading frame (847), which lacks the start methionine codon but is in-frame and adjacent to the uninterrupted open reading frame in the lox5171 site; FRT site (827); 39 functional canine V H An array of heavy chain variable region genes (851), each gene having canine coding sequences embedded in mouse non-coding sequences; optionally, a 21.6 kb pre-D region from the mouse heavy chain locus (not shown); comprising six canine D H Gene segment (853) and 6 Canine J H 58Kb DNA fragment of gene segment (855), in which Canis v H , D and J H The coding sequence is embedded in the mouse non-coding sequence; the loxP site (837) is in the opposite relative orientation to the lox5171 site (831).
[0283] Transfected clones are placed under G418 selection, which enriches for cell clones that have undergone RMCE, wherein the engineered portion of the canine donor immunoglobulin locus (809) is integrated in its entirety into the endogenous immunoglobulin heavy chain locus deleted between lox5171 (831) and loxP (837) sites to produce the DNA region shown at 811. Only cells that have properly undergone RMCE have the ability to express the neomycin resistance gene (847) because the promoter (829) and start methionine codon (835) required for its expression are not present in the vector (809) but are already pre-existing in the host cell IGH locus (807). The remaining elements from the 5' vector (803) are removed via Flp-mediated in vitro or in vivo recombination (806), resulting in the final canine-based locus shown at 813.
[0284] G418-resistant ES cell clones were analyzed by PCR and Southern blotting to determine whether they had undergone the expected RMCE process without unwanted rearrangements or deletions. Clones with the expected genomic structure were selected for further use.
[0285] According to standard procedures, ES cell clones carrying partial canine immunoglobulin heavy chain DNA (813) in the mouse heavy chain locus were microinjected into mouse blastocysts from strain DBA / 2 to produce chimeric mice of partial ES cell origin. Male chimeric mice with the highest level of ES cell-derived contribution to their fur were selected for mating with female mice. The female mice selected here were of the C57B1 / 6NTac strain and also carried a transgene encoding the Flp recombinase expressed in their germline. The offspring from these matings were analyzed for the presence of the partial canine immunoglobulin heavy chain locus and the loss of the neomycin resistance gene flanked by FRT generated in the RMCE step. Mice carrying the partial canine locus were used to establish mouse colonies.
[0286] Example 4: Introducing engineered portions of canine immunoglobulin loci into the immunoglobulin loci of the mouse genome Protein kappa chain locus
[0287] Figure 9 Another method for replacing a portion of the mouse genome with a portion of the canine immunoglobulin locus is shown. The method includes introducing a first site-specific recombinase recognition sequence into the mouse genome, followed by introducing a second site-specific recombinase recognition sequence into the mouse genome. The first site-specific recombinase recognition sequence can be introduced into the endogenous V κ (915) and J κ (919) region gene segment cluster 5' or 3', the second site-specific recombinase recognition sequence combined with the first sequence-specific recombination site is located upstream of the V containing constant region gene (921)κ and J κ The entire locus of the gene segment cluster is flanked by the flanking regions deleted and then replaced with portions of the canine immunoglobulin locus using the relevant site-specific recombinases, as described herein.
[0288] For use in V κ (915) and J κ (919) The targeting vector that introduces site-specific recombination sequences on either side of the gene segment also contains an additional site-specific recombination sequence that has been modified so that it is still effectively recognized by the recombinase but does not recombine with the unmodified site. The site is located in the targeting vector so that the V κ and J κ After gene segment cluster deletion, it can be used in which non-native DNA fragments are moved into the modified V κ In this example, the non-natural DNA is a canine V gene embedded in mouse regulatory and flanking sequences. κ and J κ Synthetic nucleic acid of a gene segment coding sequence.
[0289] Two gene targeting vectors were constructed to carry out the method just outlined. One of the vectors (903) contained a κ Another vector (905) contains mouse genomic DNA taken from J κ Mouse genomic DNA within the locus downstream (3') of the gene segment (919) and upstream of the constant region gene (921).
[0290] The key features of the 5' vector (903) are as follows: a gene encoding the diphtheria toxin A (DTA) subunit under the transcriptional control of a modified herpes simplex virus type I thymidine kinase gene promoter coupled to two mutant transcription enhancers from polyoma virus (923); 6 kb of mouse genomic DNA located upstream of the most distal variable region gene in the kappa chain locus (925); an FRT recognition sequence for Flp recombinase (927); a genomic DNA fragment containing the mouse Polr2a gene promoter (929); a translation initiation sequence (935, a methionine amino acid embedded in a "Kozak" consensus sequence); codon); a mutant loxP recognition sequence for Cre recombinase (lox5171) (931); a transcription termination / polyadenylation sequence (933); a loxP recognition sequence for Cre recombinase (937); a gene encoding a fusion protein having a puromycin resistance-conferring protein fused to a truncated form of thymidine kinase (pu-TK) under the transcriptional control of a promoter from the mouse phosphoglycerate kinase 1 gene (939); and 2.5 Kb of mouse genomic DNA positioned adjacent to a 6 Kb sequence arranged in a native relative orientation at the 5' end of the vector (941).
[0291] The main features of the 3' vector (905) are as follows: κ (919) and C κ (921) locus; a gene encoding human hypoxanthine-guanine phosphoribosyltransferase (HPRT) (945) under the transcriptional control of the mouse Polr2a gene promoter; a neomycin resistance gene (947) under the control of the mouse phosphoglycerate kinase 1 gene promoter; a loxP recognition sequence for Cre recombinase (937); 3.6 Kb of mouse genomic DNA (949) located genomic downstream of the 6 Kb DNA fragment contained immediately at the 5' end of the vector, wherein the two fragments are oriented in the same relative manner as in the mouse genome; a gene encoding the diphtheria toxin A (DTA) subunit (923) under the transcriptional control of a modified herpes simplex virus type I thymidine kinase gene promoter coupled to two mutant transcription enhancers from polyoma virus.
[0292] Mouse embryonic stem (ES) cells derived from C57Bl / 6NTac mice were transfected with the 3' vector (905) by electroporation according to a widely used procedure. Prior to electroporation, the vector DNA was linearized with a rare-cutting restriction enzyme that only cuts the prokaryotic plasmid sequence or the polylinker associated therewith. The transfected cells were plated and, after ~24 hours, placed under positive selection for cells that had integrated the 3' vector into their DNA using the neomycin analog drug G418. There was also negative selection for cells that had integrated the vector into their DNA but not by homologous recombination. Non-homologous recombination results in the retention of the DTA gene, which kills cells when the gene is expressed, while the DTA gene is deleted by homologous recombination because it is located outside the vector homology region with the mouse Igκ locus. After about a week, colonies of drug-resistant ES cells were physically extracted from their plates after they became visible to the naked eye. These picked colonies are disaggregated, re-plated in microplates, and cultured for several days. Afterwards, each cell clone is divided so that some cells can be frozen for archival material and the rest used for DNA isolation for analytical purposes.
[0293] DNA from ES cell clones was screened by PCR using a widely used gene targeting assay design. For this assay, one PCR oligonucleotide primer sequence was positioned outside the region of shared identity between the 3' vector (905) and the genomic DNA (901), while another PCR oligonucleotide primer sequence was positioned in the new DNA between the two arms of genomic identity in the vector, i.e., the HPRT (945) or neomycin resistance (947) gene. According to the standard design, these assays detect DNA fragments that are only present in ES cell clones derived from transfected cells that have undergone fully normal homologous recombination between the 3' vector (905) and the endogenous mouse Igκ locus. Two separate transfections were performed with the 3' vector (905). PCR positive clones from both transfections were selected for amplification and subsequently further analyzed using a Southern blot assay.
[0294] Southern blot assays are performed according to widely used procedures; the Southern blot includes three probes and genomic DNA digested with a variety of restriction enzymes selected so that the combination of probes and digests allows conclusions to be drawn about the structure of the locus targeted in the clone and whether it has been appropriately modified by homologous recombination. One of the probes maps to a DNA sequence flanking the 5' side of the region of shared identity between the 3'κ targeting vector (905) and the genomic DNA; a second probe also maps outside the region of identity, but on the 3' side; and a third probe maps to new DNA between the two arms of genomic identity in the vector, i.e., in the HPRT (945) or neomycin resistance (947) gene. Southern blots identify the presence of DNA fragments generated by the expected restriction enzymes, corresponding to a portion of the κ locus that has been correctly mutated (i.e., by homologous recombination with the 3'κ targeting vector (905)) as detected by one of the external probes and by the neomycin resistance or HPRT gene probes. The external probes detect mutant fragments and also detect wild-type fragments from the non-mutant copy of the immunoglobulin κ locus on the homologous chromosome.
[0295] The karyotype of the PCR positive clones and the Southern blot positive clones of the ES cell was analyzed using an in situ fluorescence hybridization program designed to distinguish the most common chromosomal aberrations that occur in the mouse ES cell. Clone with such aberration was excluded from further use. The karyoptypically normal clones that were judged to have the correct genomic structure of expection based on the Southern blot data were selected for further use.
[0296] Acceptable clones were then modified with the 5' vector (903) using a procedure and screening assay similar in design to those used with the 3' vector (905), except that puromycin selection was used instead of G418 / neomycin selection, and the protocol was customized to match the genomic region modified by the 5' vector (903). The goal of the 5' vector (903) transfection experiment was to isolate ES cell clones that had been mutated in the desired manner by both the 3' vector (905) and the 5' vector (903), i.e., dually targeted cells carrying both engineered mutations. In these clones, Cre recombinase caused recombination (902) between the loxP sites introduced into the kappa locus by the two vectors, resulting in the genomic DNA configuration shown at 907.
[0297] Furthermore, clones must undergo gene targeting on the same chromosome, as opposed to homologous chromosomes; that is, the engineered mutations generated by the targeting vector must be in cis on the same DNA strand, rather than in trans on separate homologous DNA strands. Clones with cis arrangements are distinguished from clones with trans arrangements by analytical procedures such as fluorescent in situ hybridization of metaphase spreads using probes that hybridize to the new DNA present between the genomically identical arms of the two gene targeting vectors (903 and 905). The two types of clones can also be distinguished from each other by transfecting them with a vector expressing Cre recombinase (which deletes the pu-TK (939), HPRT (945), and neomycin resistance (947) genes if the targeting vector has been integrated in cis) and comparing the number of colonies that survive ganciclovir selection against the thymidine kinase gene introduced by the 5' vector (903) and analyzing the drug resistance phenotype of the surviving clones by a "sib selection" screening procedure in which some cells from the clone are tested for resistance to puromycin or G418 / neomycin. Cells with the cis mutant arrangement are expected to produce approximately 10 more than cells with the trans arrangement. 3 The majority of the resulting cis-derived ganciclovir-resistant clones should also be sensitive to both puromycin and G418 / neomycin, whereas trans-derived ganciclovir-resistant clones should retain resistance to both drugs. Cell clones with cis arrangements of engineered mutations in the kappa chain locus were selected for further use.
[0298] Dual targeted cell clones were transiently transfected (902) with a vector expressing Cre recombinase, and the transfected cells were subsequently placed under ganciclovir selection, as in the analytical experiments summarized above. Ganciclovir-resistant cell clones were isolated and analyzed by PCR and Southern blot for the presence of the expected deletion (907) between the two engineered mutations produced by the 5' vector (903) and the 3' vector (905). In these clones, Cre recombinase has caused recombination to occur between the loxP sites (937) introduced into the κ chain locus by the two vectors. Because the loxP sites are arranged in the same relative orientation in the two vectors, recombination causes the DNA circle comprising the entire genomic interval between the two loxP sites to be excised. This circle does not comprise a replication origin, and therefore is not replicated during mitosis, and therefore is lost from the cell clone when the cell undergoes clonal proliferation. The resulting clones carry the deletion initially located between the two loxP sites. The clones with the expected deletion are selected for further use.
[0299] An ES cell clone carrying a sequence deletion in one of its two homologous copies of the immunoglobulin kappa chain locus is retransfected (904) with a Cre recombinase expression vector together with a DNA fragment (909) comprising a portion of the canine immunoglobulin kappa chain locus comprising V κ (951) and J κ (955) gene segment coding sequence. The key features of this DNA segment (referred to as "KK") are as follows: lox5171 site (931); neomycin resistance gene open reading frame (947, lacking the start methionine codon but in frame and adjacent to the uninterrupted open reading frame in lox5171 site (931)); FRT site (927); 14 canine V κ An array of gene segments (951), each segment having a canine coding sequence embedded in a mouse non-coding sequence; optionally, a J from an adjacent mouse kappa chain locus (not shown) κ A 13.5 kb genomic DNA fragment upstream of the region gene segment cluster; containing five canine J genes embedded in mouse noncoding DNA κ A 2Kb DNA fragment (955) of the region gene segment; a loxP site (937) in the opposite relative direction to the lox5171 site (931).
[0300] Canine V κ and J κ The sequences of the gene coding regions are given in Table 2 .
[0301] In a second independent experiment, an alternative partial canine DNA fragment (909) was used in place of the KK DNA. The key features of this DNA (referred to as "LK") were as follows: lox5171 site (931); a neomycin resistance gene open reading frame (947) that lacked the initiator methionine codon but was in frame and adjacent to the uninterrupted open reading frame in the lox5171 site (931); an FRT site (927); 76 functional canine V λ An array (951) of variable region gene segments, each segment having a canine coding sequence embedded in a mouse non-coding regulatory or scaffold sequence; optionally, a J from a proximal mouse kappa chain locus; κ A 13.5 Kb genomic DNA fragment (not shown) upstream of the region gene segment cluster contains seven canine J genes embedded in mouse noncoding DNA. λ A 2Kb DNA fragment (955) of the region gene segment; a loxP site (937) in the opposite direction to the lox5171 site (931). (The dog has 9 functional J λ region gene segment, however, J λ4and J λ9 and J λ7 and J λ8 The protein coding sequences are identical and therefore only include 7 J λ gene segment.)
[0302] Transfected clones from the KK and LK transfection experiments were placed under G418 selection, which enriched for cell clones that had undergone RMCE, in which a portion of the canine donor DNA (909) was integrated in its entirety into the immunoglobulin kappa chain locus deleted between the lox5171 (931) and loxP (937) sites placed therein by the 5' (903) and 3' (905) vectors, respectively. Only cells that had properly undergone RMCE had the ability to express the neomycin resistance gene (947) because the promoter (929) and start methionine codon (935) required for its expression were not present in the vector (909) and were already pre-existing in the host cell Igh locus (907). The DNA region generated using the KK sequence is shown at 911. The remaining elements from the 5' vector (903) are removed in vitro or in vivo via Flp-mediated recombination (906), resulting in the final canine-based light chain locus as shown at 913.
[0303] G418-resistant ES cell clones were analyzed by PCR and Southern blot to determine whether they had undergone the expected RMCE process without unwanted rearrangements or deletions. Both KK and LK clones with the expected genomic structure were selected for further use.
[0304] K-K ES cell clones and LK ES cell clones carrying partial canine immunoglobulin DNA (913) in the mouse kappa chain locus were microinjected into mouse blastocysts from strain DBA / 2 to produce partial ES cell-derived chimeric mice according to standard procedures. Male chimeric mice with the highest level of ES cell-derived contribution to their fur were selected for mating with female mice. The female mice selected for use in mating were of the C57Bl / 6NTac strain and also carried a transgene encoding the Flp recombinase expressed in their germline. The offspring from these matings were analyzed for the presence of partial canine immunoglobulin kappa or lambda light chain loci and the loss of the neomycin resistance gene flanked by FRTs generated in the RMCE step. Mice carrying partial canine loci were used to establish colonies of KK and LK mice.
[0305] The mouse of carrying part canine heavy chain locus produced as described in embodiment 3 can be bred together with the mouse of carrying the κ chain locus based on canine.Then their offspring are bred together in a scheme, and two of the mouse of final production are all isozygous based on the locus (that is, based on the heavy chain and κ of canine).Such mouse produces the part canine heavy chain with canine variable domains and mouse constant domains.Such mouse also produces the part canine κ albumen with canine κ variable domains and mouse κ constant domains from its κ locus.The monoclonal antibody recovered from these mice has the canine heavy chain variable domains paired with canine κ variable domains.
[0306] A variation of the breeding scheme includes producing mice that are homozygous for a canine-based heavy chain locus but heterozygous at the kappa locus, such that they have a KK canine-based locus on one chromosome and a LK canine-based locus on another chromosome. Such mice produce partial canine heavy chains with canine variable domains and mouse constant domains. Such mice also produce partial canine kappa proteins with canine kappa variable domains and mouse kappa constant domains from one of their kappa loci. From the other kappa locus, such mice produce partial canine lambda proteins with canine lambda variable domains and mouse kappa constant domains. Monoclonal antibodies recovered from these mice have canine variable domains that are paired with canine kappa variable domains in some cases and paired with canine lambda variable domains in other cases.
[0307] Example 5: Introducing engineered portions of canine immunoglobulin loci into the immunoglobulin loci of the mouse genome Protein λ chain locus
[0308] Figure 10 Another method for replacing a portion of the mouse genome with an engineered portion of the canine immunoglobulin locus is shown. The method involves deleting approximately 194 kb of DNA from a wild-type mouse immunoglobulin lambda locus (1001) comprising V λx / V λ2 Gene segment (1013), J λ2 / C λ2 Gene cluster (1015) and V λ1 gene segment (1017), the homologous recombination method involves with V λx / V λ2 Gene segment (1013) upstream and V λ1 Gene segment (1017) is immediately downstream of J λ3 、C λ3 、Jλ1 and C λ1 The λ gene cluster (1023) shares a common locus with the target vector (1003). This vector replaces 194 Kb of DNA with elements designed to allow subsequent site-specific recombination in which the non-native DNA fragment moves to the modified V gene cluster via RMCE (1004). λ In this example, the non-natural DNA is a synthetic nucleic acid comprising both canine and mouse sequences.
[0309] The key features of the gene targeting vector (1003) used to accomplish the 194 Kb deletion are as follows: a negative selection gene, such as the gene encoding the diphtheria toxin A subunit (DTA, 1059) or the herpes simplex virus thymidine kinase gene (not shown); λx / V λ2 4 kb of genomic DNA 5' to the variable region gene segment (1025); an FRT site (1027); a genomic DNA fragment containing the mouse Polr2a gene promoter (1029); a translation initiation sequence (a methionine codon embedded in a "Kozak" consensus sequence) (1035); a mutant loxP recognition sequence for Cre recombinase (lox5171) (1031); a transcription termination / polyadenylation sequence (1033); an open reading frame encoding a protein conferring puromycin resistance (1037), which is located on the antisense strand relative to the Polr2a promoter and the translation initiation sequence immediately adjacent thereto, and is followed by its own transcription termination / polyadenylation sequence (1033). ; a loxP recognition sequence for Cre recombinase (1039); a translation initiation sequence (a methionine codon embedded in a "Kozak" consensus sequence) on the same antisense strand as the puromycin resistance gene open reading frame (1035); a chicken beta-actin promoter and a cytomegalovirus early enhancer element (1041) oriented so that it directs transcription of the puromycin resistance open reading frame, with translation initiating at the start codon downstream of the loxP site and continuing through the loxP site back to the puromycin open reading frame, all on the antisense strand relative to the Polr2a promoter and the translation initiation sequence immediately adjacent thereto; a mutant recognition site for Flp recombinase, designated the "F3" site (1043); and a cytomegalovirus early enhancer element (1041) oriented so that it directs transcription of the puromycin resistance open reading frame. λ3 、C λ3 、J λ1 and C λ1 A genomic DNA fragment upstream of the gene segment (1045).
[0310] Mouse embryonic stem (ES) cells derived from C57Bl / 6NTac mice were transfected (1002) with a targeting vector (1003) by electroporation according to widely used procedures. Homologous recombination replaced native DNA with sequences from the targeting vector (1003) in a 196 kb region, resulting in the genomic DNA configuration depicted at 1005.
[0311] Prior to electroporation, the vector DNA is linearized with a rare-cutting restriction enzyme that only cuts prokaryotic plasmid sequences or the polylinker associated with them. The transfected cells are plated and, after ~24 hours, placed under positive drug selection with puromycin. Negative selection also occurs for cells that have integrated the vector into their DNA, but not through homologous recombination. Non-homologous recombination results in the retention of the DTA gene, which kills cells upon gene expression, while the DTA gene is lost through homologous recombination because it is located outside the vector's region of homology to the mouse IGL locus. Approximately one week later, after colonies of drug-resistant ES cells become visible to the naked eye, colonies of drug-resistant ES cells are physically extracted from their plates. These selected colonies are disaggregated, re-plated in microtiter plates, and cultured for several days. Thereafter, each cell clone is partitioned so that some cells are frozen for archival purposes and the remainder are used to isolate DNA for analytical purposes.
[0312] DNA from ES cell clones was screened by PCR using a widely used gene targeting assay design. For these assays, one PCR oligonucleotide primer sequence is positioned outside the region of shared identity between the targeting vector and the genomic DNA, while the other PCR oligonucleotide primer sequence is positioned in new DNA between the two arms of the vector that share genomic identity, such as the puro gene (1037). According to the standard design, these assays detect DNA fragments that are only present in cell clones derived from transfected cells that have undergone complete, normal homologous recombination between the targeting vector (1003) and the native DNA (1001).
[0313] Six PCR-positive clones from the transfection (1002) were selected for amplification and subsequently further analyzed using a Southern blot assay. The Southern blot included three probes and genomic DNA from the clones that had been digested with a variety of selected restriction enzymes, such that the combination of probes and digests allowed identification of whether the ES cell DNA had been appropriately modified by homologous recombination.
[0314] The karyotypes of six PCR-positive clones and Southern blot-positive clones of ES cells were analyzed using an in situ fluorescence hybridization procedure designed to distinguish the most common chromosomal aberrations occurring in mouse ES cells. Clones showing signs of aberrations were excluded from further use. Karyotypically normal clones judged to have the expected correct genomic structure based on Southern blot data were selected for further use.
[0315] An ES cell clone carrying a deletion in one of its two homologous copies of the immunoglobulin λ chain locus is retransfected (1004) with a Cre recombinase expression vector together with a DNA fragment (1007) comprising a portion of the canine immunoglobulin λ chain locus comprising V λ 、J λ and C λ The key features of this DNA fragment (1007) are as follows: a lox5171 site (1031); a neomycin resistance gene open reading frame (1047) that lacks the start methionine codon but is in frame and contiguous with the uninterrupted open reading frame in the lox5171 site; an FRT site (1027); an array of 76 functional canine lambda region gene segments (1051), each segment having a canine lambda coding sequence embedded in a mouse lambda non-coding sequence; an array of JC units (1055), each unit having a canine JC embedded in a non-coding sequence from the mouse lambda locus λ gene segments and mouse lambda constant domain gene segments (canine J λ The gene segment encodes J λ1 、J λ2 、J λ3 、J λ4 、J λ5 、J λ6 and J λ7 Those gene segments, while the mouse lambda constant domain gene segment is C λ1 or C λ2 or C λ3 ); a mutant recognition site for Flp recombinase, referred to as the "F3" site (1043); an open reading frame conferring hygromycin resistance (1057), which is located on the antisense strand relative to the immunoglobulin gene segment encoding information in the construct; and a loxP site (1039) in the opposite relative orientation to the lox5171 site.
[0316] Canine V λ and J λ The sequences of the gene coding regions are given in Table 3 .
[0317] Transfected clones are placed under G418 or hygromycin selection, which enriches for cell clones that have undergone the RMCE process, wherein a portion of the canine donor DNA is integrated in its entirety into the immunoglobulin lambda chain locus deleted between lox5171 and the loxP site placed there by the gene targeting vector. The remaining elements from the targeting vector (1003) are removed in vitro or in vivo via FLP-mediated recombination (1006), resulting in the final canine-like locus as shown at 1011.
[0318] G418 / hygromycin-resistant ES cell clones were analyzed by PCR and Southern blot to determine whether they had undergone the expected recombinase-mediated cassette exchange process without unwanted rearrangements or deletions. Clones with the expected genomic structure were selected for further use.
[0319] According to standard procedures, ES cell clones carrying partial canine immunoglobulin DNA (1011) in the mouse λ chain locus were microinjected into mouse blastocysts from strain DBA / 2 to produce chimeric mice of partial ES cell origin. Male chimeric mice with the highest level of ES cell-derived contribution to their fur were selected for mating with female mice. The female mice selected here were of the C57B1 / 6NTac strain, which carries a transgene encoding the Flp recombinase expressed in its germline. The offspring from these matings were analyzed for the presence of the partial canine immunoglobulin λ chain locus and the loss of the neomycin resistance gene flanked by FRT and the hygromycin resistance gene flanked by F3 generated in the RMCE step. Mice carrying the partial canine locus were used to establish mouse colonies.
[0320] In some aspects, the mouse (as described in Example 3 and 4) comprising a heavy chain and κ locus based on canines is bred to carry a mouse based on the lambda locus of canines. The mouse produced from this type of breeding scheme is homozygous for the heavy chain locus based on canines, and KK can be homozygous based on the locus of canines or LK can be homozygous based on the locus of canines. Alternatively, they can be heterozygous at the κ locus, carry the KK locus on a chromosome, and carry the LK locus on another chromosome. Each of these mouse strains is homozygous based on the lambda locus of canines. The monoclonal antibody recovered from these mice has the canine heavy chain variable domains that are paired with canine κ variable domains in some cases and paired with canine lambda variable domains in other cases. The lambda variable domains derive from the LK locus based on canines or the lambda locus based on canines.
[0321] Example 6: Introduction of an engineered partial canine immunoglobulin miniloci into the mouse genome
[0322] In certain other aspects, the portion of the canine immunoglobulin locus comprises a canine variable domain miniloci, such as Figure 11 Here, rather than being a portion of the canine immunoglobulin locus comprising all or substantially all of the canine V H gene segment coding sequence, but the mouse immunoglobulin locus is comprised of fewer chimeric canine V H Gene segments (e.g., 1-39 canine V H The gene segment was replaced by a minilocus (1119) that was determined to be functional; that is, not a pseudogene).
[0323] A site-specific targeting vector (1131) comprising a portion of a canine immunoglobulin locus to be integrated into the mammalian host genome is introduced (1102) into a genomic region (1101), wherein the deleted endogenous immunoglobulin locus comprises a puro-TK gene (1105) and the following sequence-specific recombination sites flanking it: a mutant FRT site (1109), a mutant LoxP site (1111), a wild-type FRT site (1107), and a wild-type LoxP site (1105). The site-specific targeting vector comprises i) an array of optional PAIR elements (1141); ii) a sequence-specific recombination vector comprising, for example, 1-39 functional canine V H The coding region and the intervening sequence based on the mouse genome endogenous sequence V H locus (1119); iii) a 21.6 kb pre-D region (1121) containing mouse sequences; iv) a 6 D and 6 J H Canine coding sequence and intervening sequence based on the mouse genome endogenous sequence D locus (1123) and J H Locus (1125). The partial canine immunoglobulin locus is flanked by recombination sites that allow recombination with the modified endogenous locus: mutant FRT (1109), mutant LoxP (1111), wild-type FRT (1107), and wild-type loxP (1105). After introduction of an appropriate recombinase, such as Cre (1104), the partial canine immunoglobulin locus is integrated into the genome upstream of the constant gene region (1127), as shown at 1129.
[0324] Primary screening for the introduction of portions of the canine immunoglobulin variable region loci was performed by primary PCR screening supported by secondary Southern blot analysis as described in Example 1. Deletion of the puro-TK gene (1105) as part of the recombination event allowed the use of ganciclovir negative selection to identify cells that had not undergone the recombination event.
[0325] Example 7: Introduction of Canine Lambda Variable Region Coding Sequences Embedded in Kappa Immunoglobulin Non-Coding Sequences Engineered partial canine immunoglobulin loci with mouse lambda constant region sequences
[0326] Canine antibodies mostly contain λ light chains, while mouse antibodies mostly contain κ light chains. To increase the production of antibodies containing λ LC, endogenous mouse V κ and J κ Replaced with a partial canine locus containing an inserted mouse V κ V region flanking and regulatory sequences λ and J λ gene segment coding sequence, i.e., the LK mouse of Example 4. In such mice, endogenous regulatory sequences that promote high-level rearrangement and expression of the κ locus are predicted to have an equivalent effect on the ectopic λ locus. However, in vitro studies have shown that canine V λ domain to mouse C κ Therefore, the expected increase in antibodies containing λLC in LK mice may not occur. As an alternative strategy, endogenous mouse V κ and J κ Replaced with a partial canine locus containing an inserted mouse V κ V in the flanking region and regulatory sequences λ and J λ gene segment coding sequence, and mouse C κ Using mice C λ replace.
[0327] Figure 13 is a schematic diagram illustrating the introduction of an engineered portion of a canine light chain variable region locus, wherein one or more canine V λ The gene segment coding sequence is inserted into one or more canine J λ In the rodent immunoglobulin kappa light chain locus upstream of the gene segment coding sequence, the one or more canine J λ The gene segment coding sequence is located in one or more rodent C λ upstream of the coding sequence.
[0328] Figure 13 The method of replacing a portion of the mouse genome with a portion of the canine immunoglobulin locus is shown. The method includes introducing a first site-specific recombinase recognition sequence into the mouse genome, and then introducing a second site-specific recombinase recognition sequence into the mouse genome. The first site-specific recombinase recognition sequence can be introduced into the endogenous V κ (1315) and J κ (1319) region gene segment and C κ(1321) 5' or 3' of the cluster of exons, the second site-specific recombinase recognition sequence combined with the first sequence-specific recombination site is located at the position comprising V κ and J κ Gene segments and C κ The entire locus is flanked by a cluster of exons. The flanking regions are deleted and then replaced with portions of the canine immunoglobulin locus using the relevant site-specific recombinases, as described herein.
[0329] For use in V κ (1315) gene segment and C κ The targeting vector that introduces the site-specific recombination sequence on either side of exon (1321) also contains an additional site-specific recombination sequence that has been modified so that it is still effectively recognized by the recombinase but does not recombine with the unmodified site. The site is located in the targeting vector so that in V κ and J κ Gene segment clusters and C κ After exon deletion, it can be used to introduce non-native DNA fragments into modified V κ In this example, the non-natural DNA is a canine V gene embedded in the mouse IGK regulatory and flanking sequences. λ and J λ Gene segment coding sequence and one or more mouse C λ Synthetic nucleic acid of exons.
[0330] Two gene targeting vectors were constructed to accomplish the method just outlined. One of the vectors (1303) contained a κ The other vector (1305) contains mouse genomic DNA taken from the locus spanning C κ Mouse genomic DNA within the locus in the regions upstream (5') and downstream (3') of exon (1321).
[0331] The key features of the 5' vector (1303) are as follows: a gene encoding the diphtheria toxin A (DTA) subunit under the transcriptional control of a modified herpes simplex virus type I thymidine kinase gene promoter coupled to two mutant transcription enhancers from polyoma virus (1323); 6 kb of mouse genomic DNA located upstream of the most distal variable region gene in the kappa chain locus (1325); an FRT recognition sequence for Flp recombinase (1327); a genomic DNA fragment containing the mouse Polr2a gene promoter (1329); a translation initiation sequence (1335, a methionine amino acid embedded in a "Kozak" consensus sequence); codon); a mutant loxP recognition sequence for Cre recombinase (lox5171) (1331); a transcription termination / polyadenylation sequence (1333); a loxP recognition sequence for Cre recombinase (1337); a gene encoding a fusion protein having a puromycin resistance-conferring protein fused to a truncated form of thymidine kinase (pu-TK) under the transcriptional control of a promoter from the mouse phosphoglycerate kinase 1 gene (1339); and 2.5 Kb of mouse genomic DNA positioned adjacent to a 6 Kb sequence arranged in a native, opposite orientation at the 5' end of the vector (1341).
[0332] The main features of the 3' vector (1305) are as follows: κ 6 Kb of mouse genomic DNA (1343) positioned within the locus in the regions upstream (5') and downstream (3') of the exon; a gene encoding human hypoxanthine-guanine phosphoribosyltransferase (HPRT) under the transcriptional control of the mouse Polr2a gene promoter (1345); a neomycin resistance gene (1347) under the control of the mouse phosphoglycerate kinase 1 gene promoter; a loxP recognition sequence for Cre recombinase (1337); 3.6 Kb of mouse genomic DNA (1349) positioned genomically downstream of the 6 Kb DNA fragment contained at the 5' end of the vector, wherein the two fragments are oriented in the same relative manner as in the mouse genome; a gene encoding the diphtheria toxin A (DTA) subunit under the transcriptional control of a modified herpes simplex virus type 1 thymidine kinase gene promoter coupled to two mutant transcription enhancers from a polyoma virus (1323).
[0333] One strategy to delete the endogenous mouse IGK locus is to insert the 3' vector (1305) into the mouse C κ However, the 3'κ enhancer that needs to be retained in the modified locus is located at C κ The exon is 9.1 kb downstream, which is too short to accommodate the upstream and downstream homology arms of the 3' vector (9.6 kb in total). Therefore, the upstream region of homology was extended.
[0334] According to a widely used procedure, mouse embryonic stem (ES) cells derived from C57Bl / 6NTac mice were transfected with 3' vectors (1305) by electroporation. Prior to electroporation, the vector DNA was linearized with a rare-cutting restriction enzyme that only cuts the prokaryotic plasmid sequence or the polylinker associated therewith. The transfected cells were plated and, after ~24 hours, placed under a positive selection of cells that had integrated the 3' vector into their DNA using the neomycin analog drug G418. There was also a negative selection for cells that had integrated the vector into their DNA but that had not been integrated by homologous recombination. Non-homologous recombination retains the DTA gene, which kills cells when the gene is expressed, but is deleted by homologous recombination because it is located outside the vector homology region to the mouse Igκ locus. About a week later, after the colonies of drug-resistant ES cells were visible to the naked eye, the colonies of drug-resistant ES cells were physically extracted from their plates. These colonies are disaggregated, re-plated in microplates, and cultured for several days. Afterwards, each cell clone is divided, some cells are frozen for archival material, and the rest are used to isolate DNA for analytical purposes.
[0335] DNA from ES cell clones was screened by PCR using a widely used gene targeting assay design. For this assay, one PCR oligonucleotide primer sequence was positioned outside the region of shared identity between the 3' vector (1305) and the genomic DNA (1301), while another PCR oligonucleotide primer sequence was positioned in the new DNA between the two arms of genomic identity in the vector, i.e., the HPRT (1345) or neomycin resistance (1347) gene. According to the standard design, these assays detect DNA fragments that are only present in ES cell clones derived from transfected cells that have undergone fully normal homologous recombination between the 3' vector (1305) and the endogenous mouse Igκ locus. Two separate transfections were performed with the 3' vector (1305). PCR positive clones from both transfections were selected for amplification and subsequently further analyzed using a Southern blot assay.
[0336] Southern blot assays are performed according to widely used procedures using three probes and genomic DNA digested with a variety of selected restriction enzymes, so that the combination of probes and digests allows conclusions to be drawn about the structure of the locus targeted in the clone and whether it has been appropriately modified by homologous recombination. The first probe maps to DNA sequences flanking the 5' side of the region of shared identity between the 3'κ targeting vector (1305) and the genomic DNA; the second probe also maps outside the region of identity, but on the 3' side; and the third probe maps to new DNA between the two arms with genomic identity in the vector, i.e., in the HPRT (1345) or neomycin resistance (1347) gene. Southern blots identify the presence of DNA fragments generated by the expected restriction enzymes, corresponding to a portion of the κ locus that has been correctly mutated (i.e., by homologous recombination using the 3'κ targeting vector (1305)) as detected by one of the external probes and by the neomycin resistance or HPRT gene probes. The external probes detect mutant fragments and also detect wild-type fragments from the non-mutant copy of the immunoglobulin κ locus on the homologous chromosome.
[0337] The karyotypes of PCR-positive clones and Southern blot-positive clones of ES cells were analyzed using an in situ fluorescence hybridization procedure designed to distinguish the most common chromosomal aberrations that occur in mouse ES cells. Clones with such aberrations were excluded from further use. Normal clones with the correct karyotype structure that were judged to have the expected structure based on Southern blot data were selected for further use.
[0338] Acceptable clones were then modified with the 5' vector (1303) using a procedure and screening assay similar in design to those used with the 3' vector (1305), except that puromycin selection was used instead of G418 / neomycin selection, and the protocol was customized to match the genomic region modified by the 5' vector (1303). The goal of the 5' vector (1303) transfection experiment was to isolate ES cell clones that had been mutated in the desired manner by both the 3' vector (1305) and the 5' vector (1303), i.e., dual-targeted cells carrying both engineered mutations. In these clones, Cre recombinase caused recombination (1302) between the loxP sites introduced into the κ locus by the two vectors, resulting in the genomic DNA configuration shown at 1307.
[0339] Furthermore, clones must undergo gene targeting on the same chromosome, as opposed to homologous chromosomes; that is, the engineered mutations generated by the targeting vector must be in cis on the same DNA strand, rather than in trans on separate homologous DNA strands. Clones with cis arrangements are distinguished from clones with trans arrangements by analytical procedures such as fluorescent in situ hybridization of metaphase spreads using probes that hybridize to the new DNA present between the arms of the two gene targeting vectors (1303 and 1305) that share their genomic identity. The two types of clones can also be distinguished from each other by transfecting them with a vector expressing Cre recombinase (which deletes the pu-TK (1339), HPRT (1345), and neomycin resistance (1347) genes if the targeting vector has been integrated in cis) and comparing the number of colonies that survive ganciclovir selection against the thymidine kinase gene introduced by the 5' vector (1303) and analyzing the drug resistance phenotype of the surviving clones by a "sib selection" screening procedure in which some cells from the clone are tested for resistance to puromycin or G418 / neomycin. Cells with the cis mutant arrangement are expected to produce approximately 10 more than cells with the trans arrangement. 3 The majority of the resulting cis-derived ganciclovir-resistant clones should also be sensitive to both puromycin and G418 / neomycin, whereas trans-derived ganciclovir-resistant clones should retain resistance to both drugs. Cell clones with cis arrangements of engineered mutations in the kappa chain locus were selected for further use.
[0340] Dual-targeted cell clones are transiently transfected (1302) with a vector expressing Cre recombinase, and subsequently the transfected cells are placed under ganciclovir selection, as in the analytical experiments summarized above. Ganciclovir-resistant cell clones are isolated, and the presence of the expected deletion (1307) between two engineered mutations produced by 5' vectors (1303) and 3' vectors (1305) is detected by PCR and Southern blot analysis. In these clones, Cre recombinase causes recombination between the loxP sites (1337) introduced into the κ chain locus by two vectors. Because the loxP sites are arranged in identical relative orientations in the two vectors, recombination causes the DNA circle comprising the entire genome interval between the two loxP sites to be excised. This circle does not comprise a replication origin, and is therefore not replicated during mitosis, and is therefore lost from the cell clone when the cell undergoes clonal proliferation. The clones of gained carry the DNA deletion initially located between the two loxP sites, and have the genomic structure shown in 1307. The clones selected with expected deletion are used for further use.
[0341] An ES cell clone carrying a sequence deletion in one of its two homologous copies of the immunoglobulin kappa chain locus is retransfected (1304) with a Cre recombinase expression vector together with a DNA fragment (1309) comprising a portion of the canine immunoglobulin lambda chain locus comprising V λ (1351) and J λ (1355) gene segment coding sequence and one or more mouse C λ Exon (1357). The key features of this DNA fragment are as follows: lox5171 site (1331); neomycin resistance gene open reading frame (1347, lacking the start methionine codon but in frame and adjacent to the uninterrupted open reading frame in lox5171 site (1331)); FRT site (1327); 1-76 functional canine V λ An array (1351) of variable region gene segments, each segment having a canine coding sequence embedded in a mouse non-coding regulatory or scaffold sequence; optionally, a J from a proximal mouse kappa chain locus; κ A 13.5 Kb genomic DNA fragment (not shown) upstream of the region gene segment cluster contains an embedded mouse noncoding DNA (1355) and one or more mouse C λ Canine J in exons 1-7 (1357) λ A 2Kb DNA fragment containing a region of the gene segment; a loxP site (1337) in the opposite direction to the lox5171 site (1331). The DNA fragment also contains the deleted iE κ (not shown).
[0342] Canine V λ and J λ The sequences of the gene coding regions are given in Table 3 .
[0343] The transfected cells were placed under G418 selection, which enriched for cell clones that had undergone RMCE, in which a portion of the canine donor DNA (1309) was integrated in its entirety into the immunoglobulin kappa chain locus deleted between the lox5171 (1331) and loxP (1337) sites placed there by the 5' (1303) and 3' (1305) vectors, respectively. Only cells that had properly undergone RMCE had the ability to express the neomycin resistance gene (1347) because the promoter (1329) and start methionine codon (1335) required for its expression were not present in the vector (1309) and were already pre-existing in the host cell IGK locus (1307). The DNA region resulting from RMCE is shown at 1311. The remaining elements from the 5′ vector ( 1303 ) are removed in vitro or in vivo via Flp-mediated recombination ( 1306 ), resulting in the final canine-based light chain locus as shown at 1313 .
[0344] G418-resistant ES cell clones were analyzed by PCR and Southern blotting to determine whether they had undergone the expected RMCE process without unwanted rearrangements or deletions. Clones with the expected genomic structure were selected for further use.
[0345] According to standard procedures, clones carrying partial canine immunoglobulin DNA in the mouse kappa chain locus (1313) were microinjected into mouse blastocysts from strain DBA / 2 to produce chimeric mice of partial ES cell origin. Male chimeric mice with the highest level of ES cell-derived contribution to their fur were selected for mating with female mice. The female mice selected for use in mating were of the C57B1 / 6NTac strain and also carried a transgene encoding the Flp recombinase expressed in their germline. The offspring from these matings were analyzed for the presence of the partial canine immunoglobulin lambda light chain locus and the loss of the neomycin resistance gene flanked by FRT generated in the RMCE step. Mice carrying partial canine loci were used to establish colonies of mice.
[0346] The mice that carry part canine heavy chain locus produced as described in Example 3 can be bred together with the mice that carry the κ chain locus based on canine lambda.Then their offspring are bred together in a scheme, and two of the mice that are finally produced are all isozygous for canine locus (that is, based on canine heavy chain and based on lambda lambda).Such mice produce part canine heavy chain with canine variable domains and mouse constant domains.Such mice also produce part canine lambda albumen with canine lambda variable domains and mouse lambda constant domains from its κ locus.The monoclonal antibodies recovered from these mice have canine heavy chain variable domains paired with canine lambda variable domains.
[0347] A variation of the breeding scheme involves producing mice that are homozygous for a canine-based heavy chain locus but heterozygous at the kappa locus, such that on one chromosome they have the KK canine-based locus described in Example 4 and on another chromosome they have a partial canine lambda-based kappa locus described in this example. Such mice produce partial canine heavy chains with canine variable domains and mouse constant domains. Such mice also produce partial canine kappa proteins with canine kappa variable domains and mouse kappa constant domains from one of their kappa loci. From the other kappa locus, partial canine lambda proteins comprising canine lambda variable domains and mouse lambda constant domains are produced. Monoclonal antibodies recovered from these mice include canine variable domains paired with canine kappa variable domains in some cases and with canine lambda variable domains in other cases.
[0348] Example 8. Introduction of canine lambda variable region coding sequences with embedded mouse kappa immunoglobulin noncoding sequences Arrayed with engineered portions of the canine immunoglobulin locus with mouse lambda constant region sequences
[0349] This example describes an alternative strategy to Example 7, in which endogenous mouse V κ and J κ Replaced with a partial canine locus containing an inserted mouse V κ Canine V λ and J λ gene segment coding sequence, and mouse C κ Using mice C λ However, in this embodiment, the structure of the targeting vector comprising a portion of the canine locus is different. The canine V locus coding sequence comprises a functional V locus located between 1 and 76 positions. λ Array anywhere in the gene segment coding sequence, followed by J λ -C λ Serial box array, where J λ It is of canine origin, and C λ Of mouse origin, such as C λ1 、C λ2 or C λ3 The number of cassettes ranged from one to seven unique functional canine J λ The overall structure of the partial canine λ locus in this example is similar to the endogenous mouse λ locus, while the structure of the locus in Example 7 is similar to the endogenous mouse κ locus, which was replaced by the partial canine λ locus in this example.
[0350] Figure 14is a schematic diagram illustrating the introduction of an engineered portion of a canine light chain variable region locus, wherein one or more canine V λ The gene segment coding sequence was inserted into the J λ -C λ Tandem cassette array upstream of the rodent immunoglobulin kappa light chain locus, where J λ of canine origin, and C λ From mouse sources, e.g., C λ1 、C λ2 or C λ3 .
[0351] Figure 14 The method for replacing a portion of the mouse genome with a portion of the canine immunoglobulin locus is illustrated. The method provides for introducing a first site-specific recombinase recognition sequence into the mouse genome, followed by introducing a second site-specific recombinase recognition sequence into the mouse genome. The first site-specific recombinase recognition sequence can be introduced into the endogenous V κ (1415) and J κ (1419) region gene segment and C κ (1421) 5' or 3' of the cluster of exons, the second site-specific recombinase recognition sequence combined with the first sequence-specific recombination site is located at the position comprising V κ and J κ Gene segments and C κ The entire locus is flanked by a cluster of exons. The flanking regions are deleted and then replaced with portions of the canine immunoglobulin locus using the relevant site-specific recombinases, as described herein.
[0352] For use in V κ (1415) gene segment and C κ The targeting vector that introduces the site-specific recombination sequence on either side of exon (1421) also contains an additional site-specific recombination sequence that has been modified so that it is still effectively recognized by the recombinase but does not recombine with the unmodified site. The site is located in the targeting vector so that in V κ and J κ Gene segment clusters and C κ After exon deletion, it can be used to introduce non-native DNA fragments into modified V κ In this embodiment, the non-natural DNA is a canine V λ Gene segment coding sequence array and J λ -C λ Synthetic nucleic acid of tandem cassette array, where J λIt is of canine origin, and C λ Of mouse origin, such as C embedded in the mouse IGK regulatory and flanking sequences λ1 、C λ2 or C λ3 .
[0353] Two gene targeting vectors were constructed to accomplish the method just outlined. One of the vectors (1403) contained a κ The other vector (1405) contains mouse genomic DNA taken from the locus spanning C κ Mouse genomic DNA within the locus in the regions upstream (5') and downstream (3') of exon (1421).
[0354] Key features of the 5' vector (1403) and the 3' vector (1405) are described in Example 7.
[0355] Mouse embryonic stem (ES) cells derived from C57Bl / 6NTac mice were transfected with the 3' vector (1405) by electroporation according to a widely used procedure as described in Example 7. DNA from ES cell clones was screened by PCR using a widely used gene targeting assay as described in Example 7. Southern blot assays were performed according to a widely used procedure as described in Example 7.
[0356] The karyotypes of PCR-positive clones and Southern blot-positive clones of ES cells were analyzed using an in situ fluorescence hybridization procedure designed to distinguish the most common chromosomal aberrations that occur in mouse ES cells. Clones with such aberrations were excluded from further use. Normal clones with the correct karyotype structure that were judged to have the expected structure based on Southern blot data were selected for further use.
[0357] Acceptable clones were modified with the 5' vector (1403) using the procedures and screening assays described in Example 7. The resulting correctly targeted ES clones had a genomic DNA configuration of the endogenous kappa locus, with the 5' vector (1403) inserted into the endogenous V κ gene segment, and the 3' vector (1405) is inserted into the endogenous C κ In these clones, Cre recombinase causes recombination between the loxP sites introduced into the κ locus by the two vectors (1402), resulting in the genomic DNA configuration shown at 1407.
[0358] In contrast to homologous chromosomes, acceptable clones undergo gene targeting on the same chromosome; such that the engineered mutations generated by the targeting vector are in cis on the same DNA strand, rather than in trans on separate homologous DNA strands. Clones with cis arrangement are distinguished from those with trans arrangement by analytical procedures as described in Example 7.
[0359] Dual-targeted cell clones were transiently transfected (1402) with a vector expressing Cre recombinase, and subsequently the transfected cells were placed under ganciclovir selection and analyzed using the program described in Example 7. In the clone selected, Cre recombinase has caused recombination between the loxP sites (1437) introduced into the κ chain locus by two vectors. Because the loxP sites are arranged in identical relative orientations in the two vectors, recombination causes the DNA circle comprising the entire genome interval between the two loxP sites to be excised. This circle does not comprise a replication origin, and is therefore not replicated during mitosis, and is therefore lost from cell clones when cell experience clonal proliferation. The clones of gained carry the DNA deletion initially located between the two loxP sites, and have the genomic structure shown in 1407. The clones selected with expected deletions are used for further use.
[0360] An ES cell clone carrying a sequence deletion in one of its two homologous copies of the immunoglobulin kappa chain locus is retransfected (1404) with a Cre recombinase expression vector together with a DNA fragment (1409) comprising a portion of the canine immunoglobulin lambda chain locus comprising V embedded within mouse IGK flanking and regulatory DNA sequences (1457). λ (1451) segment coding sequence and Canis j λ Gene segment coding sequence and one or more mouse C λ Tandem cassette array of exons. The key features of this DNA fragment are as follows: lox5171 site (1431); neomycin resistance gene open reading frame (1447, lacking the start methionine codon but in frame and adjacent to the uninterrupted open reading frame in lox5171 site (1431)); FRT site (1427); 1-76 functional canine V λ An array of variable region gene segments (1451), each segment comprising a canine coding sequence embedded in a mouse non-coding regulatory or scaffold sequence; optionally, a J from a mouse kappa chain locus adjacent to the J κ A 13.5 kb genomic DNA fragment (not shown) upstream of the region gene segment cluster contains the canine J embedded in the mouse IGK flanking and regulatory DNA sequences. λ Gene segment coding sequence and one or more mouse C λDNA of a tandem cassette array of exons (1457); loxP site (1437) in the opposite relative orientation to lox5171 site (1431).
[0361] Canine V λ and J λ The sequences of the gene coding regions are given in Table 3 .
[0362] The transfected cells were placed under G418 selection, which enriched for cell clones that had undergone RMCE, in which a portion of the canine donor DNA (1409) was integrated in its entirety into the immunoglobulin kappa chain locus deleted between the lox5171 (1431) and loxP (1437) sites placed there by the 5' (1403) and 3' (1405) vectors, respectively. Only cells that properly underwent RMCE had the ability to express the neomycin resistance gene (1447) because the promoter (1429) and start methionine codon (1435) required for its expression were not present in the vector (1409) and were already pre-existing in the host cell IGK locus (1407). The DNA region generated by RMCE is shown at 1411. The remaining elements from the 5′ vector ( 1403 ) are removed in vitro or in vivo via Flp-mediated recombination ( 1406 ), resulting in the final canine-based light chain locus as shown at 1413 .
[0363] G418-resistant ES cell clones were analyzed by PCR and Southern blotting to determine whether they had undergone the expected RMCE process without unwanted rearrangements or deletions. Clones with the expected genomic structure were selected for further use.
[0364] According to standard procedures, clones carrying partial canine immunoglobulin DNA in the mouse kappa chain locus (1413) were microinjected into mouse blastocysts from strain DBA / 2 to produce chimeric mice of partial ES cell origin. Male chimeric mice with the highest level of ES cell-derived contribution to their fur were selected for mating with female mice. The female mice selected for use in mating were of the C57B1 / 6NTac strain and also carried a transgene encoding the Flp recombinase expressed in their germline. The offspring from these matings were analyzed for the presence of the partial canine immunoglobulin lambda light chain locus and the loss of the neomycin resistance gene flanked by FRT generated in the RMCE step. Mice carrying the partial canine locus were used to establish colonies of mice.
[0365] The mice of carrying part canine heavy chain locus produced as described in Example 3 can be bred together with the mice of carrying the κ chain locus based on canine lambda.Then their offspring are bred together in a scheme, and two of the mice finally produced are all isozygous for the locus based on canine (that is, based on the heavy chain of canine and based on lambda κ).Such mice produce part canine heavy chain with canine variable domains and mouse constant domains.Such mice also produce part canine lambda albumen with canine lambda variable domains and mouse lambda constant domains from its κ locus.The monoclonal antibodies recovered from these mice have the canine heavy chain variable domains paired with canine lambda variable domains.
[0366] A variation of the breeding scheme involves generating mice that are homozygous for a canine-based heavy chain locus but heterozygous for the kappa locus, such that on one chromosome they have the canine-based KK locus described in Example 4 and on another chromosome they have a partial canine lambda-based kappa locus described in this example. Such mice produce partial canine heavy chains with canine variable domains and mouse constant domains. Such mice also produce partial canine kappa proteins with canine kappa variable domains and mouse kappa constant domains from one of their kappa loci. From the other kappa locus, such mice produce partial canine lambda proteins with canine lambda variable domains and mouse lambda constant domains. Monoclonal antibodies recovered from these mice have canine variable domains paired with canine kappa variable domains in some cases and with canine lambda variable domains in other cases.
[0367] The methods described above for introducing engineered portions of the canine immunoglobulin locus include mouse C κ The engineered portion of the canine immunoglobulin locus has canine lambda variable region coding sequences and mouse lambda constant region sequences embedded in mouse kappa immunoglobulin noncoding sequences. Alternative approaches include making the C κExon inactivation. Introns must be removed from primary mRNA transcripts by a process called RNA splicing, in which the macromolecular machine spliceosome located in the nucleus recognizes the sequences at the 5' (splice donor) and 3' (splice acceptor) ends of the intron and other features of the intron, including the polypyrimidine region located immediately upstream of the splice acceptor. The splice donor sequence in DNA is NGT, where "N" is any deoxynucleotide, and the splice acceptor is AGN (Cech TR, Steitz JA, and Atkins JF, eds. (2019) (RNA Worlds: New Tools for Deep Exploration, CSHL Press) ISBN 978-1-621822-24-0).
[0368] Mouse C κ Exons are inactivated by mutations in their splice acceptor sequences and polypyrimidine tracts. κ The wild-type sequence upstream of the exon is CTTCCTCTC AG (SEQ ID NO: 470) (The splice acceptor site is underlined). It is mutated to AAA TTAATTAA CC (SEQ ID NO: 471), resulting in a non-functional splice acceptor site and thus a non-functional C κ exon. The mutant sequence also incorporates a PacI restriction enzyme site (underlined). This restriction site, an eight base pair recognition sequence, is expected to be rare in the mouse genome (~ every 65,000 bp), making it simple to detect whether the mutant sequence has been inserted into the IGK site by Southern blot analysis of ES cell DNA that has been digested with PacI and another more commonly cutting restriction enzyme. The wild-type sequence is replaced by the mutant sequence by homologous recombination, a technique widely known in the art for inserting 3' RMCE vectors. κ The key features of the homologous recombination vector (MSA, 1457) for exon splice acceptor sequence and polypyrimidine tract mutation are as follows: 6Kb mouse genomic DNA (1443) spanning C κ It is located within the kappa locus in the regions upstream (5') and downstream (3') of exon (1421) and is located immediately adjacent to C in its natural position. κupstream of the exon containing the mutant AAATTAATTAACC (SEQ ID NO:471) (1459) sequence instead of the wild-type CTTCCTTCCTCAG (SEQ ID NO:470) sequence; a neomycin resistance gene under the control of the mouse phosphoglycerate kinase 1 gene promoter (1447) and flanked by mutant FRT sites (1461); 3.6 Kb of mouse genomic DNA (1449) positioned immediately downstream of the genome of a 6 Kb DNA fragment contained at the 5' end of the vector, with the two fragments oriented in the same relative manner as in the mouse genome; a gene encoding the diphtheria toxin A (DTA) subunit under the transcriptional control of a modified herpes simplex virus type 1 thymidine kinase gene promoter coupled to two mutant transcription enhancers from a polyoma virus (1423). Mutant FRT sites (1461), e.g., FRT F3 or FRT F5 (Schlake and Bode (1994) Use of mutated FLP recognition target (FRT) sites for the exchange of expression cassettes at defined chromosomalloci. Biochemistry 33:12746-12751 PMID:7947678 DOI:10.1021 / bi00209a003) are used here because after the splicing mutations are introduced and the Neo gene is deleted by transient transfection of a FLP recombinase expression vector (1406), the ES cells undergo further genetic manipulation. This process requires the wild-type FRT site to delete another Neo selection gene (1447 at 1403). If the FRT site (1461) that remained in the IGK locus (1469) after the introduction of the splicing mutation was wild-type, the attempted FRT-mediated deletion of the second Neo gene (1406 at 1413) could inadvertently result in the deletion of the entire newly introduced partial canine locus and the mouse C κ Exon inactivation.
[0369] According to a widely used procedure, mouse embryonic stem (ES) cells derived from C57Bl / 6NTac mice are transfected with MSA vectors (1457) by electroporation. Prior to electroporation, the vector DNA is linearized with a rare-cutting restriction enzyme that only cuts the prokaryotic plasmid sequence or the polylinker associated therewith. The transfected cells are plated and, after ~24 hours, placed under a positive selection of cells that have integrated the MSA vector into their DNA using the neomycin analog drug G418. There is also a negative selection for cells that have integrated the vector into their DNA but have not integrated by homologous recombination. Non-homologous recombination results in the retention of the DTA gene, which kills cells when the gene is expressed, and the DTA gene is deleted by homologous recombination because it is located outside the vector homology region with the mouse IGK locus. About a week later, after the colonies of drug-resistant ES cells become visible to the naked eye, the colonies of drug-resistant ES cells are physically extracted from their plates. These picked colonies are disaggregated, re-plated in microplates, and cultured for several days. Afterwards, each cell clone is divided so that some cells are frozen as archival material and the rest are used for DNA isolation for analytical purposes.
[0370] The IGK locus in ES cells correctly targeted by homologous recombination has the 1463 depicted configuration.
[0371] DNA from ES cell clones is screened by PCR using a widely used gene targeting assay design. For this assay, a PCR oligonucleotide primer sequence is positioned outside the region of total identity between the MSA vector (1457) and the genomic DNA (1401), while another PCR oligonucleotide primer sequence is positioned in the new DNA between the two arms of genomic identity in the vector, i.e., or in the neomycin resistance (1447) gene. According to standard design, these assays detect DNA fragments that are only present in ES cell clones derived from transfected cells, which have undergone completely normal homologous recombination between the MSA vector (1457) and the endogenous mouse IGK locus. Two independent transfections are carried out with the MSA vector (1457). PCR positive clones from the two transfections are selected for amplification and subsequently further analyzed using Southern blotting.
[0372] Southern blot analysis is performed according to a widely used procedure using three probes and genomic DNA digested with a variety of selected restriction enzymes, so that the combination of probes and digests allows conclusions to be drawn about the structure of the locus targeted in the clone and whether it has been appropriately modified by homologous recombination. In this particular example, the DNA is doubly digested with PacI and another restriction enzyme such as EcoRI or HindIII, because only cells with integrated MSA vectors contain PacI sites. The first probe maps to DNA sequences flanking the 5' side of the region of shared identity between the MSA vector (1457) and the genomic DNA; the second probe also maps outside the region of identity, but on the 3' side; and the third probe maps to new DNA between the two arms of genomic identity in the vector, i.e., in the neomycin resistance (1447) gene. Southern blots identify the presence of DNA fragments generated by the expected restriction enzymes, which correspond to a portion of the κ locus that has been correctly mutated (i.e., by homologous recombination using the MSA κ targeting vector (1457)) as detected by one of the external probes and by the neomycin resistance gene probe. The external probe detects the mutant fragment and also detects the wild-type fragment from the non-mutant copy of the immunoglobulin kappa locus on the homologous chromosome. Southern blot assays were performed according to the widely used procedure described in Example 7.
[0373] The karyotypes of PCR-positive clones and Southern blot-positive clones of ES cells were analyzed using an in situ fluorescence hybridization procedure designed to distinguish the most common chromosomal aberrations that occur in mouse ES cells. Clones with such aberrations were excluded from further use. Normal clones with the correct karyotype structure that were judged to have the expected structure based on Southern blot data were selected for further use.
[0374] Although the ability of ES cell DNA to be digested by PacI in the mutant IGK allele confirmed the presence of the TTAATTAA sequence, a C-focused κ DNA sequencing of the region upstream of the exon was performed to confirm the presence of the fully anticipated splice mutation. This region was amplified by genomic PCR using primers flanking the mutation [1465 and 1467 (Table 6: SEQ ID NO: 417 and SEQ ID NO: 418)]. Alternative primer pairs are shown in SEQ ID NO: 419 and SEQ ID NO: 420. These primers were designed using NCBI Primer-Blast and verified in silico to lack any predicted off-target binding sites in the mouse genome.
[0375] Sequence-verified ES cell clones were transiently transfected with a FLP recombinase expression vector (1406) to delete the neomycin resistance gene (1427). The cells were then subcloned, and the deletion was confirmed by PCR. The IGK locus in ES cells has the genomic configuration depicted at 1469.
[0376] ES cells were electroporated with the 5' and 3' RMCE vectors as described above. The only difference was that the 3' vector (1405) was inserted between the mutant C κ Upstream of the exon Figure 9 901, and the upstream and downstream homology arms of the 3' vector (1405) are respectively Figure 9 As a result, the PCR primers and Southern blot probe used to test the correct integration of the 3' vector (1405) were derived from sequences 943 and 949, rather than 1443 and 1449. κ The enhancer is not included in the targeting vector (1409) because this sequence is not deleted.
[0377] Example 9: Canine V λ domain and mouse C κ The domain does not function well, and canine V κ domain and mouse C λ The domain does not function well .
[0378] For the proposed LK mouse (Example 4), the canine V λ and J λ The gene segment coding sequence is embedded in the endogenous V κ and J κ The gene segment has been deleted from the mouse IGK locus. λ →J λ After gene rearrangement, the resulting Ig gene encodes an LC with a canine lambda variable domain and a mouse kappa constant domain. To test whether such a hybrid LC is correctly expressed and forms a complete Ig molecule, the V s (V κ and V λ Both) and C light chain exon (C κ and C λ Different combinations of both) were subjected to a series of transient transfection assays together with Ig HCs, and the cell surface and intracellular expression and secretion of the encoded Ig were tested.
[0379] For these experiments, mouse IgM b Allotypic HC-linked canine IGHV3-5 (accession number MF785020.1), IGHV3-19 (accession number FJ197781.1), or IGHV4-1 (accession number DN362337.1) were cloned into the pCMV vector.H The DNA contained endogenous canine L1-intron-L2 and germline VDJ sequences, i.e., unmutated VDJ sequences. Unmutated canine IGLV3-28 (accession number EU305423) or IGKV2-5 (accession number EU295719.1) was cloned into the pFUSE vector. Each canine V L Exons are all related to mouse C κ 、C λ1 or C λ2 The constant region of the λ3 With C λ2 similar properties because they have almost identical protein sequences). Each V L The L1-intron-L2 sequences in the 293T / 17 cells are all of canine origin. 293T / 17 cells were co-transfected with a human CD4 expression vector plus one of the HC and LC constructs as a transfection control, and a CD79a / b expression vector. Cell surface IgM expression requires CD79a / b heterodimers. Approximately 24 hours later, transfected cells were subjected to cell surface or intracellular staining by flow cytometry. For analysis of Ig secretion, the same V vectors as above were transfected. H The gene was cloned into a pFUSE vector containing mouse IgG2a Fc. 293T / 17 cells were co-transfected with a human CD4 (hCD4) expression vector as a transfection control plus one of the HC and LC constructs described above. (In these experiments, C λ3 Approximately 48 hours later, transfected cells and their corresponding supernatants were harvested and analyzed for HC / LC expression / secretion by Western blotting.
[0380] Summarizing the data obtained from these experiments, we found that the canine IGLV3-28 and the mouse C κ When connected, the IgM expression on the cell surface is higher than that of the same canine V λ with C λ1 or C λ2 Similarly, in the case of IGKV2-5 and mouse C λ Upon ligation, surface IgM levels are dramatically reduced. The extent of the expression defect depends on the specific V H Gene; some V H Some genes allow for some cell-surface expression of the hybrid light chain, but others are more restrictive. Similar trends were observed for Ig secretion.
[0381] Figure 15 The less stringent V expression was shown using canine IGVL3-28 / IGLJ6 (1501) or using canine IGVK2-5 / IGJK1 (1502). HFlow cytometric analysis of cells expressing one of the genes, IGHV3-5. The top row of graphs is a transfection control stained with hCD4 mAb antibody (1509), and the bottom row is stained with mouse IgM b Allotypic mAb (1510) staining. Untransfected hCD4- cells (1513) and transfected hCD4+ cells (1514) are indicated in all figures by differently shaded histograms. The frequency of untransfected hCD4- cells is indicated by the number in the upper left corner of each figure in the upper row, and the frequency of transfected hCD4+ cells is indicated by the number in the upper right corner of each figure in the upper row. Transfection efficiency was similar in all cases. However, in canine V λ With mouse C κ (1503, bottom row) when connected, the IgM expression on the cell surface was higher than that of the same canine V λ With mouse C λ1 or C λ2 (1504, 1505, bottom row) are even less. Similarly, in conjunction with C κ (1506, bottom row) When connected, the canine IgM to Vκ ratio is similar to C λ1 or C λ2 (1507, 1508, bottom row) The numbers in the upper right corner of each figure in the bottom row indicate cell surface IgM b The mean fluorescence intensity (MFI) of the staining is a quantitative indicator of expression level.
[0382] Figure 16 The less stringent V expression was shown using canine IGVL3-28 / IGLJ6 (1601) or using canine IGVK2-5 / IGJK1 (1602). H Flow cytometric analysis of cells expressing one of the genes, IGHV3-5. Figure 15 The cells were the same as in the previous study, but the cell surface was stained for mouse κLC (1609) or mouse λLC (1610), confirming that Figure 15 The results shown in .
[0383] Figure 17 Flow cytometric analysis of cells expressing IGHV4-1, which is more stringent than IGHV3-5, with canine IGVL3-28 / IGLJ6 (1701) or with canine IGVK2-5 / IGJK1 (1702) is shown. The top row is a transfection control stained with hCD4 mAb antibody (1709), and the bottom row is a transfection control stained with mouse IgM bAllotypic mAb (1710) staining. Untransfected hCD4- cells (1713) and transfected hCD4+ cells (1714) are indicated by differently shaded histograms throughout the bottom panels. The frequency of untransfected hCD4- cells is indicated by the number in the upper left corner of each panel in the upper row, and the frequency of transfected hCD4+ cells is indicated by the number in the upper right corner of each panel in the upper row. Transfection efficiency was similar in all cases. However, in canine V λ With mouse C κ (1703, bottom row) when connected, the IgM expression on the cell surface was higher than that of the same canine V λ With mouse C λ1 or C λ2 (1704, 1705, bottom row) are much less common when connected, although the best representation in this case is with C λ2 (1705, bottom row) connection. Similarly, in the κ (1706, bottom row) when linked to canine IgM and V κ Compared with C λ1 or C λ2 (1707, 1708, bottom row) are much better expressed when linked. In fact, in this case, IgM is linked to C λ1 or C λ2 The numbers in the upper right corner of the bottom row of the graphs indicate the cell surface IgM b The mean fluorescence intensity (MFI) of the staining was a quantitative indicator of expression level. Staining with mouse λLC or κLC specific antibodies was performed in all experiments, and the expression of IgM was confirmed. b Results of allotypic mAb staining (not shown).
[0384] Figure 18 Flow cytometric analysis of cells expressing IGHV3-19 is shown. λ C κ IGHV3-19 was the most stringent IGHV gene tested in terms of its ability to function with canine IGVL3-28 / IGLJ6 (1801) or with canine IGVK2-5 / IGJK1 (1802). The top row of graphs is a transfection control stained with hCD4 mAb antibody (1809), and the bottom row of graphs is a transfection control stained with mouse IgM bAllotypic mAb (1810) staining. Untransfected hCD4- cells (1813) and transfected hCD4+ cells (1814) are indicated by differently shaded histograms throughout the bottom panels. The frequency of untransfected hCD4- cells is indicated by the number in the upper left corner of each panel in the upper row, and the frequency of transfected hCD4+ cells is indicated by the number in the upper right corner of each panel in the upper row. Transfection efficiency was similar in all cases. In canine V λ With mouse C κ (1803, bottom row) when ligated, essentially no surface IgM expression was present, whereas in canine V κ With mouse C λ1 or C λ2 (1807, 1808, bottom row) When connected, only low level expression is present. The numbers in the upper right corner of each figure in the bottom row indicate cell surface IgM b The mean fluorescence intensity (MFI) of the staining was a quantitative indicator of expression level. Staining with mouse λLC or κLC specific antibodies was performed in all experiments, and the expression of IgM was confirmed. b Results of allotypic mAb staining (not shown).
[0385] The results of this analysis indicate that the inclusion of canine V λ and mouse C κ or Canine V κ and mouse C λ1 or C λ2 Hybrid light chains are often poorly expressed on the surface of cells bearing μHCs. The level of cell surface IgM depends on the specific V used by the μHC. H , but there is no allowance for predicting a specific V H Whether it allows for a discernible pattern of moderate or no cell surface IgM expression. Since B cell survival depends on the expression of IgM BCR, canine V λ and mouse C κ The pairing of canine V κ With mouse C λ1 or C λ2 Pairing reduces the development of B cells expressing κ-LC.
[0386] The expression and secretion of Ig with hybrid or homologous LC was also tested.Supernatants and cell lysates of transiently transfected cells were analyzed by Western blotting. Figure 19A shows the use of mice C κ 、C λ1 、C λ2 or C λ3Results for paired canine IGVL3-28 and cell supernatants containing mouse IgG2a HCs of canine IGHVH3-5 (1901), IGHVH3-19 (1902), or IGHVH4-1 (1903). Figure 19B shows the use of mice C κ 、C λ1 、C λ2 or C λ3 Results for paired canine IGVL3-28 and cell lysates containing either canine IGHVH3-5 (1904), IGHVH3-19 (1905), or IGHVH4-1 (1906) mouse IgG2a HC. Samples were electrophoresed under non-reducing (not shown) or reducing conditions, and the blots were probed with IgG2a antibodies. κ (1907) when paired with C λ1 (1908), C λ2 (1909) or C λ3 (1910) much less when paired ( Figure 19A This difference is not due to the presence of γ2a HC in canine IGVL3-28-mouse C κ Lower expression or enhanced degradation in cells (as levels were similar in each group of transfectants ( Figure 19B )), or because the number of proteins analyzed is small. Loading control Myc ( Figure 20A ) and GAPDH( Figure 20B ) showed that the amount of protein in each group was almost the same. Figure 19B The blots used in were stripped and reprobed with antibodies against Myc and GAPDH, respectively, and thus Figure 20A and 20B The lanes in Figure 19B same.
[0387] In another set of experiments, compared with secretion assays ( Figure 21A , non-reducing conditions) were examined in parallel with canine IGVL3-28-mouse C κ Stability of LC in transfected cells ( Figure 21B , reducing conditions). Similarly, in the case of LC, canine IGVL3-28-mouse C κ ( Figure 21A , 2102), secretion ratio is higher than that of canine IGVL3-28-mouse C λ1 ( Figure 21A , 2103) or IGVL3-28-mouse C λ2 ( Figure 21A, 2104) with much less IgG2a. However, in IGVL3-28-mouse C, which was detectable with anti-κ antibodies, κ Significant amounts of intracellular κLC ( Figure 21B , 2102), and LC is canine IGVK2-5-mouse C κ ( Figure 21B , 2105) were similar to the levels observed. κ It is well expressed and not rapidly degraded in the cell. In this particular canine VH-VK combination, κ (2105), C λ1 (2106) or C λ2 (2107), secretion of canine IgG2a using VK2-5 was similar.
[0388] Figure 21A and 21B The results in the study indicate that hybrid canines carrying V λ -Mouse C κ The reduced secretion of Ig molecules is due to the inability to fold or to properly pair with the γ2a HC. Although not wishing to be bound by theory, it is believed that this is due to endoplasmic reticulum (ER) quality control mechanisms, such as the Ig HC retention molecule BiP, which causes incompletely assembled IgG2a molecules to be retained in the ER (Haas and Wabl (1983) Immunoglobulin Heavy Chain Binding Protein. Nature 306: 387-389 PMID 6417546; Bole, et al. (1986) Posttranslational association of immunoglobulin heavy chain binding protein with nascent heavy chains in nonsecreting and secreting hybridomas. J. Cell Biology 102: 1558-1566 PMID 3084497).
[0389] Example 10: Expression of some canine immunoglobulins and mouse IgD
[0390] In the mature B cells of most mammals, IgD is co-expressed with IgM. However, there is considerable controversy about whether dogs have functional constant region genes encoding δHC. Early serological studies using mAbs identified "IgD-like" molecules expressed on canine lymphocytes (Yang et al. (1995) Identification of a dog IgD-like molecule by a monoclonal antibody. Vet. Immunol. and Immunopath. 47: 215-224. PMID: 8571542). However, after immunization of dogs with ragweed extract, serum levels of this IgD increased. This is not a typical feature of true IgD, which is present in serum in very small amounts and is not enhanced by immunization; IgD is primarily a BCR isotype, particularly in mice. Later, Rogers et al. ((2006) Molecular characterization of immunoglobulin D in mammals: immunoglobulin heavy constant delta genes in dogs, chimpanzees and four old world monkey species. Immunol. 118:88-100 (doi:10.1111 / j.1365-2567.2006.02345.x)) cloned a cDNA encoding the authentic delta HC by RT-PCR of RNA isolated from canine blood. However, the International ImMunoGeneTics The most recent annotation of the canine IgH locus by IMGT (www.imgt.org) lists Cδ as a nonfunctional open reading frame because the hinge 2 exon has an atypical splice donor site, NGC, rather than NGT. It is possible that some low level of correct “leaky” splicing and IgD expression can occur in dogs, thus explaining the ability of Rogers et al. to isolate a Cδ cDNA clone. However, it is concerning that the canine V H The domain may not fold correctly when linked to mouse Cδ because the canine V H The gene region is clearly associated with partially or completely nonfunctional C δ The partial or no assembly of IgD in some canine species may interfere with normal B cell development.
[0391] To test the canine V with Cδ skeleton HWhether the domains could assemble into IgD molecules that could be expressed on the cell membrane was analyzed by transient transfection and flow cytometry using methods similar to those described in Example 8.
[0392] 293T / 17 cells were transfected with a human CD4 (hCD4) expression vector as a transfection control plus one of the HC constructs from Example 8 (except that C μ replaced by Cδ) and one of the κ or λ LC constructs were co-transfected with CD79a / b expression vectors. Figure 22-Figure 24 As shown in the figure, in the κ - Mouse Cκ or Canine C κ -Mouse C λ When LC is paired, HC with canine VH domains and mouse IgD framework is expressed on the cell surface.
[0393] Figure 22 Shown are cell surface canine IGHV3-5 with mouse IgD backbone and canine IGKV2-5 / IGKJ1-C κ (column 2201) and attached to mouse C λ1 (2202), C λ2 (2203) or C λ3 (2204) canine IGLV3-28 / IGLJ6 expression. In these studies, the top row (2205) shows cell surface hCD4 staining, which is a control for transfection efficiency. Row 2206 shows CD79b staining, CD79b is a required component of the BCR, which confirms cell surface IgD expression. Row 2207 shows IgD staining, row 2208 shows kappa LC, and row 2209 shows lambda LC. These specific canine V H / V κ or V H / V λ The LC combination was well expressed on the cell surface.
[0394] Figure 23 Cell surface canine IGHV3-19 with mouse IgD backbone and canine IGKV2-5 / IGKJ1-C are shown. κ (column 2301) and attached to mouse C λ1 (2302), C λ2 (2303) or C λ3 (2304) canine IGLV3-28 / IGLJ6 expression. (Cell surface staining data and Figure 22 with these specific canines V H / V κ or V H / V λThe cell surface expression of IgD in LC combination was no higher than Figure 22 It is worth noting that canine IGHV3-19 is highly expressed in its κ - Mouse CλLC association ability is also the most stringent V H . (Figure 19).
[0395] Figure 24 Shown are cell surface canine IGHV4-1 with mouse IgD backbone and canine IGKV2-5 / IGKJ1-C κ (column 2401) and attached to mouse C λ1 (2402), C λ2 (2403) or C λ3 (2404) canine IGLV3-28 / IGLJ6 expression. (Cell surface staining data and Figure 22 with these specific canines V H / V κ or V H / V λ The cell surface expression of IgD in LC combination is between Figure 22 and Figure 23 between the cell surface expression observed in .
[0396] These data demonstrate that although cell surface expression levels vary depending on the specific HC / LC combination, canine V H The genes are expressed with a mouse IgD backbone. It is thought that during B cell development, HC / LC combinations that can express IgD on the cell surface are selected for entry into the follicular B cell compartment, generating a sufficient BCR repertoire.
[0397] The foregoing merely illustrates the principles of the methods described herein. It will be understood that those skilled in the art will be able to design various arrangements that, although not explicitly described or shown herein, embody the principles of the invention and are included in the spirit and scope of the invention. In addition, all examples and conditional language listed herein are primarily intended to help the reader understand the principles of the invention and the concepts contributed by the inventors to promote the development of the art, and should be interpreted as not being limited to such specific listed examples and conditions. In addition, all statements herein listing the principles, aspects and embodiments of the invention and specific examples thereof are intended to include both their structural and functional equivalents. Furthermore, it is intended that such equivalents include both currently known equivalents and future developed equivalents, i.e., any elements developed to perform the same function regardless of structure. Therefore, the scope of the invention is not intended to be limited to the exemplary embodiments shown and described herein. Rather, the scope and spirit of the invention are embodied by the appended claims. In the appended claims, unless the term "means" is used, none of the features or elements listed therein should be interpreted as being intended to be construed as being intended to be used under 35 USC §112, All references cited herein are incorporated by reference in their entirety for all purposes.
[0398] Sequence Listing
[0399] Canine Ig
[0400] (Note that the sequence and annotation of the canine genome are still incomplete. These tables do not necessarily describe the complete canine VH, DH and JH, Vκ and Jκ, or Vλ and Jλ gene segment repertoires.)
[0401] (F = functional, ORF = open reading frame, P = pseudogene, *OX indicates the number of IMGT alleles)
[0402] Table 1. Canine IGH loci
[0403] Germline VH sequences
[0404] SEQ ID NO.1 IGHV1-4-1(P)
[0405] >IGHV1-4-1*01|Dog_Boxer|P|V-Zone|
[0406] gaggtccagctggtgcagtctggggctgaggtgaggaaaccagtttcatctgtgaaggtctcctggaaggcatctggatacacctacatggatgcttatatgcactggttatgacaagcttcaggaataaggtttgggtgtatgggatggattggtcccaaagatggtgccacaagatattcacagaagttccacagcagagtctccctgatggcagacatgtccaaagcacagcctacatgctgctgagcagtcagaggcctgaggacacacctgcatattactgtgtgggacact
[0407] SEQ ID NO.2 IGHV1-15(P)
[0408] >IGHV1-15*01|Canis lupus familiaris_Boxer dog|P|V-region|
[0409] gaggtccagctggtgcagtctggggctgaggtgaagaagccaggtacatccgtgaaggtctcatgcaagacatctggatacaccttcactgactactatatgtactgggtacgacaggcttcaggagcagggcttgattggatgggacagattggtccctaagatggtgccacaaggtatgcacagaagtttcagggcagagtcaccctgtcaacagacacatccacaagcacagcctacatggagctgagcagtctgagagctgaggacacagccatgtactactctgtgaga
[0410] SEQ ID NO.3 IGHV1-17(P)
[0411] >IGHV1-17*01|Canis lupus familiaris_Boxer dog|P|V-region|
[0412] gaggtccagctggtgcagtctggggctgaggtgaagaagctaagggcatcagtgatagtcccctgcaagacatctggatacagcttcactgactacattttggaatgggtatgacaggctccaggaccagggcttgagtggatgggatggattggtcctgaagatggtgagacaaagtatgtgcagaagttccaggcagagtcaccctgatggcagacacaaccacaagcacagccaacatggagctgaccagtctgagagctgaggacacagccatgtactactgtgtga
[0413] SEQ ID NO.4 IGHV1-30(F)
[0414] >IGHV1-30*01|Canis familiaris_Boxer|F|V-region|
[0415] gaggtccagctggtgcagtctggggctgaggtgaagaagccaggggcatctgtgaaggtctcctgcaagacatctggatacaccttcattaactactatatgatctgggtacgacaggctccaggagcagggcttgattggatgggacagattgatcctgaagatggtgccacaagttatgcacagaagttccagggcagagtcaccctgacagcagacacatccacaagcacagcctacatggagctgagcagtctgagagctggggacatagctgtgtactactgtgcgaga
[0416] SEQ ID NO.5 IGHV3-2(F)
[0417] >IGHV3-2*01|Canis familiaris_Boxer|F|V-region|
[0418] gaggtgcagctggtggagtctgggggagacctggtgaagcctggggggtccctgagactctcctgtgtggcctctggattcaccttcagtagcaactacatgagctggatccgccaggctccagggaaggggctgcagtgggtctcacaaattagcagtgatggaagtagcacaagctacgcagacgctgtgaagggccgattcaccatctccagagacaatgccaagaacacgctgtatctgcagatgaacagcctgagagatgaggacacggcagtgtattactgtgcaaggga
[0419] SEQ ID NO.6 IGHV3-3(F)
[0420] >IGHV3-3*01|Canis lupus familiaris_Boxer dog|F|V-region|
[0421] gaggtgcagctggtggagtctgggggagacatggtgaagcctggggggtccctgagactctcctgtgtggcctctggatttaccttcagtagttactacatgtattgggcccgccaggctccagggaaggggcttcagtgggtctcacacattaacaaagatggaagtagcacaagctatgcagacgctgtgaagggccgattcaccatctccagagacaacgcaaagaatacgctgtatctgcagatgaacagcctgagagctgaggacacagcggtgtattactgtgcaaagga
[0422] SEQ ID NO.7 IGHV3-4(P)[[ID=gaggtgcagctggtggagtctgggggagacctgatgaagcctgggggggtccctgagactctcctgtgtggcctctgaattcatcttcagtggctactggaagtactggatccaccaagctccagggaaggggctgcagtgggtcacatggattagcaatgatggaagtagcaaaagctatgcagacgctgtgaagggccaattcaccatctccaaagacaatgccaaatacacgctgtatctgcagatgaacagcctgagagccgaggacatggccgtgtattactgtatgatgca
[0425] SEQ ID NO.8 IGHV3-5(F)
[0426] >IMGT000001|IGHV3-5*01|Canis lupus familiaris_Boxer|F|V-region|
[0427] gaggtgcagctggtggagtctgggggagacctggtgaagcctggggggtccctgagactttcctgtgtggcctctggattcaccttcagtagctaccacatgagctgggtccgccaggctccagggaaggggcttcagtgggtcgcatacattaacagtggtggaagtagcacaagctatgcagacgctgtgaagggccgattcaccatctccagagacaacgccaagaacacgctgtatcttcagatgaacagcctgagagccgaggacacggccgtgtattactgtgcgagtga
[0428] SEQ ID NO.9 IGHV3-5-1(P)
[0429] >IMGT000001|IGHV3-5-1*01|Canis lupus familiaris_Boxer|P|V-region|
[0430] gaggtgcagctggtggagtctgggggagccctggtgaagcctgggggggtccctgagactctcctatgtggcctctggattcaccttcagtagctaccacatgagctgggtccgccaggctccagggaaggggctgcagtgggtcgcatacattaacagtggtggaagtagggatccctgggtggcgcagtggtttggcgcctgcctttggcccagggcacgatcctggagacccgggatcgaatcccacgtcgggctccctgcatggagcctgcttctccctctgcctgtgtctct
[0431] SEQ ID NO.10 IGHV3-6(F)
[0432] >IGHV3-6*01|Canis lupus familiaris_Boxer|F|V-region|
[0433] gaggtgcagctggtggagtctgggggagacctggtgaagcctggggggtccctgagactctcctgtgtagcctctggattcaccttcagtagctccgacatgagctggatccgccaggctccaggaaaggggcttcagtgggtcgcatacattagcaatgatggaagtagcacaagctacgcagacgctgtgaagggccgattcaccatctccagagacaacgccaagaacacgctctatctgcagatgaacagcctcagagccgaggacacggccgtgtattactgtgcaga
[0434] SEQ ID NO.11 IGHV3-7(F)
[0435] >IGHV3-7*01|Canis lupus familiaris_Boxer|F|V-region|
[0436] gaggagcaactggtggagtttggaggacacatggtgaatcctgggggttccctgggtctctcctgtcaggcctctggattcaccttcagtagctatggcatgagctgggtccgccaggctcaaaagaaggggctgcagtgggtcggacatattagctatgatggaagtagtacatactacgcagacactttgagggacagattcaccatctccagagacaacaccaagaacatgctgtatctgcagatgaacagcctgagagccgaggacacagccgtgtattactgcatgaggaa
[0437] SEQ ID NO.12 IGHV3-8(F)
[0438] >IGHV3-8*01|Canis lupus familiaris_Boxer|F|V-region|
[0439] gaggtgcagctggtggagtctgggggagacctggtgaagcctggggggtccctgagactctcctgtgtggcctctggattcaccttcagtaactacgaaatgtactgggtccgccaggctccagggaaagggctggagtgggtcgcaaggatttatgagagtggaagtaccacatactatgcagaagctgtaaagggccgattcaccatctccagagacaacgccaagaacatggcgtatctgcagatgaacagcctgagagccgaggacacggccgtgtattactgtgcgagtga
[0440] SEQ ID NO.13 IGHV3-9(F)
[0441] >IGHV3-9*01|Canis lupus familiaris_Boxer|F|V-region|
[0442] gaggtgcagctggtggagtctggaggagacctggtgaagcctggggggtccctgagactttcctgtgtggcctctggattcaccttcagtagctatgacatggactgggtccgccaggctccagggaaggggctgcagtggctctcagaaattagcagtagtggaagtagcacatactacgcagacgctgtgaagggccgattcaccatctccagagacaacgccaagaacacgctgtatctgcagatgaacagcctgagagccgaggacacggccgtgtattactgtgcaaggga
[0443] SEQ ID NO.14 IGHV3-10(F)
[0444] >IGHV3-10*01|Canis lupus familiaris_Boxer dog|F|V-region|
[0445] gaggtgcagctggtggagactgagggagacctggtgaagcctgggggatccctgagactttcctgtgtggcctctggattcaccttcagtagctacgacatggactgggtctaccaggctccagggaaagggttacagtgggtcacatacattagcaatggtggaagtagcacaaggtatgcagacgctgtgaagggccaattcaccatctccagagacaacgccaggaacacgctctatctgcagatgaacagcctgagagacaaggacatggccgtgtattactgtgtgagtga
[0446] SEQ ID NO.15 IGHV3-11(P)
[0447] >IMGT000001|IGHV3-11*01|Canis lupus familiaris_Boxer dog|P|V-region|
[0448] gaggtgcagctggtggagtctaggggagacgtggtgaagcctggggaggtccctctcctgtgtggcctctagattcaccttcagtagctactacatgggctgggtccactaggctccagggaaggggctgcagtgggtcgcaggtattaccaatgatagaagtagcacaagctatgcagacgctgtgaagggccgattcaccatctccagagacaatgccaagaacacgctgtatctgcagatgaacagcctgggagccgaggacacggctgtgtattattgtgtgaaacaga
[0449] SEQ ID NO.16 IGHV3-12(P)
[0450] >IGHV3-12*01|Canis lupus familiaris_Boxer dog|P|V-region|
[0451] gaggtgcagctggtggagtctggggagacctggtgaagcctggggggtctctgagactctcctgtgtggcctctggattcaccttcagtagctactacatgagctgggtccgccaggctccagggaaggggctgcagtgggtcggatacattaacagtggtggaagtagcacatactatgcagacgctgtgaagggccgattcaccatctccagagacaatgccaagaacacgctgtatctgcagatgaacagcctgagagccgaggacacagctgtgtattactgtgggaaggga
[0452] SEQ ID NO.17 IGHV3-13(F)
[0453] >IGHV3-13*01|Canis lupus familiaris_Boxer dog|F|V-region|
[0454] gaggagcaactggtggagtttggaggacacatggtgaatcctgggggttccctgggtctctcctgtcaggcctctggattcaccttcagtagctatggcatgagctgggtccgccaggctcaaaagaaggggctgcagtgggtcggacatattagctatgatggaagtagcacatactacacagacactgtgagggacagattcaccatctccagagacaacaccaagaacatgctgtatctgcagatgaacagcctgagagccgaggacacagccgtgtattactgcatgaggaa
[0455] SEQ ID NO.18 IGHV3-14(P)
[0456] >IGHV3-14*01|Canis lupus familiaris_Boxer|P|V-region|
[0457] gaggtgcagatggtggagtctgggggagacctggtgaagcctgggggatccctgagactctcctgtgtggcctctggattcaccttcagtaactacaaaatgtactgggtccaccaggctccagggaaagggctggagtgggtcgcaaggatttatgagagtggaagtaccacatactacgcagaagctgtaaagggccgattcaccatctccagagacaacgccaagaacatggtgtatctgcagatgaacagcctgagagcctaggacacggccgtgtattactgtgtgagtga
[0458] SEQ ID NO.19 IGHV3-16(F)
[0459] >IGHV3-16*01|Canis lupus familiaris_Boxer|F|V-region|
[0460] gaggtacagctggtggagtctggaggagacctggtgaagcctggggggtccctgagactctcctgtgtggcctctggattcacctttagtagttactacatgttttggatccgccaggcaccagggaagggcaatcagtgggtcggatatattaacaaagatggaagtagcacatactacccagacgctgtgaagggccgattcaccatctccagagacaacgccaagaacacactgtatctgcagatgaacagcctgacagtggaggacacagccctttattactgtgcgagaga
[0461] SEQ ID NO.20 IGHV3-18(F)
[0462] >IGHV3-18*01|Canis lupus familiaris_Boxer|F|V-region|
[0463] gaggtgcagctggtggagtctgggggagaccttgtgaaacctgaggggtccctgagactctcctgtgtggtctctggcttcaccttcagtagctacgacatgagctgggtccgccaggctccagggaaggggctgcagtgggtcgcatacattagcagtgatggaaggagcacaagttacacagacgctgtgaagggccgattcaccatctccagagacaatgccaagaacacgctgtatctgcagatgaacagcctgagaactgaggacacagccgtgtattactgtgcgaagga
[0464] SEQ ID NO.21 IGHV3-19(F)
[0465] >IGHV3-19*01|Canis lupus familiaris_Boxer|F|V-region|
[0466] gaggtgcagctggtggagtctgggggagacctggtgaagcctgcggggtccctgagactgtcctgtgtggcctctggattcaccttcagtagctacagcatgagctgggtccgccaggctcctgagaaggggctgcagttggtcgcaggtattaacagcggtggaagtagcacatactacacagacgctgtgaagggccgattcaccatctccagagacaacgccaagaacacagtgtatctgcagatgaacagcctgagagccgaggacacggccatgtattactgtgcaaagga
[0467] SEQ ID NO.22 IGHV3-20(P)
[0468] >IGHV�-20*01|Canis familiaris_Boxer|P|V-region|
[0469] gaggtgcagctggtggagtctgggggatacctggtgaagcctggagggtcctgagactctcctctgtgtcctctggattcaccttcagtatctactgcatgtgatgggtctgccaggctccaggaaaggggctgcagtgagtcgcatacagtaacagtggtggaagtagcactaggtacacagacgctgtgaagggctgattcaccacctccagagacaatgccaagaacacactgtatctgcagatgaacagcctgagagtgaggacacagcggtgtattactgtgcaggtga
[0470] SEQ ID NO.23 IGHV3-21(P) [[ID=gaggtgcagctgttggagtctgggggagacctggtgaagcctggggggtccctgagactgtcctgtgtggtctctggattcaccttcagtaagtatggcatgagctgggtctgccaggctttggggaaggggctacagttggtcgcagctattagctaagatggaaggagcacatactacacagacactgtgaagggccgattcaccatctccagagacaatgccaagaacacgctgtacctgcagatgaacagcttgagagctgaggacacggccgtgtattactgtgagagtga
[0473] SEQ ID NO.24 IGHV3-21-1(P)
[0474] >IGHV3-21-1*01|Canis lupus familiaris_Boxer|P|V-region|
[0475] gaggtgaagctagtggagtctgggggagacctggtgaagcctgggggatcaattagactctcctatgtgacctctggattcaccttcaggagctactggatgagctgggtcagccaggctccagggaaggggctgcagtgggtcatatgggttaatactggtggaagcagaaaaagctatgcagatgctgtgaaggggtgattcaccatctccagagacaatgccaagaacacgctgtatctgcatatgaacagcctgagagccctgtattattatgtgagtga
[0476] SEQ ID NO.25 IGHV3-22(P)
[0477] >IGHV3-22*01|Canis lupus familiaris_Boxer|P|V-region|
[0478] gaggtgcagatgatggagtctgggggagaactgatgaagcctgcaggatccctgagacctcctgtgtggcctctggattcaccttcagtagctactggatgtactggatccaccaaactccggggaaggggctgcagtgggtcgcaggtattagcacagatggaagtagcacaagctacgtagacgctctgaagggctgattcaccatctccagagacaacgccaagaacacgctctatctgcagatgaacagcctgagagccgaggacatggccatgtattactgtgcaga
[0479] SEQ ID NO.26 IGHV3-23(F)
[0480] >IGHV3-23*01|Canis lupus familiaris_Boxer|F|V-region|
[0481] gaggtgcagctggtggagtctgggggagacctggagaagcctgggggatccctgagactgtcctgtgtggcctctggattcaccttcagtagctacggcatgagctgggtccgccaggctccagggaaggggctgcagggggtctcattgattaggtatgatggaagtagcacaaggtatgcagacgctgtgaagggccgattcaccatctccagagacaatgccaagaacacgctgtatctgcagatgaacagcctgagagccgaggacacagccgtgtattcctgtgcgaagga
[0482] SEQ ID NO.27 IGHV3-24(F)
[0483] >IGHV3-24*01|Canis lupus familiaris_Boxer|F|V-region|
[0484] gaggtgcagctggtggagtctgggggagaccttgtgaagcctgaggggtccctgagactctcctgtgtggcctctggattcaccttcagtagcttctacatgagctggttctgccaggctccaaggaaggggctacagtgggttgcagaaattagcagtagtggaagtagcacaagctacgcagacattgtgaagggccgattcaccatctccagagacaatgccaagaacatgctgtatctgcagatgaacagcctgagagccgaggacatggccgtatattattgtgcaaggta
[0485] SEQ ID NO.28 IGHV3-25(P)
[0486] >IGHV3-25*01|Canis lupus familiaris_Boxer|P|V-region|
[0487] gaggtgcagctggtggagcctgggggagaactggtgaagcctggggcgtccctgagactctcctgtgtggtccctggattcaccttcagtagctacaacatgggctgggctcaccagcctccagggaaggggatgcagtgggtcgcaggttttaacagcggtggaagtagcacaagctacacagatgctgtgaagggtgaattcaccatctccagagacaatgtcaagaacacgctgtatctgcagatgaacagcctgagatccgaggacacggccgtgtattactgtgtgaagga
[0488] SEQ ID NO.29 IGHV3-26(P)
[0489] >IGHV3-26*01|Canis lupus familiaris_Boxer|P|V-region|
[0490] gaggtgtagctggtggagtctgggggagacctggtgaagcctggggggtccctgagactctcctgtgtgggctctggattcaccttcagtagctactggatgagctgggtccgccaggctccagggaaggggctacagtgggttgcagaaattagcggtagtggaagtagcacaaactatgcagacgctgtgaagggccgattcatcatctccagagacaatgccaagaacacgctgtatctgcagatgaacagcctgagagccgaggacacggccatgtattactgtgcaaggga
[0491] SEQ ID NO.30 IGHV3-27(P)
[0492] >IGHV3-27*01|Canis lupus familiaris_Boxer dog|P|V-region|
[0493] aaggtgcatctggtggagtctgcgggagacgtggtgaagcctaggaggtccctgagactctcctgtgtgggctctggattcaccttcagtagctacagcatgtggtgggcccgtgaggctcccgggatggggctacagggggtcgcaggtattagatatgatggaagtagcacaagctacgcagacgctctgaagggccgattcaccatctccagagacaatgccaaaaacacactgtatctgtagaagaacagcctgagagccgagggaggacacggccgtgtattactgtgcgaggga
[0494] SEQ ID NO.31 IGHV3-28(P)
[0495] >IGHV3-28*01|Canis lupus familiaris_Boxer dog|P|V-region|
[0496] gaggtgcagctagtggagtctgggggagacctggtgaagtctgggggggtccctgagagtctcctgtgtgggctctggattcaccttcagtagctactggatgtactgggtccaccaggctccagggaaggggctccatgggtcgcatggattaggtatgatggaagtagcacaagctacgcagaagctgtgaaaggccgattcactgtttctagagacaacgccaagaacacgctgtatctgcagatgaacagcctgagagccgaggacacggccgtgtattactgtgtgaggga
[0497] SEQ ID NO.32 IGHV3-29(P)
[0498] >IGHV3-29*01|Canis familiaris_Boxer|P|V-region|
[0499] gaggtgcagctggtggagtcctggggagacctggtgaagactggaggtttcctgagactctcctgtctcctgtgtggcttccggattcaccttcagtaactacagcatgatctgggtccgccaggctccaaggaaggggctgcagtggatcacaactattagcaatagtggaagtagcacaaatcacgcagacacagtaaagggccgatttaccatctccagagacaacaccaagaacacgctgtatctacagatgagcagcctgggagccgatgacacggccctgtattactgtgtgaggga
[0500] SEQ ID NO.33 IGHV3-31(P)
[0501] >IGHV3-31*01|Canis familiaris_Boxer|P|V-region|
[0502] gaggtgcagctggtggagtctgggggagaactggtgaagcctggggggtccctgagactctcctgtgtggcctctggattcaccttcagtagctactacatgagctggatccgccaggctcctgggaaggggctgcagtgggtcgcagatattagtgacagtggaggtagcacatactacactgacgctgtgaagggccgattcaccatctccagagacaacgtcaagaactcgctgtatttgcagatgaacagcctgagagccgaggacacggccgtgtattactgtgcgaagga
[0503] SEQ ID NO.34 IGHV3-32(ORF)
[0504] >IGHV3-32*01|Canis lupus familiaris_Boxer|ORF|V-region|
[0505] ggggtgcagctggtggagtctgggggagacctggtgaagcctggggggtccctgacactctcctgtgtggcctatggattcaccttcagtagctacagcatgcaatgggtctgtcaggctccagggaagggggtgcagtgggtcgcatacattaacagtggtggaagtagcacaagctccgcagatgctgtgaagggtcgattcatcatctccagagacaacgtcaagaacacgctatatctgcagatgaacagcctgagagccgaggacaccgccgtgtattactgtgcgggtga
[0506] SEQ ID NO.35 IGHV3-33(P)
[0507] >IGHV3-33*01|Canis lupus familiaris_Boxer|P|V-region|
[0508] gagatgcagctggtggaggctgggggagacctggtgaagcttggggggtccctgagactcttctgtgtggcctctggatttaccttcagtagctattggatgagctgggtcggccaggctccagggaaagggttgcagtgggttgcatacattaacagtggtggaagtagcacatactatgcagacgctgtgaagggccgattcaccatctccagagacaatgccaagaacacgctgtatctgcagatgaactgcctgagagccgaggacacggccgtatattactgtgtggga
[0509] SEQ ID NO.36 IGHV3-34(F)
[0510] >IGHV3-34*01|Canine_Boxer|F|V-region|
[0511] cagacactgtgaagggccgattcaccatctccagagacaacgccaagaacacgctctatctgcagatgaacagcctgagagctgaggacacggccgtgtattactgtgcgaagga(Incomplete sequence in database)
[0512] SEQ ID NO.37 IGHV3-35(F)
[0513] >IGHV3-35*01|Canine_Boxer|F|V-region|||
[0514] gaggtgcagctggtggagtctgggggagacctggtgaagcctgtgggatccctgagactctcctgtgtggcctctggattcaccttcagtagctatgacatgaactgggtccgccaggctccagggaaggggctgcagtgggtcgcatacattagcagtggtggaagtagcacatactatgcagatgctgtgaagggccggttcaccatctccagagacaacgccaagaacacgctgtatcttcagatgaacagcctgagagccgaggacacggccatgtattactgtgcgggtga
[0515] SEQ ID NO.38 IGHV3-36(P)
[0516] >IGHV3-36*01|Canine_Boxer|P|V-region|
[0517] gaggggcagctggcggagtctgggggagacctggtgaagcctgagaggtccctgagactcgcccgtgtggcctctggattcaccttcatttcctataccatgagctgggtccacaaggctcctgggaaggggctgccgtgagtcgcatgaatttattctagtggaagtaacatgagctatgcagacgctgtgaagggccgattcaccatctccagagacaatgccaagaacatgctgtatctgcagatgaacagcctgagagctgaggacatggccatgtattactgtgtgaatga
[0518] SEQ ID NO.39 IGHV3-37(F)
[0519] >IGHV3-37*01|Canine_Boxer|F|V-region|
[0520] gaggtacagctggtggagtctggggaagatttggtgaagcctggagggtccctgagactctcctgtgtggcctctggattcaccttcagtagcagtgaaatgagctgggtccaccaggctccagggcaggggctgcagtgggtctcatggattaggtatgatggaagtatctcaaggtatgcagacactgtgaagggccgattcaccatctccagagacaatgtcaagaacacgctgtatctgcagatgaacagcctgagagccgaggacacggccatatattactgtgcaga
[0521] SEQ ID NO.40 IGHV3-38(F)
[0522] >IGHV3-38*01|Canine_Boxer|F|V-region|
[0523] gaggtgcagctggtggagtctgggggagacctggtgaagcctggggggaccttgagactgtcctgtgtggcctctggattcacctttagtagctatgacatgagctgggtccgtcagtctccagggaaggggctgcagtgggtcgcagttatttggaatgatggaagtagcacatactacgcagacgctgtgaagggccgattcaccatctccagagacaacgccaagaacacgctgtatctgcagatgaacagcctgagagccgaggacacggccgtgtattactgtgcgaagga
[0524] SEQ ID NO.41 IGHV3-39(F)
[0525] >IGHV3-39*01|Canis familiaris_Boxer dog|F|V-region|
[0526] gaggtacagctggtggaatctgggggagacctcgtgaagcctgggggttccctgagactctcctgtgtggcctcgggattcaccttcagtagctactacatgagctggatccgccaggctcctgggaaggggctgcagtgggtcgcagatattagtgatagtggaggtagcacaggctacgcagacgctgtgaagggccggttcaccatctccagagagaacgccaagaacaagctgtatcttcagatgaacagcctgagagccgaggacacagccgtgtattactgtgcgaagga <00atgcaatgggtccgtcaggctcctgggaagggggtgcagtgggtcgcatacattaacagtggtggaagtagcacaagcttcgcagatgctgtgaagggcatgagctggtttcgccaggctccagggaaggggctgcaatgggttacatggattgggtatgatggaagtagcacatactacacagacactgtaaagggccgattcactatctccatagacaacgccaagaacatgctgtatctgcagatgaacagcctgagagccgaggacatagccctgtattactgtgcgaggga
[0530] SEQ ID NO.43 IGHV3-41(F)
[0531] >IGHV3-41*01|Canis lupus familiaris_Boxer dog|F|V-region|
[0532] gaggtgcagctggtggagtctgggggagacctggtgaagcctggggggtccctgagactctcctgtgtagcctctggattcaccttcagtaactacgacatgagctgggtccgccaggctcctgggaaggggctgcagtgggtcgcagctattagctatgatggaagtagcacatactacactgacgctgtgaagggccgattcaccatctccagagacaacgccaggaacacagtgtatctgcagatgaacagcctgagagccgaggacacggctgtgtattactgtgcgaagga
[0533] SEQ ID NO.44 IGHV3-42(P)
[0534] IGHV3-42*01|Canis lupus familiaris_Boxer dog|P|V-region|
[0535] gaagtgcagctggtggagtctgggggaagacctggtgaagccaggggggtccctgagactctcctgtgtgacctctggattcaccttcagtaggtatgccatgagctgggtcggccaggctccagggaagggcctgcagtgggttgcagctattagcagtagtggaagtagcacatactacgtagatgctgtgaagggccgattcaccatctccatagacaacgccaagaacatggtgtatctgcagatgaacagcctgagagctgaggatattgctgtgtattactgtgggaagga gaagtgcagctggtggagtctgggggaagacctggtgaagccaggggggtccctgagactctcctgtgtgacctctggattcaccttcagtaggtatgccatgagctgggtcggccaggctccagggaagggcctgcagtgggttgcagctattagcagtagtggaagtagcacatactacgtagatgctgtgaagggccgattcaccatctccatagacaacgccaagaacatggtgtatctgcagatgaacagcctgagagctgaggatattgctgtgtattactgtgggaagga
[0536] SEQ ID NO.45 IGHV3-43(P)
[0537] >IGHV3-43*01|Canis lupus familiaris_Boxer|P|V-region|
[0538] aaggtgtagctggtggagtctgggggagacctgatgaagcctgggggttccctgagactgtcctgtgtggcctctggattcaccttcaggagctatggcatgagctgggtctgccaggcttcagggaaggggctgcagtgggtcgcagctattagctatgatggaaggagcacatactacacagacactgtgaagggccgattcaccatctccagagacaatggcaagaacacgctgtacctgcagatgaacagcttgagagctgaggacacggccgtgtattactgtgcgagtga aaggtgtagctggtggagtctgggggagacctgatgaagcctgggggttccctgagactgtcctgtgtggcctctggattcaccttcaggagctatggcatgagctgggtctgccaggcttcagggaaggggctgcagtgggtcgcagctattagctatgatggaaggagcacatactacacagacactgtgaagggccgattcaccatctccagagacaatggcaagaacacgctgtacctgcagatgaacagcttgagagctgaggacacggccgtgtattactgtgcgagtga
[0539] SEQ ID NO.46 IGHV3-44(ORF)
[0540] >IGHV3-44*01|Canis lupus familiaris_Boxer|ORF|V-region|
[0541] gaggtgcagctggtggagtctgggggagacctggtgaagcctgggggttccctgagactctcatgtgtgacttctggattcaccttcagtagctattggatgagctgtgtccgccaggctccagggaaggagctgcagtgggtcgcgtacattaacagtggtggaagtagcacatggtacacagacgctgtgaagggtcgattcaccatctccagagacaacgccaagaacacgctgtatctgcagatgaacaacctgagagccgaagacacggccgtgtattactgtgcgaggga
[0542] SEQ ID NO.47 IGHV3-45(P)
[0543] >IGHV3-45*01|Canis lupus familiaris_Boxer|P|V-region|
[0544] gaagtacagctgctggagtctgggggagaccgagtgaaacctggggggtcccagagactctcctgtgtggcctcaaggttcaccttcagtagctacagcatgcattgtctccgtcagtctcctgggatggggctacagtgggtcacatacattagcagtaatggaagcagcacatactatgcagacgctgtgaagggtcgattcaccatctccagagacaaagccaagaacatgctttatctacagatgaacagcctgagagctcaggacatagccctgtattactgtgcagatg
[0545] SEQ ID NO.48 IGHV3-46(F)
[0546] >IGHV3-46*01|Canis lupus familiaris_Boxer|F|V-region|
[0547] gaggtacagctggtggagtctggggaagatttggtgaagcctggagggtccctgagactctcctgtgtggcctctggattcaccttcagtagcagtgaaatgagctgggtccaccaggctccagggcaggggctgcagtgggtctcatggattaggtatgatggaagtagctcaaggtatgcagacactgtgaagggccgattcaccatctccagagacaatgccaagaacacgctgtatctgcagatgaacagcctgagagccgaggacacggccatatattactgtgcaga
[0548] SEQ ID NO.49 IGHV3-47(F)
[0549] >IGHV3-47*01|Canis lupus familiaris_Boxer dog|F|V-region|
[0550] gaggtgcagctggtggagtctgggggagacctggcgaagcctggggggtccctgagactctcctgtgtggcctctggattaaccttcagtagctacagcatgagctgggtccgccaggctcctgggaaggggctgcagtgggtcacagctattagctatgatggaagtagcacatactacactgacgctgtgaagggccgattcaccatctccagagacaacgccaggaacacagtgtatctgcagatgaacagcctgagagccgaggacacagctgtgtattactgtgtgga
[0551] SEQ ID NO.50 IGHV3-47-1(P)
[0552] >IGHV3-47-1*01|Canis lupus familiaris_Boxer dog|P|V-region|
[0553] gaggtgccactggtggaatctgggggagagctggtgaagcctggggggtccctgagactctcctttgtagcctctgcattcactttcagtagttactggataagctgggtccgccaagctccagggaaagggctgcactgagtctcagtaattaacaaagatggaagtaccacataccacgcagatgctgtgaagggccgattcaccatctccagagacaatgccaagaacacgctgtatctgcagatgaacagcctgagagctgaggacacggctgtgtattactgtgcaca
[0554] SEQ ID NO.51 IGHV3-48(P)
[0555] >IGHV3-48*01|Canis lupus familiaris_Boxer|P|V-region|
[0556] gaggagcagttggtgaaatctaggggagacctggtgaagcctggcgggtccctgagactcttctgtgagtcctctacattcacctttcatagcaacagcatacattggctccaccagtctcccggtagtggctacagtgggtcatatccaatagcagtaatggaagtagcatgtactatgcagacgctgtaaagggctgattcaccatctccagagacagcaccaggaacatgctgtatctgcagatgaacagcctgagagctgaggacacagccgtgcattgctgtgcgaggga
[0557] SEQ ID NO.52 IGHV3-49(P)
[0558] >IGHV3-49*01|Canis lupus familiaris_Boxer|P|V-region|
[0559] gaggtgcagctggtggagtctgggggagacctcatgaagcctggggggtccctgagactctcctgtgtggccgctggattcaccttcagtagctacagcatgagctgggtccgccaggctcccgggaaggggattcagtgggtcgcatggatttaagctagtggaaatagcacaagctacacagatgctgtgaagggccgattcaccatctccagagaacgccaagaacacagtgtttctgcagatgaacagcctgagagctgaggacaaggccatgtattactgtgcgaggga
[0560] SEQ ID NO.53 IGHV3-50(F)
[0561] >IGHV3-50*01|Canis lupus familiaris_Boxer|F|V-region|
[0562] gaggtgcagctggtggagtctgggggagacctggtgaagcctggggggtccttgagactctcctgtgtggcctctggtttcaccttcagtagcaacgacatggactgggtccgccaggctccagggaaggggctgcagtggctcacacggattagcaatgatggaaggagcacaggctacgcagatgctgtgaagggccgattcaccatctccagagacaacgccaagaacacgctgtatctgcagatgaacagcctgagagctgaggacacagccgtgtattactgtgcgaagga
[0563] SEQ ID NO.54 IGHV3-51(P)
[0564] >IGHV3-51*01|Canis lupus familiaris_Boxer|P|V-region|
[0565] gaggtgcagctggaggagtctgggggagacctggtgaagcctggggttccctaagactgtcctgtgtgacctccggattcactttcagtagctatgccatgcactgggtccgccaggctccagggaaggggctgcagtgggtcgcagttattagcagggatggaagtagcacaaactacgcagacgctgtgaagggccgattcaccatctccagagacaacgccaagaacatgctgtatctacagatgaacagcctgagagctgaggacacggccatgtattactgtgcgaagga
[0566] SEQ ID NO.55 IGHV3-52(P)
[0567] >IGHV3-52*01|Canis lupus familiaris_Boxer|P|V-region||
[0568] gaagtgcagctggtggagtatgggggagagctggtgaagcctggggggtccctgagactgtcctgtgtggcctccggattcaccttcagtatctactacatgcactgggtccaccaggctccagggaaggggctgcagtggttcgcatgaattaggagtgatggaagtagcacatactacactgatgctgtgaagggccgattcaccatctccagagacaattccaagaacactctgtatctgcagatgaccagcctgagagccgaggacacggccctatattactgtgcgatgga
[0569] SEQ ID NO.56 IGHV3-53(P)
[0570] >IGHV3-53*01|Canis lupus familiaris_Boxer|P|V-region|
[0571] gagatgcagctggtggagtctagggaggcctggtgaagcctggggggtccctgagactctcctgtgtggaccctggattcaccttcagtagctactggatgtactgggtccaccaggctccagggatggggctgcagtggcttgcagaaattagcagtactggaagtagcacaaactatgcagacgctgtgaggggcccattcaccatctccagagacaatgccaagaacacgctgtacctgcaggtgaacagcctgagagccgaagacacggccgtgtattactgtgtgagtga
[0572] SEQ ID NO.57 IGHV3-54(F)
[0573] >IGHV3-54*01|Canis lupus familiaris_Boxer dog|F|V-region|
[0574] gaggtgcagctggtggagtctgggggagacctgatgaagcctggggggtccctgagactctcctgtgtggcctccggattcactatcagtagcaactacatgaactgggtccgccaggctccagggaaggggctgcagtgggtcggatacattagcagtgatggaagtagcacaagctatgcagacgctgtgaagggccgattcaccatctccagagacaatgccaagaacacgctgtatctgcagatgaacagcctgagagccgaggacacggccgtgtattactgtgtgaaggga
[0575] SEQ ID NO.58 IGHV3-55(P)
[0576] >IGHV3-55*01|Canis lupus familiaris_Boxer dog|P|V-region|<00024,29>
[0577] gaggtgcagctggtggagtctggggaaacctggtgaagcctggggagtctctgagactctcttgtgtggcctctggattcaccttcagtagctactggatgcattgggtctgccaggctccagggaaagggttggggtgggttgcaattattaacagtggtggaggtagcacatactatgcagacacagtgaagggccaattcaccatcttcagagacaatgccaagaacatgctgtatctgcagatgaacagcctgagagcccaggacatgaccgcgtattactgtgtgagtga
[0578] SEQ ID NO.59 IGHV3-56(P)
[0579] >IGHV3-56*01|Canis lupus familiaris_Boxer dog|P|V-region|
[0580] gaggtgcagctggtggaatctgggggagacctggtgaagcctgggggatccctgagactctcctgtgtggcctctggattcaccttcagtagctactatatggaatgggtctgccaggctccagggaggggctgaagtgggtcgcacggattagcagtgacggaagtagcacatactacacagacgctgtgaagggccgattcaccatctccagagacaatgccaagacggccgtgtattactgtgcgaagga
[0581] SEQ ID NO.60 IGHV3-57(P)
[0582] >IGHV3-57*01|Canis lupus familiaris_Boxer dog|P|V-region|
[0583] gaagtgcagcttgtggagtctgggggagagctggtgaagcctgggggttccctgagactgtcctgtgtggcctctggattcaccttcagtagctactacatgcactgggtctgcaggctccagggaaggggctgcagtgggttgcaagaattaggagtgatggaagtagcacaagctacccagacgctgtgaagggcagattcaccatctccagagacaattccaagaacactctgtatctgcagatgaacagcctgagagctgatgatacggccctatattactgtgcaaggga
[0584] SEQ ID NO.61 IGHV3-58(F)
[0585] >IGHV3-58*01|Canis lupus familiaris_Boxer|F|V-region|
[0586] gaggtgcagctggtggagtctgggggagacctggtgaagcctgggggatccctgagactctcttgtgtggcctccggattcaccttcagtagccatgccaagagctgggtccgccaggctccagggaaggggctgaagtgggtagcagttattagcagtagtggaagtagcacaggctccgcagacactgtgaagggccgattcaccatctccagagacaatgccaagaacacgctgtatctgcagatgaacagcctgagagctgaggacacagccgtgtattactgtgcgaagga
[0587] SEQ ID NO.62 IGHV3-59(P)
[0588] >IGHV3-59*01|Canis lupus familiaris_Boxer|P|V-region|
[0589] gaggtacagctggtggagtctggaggagaccttgtgaagactgagcggtccctgagactctcctgtgtggcctctggattcaccttcagtagcttctacatgaggtgtctgccagactccagggaagggactacagtgggttgcagaaattagcagtagtggaagtagcacaagctacacagatgctctgaagggctgattctccatctccaaaaacaatgccaagaacacgctgtatctgcagatgaacagcctgagagccgaggtcacagccgtatattactgtgcaaggta
[0590] SEQ ID NO.63 IGHV3-60(P)
[0591] >IGHV3-60*01|Canis lupus familiaris_Boxer|P|V-region|
[0592] gaggtgaagctggtggagtctgggggagacctgttgaagcctgggggatcaattaaactctcctatgtgacctctggattcaccttcaggagctactggatgagctgggtcagccaggctccagggaaggggctgcagtgggtcacatgggttaatactggtggaagcagcaaaagctatgcagatgctgtgaaggggcaattcaccatctccagagacaatgccaagaacacgctgtatctgcatatgaacagcctgatagccctgtattattgtgtgagtga
[0593] SEQ ID NO.64 IGHV3-61(F)
[0594] >IGHV3-61*01|Canis lupus familiaris_Boxer|F|V-region|
[0595] gaggtgcagctggtggagtctggtggaaacctggtgaagcctgggggttccctgagactgtcctgtgtggcctctggattaaccttctatagctatgccatttactgggtccacgaggctcctgggaaggggctgcagtgggtcgcagctattaccactgatggaagtagcacatactacactgacgctgtgaagggccgattcaccatctccagagacaatgccaagaacacgctgtatctgcagatgaacagcctgagagctgaggacatgcccgtgtattactgtgcgaggga
[0596] SEQ ID NO.65 IGHV3-62(P)
[0597] >IGHV3-62*01|Canis lupus familiaris_Boxer dog|P|V-region|
[0598] gaggagcagctggtggagtctcggggagatctggtgaagtctggggggtccctgagactctcctgtgtggccccttgattcaccttcagtaactgtgacatgagctgggtccattaggctccaggaaagggctgcagtgtgttgcatacattagctatgatggaagtagcacaggttacaaagacgctgtgaagggccgattcaccatctccagagacaacgccaagaacatgctgtatcttcagatgaacagcctgagagctgaggacacggctctgtattactgtgcaga
[0599] SEQ ID NO.66 IGHV3-63(P)
[0600] IGHV3-63*01|Canis lupus familiaris_Boxer dog|P|V-region|
[0601] gaggagcagttggtgaaatctaggggagacctggtgaagcctggcgggtccctgagactcttctgtgagtcctctacgttcacctttcatagctacagcatgcattggctccaccagtctcccggtagtggctacagtgggtcatatccaatagcagtaatggaagtagcatgtactatgcagacgctgtaaagggctgatacaccatctccagagacaacaccaggaacatgctgtatctgcagatgaataacctgagagctgaggacacagccgtgcattgctgtgcgaggga
[0602] SEQ ID NO.67 IGHV3-64(P)
[0603] >IGHV3-64*01|Canis lupus familiaris_Boxer dog|P|V-region|
[0604] gaggtgcagctggtggagtctgcgggagaccccgtgaagcctggggggtccctgagactctcctgtgtggccgctggattcaccttcagtagctacagcatgagctgggtccgccaggctcccgggaaggggatgcagtgggtcgcatggatatatgctagcggaagtagcacaagctacgcagacgctgtgaagggccgattcaccatctccagagacaacgccaagaacacactgtttctgcagatgcctgagagctgaggacacggccatgtattcctgtgcagggga
[0605] SEQ ID NO.68 IGHV3-65(P)
[0606] >IGHV3-65*01|Canis lupus familiaris_Boxer dog|P|V-region
[0607] |gatgtacagctggtggagtctgggggagacctggtgaagcctggggggtccctgagactgtcctgtgtggcctctggattcacctgcagtagctactacatgtactagacccaccaaattccagggaaggggatgcagggggttgcacggattagctatgatggaagtagcacaagctacaccgacgcaatgaaaggccgattcaccatctccagagacaacgccaagaacatgctgtatctgcaatgaacagcctgagagccgaggacacagccgtgtattactgtgtgaagga
[0608] SEQ ID NO.69 IGHV3-66(P)
[0609] >IGHV3-66*01|Canis lupus familiaris_Boxer|P|V-region|
[0610] gaggtgcagctggtggagtctggcggagacctggtgaagcctgggcggtccctgagactgtcctgtatggcctctggattcacttcagtagctacagcatgagctgtgtccgccaggctcctgggaagggctgcagtgggtcgcaaaaattagcaatagtggaagtagcacatactacacagatgctgtgaagggccgattcaccatctccagagacaatgccaagaacacgctctatctgcagatgaacagcctgagagccgaggacacggccttgtattactgtgcaga
[0611] SEQ ID NO.70 IGHV3-67(F)
[0612] >IGHV3-67*01|Canis lupus familiaris_Boxer|F|V-region|
[0613] gaggtgcagctggtggagtctgggggagacctggtgaagcctggggggtccctgagactgtcctgtgtggcctctggattcaccttcagtagctactacatgtactgggtccgccaggctccagggaaggggcttcagtgggtcgcacggattagcagtgatggaagtagcacatactacgcagacgctgtgaagggccgattcaccatctccagagacaatgccaagaacacgctgtatctgcagatgaacagcctgagagccgaggacacggctatgtattactgtgcaaagga
[0614] SEQ ID NO.71 IGHV3-68(P)
[0615] >IGHV3-68*01|Canis lupus familiaris_Boxer|P|V-region|
[0616] gaagtgcagctggtggagtctgggggagagctggtgaagcctggggggtccctgagactctcctgtgtggcctctggattcaccttcagtagctactacatgtactgggtccgccaggctccagggaaatggctgctgtgggtcacatgaattaggagtgatggaagtagcacatatacactgatgctgtgaaggaccgatacaccatctccaaagacaattccaagaacattctgtatctgcagatgaacagcctgagagccaaggacacggccctatatccctgtgcaatgga
[0617] SEQ ID NO.72 IGHV3-69(F)
[0618] >IGHV3-69*01|Canis lupus familiaris_Boxer|F|V-region|[[ID=十六]] [[ID=十七]]
[0619] gaggtacagctggtggagtctgggggagacctggtgaagcctgggggatccctgagactgtcctgtgtggcctctggattcaccttcagtagctatgccatgagctgggtccgccaggctccagggaaggggctgcagtgggtcgcatacattaacagtggtggaagtagcacatactacgcagatgctgtgaagggccggttcaccatctccagagacaatgccaggaacacactgtatctgcagatgaacagcctgagatccgaggacacagccgtgtattactgtccgaagga
[0620] SEQ ID NO.73 IGHV3-70(F)
[0621] >IGHV3-70*01|Canis lupus familiaris_Boxer|F|V-region|
[0622] gaggtgcagctggtggagtctggaggagaccttgtgaagcctgagcggtccctgagactctcctgtgtggcctctggattcaccttcagtagcttctacatgagctggttctgccaggctccagggaaggggctacagtgtgttgcagaaattagcagtagtggaaatagcacaagctacgcagacgctgtgaagggccgattcaccatctccagagacaacgccaagaacacgctgtatctacggatgcacagcctgagagccgaggacacggctgtatattactgtgcaaggta
[0623] SEQ ID NO.74 IGHV3-71(P)
[0624] >IGHV3-71*01|Canis lupus familiaris_Boxer|P|V-region|
[0625] gaggtgaagctggtggagtgtgggggagacctggtgaagcccgggggatcgattagactctcctttgtgacctctggattcaccttcaggagctattggatgggctgtgtcagccaggctccagggaaggggctgcagtgggtcacatgggttaatactggtggaagcagcaaaagctatgcagatgctatgaaggggcgatttaccatctccaggcacaaagccaagaacacactatctgcatatgaacagcctgagagccgtgtattattgtgtgagtga
[0626] SEQ ID NO.75 IGHV3-72(P)
[0627] >IGHV3-72*01|Canis lupus familiaris_Boxer dog|P|V-region|
[0628] gaggtgcagctggtggagtctggcggagacctggtgaagcctggggattccctgagactgtcctgtgtggcctctggattcaccttcagtagctatgccatgagctgggtccgccaggctcctaggaaggggctgcagtgggtcggatacattagcagtgatggaagtagcacataatacgcagacgctgtgaagggccgattcaccatttccagagacaatgccaagaacacgctgtatctgcagatgaacagcctgagagctgaggatacggccctgtataactgtgcaaggga
[0629] SEQ ID NO.76 IGHV3-73(P)
[0630] >IGHV3-73*01|Canis lupus familiaris_Boxer dog|P|V-region|
[0631] gaggtgcagctgatggagtctgggggagacctggtgaagcctggggggtccctgagactctcctgtgtggcccctggattcaccttcagtaactatgacatgagctcggtccattagactccaggaaagggctgcagtgtattgcatatattagctatgatggaagtagcacaggttacaaagacgctgtgcagggccgattcaccatctccagagacaacgccaagaacacgctgtatcttcagatgaacagcctgagagctgagcacacggccctgtattactgtgcaga
[0632] SEQ ID NO.77 IGHV3-74(P)
[0633] >IGHV3-74*01|Canis lupus familiaris_Boxer dog|P|V-region|
[0634] gaggtgcagctggtggagtctgggggagacttggtgaagccttgtgggctcctgagactctcctgtgtggcttctggattcaccttcagtagctacatcatgagctgggtccgccaggctccagggaagtggctgcagtgggtcgcatacattaacagtggtggaagtagcacaaggtacacagatgctgtgaagggccgattcacctctccagagacaacgccaagaacatgctgtatctgcagttgaacagcctgagagccgaggacaccgctgtgtattactgtgcgaggga
[0635] SEQ ID NO.78 IGHV3-75(F)
[0636] >IGHV3-75*01|Canis lupus familiaris_Boxer dog|F|V-region|
[0637] gaattgcagctggtggagcttgggggagatctggtgaagccaggggggtccctgagactctcctgtgtggcctctggattcaccttcagtagctatgccatgagttgggtctgccaggctccagggaaggggctgcagtgggttgcagctattagcagtagtggaagtagcacataccatgtagacgctgtgaagggccgattcaccatctccagagacaacgccaagaacacagtgtatctgcagatgaacagcctgagagccgaggacacggccgtgtattactgtgcaga
[0638] SEQ ID NO.79 IGHV3-76(F)
[0639] >IGHV3-76*01|Canis familiaris_Boxer|F|V-region|
[0640] gaggtgccactggtggaatctgggggagagctggtgaagcctgaggggtccctgagattctcctgtgtagcctctggattcactttcagtagttactggataagctgggtccgccaagctccagggaaagggctgcactgggtctcagtaattaacaaagatggaagtaccacataccacgcagatgctgtgaagggccgattcaccatctccagagacaatgccaagaacacgctgtatctgcagatgaacagcctgagagctgagggcacgactgtgtattactgtgcaca
[0641] SEQ ID NO.80 IGHV3-77(P)
[0642] >IGHV3-77*01|Canis familiaris_Boxer|P|V-region|
[0643] gaggagcagttggtgaagtctgggggagacctggtgaagcttggcaggtccctgagtcctctacattcacctttcatagctacagcatgcattggctccaccagtctcccggtagtggctacagtgggtcatatccaatagcagtaatggaagtagcatgtactatgcagacgctgtaaagggttgattcaccatctccagagacaacaccaggaacacgctgtatctgcagatgaacagcctgagagccgacgacacggccgtgtgttgctgtgcgaggga
[0644] SEQ ID NO.81 IGHV3-78(P)
[0645] >|IGHV3-78*01| Canis lupus familiaris_Boxer dog|P|V-region|
[0646] gaggtgcagctggtggagtctgggggagaccttgtgaagccggaggggtccctgagactctcctgtgtggccgctggattcacctttagtagctacagcatgagctgggtccgccaggctcccgggaagggggtgcagtgggtcacatagatttatgctagtggaagtagcacaagctacacagatgctgtgaagggccgattcaccatctccagagacaacgccaagaacacagtgtttctgcagatgaacagcctgagagctgagaacacggccatgtattcctgtgcaaggga
[0647] SEQ ID NO.82 IGHV3-79(P)
[0648] >IGHV3-79*01| Canis lupus familiaris_Boxer dog|P|V-region|
[0649] tggggaattccctctggtgtggcctctggattcacctgcagtagctccctcacctccctctcctgtgtggcctctagattcaccttcagtagctactacatatactgtatccaccaagctccagggaaggggctgcaggtggtcgcatggattagctatgatggaagtagaacaagctacgccgacgctatgtagggccaattcatcatctccagagaaaacaccaagaacacgctgtatctgtagatgaacagcctgagtgccaaggacacggcactatatccctgtgcgaggaa
[0650] SEQ ID NO.83 IGHV3-80(F)
[0651] >IGHV3-80*01|Canis lupus familiaris_Boxer|F|V-region|
[0652] gaggtgcagctggtggagtctgggggagatctggtgaagcctgggggatccctgagactctcttgtgtggcctctggattcaccttcagtagctactacatggaatgggtccgccaggctccagggaaggggctgcagtgggtcgcacagattagcagtgatggaagtagcacatactacccagacgctgtgaagggtcaattcaccatctccagagacaatgccaagaacacgctgtatctgcagatgaacagcctgggagccgaggacacggccgtgtattactgtgcaaagga
[0653] SEQ ID NO.�4 IGHV3-81(F)
[0654] >IGHV3-81*01|Canis lupus familiaris_Boxer|F|V-region|
[0655] It should be noted that there may be some inaccuracies in the text due to the complexity of the original sequence. It is recommended to double-check with the relevant biological or technical experts for more accurate understanding and use.gaggtgcagctggtggagtctggaggaaacctggtgaagcctggggggtccctgagactctcttgtgtggcctctggattcaccttcagtagctactacatggactgggtccgccaggctccagggaagaggctgcagtgggtcgcagggattagcagtgatggaagtagcacatactacccacaggctgtgaagggccgattcaccatctccagagacaacgccaagaacacgctctatctgcagatgaacagcctgagagccgaggactctgctgtgtattactgtgcgatgga
[0656] SEQ ID NO.85 IGHV3-82(F)
[0657] >IGHV3-82*01|Canis lupus familiaris_Boxer|F|V-region|
[0658] gaggtgcagctggtggagtctggaggagacctggtgaagtctggggggtccctgagactctcttgtgtggcctctggattcaccttcagtagctactacatgcactgggtccgccaggctacagggaaggggctgcagtgggtcacaaggattagcaatgatggaagtagcacaaggtacgcagacgccatgaagggccaatttaccatctccagagacaattccaagaatacgctgtatctgcagatgaacagccagagagccgaggacatggccctatattactgtgcaaggga
[0659] SEQ ID NO.86 IGHV3-83(P)
[0660] >IGHV3-83*01|Canis lupus familiaris_Boxer|P|V-region|
[0661] gagttgcagctggtagagtctgggggagacctggtgaagcctggggggtctctgagactttcttgtgtgtcctctggattcaccttcagtagctactggatgcactgggtcctccaggctccagggaaagggctggagtgggtcgcaattattaacagtggtggaggtagcatatactacgcagacacagtgaagggccgattcaccatctccagagaaaacgccaagaacacgctctatctgcagatgaacagcctgagagctgaggacagggccatgcattactgtgcgaaggga
[0662] SEQ ID NO.87 IGHV4-1(F)
[0663] >IGHV4-1*01|Canis familiaris_Boxer dog|F|V-region|
[0664] gaactcacactgcaggagtcagggccaggactggtgaagccctcacagaccctctctctcacctgtgttgtgtccggaggctccgtcaccagcagttactactggaactggatccgccagcgccctgggaggggactggaatggatggggtactggacaggtagcacaaactacaacccggcattccagggacgcatctccatcactgctgacacggccaagaaccagttctccctgcagctgagctccatgaccaccgaggacacggccgtgtattactgtgcaagaga
[0665] SEQ ID NO.88 IGHV(II)-1(P)
[0666] >IGHV(II)-1*01|Canis familiaris_Boxer dog|P|V-region|
[0667] ctggcacccctgcaggagtctgtttctgggctggggaaacccaggcagatccttacactcacctgctccttctctgggttcttattgagcatgtcagtatgggtgtcacatgggtcctttacccaccaggggaaggcactggagtcaatgccacatctggtgggagaacgctaagtaccacagcctgtctctgaacagcagcaagatgtatagaaagtccaacacttggaaagataaaggattatgtttcacaccagaagcacatctattcaacctgatgaacagccagcctgat
[0668] SEQ ID NO.89 IGHV(II)-2(P)
[0669] >IGHV(II)-2*01|Canis familiaris_Boxer|P|V - region|
[0670] ctggcacccctgcaggagtctgtttctgggctggggaaacccaggcagacccttacactcacctgctccttctctgggttcttattgagcatgtcagtgtgggtgtcacatgggtcctttacccaccaggggaaggcactggagtcaatgccacgtctggtgggagaacactaagtaccacagcctgtctctgaacagcagcaagatgtatagaaagtccaacacttggaaagataaaggattatgtttcacaccagaagcacatctattcaacctgatgaacaatcagcctgatgaga
[0671] Germline D sequence
[0672] SEQ ID NO.90 IGHD1(F)
[0673] >IGHD1*01|Canis familiaris_Boxer|F|D - region|
[0674] gtactactgtactgatgattactgtttcaac
[0675] J SEQ ID NO.91 IGHD2(F)
[0676] >IGHD2*01|Dog_Boxer|F|D-Area|
[0677] ctactacggtagctactac
[0678] SEQ ID NO.92 IGHD3(F)
[0679] >IGHD3*01|Dog_Boxer|F|D-Area|
[0680] tatatatatatggatac
[0681] SEQ ID NO.93 IGHD4(F)
[0682] >IGHD4*01|Dog_Boxer|F|D-Area|
[0683] gtatagtagcagctggtac
[0684] SEQ ID NO.94 IGHD5 (ORF)
[0685] >IGHD5*01|Dog_Boxer|ORF|D-Region|
[0686] agttctagtagttggggct
[0687] SEQ ID NO.95 IGHD6(F)
[0688] >IGHD6*01|Dog_Boxer|F|D-Area|
[0689] ctaactggggc
[0690] Germline JH sequence
[0691] SEQ ID NO.96 IGHJ1 (ORF)
[0692] >IGHJ1*01|Dog_Boxer|ORF|J-Region|
[0693] tgacatttactttgacctctggggcccgggcaccctggtcaccatctcctcag
[0694] SEQ ID NO.97 IGHJ2(F)
[0695] >IGHJ2*01|Dog_Boxer|F|J-Area|
[0696] aacatgattacttagacctctggggccagggcacctggtcaccgtctcctcag
[0697] SEQ ID NO.98 IGHJ3(F)
[0698] >IGHJ3*01|Dog_Boxer|F|J-Area|
[0699] caatgcttttggttatactggggccagggcacctggtcactgtctcctcag
[0700] SEQ ID NO.99 IGHJ4(F)
[0701] >IGHJ4*01|Dog_Boxer|F|J-Area|
[0702] ataattttgactactggggccagggaaccctggtcaccgtctcctcag
[0703] SEQ ID NO.100 IGHJ5(F)
[0704] >IGHJ5*01|Dog_Boxer|F|J-Area|
[0705] acaactggttctactactggggccaagggaccctggtcactgtgtcctcag
[0706] SEQ ID NO.101 IGHJ6(F)
[0707] >IGHJ6*01|Dog_Boxer|F|J-Area|
[0708] attactatggtatggactactggggccatggcacctcactcttcgtgtcctcag
[0709] Table 2. Canine Igκ sequence in...
Claims
1. A transgenic rodent cell comprising a genome comprising an engineered portion of a canine immunoglobulin light chain locus, wherein the engineered portion of the canine immunoglobulin light chain locus comprises a canine immunoglobulin lambda light chain variable region gene segment, Among them, rodents κ The gene segment coding sequence is replaced by one or more canine V λ Gene segment coding sequence replacement, Among them, rodents κ The gene segment coding sequence is replaced by one or more Canis species. λ Gene segment coding sequence replacement, Among them, rodents C κ The coding sequence has been identified by rodent C λ1 、C λ2 or C λ3 Coding sequence substitutions, wherein the engineered portion of the canine immunoglobulin light chain locus comprises a canine V C sequence embedded in a rodent non-coding regulatory or scaffold sequence of a rodent immunoglobulin kappa light chain variable region locus. λ and J λ gene segment coding sequence; and wherein the engineered portion of the canine immunoglobulin light chain locus is capable of expressing immunoglobulins comprising canine variable domains, and wherein the transgenic rodent cells produce more immunoglobulins comprising lambda light chains than immunoglobulins comprising kappa light chains, or are more likely to produce immunoglobulins comprising lambda light chains than immunoglobulins comprising kappa light chains.
2. The transgenic rodent cell of claim 1, wherein the transgenic rodent cell or its progeny has a probability of at least 90% to produce an immunoglobulin comprising a lambda light chain.
3. The transgenic rodent cell of claim 1 , wherein the engineered portion of the canine immunoglobulin light chain locus comprises one or more canine V λ gene segment coding sequence and one or more JC units, wherein each JC unit comprises a canine J λ gene segment coding sequence and a rodent lambda constant region coding sequence, wherein the rodent lambda constant region coding sequence comprises a rodent C λ1 、C λ2 、C λ3 coding sequences or combinations thereof.
4. The transgenic rodent cell of claim 3, wherein the one or more canine V λ The gene segment coding sequence is located upstream of the one or more JC units, wherein each JC unit comprises a canine J λ Gene segment coding sequence and rodent C λ Coding sequence.
5. The transgenic rodent cell of claim 3, wherein the one or more canine V λ The gene segment coding sequence is located upstream of the one or more JC units, wherein each JC unit comprises a canine J λ Gene segment coding sequence and rodent C λ coding sequence and rodent C λ Non-coding sequences.
6. The transgenic rodent cell of claim 1 , wherein the endogenous rodent immunoglobulin kappa light chain locus is replaced by one or more of: a. Deletion or mutation of all endogenous rodent V κ Gene segment coding sequence; b. Deletion or mutation of all endogenous rodent J κ Gene segment coding sequence; c. Deletion or mutation of all endogenous rodent C κ Coding sequence; d. Deletion or mutation of rodent C κ the 5′ splice site and adjacent polypyrimidine region of the coding sequence; e. Deletion, mutation or disruption of the endogenous intronic kappa enhancer (iE κ ) and a 3' enhancer sequence.
7. The transgenic rodent cell of claim 1 , wherein the engineered portion of the canine immunoglobulin light chain locus comprises a rodent intronic kappa enhancer (iE κ ) and 3'E κ Regulatory sequences.
8. The transgenic rodent cell of claim 1 , wherein the transgenic rodent cell comprises an engineered portion of a canine immunoglobulin heavy chain locus comprising a canine immunoglobulin heavy chain variable region gene coding sequence and non-coding regulatory or scaffold sequences of the rodent immunoglobulin heavy chain locus.
9. The transgenic rodent cell of claim 8, wherein the engineered portion of the canine immunoglobulin heavy chain locus comprises a canine V H , D and J H Gene segment.
10. The transgenic rodent cell of claim 9, wherein each canine V H , D or J H The coding gene segment comprises a V segment embedded in the non-coding regulatory or scaffold sequence of the rodent immunoglobulin heavy chain locus. H , D or J H Coding sequence.
11. The transgenic rodent cell of claim 10, wherein the heavy chain scaffold sequence is interrupted by a functional ADAM6A gene, ADAM6B gene, or a combination thereof.
12. The transgenic rodent cell of claim 1, wherein the rodent regulatory or scaffold sequence comprises an enhancer, a promoter, a splice site, an intron, a recombination signal sequence, or a combination thereof.
13. The transgenic rodent cell of claim 1, wherein an endogenous rodent immunoglobulin light chain locus has been replaced by the engineered portion of the canine immunoglobulin light chain locus.
14. The transgenic rodent cell of claim 1, wherein the transgenic rodent cell is a mouse or rat cell.
15. The transgenic rodent cell of any one of claims 1 to 14, wherein the transgenic rodent cell is a B lymphocyte lineage cell, and wherein the engineered portion of the canine immunoglobulin locus expresses a chimeric immunoglobulin heavy or light chain comprising a canine variable region and a rodent immunoglobulin constant region.
16. A hybridoma cell or immortalized cell line derived from the transgenic rodent cell of claim 15.
Citation Information
Patent Citations
Site-specific recombination of DNA in eukaryotic cells
US4959317A
Positive-negative selection methods and vectors
US5464764A
Cells and non-human organisms containing predetermined genomic modifications and positive-negative selection methods and vectors for making same
US5487992A
Transgenic mice depleted in a mature lymphocytic cell-type
US5591669A
Method and apparatus for closed loop recycling of contaminated cleaning solution
US5593598A