Alleles of the mads-box domain for controlling palm kernel shell phenotype

Abstract

Disclosed are sequences of nucleotides and polypeptides useful for predicting and controlling shell phenotype of palm.

Description

[0001] This application is a divisional application of application number 2016800475385, filed on June 14, 2016, with the title "Alleles of MADS-BOX domain for controlling palm kernel shell phenotype".

[0002] This application claims priority to U.S. Provisional Application No. 62 / 180,042, filed on June 15, 2015, the contents of which are hereby incorporated by reference in their entirety for all purposes. BACKGROUND

[0003] Oil palms (Elaeis guineensis and Elaeis oleifera) can be divided into different groups according to their fruit characteristics and have 3 naturally occurring fruit types that differ in shell thickness and oil yield. Dura type palms are homozygous for the wild type allele of the shell gene (sh + / sh + ) with thick seed coat or shell (2-8 mm) and produce about 5.3 tons of oil per hectare per year. Tenera type palms are heterozygous for the wild type and mutant alleles of the shell gene (sh + / sh - ) with relatively thin shell surrounded by a distinct fiber ring and produce about 7.4 tons of oil per hectare per year. Finally, pisifera type palms are homozygous for the mutant allele of the shell gene (sh - / sh - ) without seed coat or shell and are usually female sterile (Hartley, 1988) (Table 1). Thus, the genetic mechanism of a single gene controlling the shell phenotype is a major factor influencing palm oil yield.

[0004] Tenera palms are heterozygous between dura and pisifera palms. Whitmore (1973) described various fruit forms according to different classes of oil palm. However, Latiff (2000) agreed with Purseglove (1972) that the classes or cultivars proposed by Whitmore (1973) in the species did not have a strict sense. Therefore, Latiff (2000) proposed the term "race" to distinguish dura, pisifera and tenera. Races were considered as an appropriate term to reflect stable small species, where different races were able to exchange genes with each other, which was well established in different fruit forms of oil palm (Latiff, 2000). In fact, the characteristics of the three different races proved to be simply controlled by the genetic mechanism of a single gene. Genetic studies showed that the shell gene displayed a co-dominant single gene genetic mechanism, which could be used in breeding programs (Beirnaert and Vanderweyen, 1941).

[0005] The shell gene responsible for this phenotype was first reported in Belgian Congo in the 1940s (Beirnaert and Venderweyan, 1941). However, tenera fruit forms were already recognized and fully exploited in Africa before this (Devuyst, 1953; Godding, 1930; Sousa et al., 2011). Given the central role played by the shell gene, oil palm breeding was carried out using reciprocal recurrent selection with a dura (female) and pisifera (male) pool using a North Carolina Model 1 maize breeding design (Rajanaidu et al., 2000). The Deli dura population, which is the direct descendant of four original African palms (1848) planted at Bogor Botanical Garden in Bogor, Indonesia, has good combining ability with AVROS (Algemene Vereniging van Rubberplanters ter Oostkust van Sumatra) and other pisifera male palms. AVROS pisifera palms originated from the famous "Djongo" palms in Congo, but several different new dura and pisifera lines are also derived from Africa (Rajanaidu et al., 2000).

[0006] The tenera fruit type has a higher mesocarp / fruit ratio, which translates directly into significantly higher oil yield than dura and pisifera palms (as shown in Table 1).

[0007] Table 1: Comparison of dura, tenera and pisifera fruit forms

[0008]

[0009] * Usually female sterile, inflorescence rots prematurely

[0010] **Fiber ring is present in the mesocarp and is often used as a diagnostic tool to distinguish dura and tenera palms.

[0011] (Source: Hardon et al., 1985; Hartley, 1988)

[0012] Since the key to oil palm breeding programs is to produce planting material with high oil yield, tenera palms are the preferred choice for commercial plantations. For this reason, commercial seed producers invest significant resources in hybrid production selected from dura and pisifera palms. Despite the many advances made in the production of hybrid oil palm seeds, there are two important problems that still exist in the seed production process. First, batches of tenera seeds from tenera palms that produce high oil yield are often contaminated with dura seeds (Donough and Law, 1995). Today, it is estimated that dura contamination in tenera seeds can reach a proportion of about 5% (down from as high as 20-30% in the early 1990s as a result of improvements in quality control measures). Part of the reason for seed contamination is that workers manually pollinate tall trees using ladders in open planting conditions, and the maturation of a designated bunch of palm flowers takes place over a period of time, making it difficult to pollinate all the flowers in the bunch during a single manual pollination event, thus making it difficult to produce pure tenera seeds. Some of the flowers in the bunch can have matured before manual pollination, thus having the opportunity to be pollinated by unknown trees through wind pollination, thus producing contaminated seeds in the bunch. Or there can be immature flowers in the bunch at the time of manual pollination, and the immature flowers can mature after pollination has occurred, such that they can be pollinated by unknown trees through wind pollination, thus producing contaminated seeds in the bunch. Prior to describing the present invention, it was not possible to identify the type of fruit produced by a given seed or a given plant from seeds, unless it matured enough to produce the first batch of fruit, which usually takes about six years after germination. It is worth noting that during the four to five year interval from germination to fruit production, significant land, labor, capital and energy resources are invested in the planting of what is believed to be a tenera tree, some of which will end up being an undesirable low yield, contaminated fruit type. It is impractical to wait until these non-preferred trees are identified, removed from the field and replaced with tenera trees, thus obtaining lower palm oil yields for the 25-30 year production life of the contaminated trees. Thus, the problem of batches of tenera seeds being contaminated with dura or pisifera seeds is a challenge for oil palm plantations, emphasizing the need for a method to predict the type of fruit of seeds and seedlings with high accuracy.

[0013] A second problem in seed production is the investment that seed producers make in maintaining dura or pisifera lines, and other expenses incurred during hybrid seed production. Generally, there is no known method of producing trees with optimal shell phenotypes: when a tree with an optimal shell phenotype is crossed with itself or with another tree with an optimal shell phenotype, seeds of optimal shell phenotype are produced (and only produced). Thus, it is necessary to engineer the tree's genes from one generation to the next to breed true for optimal shell phenotype. It is also necessary to separate predicted tenera plants (e.g. seeds or seedlings) from any contaminating dura and / or pisifera plants produced during hybrid generation. Likewise, it is necessary to separate predicted tenera plants from pisifera and / or dura plants and predict pisifera plants from dura and / or tenera plants to maintain breeding banks for hybrid production.

[0014] Mayes et al. (1997) initially attempted to map the SHELL gene. A second group, in Brazil, reported two random amplified polymorphic DNA (RAPD) markers flanking the shell locus using a combination of bulked segregant analysis (BSA) and genetic mapping (Moretzsohn et al., 2000). More recently, Billotte et al. (2005) reported a high-density linkage map of oil palm based on simple sequence repeats (SSRs) including hybrids between tenera and dura palms. A patent application submitted by the Malaysian Palm Oil Board (MPOB) describes the identification of markers using restriction fragment technology, in particular restriction fragment length polymorphism (RFLP) markers linked to the shell gene for plant identification and breeding purposes (RAJINDER SINGH, LESLIE OOI CHENG-LI, RAHIMAH A. RAHMAN AND LESLIE LOW ENG TI. 2008, Method for identification of molecular markers linked to the shell gene of oil palm, Patent No. PI20084563, filed November 13, 2008). The RFLP marker (SFB 83) was identified by generating or constructing a genetic map for tenera fruit type palms. Patent applications published US 2013 / 024729 and US 2015 / 0037793 by MPOB describe the identification of two alleles of the SHELL gene (sh AVROS and sh MPOB ) and methods for predicting fruit form phenotypes by detecting the wild type and pisifera alleles of the SHELL gene. SUMMARY

[0015] Described herein are the identification of novel alleles of the SHELL gene for different fruit form phenotypes and methods for predicting or determining the shell phenotype of a palm plant, including but not limited to whole palm plants or palm seeds. The SHELL gene is an Elaeis oleifera MADS-box gene that is substantially similar to Arabidopsis SEEDSTICK (STK) also known as AGAMOUS-like 11 (AGL11) and Arabidopsis SHATTERPROOF (SHP1) also known as AGAMOUS-like 1 (AGL1).

[0016] When one copy of a mutated allele and one wild type allele of SHELL are present in Elaeis oleifera, two SHELL alleles have been previously identified, sh MPOB and sh AVROS Optionally, one can produce a preferred tenera fruit form. For example, a heterozygous Elaeis oleifera that includes a wild type SHELL allele Sh DeliDura exhibits a tenera phenotype on one chromosome and one of the two mutated SHELL alleles on the other chromosome.

[0017] Described herein are nine additional mutations at exon one of the SHELL gene, referred to as SHELL alleles three (3), four (4), five (5), six (6), seven (7), eight (8), nine (9), ten (10), and eleven (11). The amino acid sequences produced by alleles 3-11 are set forth in SEQ ID NOs: 3-11, respectively. The nucleotide sequences of exon 1 of the SHELL gene for alleles 3-11 are set forth in SEQ ID NOs: 13-21, respectively. Because of the sh MPOB and sh AVRO alleles, these existing SHELL alleles can produce a tenera phenotype when heterozygous with a wild type allele or a pisifera phenotype when homozygous or heterozygous with another non-functional SHELL allele.

[0018] Referring to the wild type SHELL (Sh DeliDura ) gene, the allele 3 polymorphism is a mutation from an adenine to a cytosine (A→C) at nucleotide position 67 of exon 1 of the SHELL gene. The allele 3 produces a substitution from lysine to glutamine within the conserved MADS box domain of SHELL. As shown in Figure 1 the entire MADS box domain of SHELL is encoded by exon 1 of the SHELL gene. The different amino acid appears 6 amino acids N-terminal to the amino acid substitution from sh MPOB allele. The different amino acid appears 8 amino acids N-terminal to the amino acid substitution from sh AVROSAmino acid substitution of the allele, and a translational open reading frame at position 23 of exon 1 Figure 2 and Figure 3 ).

[0019] Similarly, the allele 4 polymorphism is a mutation from cytosine to adenosine (C→A) at nucleotide position 122 of exon 1 of the SHELL gene. Allele 4 results in a substitution from alanine to aspartic acid within the conserved MADS box domain of SHELL. A different amino acid occurs at position 41 of the translational open reading frame of exon 1 Figure 2 and Figure 3 ).

[0020] The allele 5 polymorphism is a mutation from adenosine to thymine (A→T) at nucleotide position 69 of exon 1 of the SHELL gene. Allele 5 results in a mutation from lysine to asparagine at position 23 of the translational open reading frame of exon 1 Figure 2 and Figure 3 ). The allele 6 polymorphism is a mutation from guanosine to cytosine (G→C) at position 34 of exon 1 of the SHELL gene. Allele 6 results in a mutation from glutamic acid to glutamine at position 12 of the translational open reading frame of exon 1 Figure 2 and Figure 3 ). The allele 7 polymorphism is a deletion of 15 nucleotides at positions 23-37 of exon 1 of the SHELL gene (or nucleotides 22-36, as alignment of the gap is ambiguous). Allele 7 results in a frame deletion of 5 amino acids at positions 8-12 of the translational open reading frame of exon 1 Figure 2 and Figure 3 ). Amino acid positions 8-12 of the SHELL gene are encoded by nucleotides 22-36. The allele 8 polymorphism is a mutation from guanosine to adenosine (G→A) at position 71 of exon 1 of the SHELL gene. Allele 8 results in a mutation from arginine to histidine at position 24 of the translational open reading frame of exon 1 Figure 2 and Figure 3 ).

[0021] The allele 9 polymorphism is a mutation from cytosine to guanosine (C→G) at position 70 of exon 1 of the SHELL gene. Allele 9 results in a mutation from arginine to glycine at position 24 of the translational open reading frame of exon 1. The allele 10 polymorphism is a mutation from thymine to adenosine (T→A) at position 110 of exon 1 of the SHELL gene. Allele 10 results in a mutation from valine to aspartic acid at position 37 of the translational open reading frame of exon 1 Figure 2 and Figure 3 ).

[0022] Allele 11 diversity is a mutation from thymine to cytosine (T→C) at position 114 of exon 1 of the SHELL gene. Allele 11 is a silent mutation in which the amino acid sequence of the SHELL gene product is not affected. Figure 2 and Figure 3 ) can be detected to confirm or predict the presence or absence of the wild type SHELL gene product, and thus predict the dura phenotype when homozygotes or heterozygotes in a palm plant have another wild type allele, and predict the tenera phenotype when heterozygotes have an inactive SHELL allele. Alternatively, in some embodiments, the mutation can affect the gene expression and / or transcriptional or translational rules of the SHELL gene. According to these embodiments, the pisifera-associated mutation can be used when homozygotes or heterozygotes in a palm plant have an inactive SHELL allele, or the tenera-associated mutation can be used when heterozygotes have a wild type allele.

[0023] Also described herein is a mutation in intron 1 of the SHELL gene that has been found in a subset of oil palm plants having the allele 3 mutation. This mutation is referred to herein as allele 12 and is shown in SEQ ID NO: 12. This mutation results in a deletion of four nucleotides at positions 43-46 of intron 1 of the wild type SHELL (Sh DeliDura ) gene. This mutation can be silent in its own right for the contribution to the presence or absence of the SHELL fruit form phenotype (e.g., dura, tenera or pisifera). However, due to the close physical distance (i.e., genetic linkage) between the intron 1 mutation and exon 1, it is known that the contribution of a paternal germplasm having a particular SHELL allele (wild type or mutant) within the exon 1 and intron 1 markers can be tracked with high confidence by detecting the allele 12 mutation rather than the mutated exon 1 in the offspring. Moreover, in some cases, the mutation of intron 1 can be linked unequally with exon 1 or be part of it. Alternatively, allele 12 can alter transcriptional regulation or splicing, thus exhibiting a pisifera SHELL phenotype when homozygotes or tenera phenotype, heterozygotes have a wild type SHELL allele.

[0024] Nuclear proteins, such as transcription factors, must be actively transcribed and retained within the nucleus to be functionalized. Nuclear localization mechanisms include binding of a nuclear localization protein signal in the nuclear protein to importin alpha and importin beta subunits in the cytoplasm. Importin alpha binds to the nuclear localization signal (NLS), while importin B interacts with importin alpha as well as nuclear pores. In plant MADS box proteins, a prominent NLS amino acid motif is KR[K or R]X4KK (SEQ ID NO: 29), where X can be any amino acid (Gramzow and Theissen, 2010). The SHELL MADS box domain includes this motif at amino acids 23-31 (KRRNGLLKK; SEQ ID NO: 30). MADS box proteins can also have bipartite NLSs that include additional upstream amino acids. One example is the bipartite NLS of Petunia FLORAL BINDING PROTEIN 11 (FBP 11), which includes the sequence This bipartite NLS consists of NLS amino acids (underlined) as well as conserved basic amino acids (italicized), all of which contribute to nuclear localization mechanisms (Immink et al., 2002).

[0025] The SHELL MADS box domain includes a very similar bipartite NLS that includes amino acids 3, 5, 9-10, and 21-31 Figure 2 and Figure 3 Notably, ten sequence variations result in amino acid substitutions or deletions (sh AVROS , sh MPOB , and alleles 3-10) and six substitutions that introduce proline substitutions at variable positions within the prominent NLS (sh AVROS , shMPOB, allele 3, allele 5, allele 7, allele 8, and allele 9) that are expected to significantly alter the secondary structure of the protein within the NLS domain Figure 2 and Figure 3 These findings suggest that a common mechanism that confers the pisifera (when homozygous or heterozygous for another non-functional SHELL allele) or tenera (when heterozygous for a wild-type SHELL allele) phenotype can reduce or prevent nuclear localization of SHELL protein with non-functional SHELL protein or dimers of other MADS box transcription factors. Thus, it is likely that any one of the conserved NLS amino acids Figure 1 and Figure 2 in-frame), or any mutation that disrupts SHELL NLS function, can be associated with the pisifera or tenera phenotype. ​

[0026] Thus in one aspect, methods for determining or predicting the shell phenotype of a palm (e.g., oil palm) plant, including but not limited to a whole palm plant or a palm seed, are provided. In some embodiments, the methods comprise providing a sample from a plant or seed; and determining the genotype of a polymorphic marker at exon 1 position of a SHELL gene selected from the following nucleotides:

[0027] (i) 7, 8, 9, 13, 14, 15, 22, 23, 24, 25, 26, 27, 28, 29, 30, 31, 32, 33, 34, 35, 36, 37, 61, 62, 63, 64, 65, 66, 67, 68, 69, 70, 71, 72, 73, 74, 75, 76, 77, 78, 79, 80, 81, 82, 83, 84, 85, 87, 88, 89, 90, 91, 92, 109, 110, 111, 114, 121, 122, and 123;

[0028] (ii) 23, 24, 25, 26, 27, 28, 29, 30, 31, 32, 33, 34, 35, 36, 37, 67, 69, 70, 71, 110, 114, and 122; or

[0029] (iii) 7-9, 13-15, 25-30, 61-75, and 88-92. In some cases, heterozygosity for one or more polymorphic markers for pisifera alleles predicts the presence of tenera shell phenotype. In some cases, heterozygosity for the genotype of one or more polymorphic markers predicted pisifera alleles predicts the presence of pisifera shell phenotype. In some cases, the genotype of the polymorphic markers can include the genotype of one or more predicted pisifera alleles as set forth in SEQ ID NOs: 13-21.

[0030] In some cases, when a homozygote or heterozygote for a wild-type SHELL (Sh DeliDura ) gene has different mutations, mutations of the wild-type SHELL (Sh DeliDura ) gene that result in an amino acid substitution (e.g., non-conservative substitution), deletion, insertion, or frameshift at one or more nucleotide positions can predict pisifera shell phenotype, when the heterozygote has a wild-type allele can predict tenera phenotype. For example, when the heterozygote has different mutations that result in a non-functional SHELL gene, mutations of the wild-type SHELL (Sh DeliDura) mutations that result in different substitutions (e.g., non-conservative substitutions), deletions, insertions, or frameshifts.

[0031] In some embodiments, the polymorphic marker genotype includes a deletion or mutation of one or more nucleotides selected from: (i) nucleotides 22, 23, 24, 25, 26, 27, 28, 29, 30, 31, 32, 33, 34, 35, 36, and 37 of exon 1 of the SHELL gene; (ii) nucleotides 22, 23, 24, 25, 26, 27, 28, 29, 30, 31, 32, 33, 34, 35, and 36; or (iii) nucleotides 23, 24, 25, 26, 27, 28, 29, 30, 31, 32, 33, 34, 35, 36, and 37 of exon 1 of the SHELL gene. In some embodiments, the polymorphic marker genotype includes a deletion of one or more, or all, of nucleotides 23-37 (or 22-36) of exon 1 of the SHELL gene. In some embodiments, the polymorphic marker genotype includes a mutation (e.g., a mutation relative to Sh DeliDura In some embodiments, the mutation includes a missense (e.g., a non-conservative substitution), nonsense, insertion, deletion, or frameshift mutation. In some embodiments, the polymorphic marker genotype includes a cytosine (C) at nucleotide 34 of exon 1 of the SHELL gene. In some embodiments, the polymorphic marker genotype includes a mutation (e.g., a mutation relative to Sh

[0032] In some embodiments, the polymorphic marker genotype includes a mutation (e.g., a mutation relative to Sh DeliDura In some embodiments, the mutation includes a missense (e.g., a non-conservative substitution), nonsense, insertion, deletion, or frameshift mutation. In some embodiments, the polymorphic marker genotype includes a cytosine (C) at nucleotide 67 of exon 1 of the SHELL gene. In some embodiments, the polymorphic marker genotype includes a mutation (e.g., a mutation relative to Sh DeliDura In some embodiments, the mutation includes a missense (e.g., a non-conservative substitution), nonsense, insertion, deletion, or frameshift mutation. In some embodiments, the polymorphic marker genotype includes a thymine (T) at nucleotide 69 of exon 1 of the SHELL gene. In some embodiments, the polymorphic marker genotype includes a mutation (e.g., a mutation relative to Sh

[0033] In some embodiments, the polymorphic marker genotype includes a mutation (e.g., a mutation relative to Sh DeliDuramutation). In some embodiments, the mutation comprises a missense (e.g., non-conservative substitution), nonsense, insertion, deletion, or frameshift mutation. In some embodiments, the polymorphic marker genotype comprises an adenine (A) at nucleotide 71 of exon 1 of the SHELL gene. In some embodiments, the polymorphic marker genotype comprises a mutation at nucleotide 110 of exon 1 of the SHELL gene (e.g., relative to Sh DeliDura mutation). In some embodiments, the mutation comprises a missense (e.g., non-conservative substitution), nonsense, insertion, deletion, or frameshift mutation. In some embodiments, the polymorphic marker genotype comprises an adenine (A) at nucleotide 71 of exon 1 of the SHELL gene. In some embodiments, the polymorphic marker genotype comprises a mutation at nucleotide 110 of exon 1 of the SHELL gene (e.g., relative to Sh DeliDura mutation). In some embodiments, the mutation comprises a missense (e.g., non-conservative substitution), nonsense, insertion, deletion, or frameshift mutation. In some embodiments, the polymorphic marker genotype comprises an adenine (A) at nucleotide 71 of exon 1 of the SHELL gene. In some embodiments, the polymorphic marker genotype comprises a mutation at nucleotide 110 of exon 1 of the SHELL gene (e.g., relative to Sh

[0034] In some embodiments, the polymorphic marker genotype comprises a mutation at nucleotide 114 of exon 1 of the SHELL gene (e.g., relative to Sh DeliDura mutation). In some embodiments, the mutation comprises a missense (e.g., non-conservative substitution), nonsense, insertion, deletion, or frameshift mutation. In some embodiments, the polymorphic marker genotype comprises an adenine (A) at nucleotide 71 of exon 1 of the SHELL gene. In some embodiments, the polymorphic marker genotype comprises a mutation at nucleotide 110 of exon 1 of the SHELL gene (e.g., relative to Sh DeliDura mutation). In some embodiments, the mutation comprises a missense (e.g., non-conservative substitution), nonsense, insertion, deletion, or frameshift mutation. In some embodiments, the polymorphic marker genotype comprises an adenine (A) at nucleotide 71 of exon 1 of the SHELL gene. In some embodiments, the polymorphic marker genotype comprises a mutation at nucleotide 110 of exon 1 of the SHELL gene (e.g., relative to Sh

[0035] In any of the foregoing embodiments, the method can comprise providing a sample from a plant or seed; and determining the polymorphic marker genotype at the position of exon 1 of a SHELL gene selected from the following nucleotides:

[0036] (i) 22, 23, 24, 25, 26, 27, 28, 29, 30, 31, 32, 33, 34, 35, 36, 37, 67, 68, 69, 70, 71, 72, 73, 74, 75, 76, 77, 78, 79, 80, 81, 82, 83, 84, 85, 87, 88, 89, 90, 91, 92, 110, 114, and 122;

[0037] (ii) 23, 24, 25, 26, 27, 28, 29, 30, 31, 32, 33, 34, 35, 36, 37, 67, 69, 70, 71, 110, 114, and 122; or

[0038] (iii) 67, 69, 70, and 71. In some cases, heterozygosity for one or more polymorphic markers for pisifera and dura alleles predicts the presence of tenera shell phenotype. In some cases, heterozygosity for one or more polymorphic markers for pisifera alleles predicted genotype predicts the presence of pisifera shell phenotype. In some cases, pisifera shell phenotype is predicted by first predicting the genotype of pisifera alleles for one or more polymorphic markers and then predicting the heterozygosity of pisifera alleles for one or more polymorphic markers. In some cases, the genotype of the polymorphic markers can include one or more of the predicted pisifera alleles genotypes as set forth in SEQ ID NOs: 13, 15, 17, 18, and 19.

[0039] In some embodiments, the method comprises, providing a sample from a plant or seed; and determining the genotype of a polymorphic marker at intron 1 position of a SHELL gene selected from nucleotides 43, 44, 45, and 46. In some cases, heterozygosity for one or more polymorphic markers for pisifera and dura alleles predicts the presence of tenera shell phenotype. In some cases, heterozygosity for one or more polymorphic markers for pisifera alleles predicted genotype predicts the presence of pisifera shell phenotype. In some cases, pisifera shell phenotype is predicted by first predicting the genotype of pisifera alleles for one or more polymorphic markers and then predicting the heterozygosity of pisifera alleles for one or more polymorphic markers. In some cases, the genotype of the polymorphic markers can include one or more, or all, of the nucleotides of intron 1 as set forth in SEQ ID NO: 12 are missing.

[0040] In some embodiments, the method comprises providing a sample from a plant or seed; and detecting the genotype of the sample for a polymorphic marker that detects a mutation at one or more amino acid positions in a SHELL gene product selected from the group consisting of 3, 5, 8, 9, 10, 11, 12, 21, 22, 23, 24, 25, 26, 27, 28, 30, 37, and 41, from the group consisting of amino acid positions 3, 5, 8, 9, 10, 11, 12, 21, 22, 23, 24, 25, 26, 27, 28, 30, 31, 37, and 41, from the group consisting of amino acid positions 8, 9, 10, 11, 12, 23, 24, 37, and 41, or from the group consisting of amino acid positions 8, 9, 10, 11, 12, 23, 24, 31, 37, and 41. In some cases, the genotype of the polymorphic marker comprises one or more, or all, of the amino acid positions 8-12 of the wild-type SHELL gene product are missing. In some cases, the heterozygosity of the genotype of one or more polymorphic markers for the pisifera allele predicts the presence of the tenera shell phenotype. In some cases, the heterozygosity of the genotype of one or more polymorphic markers for the pisifera allele predicts the presence of the pisifera shell phenotype. In some cases, the heterozygosity of the genotype of one or more polymorphic markers for the pisifera allele predicted first and one or more polymorphic markers for the pisifera allele predicted second predicts the presence of the pisifera shell phenotype. In some cases, the genotype of the polymorphic marker can comprise one or more pisifera allele SHELL gene products as set forth in SEQ ID NOs: 3-10, or one or more pisifera allele SHELL gene products as set forth in SEQ ID NOs: 3, 5, 7, 8, and 9.

[0041] In some embodiments, the polymorphic marker genotype comprises a mutation at amino acid position 23 compared to a wild-type SHELL gene product. In some cases, the mutation comprises a lysine to glutamine mutation or a lysine to aspartic acid mutation at amino acid position 23. In some embodiments, the polymorphic marker genotype comprises a mutation at amino acid position 24 compared to a wild-type SHELL gene product. In some cases, the mutation comprises an arginine to histidine mutation or an arginine to glycine mutation at amino acid 24. In some embodiments, the polymorphic marker genotype comprises a mutation at amino acid position 37 of a wild-type SHELL gene product. In some cases, the mutation comprises a valine to aspartic acid mutation at amino acid 37. In some embodiments, the polymorphic marker genotype comprises a mutation at amino acid position 41 of a wild-type SHELL gene product. In some cases, the mutation comprises an alanine to aspartic acid mutation at amino acid 41.

[0042] In some embodiments, the method comprises providing a plant or seed sample; and detecting a polymorphic marker genotype of a SHELL gene product mutation at a nuclear localization signal (NLS) position of the SHELL gene product in the sample, wherein the mutation at the NLS position comprises an amino acid position mutation selected from the group consisting of amino acid positions 3, 5, 9, 10, 21, 22, 23, 24, 25, 26, 27, 28, and 30 of the SHELL gene product; or amino acid positions 23, 24, 25, 26, 27, 28, and 30. In some cases, the mutation is at an amino acid position selected from the group consisting of amino acid positions 23 and 24 of the SHELL gene product. In some cases, the mutation at amino acid position 23 comprises a lysine to glutamine mutation. In some cases, the mutation at amino acid position 23 comprises a lysine to aspartic acid mutation. In some cases, the mutation at amino acid position 24 comprises an arginine to histidine mutation. In some cases, the mutation at amino acid position 24 comprises an arginine to glycine mutation.

[0043] In some embodiments, the plant or seed is produced from: i) a cross between a plant having a dura shell phenotype and a plant having a pisifera shell phenotype, ii) a tenera palm self-cross, iii) a cross between two plants having a tenera shell phenotype, iv) a cross between a plant having a dura shell phenotype and a plant having a tenera shell phenotype, or v) a cross between a plant having a tenera shell phenotype and a plant having a pisifera shell phenotype. In some embodiments, the plant is less than 5 years old. In some embodiments, the plant is less than 1 year old. In some embodiments, the polymorphic marker is predictive, or predictive of at least 86%, 88%, 90%, 92%, 94%, 96%, 97%, 98%, or 99% of the tenera phenotype.

[0044] In some embodiments, if the plant is heterozygous for the polymorphic marker (e.g., heterozygous for dura and pisifera markers predictive of the tenera phenotype), the method further comprises selecting the seed or plant for cultivation. In some embodiments, if the plant is homozygous for the polymorphic marker (e.g., homozygous for a dura or pisifera phenotype), the method further comprises selecting the seed or plant for cultivation. In some embodiments, if the plant or seed does not have the genotype of the predicted tenera shell phenotype, e.g., if the plant or seed has the genotype of the predicted pisifera phenotype or has the genotype of the predicted dura phenotype, the plant or seed is discarded, stored (e.g., stored separately from tenera plants or seeds), or cultivated (e.g., cultivated separately from tenera plants or seeds).

[0045] Also provided is a method of classifying a plurality of oil palm (e.g., Elaeis guineensis) plants into different categories based on predicted shell phenotype. In some embodiments, the method comprises, providing a sample from a plant or seed; and determining the genotype of at least one polymorphic marker at exon 1 position of a SHELL gene selected from the group consisting of: (i) nucleotides 7, 8, 9, 13, 14, 15, 22, 23, 24, 25, 26, 27, 28, 29, 30, 31, 32, 33, 34, 35, 36, 37, 61, 62, 63, 64, 65, 66, 67, 68, 69, 70, 71, 72, 73, 74, 75, 76, 77, 78, 79, 80, 81, 82, 83, 84, 85, 87, 88, 89, 90, 91, 92, 109, 110, 111, 114, 121, 122, and 123; (ii) nucleotides 23, 24, 25, 26, 27, 28, 29, 30, 31, 32, 33, 34, 35, 36, and 37; (iii) nucleotide 34; (iv) nucleotides 67, 68, 69, 70, 71, 72, 73, 74, 75, 76, 77, 78, 79, 80, 81, 82, 83, 84, 85, 87, 88, 89, 90, 91, and 92; (v) nucleotides 67, 69, 70, and 71; (vi) nucleotide 67; (vii) nucleotide 69; (viii) nucleotide 70; (ix) nucleotide 71; (x) nucleotide 110; (xi) nucleotide 114; or (xii) nucleotide 122; and grouping the plants based on the genotype of the polymorphic marker, wherein the groups correspond to plants predicted to have tenera shell phenotype, plants predicted to have dura shell phenotype, and plants predicted to have pisifera shell phenotype.

[0046] Also provided is a kit for determining the shell phenotype of an oil palm seed or plant. In some embodiments, the kit comprises, one or more oligonucleotide primers or probes independently comprising:

[0047] at least as 6, 7, 8, 9, 10, 11, 12, 13, 14, 15, 16, 17, or 18 (or 20, 22, 24, 30, or more) contiguous nucleotides of SEQ ID NO: 27; or

[0048] at least as 6, 7, 8, 9, 10, 11, 12, 13, 14, 15, 16, 17, or 18 (or 20, 22, 24, 30, or more) contiguous nucleotides of SEQ ID NO: 27; or

[0049] one or more primers or probes independently hybridizes to a sequence selected from the group consisting of nucleotides 1-1000 of the SHELL gene:

[0050] (i) nucleotides 7, 8, 9, 13, 14, 15, 22, 23, 24, 25, 26, 27, 28, 29, 30, 31, 32, 33, 34, 35, 36, 37, 61, 62, 63, 64, 65, 66, 67, 68, 69, 70, 71, 72, 73, 74, 75, 76, 77, 78, 79, 80, 81, 82, 83, 84, 85, 87, 88, 89, 90, 91, 92, 109, 110, 111, 114, 121, 122, and 123;

[0051] (ii) nucleotides 23, 24, 25, 26, 27, 28, 29, 30, 31, 32, 33, 34, 35, 36, and 37;

[0052] (iii) nucleotide 34;

[0053] (iv) nucleotides 67, 68, 69, 70, 71, 72, 73, 74, 75, 76, 77, 78, 79, 80, 81, 82, 83, 84, 85, 87, 88, 89, 90, 91, and 92;

[0054] (v) nucleotides 67, 69, 70, and 71;

[0055] (vi) nucleotide 67;

[0056] (vi) nucleotide 69;

[0057] (vi) nucleotide 70;

[0058] (ix) nucleotide 71;

[0059] (x) nucleotide 110;

[0060] (xi) nucleotide 114; or

[0061] (xii) nucleotide 122.

[0062] In some embodiments, the one or more primers or probes independently hybridize to a sequence selected from the group consisting of nucleotides (i)-(xii) above.

[0063] In some embodiments, the one or more primers or probes specifically hybridize to DNA or RNA of a palm plant.

[0064] In some embodiments, the detectable label is attached (e.g., covalently attached) to the oligonucleotide. In some embodiments, the detectable label is fluorescent.

[0065] In some embodiments, the kit further comprises a polynucleotide encoding a polypeptide comprising a sequence that is substantially identical (e.g., at least 80%, 85%, 90%, 95%, 97%, 98%, 99%) or identical to at least 9, 10, 11, 12, 13, 14, 15, 16, 17, 18, 19, 20, 21, 22, 23, 24, 25, 26, 27, 28, 29, 30, 31, 32, 33, 34, 35, 36, 37, 38, 39, 40, 41, 42, 43, 44, 45, 46, 47, 48, 49, or 50 contiguous nucleotides of SEQ ID NOs: 13, 14, 15, 16, 17, 18, 19, 20, or 21, wherein the polynucleotide comprises a mutation relative to the wild-type sh AVROS or sh MPOB SHELL.

[0066] Also provided is an isolated nucleotide comprising a polynucleotide encoding a polypeptide comprising a sequence that is substantially identical (e.g., at least 80%, 85%, 90%, 95%, 97%, 98%, 99%) or identical to at least 3, 4, 5, 6, 7, 8, 9, 10, 11, 12, 13, 14, 15, 16, 17, 18, 19, 20, 21, 22, 23, 24, 25, 26, 27, 28, 29, 30, 31, 32, 33, 34, 35, 36, 37, 38, 39, 40, 41, 42, 43, 44, 45, 46, 47, 48, 49, or 50 contiguous amino acids of SEQ ID NOs: 3, 4, 5, 6, 7, 8, 9, 10, or 11, wherein the polynucleotide comprises a mutation relative to the wild-type sh AVROS or sh MPOB SHELL.

[0067] Also provided is a cell or seed or plant comprising a heterologous expression cassette comprising a heterologous promoter operably linked to a polynucleotide encoding a polypeptide comprising a sequence substantially identical (e.g., at least 80%, 85%, 90%, 95%, 97%, 98%, 99%) or identical to SEQ ID NOs: 3, 4, 5, 6, 7, 8, 9, 10, or 11, wherein the polynucleotide comprises a SHELL mutation relative to wild-type sh AVROS and sh MPOB In some embodiments, the seed or plant is a palm (e.g., oil palm) seed or palm (e.g., oil palm) plant. In some embodiments, the polypeptide comprises the amino acid sequence of SEQ ID NOs: 3, 4, 5, 6, 7, 8, 9, 10, or 11. In some embodiments, the heterologous promoter produces an expression level of the polypeptide in the seed or plant that is less than, equal to, or exceeds the expression of an endogenous SHELL RNA in the seed or plant. In some embodiments, the seed or plant comprises two dura alleles of an endogenous SHELL gene. In some embodiments, the seed or plant produces a fruit having a mature husk that is less than 2 mm thick, less than 3 mm thick, or between 0.5-3 mm thick on average.

[0068] Also provided is a cell, seed or plant comprising a heterologous expression cassette comprising a promoter operably linked to a polynucleotide having at least 15, 16, 17, 18, 19, 20, 21, 22, 23, 24, 25, 26, 27, 28, 29, 30, 31, 32, 33, 34, 35, 36, 37, 38, 39, 40, 41, 42, 43, 44, 45, 46, 47, 48, 49, or 50 contiguous nucleotides of SEQ ID NOs: 13, 14, 15, 16, 17, 18, 19, 20, or 21, or a complement thereof, when expressed in a seed or plant, wherein the polynucleotide reduces expression of an endogenous SHELL polypeptide in the seed or plant (relative to a control plant without the expression cassette), wherein the reduced expression of the SHELL polypeptide results in a reduction in husk thickness of other seeds produced by the modified plant. In some embodiments, the polynucleotide encodes an siRNA, an antisense polynucleotide, a microRNA, or a sense suppressor nucleic acid, thereby suppressing expression of an endogenous SHELL gene. In some embodiments, the seed or plant has a mature husk that is less than 2 mm thick, less than about 3 mm thick, or between 0.5-3 mm thick on average.

[0069] Also provided is a method of making a plant as described above or herein, comprising introducing an expression cassette into the plant.

[0070] Also provided is a method of cultivating a plant as described herein.

[0071] Other embodiments of the application will be apparent to those of ordinary skill in the art from a review of the rest of the present disclosure.

[0072] Definitions

[0073] "Shell phenotype" refers to the three fruit forms of Elaeis guineensis - dura, tenera, and pisifera. The dura (wild type) fruit form is exemplified by the presence of a shell that is on average at least 2-8 mm thick and is typically found in palm plants having a homozygous wild type SHELL genotype. The pisifera fruit form is exemplified by the absence of a shell and is typically found in palm plants that lack a functional SHELL gene. For example, a pisifera palm plant can have two non-functional SHELL genes (e.g., homozygous for a non-functional SHELL genotype or heterozygous for two different non-functional SHELL genotypes). The tenera fruit form is exemplified by the presence of a thin shell that is on average less than about 3 mm thick (e.g., about 0.5-3 mm) and is typically found in palm plants that are heterozygous for functional and non-functional SHELL genes. A heterologous palm plant that overexpresses or underexpresses a SHELL gene or gene product or partially or completely interferes with the activity of an endogenous SHELL gene product can also exhibit a dura, tenera, or pisifera fruit form phenotype.

[0074] "Polymorphic marker" refers to a genetic marker that distinguishes between two alleles. A polymorphic marker can be a nucleotide substitution, insertion, deletion, or rearrangement, or a combination thereof.

[0075] In the present context, "detecting genotype" means: (i) analyzing a nucleic acid to determine a genotype by performing sequencing, hybridization, polymerization, or sequence-specific endonuclease digestion reactions, or by detecting the mass of the nucleic acid or a portion thereof; or (ii) analyzing a polypeptide or a portion thereof encoded by a nucleic acid by performing sequencing, detection (e.g., ELISA), or sequence-specific endonuclease digestion reactions, or by detecting the mass of the polypeptide or a portion thereof.

[0076] In the present context, the terms "nucleic acid", "polynucleotide", and "oligonucleotide" refer to nucleic acid regions, nucleic acid fragments, primers, probes, amplicons, and oligomer fragments. The terms are not limited by length, and generally are linear polymers of deoxyribonucleotides (containing 2-deoxy-D-ribose), ribonucleotides (containing D-ribose), and any other N-glycoside of a purine or pyrimidine base, or modified purine or pyrimidine bases. The terms include double-stranded DNA and single-stranded DNA, as well as double-stranded RNA and single-stranded RNA.

[0077] Nucleic acids, polynucleotides, or oligonucleotides can include, for example, phosphodiester bonds or modified bonds, including but not limited to phosphotriester, phosphoramidate, siloxane, carbonate, carboxymethyl ester, acetamidate, carbamate, thioether, bridged phosphoramidate, bridged methylenephosphonate, phosphorothioate, methylphosphonate, phosphorodithioate, bridged phosphorothioate, or sulfone bonds, and combinations of these bonds.

[0078] Nucleic acids, polynucleotides, or oligonucleotides can include five biologically occurring bases (adenine, guanine, thymine, cytosine, and uracil) and / or bases other than the five biologically occurring bases.

[0079] Optimal alignment of sequences for comparison can be conducted by the local homology algorithm of Smith and Waterman Add. APL. Math. 2:482 (1981), by the homology alignment algorithm of Needleman and Wunsch J. Mol. Biol. 48:443 (1970), by the search for similarity method of Pearson and Lipman Proc. Natl. Acad. Sci. (U.S.A.) 85:2444 (1988), by computerized implementations of these algorithms (GAP, BESTFIT, BLAST, FASTA, and TFASTA in the Wisconsin Genetics Software Package, Genetics Computer Group (GCG), 575 Science Dr., Madison, WI), or by inspection.

[0080] “Percent sequence identity” is determined by comparing two optimally aligned sequences over a comparison window, wherein the portion of the polynucleotide sequence in the comparison window can comprise additions or deletions (i.e., gaps) as compared to the reference sequence (which does not comprise additions or deletions) for optimal alignment of the two sequences. The number of positions at which the identical nucleic acid base or amino acid residue occurs in both sequences is ascertained for each position in the comparison window. The percent sequence identity is then calculated by dividing the number of matched positions by the total number of positions in the comparison window and multiplying the result by 100.

[0081] The term "substantially identical" with respect to a polypeptide sequence means a polypeptide comprising a sequence that has at least 75% sequence identity. Alternatively, the percent identity can be any integer from 75% to 100%. Exemplary embodiments include at least: 75%, 80%, 85%, 90%, 95%, or 99% using the programs described herein for comparison to a reference sequence, preferably using BLAST with the standard or default parameters as described below. Those skilled in the art will recognize that these values can be adjusted as appropriate, taking into account codon degeneracy, amino acid similarity, reading frame position, and the like, to determine the relative correspondence of proteins encoded by two nucleotide sequences. A "substantially similar" polypeptide shares a sequence as described above, except that non-identical residue positions can differ by conservative amino acid changes. Conservative amino acid substitutions refer to the interchangeability of residues having similar side chains. For example, amino acids with aliphatic side chains are glycine, alanine, valine, leucine, and isoleucine; those with aliphatic-hydroxyl side chains are serine and threonine; those with amide-containing side chains are asparagine and glutamine; those with aromatic side chains are phenylalanine, tyrosine, and tryptophan; those with basic side chains are lysine, arginine, and histidine; those with acidic side chains are aspartic acid and glutamic acid; and those with sulfur-containing side chains are cysteine and methionine. Preferred conservative amino acid substitutions are: valine-leucine-isoleucine, phenylalanine-tyrosine, lysine-arginine, alanine-valine, aspartic acid-glutamic acid, and asparagine-glutamine.

[0082] One indication that nucleotide sequences are substantially identical is that the two molecules hybridize to each other under stringent conditions, or to a third nucleic acid hybridization. Stringent conditions are sequence dependent and will be different in different circumstances. In general, stringent conditions are selected to be about 5°C lower than the thermal melting point (Tm) for the specific sequences at a defined ionic strength and pH. Typically, stringent conditions will be those in which the salt concentration is about 0.02 molar at pH 7 and the temperature is at least about 60°C. The Tm is the temperature (under defined ionic strength and pH) at which 50% of the target sequence hybridizes to a perfectly matched probe.

[0083] The term "promoter" or "regulatory element" refers to a region or sequence determinant located upstream or downstream of the transcription initiation that is involved in the recognition and binding of RNA polymerase and other proteins to initiate transcription. The promoter need not be of plant origin, for example, a promoter derived from a plant virus, such as the CaMV 35S promoter, can be used.

[0084] The term "plant" includes whole plants, shoots, vegetative organs / structures (e.g., leaves, stems and tubers), roots, flowers, and floral organs / structures (e.g., bracts, sepals, petals, stamens, carpels, anthers and ovules), seed (including embryo, endosperm, and seed coat) and fruit (the mature ovary), plant tissues (e.g., vascular tissue, seed tissue, meristematic tissue, etc.) and cells (e.g., guard cells, egg cells, trichomes, etc.) and progeny of the same. The class of plants that can be used in the methods of the application is generally as broad as the class of higher and lower plants amenable to transformation techniques, including angiosperms (monocots and dicots), gymnosperms, ferns, and multicellular algal species. Plants of a variety of ploidy levels (including non- diploid, polyploid, diploid, haploid and hemizygous) are included. In an exemplary embodiment, the plant is an oil palm plant (Elaeis guineensis or Elaeis oleifera or hybrids thereof). In some cases, the plant is Elaeis guineensis.

[0085] An "expression cassette" refers to a nucleic acid construct that, when introduced into a host cell, results in the transcription and / or translation of RNA or polypeptide, respectively. Antisense constructs or sense constructs that are not or cannot be translated are expressly included in this definition. An expression cassette can contain a heterologous promoter.

[0086] The term "operably linked" refers to a functional linkage between a nucleic acid expression control sequence (e.g., a promoter, or array of transcription factor binding sites) and a second nucleic acid sequence, wherein the expression control sequence directs transcription of the corresponding second sequence.

[0087] A polynucleotide sequence or amino acid sequence is "heterologous" to an organism or to a second polynucleotide sequence if it originates from a foreign species or, if from the same species, is modified from its original form. For example, a heterologous promoter operably linked to a coding sequence refers to a promoter from a different species than the coding sequence or, if from the same species, a promoter that is different from any naturally occurring allelic variant.

[0088] In the context of nucleotide positions of exon 1 of the SHELL gene, the term "nucleotide position" and the like refers to the nucleotide position relative to the adenosine of the start codon (e.g. the amino terminal) methionine triplet codon ("ATG") of the wild type SHELL gene. Thus, for example, nucleotide position 1 refers to the adenosine of the ATG start codon methionine triplet codon of the wild type SHELL gene; and position 2 refers to the next nucleotide (i.e. the "T" of the ATG start codon methionine triplet codon), and so on. Likewise, in the context of nucleotide positions of intron 1 of the SHELL gene, the term "nucleotide position" and the like refers to the nucleotide position relative to the first nucleotide of intron 1 of the wild type SHELL gene. Thus, the first nucleotide of intron 1 of the SHELL gene is at position 1, the second at position 2, and so on.

[0089] Likewise, in the context of a particular amino acid, or group of amino acids, of the SHELL gene, the term "amino acid position" refers to the amino acid position relative to the start codon (i.e. the amino terminal) methionine of the SHELL gene. Thus, for example, amino acid position 1 refers to the amino terminal methionine, amino acid position 2 refers to the contiguous glycine of wild type SHELL, or the replacement amino acid or deletion found at the same position in a mutant SHELL allele. It is noted that these positions are independent of any N-terminal processing or conjugation or other post-translational processing. For example, in a SHELL polypeptide in which the N-terminal methionine amino acid is post-translationally removed, position 2 still refers to the previous contiguous glycine amino acid, and position 3 refers to the contiguous arginine amino acid of wild type SHELL or the replacement amino acid or deletion found at the same position in a mutant SHELL allele. BRIEF DESCRIPTION OF DRAWINGS

[0090] Figure 3 is a model of the SHELL gene. Exons (boxes) and introns (horizontal lines) are verified by RNA-seq. Protein domain map encoded by the indicated exons is provided below the gene map. MADS box, I, K and C domains are indicated for the SHELL protein.

[0091] www.illumina.com is a nucleotide variant of the SHELL gene. Wild type (Sh DeliDuraThe DNA sequence of exon 1 is shown as the first line of the DNA sequence alignment. The sequences of the alleles of AVROS, MPOB, allele 3, allele 4, allele 5, allele 6, allele 7, allele 8, allele 9, allele 10, and allele 11 (SEQ ID NOs: 22, 23, 13-21, respectively) are shown aligned to the dura sequence. Single nucleotide variants are indicated by boxes. Missing bases (allele 7) are indicated by dashes.

[0092] Figure 3 The amino acid variants are of the SHELL gene. The wild type (Sh DeliDura ) polypeptide sequence of the MADSbox domain (SEQ ID NO: 24). The sequences of the polypeptides of AVROS, MPOB, allele 3, allele 4, allele 5, allele 6, allele 7, allele 8, allele 9, allele 10, and allele 11 (SEQ ID NOs: 1-11, respectively) are shown aligned to the dura polypeptide sequence. Variant amino acids resulting from missense single nucleotide variants are indicated by the appropriate one-letter amino acid code. Missing amino acids (allele 7) are indicated by an asterisk. Amino acids that are unchanged relative to the dura polypeptide sequence are indicated by dashes. DETAILED DESCRIPTION

[0093] I. Introduction

[0094] The present disclosure describes the discovery of allele 3-10 of the SHELL gene, which is predicted to modulate fruit form phenotypes in palm (e.g., oil palm) plants. Likewise, either allele 11 (as shown in SEQ ID NOs: 11 and 21) and 12 (as shown in SEQ ID NO: 12) are predicted to directly modulate fruit form phenotypes, or can be used to infer the genotype of the SHELL gene, as they are tightly physically linked to the allele 3-10 polymorphism. Markers tightly linked to the SHELL gene, or identifying the number of copies of allele 3-11 present or absent in oil palm plants, can be used by seed producers as a quality control tool to i) reduce or eliminate dura or pisifera contamination of tenera seeds or seedlings, ii) reduce or eliminate dura or tenera contamination of pisifera seeds or seedlings, iii) reduce or eliminate pisifera or tenera contamination of dura seeds or seedlings, iv) positively identify tenera seeds or seedlings, then select them as suitable planting material for commercial palm production, v) positively identify dura seeds or seedlings, then select them as suitable planting material for dura germplasm for commercial production, or vi) positively identify pisifera seeds or seedlings, then select them as suitable planting material for pisifera germplasm for commercial production.

[0095] It is also important to identify the SHELL gene or markers that are usually linked to the shell trait in breeding programs. Markers or alleles of the gene responsible for the trait can be used to separate dura, tenera and pisifera plants in the nursery; the advantage is that they can be planted separately based on the shell fruit form phenotype. Since pisifera palms usually show very favorable plant growth, this is of great interest, and therefore in trials that include all three types, there can be distortion of results due to hybrid competition. In addition, pisifera palms are separated and encouraged to plant the father flowers at high density, which is advantageous for pollen production for breeding programs (Jack et al., 1998). Therefore, after detecting the SHELL genotype present or not, the results of predicting the dura, pisifera or tenera phenotype, or linking markers, as described below, another step: (1) to reduce or eliminate dura or pisifera contamination of tenera seeds or seedlings, (2) to positively identify tenera seeds or seedlings and then select them as suitable planting material for commercial palm oil production, or (3) it is possible to separate dura, tenera and pisifera plants into two or more groups (for example, predicting a group of plants as tenera, and predicting a second group as dura or pisifera; predicting a group of plants as dura and predicting a second group as tenera and pisifera, predicting a group of plants as pisifera and predicting a second group as dura or tenera, or into three groups: dura, pisifera and tenera).

[0096] Any marker present between the hybridized parent dura and pisifera trees is polymorphic and linked to the SHELL locus with potential use as a molecular signal to identify hybrid tenera trees. For example, if a dura tree that is homozygous "T" (i.e., T / T) at a given SNP position proximal to the SHELL locus is hybridized with a pisifera tree that is homozygous "A" (i.e., A / A) at the same SNP position, then seeds of the hybrid or seedlings produced from the hybrid can be genotyped at the SNP position to track and identify contaminated seeds or seedlings. Seeds that are heterozygous at the SNP position (e.g., A / T) are very likely to be tenera, unless recombination between the marker and the SHELL gene occurred in the individual being genotyped. Similarly, seeds that are homozygous for "A" or "T" at the SNP position (i.e., A / A or T / T) are pisifera or dura contaminated trees, respectively, and when these trees mature in several years, will produce off-standard fruit types. In addition, seeds or seedlings that have "C" or "G" at the SNP position, either of which is present in the hybridized parent palms, can be trees produced from a different pollen donor than the intended pollen donor of the hybrid and thus can be discarded as contaminated seeds or seedlings. Markers closer to the SHELL locus have higher predictive accuracy than markers further away from the SHELL locus, because the closer the marker is to the SHELL gene, the less likely recombination is to occur, breaking the linkage between the marker and the SHELL gene. Thus, polymorphic markers within the SHELL gene itself are expected to have the strongest predictive power, and it can be advantageous to analyze multiple markers that are tightly linked to or within the SHELL gene.

[0097] II. Determining SHELL phenotype based on nucleic acid detection

[0098] In view of the discovery that SHELL genotypes segregate into tenera / pisifera / dura shell phenotypes, genotyping a plant or seed at the SHELL locus or in a genomic region proximal thereto can be used to predict the shell phenotype of a palm plant.

[0099] SEQ ID NO: 24 represents the dura fruit type (Sh DeliDuraThe predicted amino acid sequence of the N-terminal 181 amino acids of a protein expressed in oil palm of the dura fruit type derived from the Zairean line (sh MPOB The predicted amino acid sequence of the N-terminal 181 amino acids of a protein expressed in oil palm of the dura fruit type derived from the Zairean line (sh AVROS The predicted amino acid sequence of the N-terminal 181 amino acids of a protein expressed in oil palm of the dura fruit type derived from the Zairean line (sh

[0100] SEQ ID NO: 1 represents the predicted amino acid sequence of the N-terminal 181 amino acids of a protein expressed in oil palm of the pisifera fruit type derived from the Zairean line (sh AVROS The predicted amino acid sequence of the N-terminal 181 amino acids of a protein expressed in oil palm of the dura fruit type derived from the Zairean line (sh AVROS The nucleotide sequence of exon 1 encoding the sh

[0101] SEQ ID NO: 2 represents the predicted amino acid sequence of the N-terminal 181 amino acids of a protein expressed in oil palm of the pisifera fruit type derived from the Zairean line (sh MPOB The predicted amino acid sequence of the N-terminal 181 amino acids of a protein expressed in oil palm of the dura fruit type derived from the Zairean line (sh MPOB The nucleotide sequence of exon 1 encoding the sh

[0102] SEQ ID NO:3 represents a predicted amino acid sequence of the N-terminal 181 amino acids of a protein expressed in Elaeis guineensis for the predicted pisifera fruit type SHELL allele 3. This endogenous protein includes additional C-terminal amino acids not included herein. This polypeptide includes a glutamine (Q) amino acid at position 23 amino acid position. The nucleotide sequence encoding exon 1 of allele 3 is set forth in SEQ ID NO: 13.

[0103] SEQ ID NO:4 represents a predicted amino acid sequence of the N-terminal 181 amino acids of a protein expressed in Elaeis guineensis for the predicted pisifera fruit type SHELL allele 4. This endogenous protein includes additional C-terminal amino acids not included herein. This polypeptide includes an aspartic acid (D) amino acid at position 41 amino acid position. The nucleotide sequence encoding exon 1 of allele 4 is set forth in SEQ ID NO: 14.

[0104] SEQ ID NO:5 represents a predicted amino acid sequence of the N-terminal 181 amino acids of a protein expressed in Elaeis guineensis for the predicted pisifera fruit type SHELL allele 5. This endogenous protein includes additional C-terminal amino acids not included herein. This polypeptide includes an asparagine (N) at position 23 amino acid position. The nucleotide sequence encoding exon 1 of allele 5 is set forth in SEQ ID NO: 15.

[0105] SEQ ID NO:6 represents a predicted amino acid sequence of the N-terminal 181 amino acids of a protein expressed in Elaeis guineensis for the predicted pisifera fruit type SHELL allele 6. This endogenous protein includes additional C-terminal amino acids not included herein. This polypeptide includes a glutamic acid (E) amino acid at position 12 amino acid position. The nucleotide sequence encoding exon 1 of allele 6 is set forth in SEQ ID NO: 16.

[0106] SEQ ID NO:7 represents a predicted amino acid sequence of the N-terminal 181 amino acids of a protein expressed in Elaeis guineensis for the predicted pisifera fruit type SHELL allele 7. This endogenous protein includes additional C-terminal amino acids not included herein. This polypeptide has deletions of amino acids lysine (K), arginine (R), isoleucine (I), and glutamic acid (E) at positions 8-12, respectively, relative to the wild-type allele Sh DeliDura The nucleotide sequence encoding exon 1 of allele 7 is set forth in SEQ ID NO: 17.

[0107] SEQ ID NO:8 represents a predicted amino acid sequence of the N-terminal 181 amino acids of a protein expressed in oil palm in the predicted pisifera fruit type SHELL allele 8. This endogenous protein includes additional C-terminal amino acids not included herein. This polypeptide includes a histidine (H) amino acid at the 24th amino acid position. The nucleotide sequence encoding exon 1 of allele 8 is set forth in SEQ ID NO: 18.

[0108] SEQ ID NO:9 represents a predicted amino acid sequence of the N-terminal 181 amino acids of a protein expressed in oil palm in the predicted pisifera fruit type SHELL allele 9. This endogenous protein includes additional C-terminal amino acids not included herein. This polypeptide includes a glycine (G) amino acid at the 24th amino acid position. The nucleotide sequence encoding exon 1 of allele 9 is set forth in SEQ ID NO: 19.

[0109] SEQ ID NO:10 represents a predicted amino acid sequence of the N-terminal 181 amino acids of a protein expressed in oil palm in the predicted pisifera fruit type SHELL allele 10. This endogenous protein includes additional C-terminal amino acids not included herein. This polypeptide includes an aspartic acid (D) amino acid at the 37th amino acid position. The nucleotide sequence encoding exon 1 of allele 10 is set forth in SEQ ID NO:20.

[0110] SEQ ID NO:11 represents a predicted amino acid sequence of the N-terminal 181 amino acids of a protein expressed in oil palm in the predicted pisifera fruit type SHELL allele 11. This endogenous protein includes additional C-terminal amino acids not included herein. Relative to the wild-type SHELL gene (Sh DeliDura ), the allele encodes a silent mutation. The nucleotide sequence encoding exon 1 of allele 11 is set forth in SEQ ID NO:21. As described herein, this silent mutation can affect transcription or translation rules and thus provide a pisifera phenotype encoding for a wild-type protein sequence. Alternatively, the nucleotide sequence encoding this silent mutation can be used to infer the genotype or amino acid markers present or not present on one or more of the foregoing polymorphic nucleotides (e.g., one or more polymorphic markers relative to the wild-type as exemplified in SEQ ID Nos: 13-20, 13-20 and 23, 13-20 and 22, or 13-20 and 22-23) or not present (e.g., one or more polymorphic markers relative to the wild-type as exemplified in SEQ ID Nos: 3-10, 2-10, 1 and 3-10, or 1-10).

[0111] SEQ ID NO: 12 represents a first nucleotide sequence of 56 nucleotides of intron 1 of SHELL allele 12, in which nucleotides 43, 44, 45, and 46 are deleted relative to the wild-type SHELL allele (Sh DeliDura When the polymorphism is within the non-coding region of the SHELL gene, it is a silent mutation. As described herein, the silent mutation can affect transcription or translation rules, or splicing, and thus provide the pisifera phenotype. Alternatively, the presence or absence of allele 12 can be used to infer the presence or absence of a genotype or amino acid marker (e.g., one or more polymorphic markers relative to the wild-type as set forth in one or more of SEQ ID Nos: 3-10, 3-11, 2-10, 2-11, 1-10, 1 and 3-10, 1 and 3-11, or 1-11) at one or more of the polymorphic nucleotides (e.g., one or more polymorphic markers relative to the wild-type as set forth in one or more of SEQ ID Nos: 13-20, 13-21, 13-20 and 22, 13-20 and 23, or 13-23).

[0112] A tenera fruit type oil palm is the result of at least one of four possibilities: i) two homozygous SHELL alleles having a nucleotide sequence encoding one of the following protein sequences SEQ ID NOs: 3-10; ii) two heterozygous SHELL alleles having two different nucleotide sequences independently encoding one of the following protein sequences SEQ ID NOs: 3-10, or iii) one SHELL allele encoding Sh AVROS or Sh MPOB protein sequence and another allele encoding a mutation relative to the wild-type as set forth in one or more of the following protein sequences SEQ ID NOs: 3-10. In some cases, the nucleotide sequence comprises SEQ ID NO: 12 and / or 21 and is analogous to a predicted pisifera allele. In these cases, the pisifera fruit type can result from a plant homozygous for SEQ ID NO: 12 or 21 or a plant heterozygous for SEQ ID NO: 12 or 21 and a different allele selected from any one of SEQ ID NOs: 13-23 (e.g., any one of SEQ ID NOs: 13-20) or encoding any one of SEQ ID NOs: 1-10 (e.g., any one of SEQ ID NOs: 3-10).

[0113] A tenera fruit type oil palm is the result of at least one of four possibilities: i) two homozygous SHELL alleles having a nucleotide sequence encoding one of the following protein sequences SEQ ID NOs: 3-10; ii) two heterozygous SHELL alleles having two different nucleotide sequences independently encoding one of the following protein sequences SEQ ID NOs: 3-10, or iii) one SHELL allele encoding Sh DeliDura) the result of one allele of the SHELL protein. Notably, SEQ ID NOs: 1-11 and 24 are representative sequences and different palm individuals can have amino acid sequences that differ from SEQ ID NOS: 1-11 and 24 by, for example, one, two, three, four, or more amino acid changes due to natural variation. Similarly, SEQ ID NOs: 12-23 and 25 are representative sequences and different palm individuals can have nucleotide sequences that differ from SEQ ID NOs: 12-23 and 25 by, for example, one, two, three, four, or more nucleotide changes due to natural variation.

[0114] One or more polymorphisms between the pisifera and dura SHELL alleles can be used to determine the SHELL phenotype of a palm or other plant. For example, when the polymorphism is co-dominant (can be detected independent of other alleles), then:

[0115] The presence of only a dura SHELL allele indicates that the plant has or will have a dura SHELL phenotype;

[0116] The presence of only a pisifera SHELL allele indicates that the plant has or will have a pisifera SHELL phenotype; and

[0117] The presence of both a pisifera SHELL allele and a dura SHELL allele indicates that the plant has a tenera SHELL phenotype.

[0118] However, the genomic region immediately adjacent to the SHELL gene can also be used to determine whether a palm plant is likely to exhibit a particular shell phenotype. Due to genetic linkage of the SHELL gene, polymorphisms proximal to the SHELL locus are still predictive of shell phenotype, although the accuracy decreases as the distance from the SHELL locus increases. SEQ ID NO: 27 provides a genomic region of about 3.4 MB of the palm genome that includes the SHELL gene. Table A of U.S. Patent Application Publication No. 2013 / 0247249 discloses 8217 SNPs identified within SEQ ID NO: 27. These SNPs were selected for genetic mapping relative to the SHELL locus. Table A of U.S. 2013 / 0247249 also describes the estimated predictive values of these SNPs. Thus, as an example, the SNP listed in row 1, column 1 of Table 1 of U.S. 2013 / 0247249 has an estimated 83 predictive successes, indicating that the SNP accurately predicted the shell phenotype 83% of the time. That is, by testing the SNP as a genetic marker, 83 out of 100 times the shell phenotype of a palm plant could be correctly predicted. Thus, even at a physical distance significantly away from the SHELL locus on the palm chromosome, a polymorphic marker can still relatively accurately predict the shell phenotype of a plant. In some embodiments, the polymorphic marker is within 1, 10, 20, 50, 100, 200, 500, 1000 kb of the SHELL gene (e.g., corresponding to the genes of SEQ ID NO: 28).

[0119] Thus, methods are provided for detecting one or more polymorphic markers within the palm genomic region corresponding to SEQ ID NO: 27. For example, the methods can be used to predict the shell phenotype of a palm plant. U.S. 2013 / 0247249 provides over 8200 specific polymorphisms, but it should be appreciated that the polymorphisms represented are merely examples of polymorphisms within the genomic region corresponding to SEQ ID NO: 27. Additional polymorphisms can be identified as desired and can be used to predict the shell phenotype of a palm plant. Such additional polymorphisms are contemplated to be encompassed by the methods described herein. Furthermore, it should be appreciated that SEQ ID NO: 27 is a representative sequence and different palm individuals can have one or more nucleotide changes relative to SEQ ID NO: 27 due to, for example, natural variation. However, as described elsewhere herein, identifying the genomic region corresponding to SEQ ID NO: 27 can be readily determined by alignment programs and the like.

[0120] The nucleic acid sequences provided herein were generated by nucleotide sequencing and occasionally include one or more consecutive "N"s. These consecutive N's represent a gap in the sequence assembly of the estimated size. The exact number of N's in the sequence is an estimate (e.g., 100 N's can represent only 30 bases). The N's can be any base and can be repetitive sequences in the genome.

[0121] Detection of specific polysaccharide markers can be accomplished by methods known in the art for detecting sequences at multiple loci. For example, standard techniques for genotyping the presence of SNPs and / or microsatellite markers can be used, such as fluorescence-based techniques (Chen, X. et al., Genome Res. 9(5):492-98 (1999)), utilizing PCR, LCR, nested PCR, and other techniques for nucleic acid amplification. Specific commercial methods that can be used for SNP genotyping include, but are not limited to, TaqMan TM Genotyping and SNPlex platforms (Applied Biosystems), gel electrophoresis (Applied Biosystems), mass spectrometry (e.g., MassARRAY system from Sequenom), microsequencing methods, real-time PCR, Bio-Plex system (BioRad), CEQ and SNPstream systems (Beckman), array hybridization techniques (e.g., Affymetrix GeneChip; Perlegen), BeadArray technology (e.g., Illumina GoldenGate and Infinium assays), array tag technology (e.g., Parallele), and endonuclease-based fluorescence hybridization technology (Invader; Third Wave). Some available array platforms, including Affymetrix SNP Array 6.0 and Illumina CNV370-Duo and 1M BeadChips, include SNPs that are tagged for certain copy number variations.

[0122] In some embodiments, polymorphic markers are detected by sequencing technology. The sequence signal obtained for a plant individual identifies the specific nucleotide in the sequence range. For SNPs, the sequence information for a single unique sequence site is sufficient to identify the allele at that particular SNP. For markers that include more than one nucleotide, the sequence information for the nucleotides of an individual identifies the alleles at the specific site for that individual.

[0123] Those skilled in the art are aware of various methods for obtaining nucleic acid sequences, and all of these methods can be used to practice the present invention. Sanger sequencing is a well-known method for generating nucleic acid sequence information. Recent methods for obtaining large amounts of sequence data have been developed, and these methods can also be considered for obtaining sequence information from plants as needed. These methods include, but are not limited to, pyrosequencing (Ronaghi, M. et al., Anal Biochem 267: 65-71 (1999); Ronaghi, et al., Biotechniques 25: 876-878 (1998)), such as 454 pyrosequencing (Nyren, P. et al., Anal Biochem 208: 171-175 (1993)), Illumina / Solexa sequencing technology (… Figure 2 See also Strausberg, RL et al., Drug Disc Today 13: 569-577 (2008), Platform for Oligonucleotide Ligation and Detection (SOLiD) technology (Applied Biosystems, www.appliedbiosystems.com); Strausberg, RL et al., Drug Disc Today 13: 569-577 (2008), Single-molecule real-time sequencing (Pacific Biosciences), and IonTorrent technology (ThermoFisher).

[0124] Polymorphism detection methods can be performed on any type of biological sample from plants containing nucleic acids (e.g., DNA, RNA). One advantage of this method is the ability to predict the shell phenotype of young plants before field cultivation. In some embodiments, samples are obtained from plants that have germinated for less than 1, 2, 4, or 6 months, or less than 1, 2, 3, 4, or 5 years. In some embodiments, plants are produced by hybridization between i) *dura* and *pisfera* palms, ii) self-pollination of *tenera* palms, iii) hybridization between two plants with the *tenera* shell phenotype, iv) hybridization between *dura* and *tenera* palms, and v) hybridization between *tenera* and *pisfera* palms. Because these hybridizations are not 100% effective, they result in a certain proportion of seeds or plants that will not produce seeds or plants with the *tenera* shell phenotype in the future (hypothesis i), and the observed values ​​of *tenera* palms do not conform to the expected Mendelian segregation (ii, iii & iv). By testing seeds or plants produced from attempted hybridization, non-tenera contamination from materials grown for cultivation can be reduced or eliminated (optionally discarding those predicted as dura and / or pisifera). Alternatively, based on their predicted shell genotype,

[0125] Plants can be identified and separated so that pure pisifera and / or dura trees can be selected and cultivated in the field as desired, for example for later breeding purposes.

[0126] III. Transgenic Plants

[0127] Based on the above discussion, it has been discovered that the SHELL gene of oil palm can be used to control the shell phenotype. Thus, in some embodiments, plants are provided that have modulated expression of a SHELL polypeptide. As a heterozygote between dura and pisifera alleles, the tenera naturally produces more of the desired shell phenotype (tenera, having a shell less than 2 mm thick).

[0128] It has been discovered that the pisifera SHELL allele contains a missense mutation in a portion of the gene that encodes a MADS box domain of the protein that functions in transcriptional regulation. Thus, it is hypothesized that the tenera phenotype can result from a mechanism involving protein-protein interactions: the non-DNA binding pisifera version of the SHELL protein interacts with either a fully functional version of SHELL (a dimer) or other MADS-box family members (heterodimers). Thus, in some embodiments, plants are provided that have a heterologous SHELL polypeptide expressed with a functional M, I, and K domains and a non-functional C- (MADs box) domain. The M, I, K, and C domains are described in, for example, Gramzow and Theissen, 2010 Genome Biology 11 :214-224, and the corresponding domains can be identified in the oil palm sequences described herein. By expressing the protein with the active protein-protein interaction domain rather than the non-functional DNA binding domain, the SHELL protein interaction is removed by biological action, resulting in a decrease in shell thickness. Thus, for example, any of the pisifera alleles described herein can be expressed under the control of a heterologous promoter in a plant (e.g., an oil palm plant, e.g., a dura background), resulting in a decrease in shell thickness.

[0129] Similarly, it has been discovered that many pisifera SHELL alleles contain mutations in the nuclear localization signal (NLS) within the MADS box domain of the SHELL protein. Thus, it is hypothesized that the tenera phenotype can result from a mechanism involving protein-protein interactions between the protein of one or more pisifera SHELL alleles lacking a NLS and one or more fully functional SHELL (dimer) or other MADS-box family members (heterodimer). By expressing the protein with the active protein-protein interaction domain rather than the non-functional NLS, the protein that modifies SHELL protein interactions can be inhibited (e.g., prevented) from entering the nucleus (e.g., blocked) or removed from the nucleus, thereby reducing the number of biologically active SHELL proteins interacting with the proteins (e.g., binding partners) with which it interacts in the nucleus and resulting in a decrease in shell thickness. Thus, for example, under the control of a heterologous promoter in a plant (e.g., a palm such as a dura background), any pisifera allele containing a mutation in the NLS as described herein, or a SHELL gene encoding a SHELL protein mutated at any (e.g., conserved) amino acid of the NLS, can be expressed, resulting in a decrease in shell thickness.

[0130] B. Use of nucleic acids of the application to enhance gene expression

[0131] Nucleic acid sequences encoding a full length or active portion of a SHELL polypeptide (including but not limited to a SHELL polypeptide having functional M, I, and K domains and a non-functional C domain, or a SHELL polypeptide having a non-functional NLS, which when expressed controls shell thickness) can be used to make expression cassettes that enhance or increase SHELL gene expression. Where gene expression is desired, the desired SHELL gene from a different species can be used to reduce potential positive suppression effects.

[0132] Any of a number of methods well known in the art can be used to increase SHELL activity in a plant. Any organ can be targeted, such as shoots, vegetative organs / structures (e.g., leaves, stems, and tubers), roots, flowers and floral organs / structures (e.g., bracts, sepals, petals, stamens, carpels, anthers, and ovules), seeds (including embryos, endosperms, and seed coats), and fruits. Alternatively, the SHELL gene can be expressed constitutively (e.g., using the CaMV 35S promoter).

[0133] The skilled artisan will recognize that, as with other proteins, the polypeptides encoded by the genes of the application have different domains that perform different functions. Thus, the gene sequence need not be full length so long as the desired functional domain of the protein is expressed.

[0134] III. Preparation of recombinant vectors

[0135] In some embodiments, to use the isolated sequences in the above-described techniques, recombinant DNA vectors suitable for transformation of plant cells are prepared. Techniques for transforming a variety of higher plant species are well known and described in the scientific literature. See, for example, Weising et al. Ann. Rev. Genet. 22:421-477 (1988). The DNA sequence encoding the desired polypeptide, such as a cDNA sequence encoding a full-length protein, is preferably combined with transcriptional and translational initiation regulatory sequences that direct transcription of the gene sequence in the target tissues of the transformed plant.

[0136] For example, for overexpression, a plant promoter fragment can be employed to direct expression of the gene in all tissues of the regenerated plant. These promoters are referred to herein as "constitutive" promoters and are active in most environmental conditions and in developmental or cell differentiation states. Examples of constitutive promoters include the cauliflower mosaic virus (CaMV) 35S transcriptional initiation region, the 1 '- or 2'-promoter from the T-DNA of Agrobacterium tumefaciens, and other transcriptional initiation regions from various plant genes known to the skilled artisan.

[0137] Alternatively, the plant promoter can direct expression of the polynucleotide of the application in specific tissues (tissue-specific promoters) or can be under more stringent environmental control (inducible promoters). Examples of tissue-specific promoters under developmental control include promoters that initiate transcription only in specific tissues, e.g., leaves, seeds, or flowers. Examples of environmental conditions that can affect transcription of inducible promoters include anoxia, high temperature, or presence of a ligand.

[0138] If appropriate polypeptide expression is desired, a polyadenylation region should be included at the 3 '-end of the coding region. This polyadenylation region can be from the native gene, from various other plant genes, or from the T-DNA.

[0139] Vectors containing sequences from the genes of the application, such as the promoter or coding region, can optionally comprise a marker gene that confers a selectable phenotype in plant cells. For example, the marker can encode resistance to an antimicrobial agent, particularly an antibiotic, such as kanamycin, G418, bleomycin, hygromycin, or hygromycin resistance, e.g., chlorosulfuron or Basta resistance.

[0140] A SHELL nucleic acid operably linked to a promoter is provided, which in some embodiments is capable of driving transcription of a SHELL coding sequence in a plant. The promoter can be, for example, from a plant or a virus. The promoter can be, for example, constitutively active, inducible or tissue specific. In constructing the recombinant expression cassettes, vectors, transgenes of the application, different promoters can be selected and used to differentially direct gene expression, for example, in some or all tissues of a plant or animal. In some embodiments, the desired promoter is identified by analysis of the 5' sequence of a genomic clone corresponding to the SHELL gene described herein, as discussed above.

[0141] V. Production of Transgenic Plants

[0142] The DNA constructs of the application can be introduced into the desired plant host by a variety of conventional techniques. For example, the DNA construct can be introduced directly into the genomic DNA of a plant cell using techniques such as electroporation and microinjection of plant cell protoplasts, or the DNA construct can be introduced directly into plant tissue using ballistic methods, such as DNA microprojectile bombardment. Alternatively, the DNA construct can be associated with suitable T-DNA flanking regions and introduced into a conventional Agrobacterium tumefaciens host vector. The invasive functions of the Agrobacterium tumefaciens host will direct the insertion of the construct and adjacent markers into the plant cell DNA when the cell is infected with the bacteria.

[0143] Various palm transformation methods have been described. See, for example, Masani and Parveez, Electronic Journal of Biotechnology Vol. 11 No. 3, July 15, 2008; Chowdury et al., Plant Cell Reports, Volume 16, Number 5, 277-281 (1997).

[0144] Microinjection techniques are well known in the art and well described in the scientific literature. Paszkowski et al. EMBO J. 3:2717-2722 (1984) describe the use of polyethylene glycol precipitation for introducing DNA constructs. Fromm et al. Proc. Natl. Acad. Sci. USA 82:5824 (1985) describe electroporation techniques. Klein et al. Nature 327:70-73 (1987) describe ballistic transformation techniques.

[0145] The scientific literature describes in detail Agrobacterium tumefaciens-mediated transformation techniques, including disarming and use of binary vectors. See, for example, Horsch et al. Science 233:496-498 (1984), and Fraley et al. Proc. Natl. Acad. Sci. USA 80:4803 (1983).

[0146] Plants cells transformed by any of the transformation techniques can be grown to regenerate into whole plants having a transformed genotype and, thus, a desired phenotype. Such regeneration techniques rely on manipulation of certain phytohormones in a tissue culture growth medium, optionally in combination with the use of an antimicrobial agent and / or herbicide marker introduced together with the desired nucleotide sequence. Plants regenerated from cultured protoplasts are described in Evans et al., Protoplasts Isolation and Culture, Handbook of Plant Cell Culture, pp. 124-176, MacMillilan Publishing Company, New York, 1983; and Binding, Regeneration of Plants, Plant Protoplasts, pp. 21-73, CRC Press, Boca Raton, 1985. Regeneration can also be obtained from plant callus, explants, organs, or parts thereof. These regeneration techniques are described generally in Klee et al. Ann. Rev. of Plant Phys. 38:467-486 (1987).

[0147] The nucleic acids of the present application can be used to impart a desired trait to essentially any plant. Thus, the present application uses a large number of plants, including species of the following genera: Asparagus, Atropa, Avena, Brassica, Citrus, Cucumis, Capsicum, Cucurbita, Daucus, Fragaria, Glycine, Gossypium, Helianthus, Hemerocallis, Hordeum, Hyoscyamus, Lactuca, Linum, Lolium, Lycopersicon, Malus, Manihot, Matthiola, Medicago, Nicotiana, Oryza, Panicum, Pennisetum, Persea, Pisum, Plumbago, Prunus, Raphanus, Secale, Senecia, Sinapis, Solanum, Sorghum, Trifolium, Triticum, Vitis, Vigna, and Zea. Plants having a shell, as well as those used in the present application include, but are not limited to, dicotyledons and monocotyledons, including, but not limited to, palms.

[0148] Examples

[0149] The following examples are provided for illustration, and are not limiting of the claimed application.

[0150] Example 1. Identification of allele 3-11, corresponding to nucleotide sequences SEQ ID NOs: 12-21 and polypeptides SEQ ID NOs: 3-11

[0151] We previously reported that homozygotes (e.g. AVROS / AVROS, MPOB / MPOB or AVROS / MPOB) and tenera oil palm fruit phenotypes, heterozygotes with one wild type dura allele (e.g. AVROS / dura or MPOB / dura), AVROS and MPOB mutations in exon 1 of the SHELL gene are responsible for pisifera oil palm fruit phenotypes. While tenera oil palm is the preferred phenotype for commercial oil palm production, it is very difficult to completely prevent the occurrence of wild type dura palms in commercial populations. To assess the extent of dura contamination within commercial oil palm populations, and to search for new alleles of the SHELL gene that produce pisifera / tenera phenotypes, we tested 5,158 oil palm trees from 6 different smallholders in Malaysia for the presence of AVROS and / or MPOB alleles using an allele-specific PCR assay for each allele (dura, sh AVROS and sh MPOB ) alleles. As expected, the majority of palms were heterozygous for sh AVROS or sh MPOB alleles (Table 2).

[0152] However, 504 palms that were predicted to be homozygous for the Sh DeliDura allele at the SNP position. Exon 1 of the SHELL gene, which encodes the entire MADS box domain, was sequenced in each of these 504 palms. Sequencing was performed by PCR using primers flanking exon 1 to amplify the amplicon. PCR was performed under standard conditions. The amplicon was purified and Sanger sequenced using primers within the PCR amplification primers in one direction. Sequence reads were individually analyzed in the DONSED to determine the identity of the sequence to each nucleotide position within exon 1. As shown in Table 2, 13 palms were determined to be heterozygous for the sh AVROS allele (2 from site 1, 4 from site 2, 2 from site 3, 3 from site 4 and 2 from site 5), indicating that these palms are indeed genotype tenera palms. Three palms were determined to be heterozygous for the sh MPOB allele (1 from site 2, 1 from site 4 and 1 from site 5), indicating that these are also genotype tenera palms. However, the remaining 488 palms were homozygous for the Sh DeliDura allele at the SNP position, indicating that these trees are genotype dura, or they carry a previously unidentified mutant allele of the SHELL gene.

[0153] Allele 3 (SEQ ID NO: 3 and 13) was found in 68 palms that were heterozygous (Table 2), allele 4 (SEQ ID NO: 4 and 14) was found in 66 palms that were heterozygous and allele 5 was found in 1 palm that was heterozygous. Each of these 135 palms was independent of each other. There were amino acids encoded by alleles 3 and 5 within the NLS of SHELL because of the AVROS and MPOB mutations ( Figure 2 ). The amino acid encoded by allele 4 was located outside the sh AVROS The 10 amino acids C-terminal of the amino acid mutated by the alleles.

[0154] Table 2 identifies the SHELL exon 1 genotypes of palm samples from small-scale planters

[0155]

[0156] a Independent palm numbers of AVROS and MPOB mutations were tested by allele-specific PCR assays

[0157] b Further analysis of independent palm numbers was performed by sequencing the exon 1 DNA of the SHELL gene

[0158] Next, we tested the genotypes of 3952 palms from seven oil palm nursery sites throughout Malaysia (Table 3). Again, most were heterozygous for either the shAVROS or shMPOB alleles, indicating that they were genotype tenera palms. However, 536 palms that were predicted to be homozygous for SHELL were sequenced. DeliDura The alleles were located at the SNP positions. As described above, exon 1 of the SHELL gene encoding the entire MADS box domain was sequenced in each of these 536 palms.

[0159] As shown in Table 3, six palms were determined to be heterozygous for the sh AVROS alleles, indicating that these palms were indeed genotype tenera palms. One palm was determined to be heterozygous for the sh MPOB alleles. However, the remaining 529 palms were determined to be homozygous for the Sh DeliDura alleles at the SNP positions, indicating that these trees were genotype dura or that they carried a previously unidentified mutant allele of the SHELL gene. Allele 3 (SEQ ID NO: 3 and 13) was found in 36 palms that were heterozygous and allele 4 (SEQ ID NO: 4 and 14) was found in 2 palms that were heterozygous. Each of these 38 palms was independent of each other.

[0160] Table 3 determines the SHELL exon 1 genotypes of palm samples from the oil palm nursery

[0161]

[0162] a Number of independent palms of AVROS and MPOB mutations tested by the allele-specific PCR assay

[0163] b Number of independent palms further analyzed by DNA sequencing of exon 1 of the SHELL gene

[0164] To further identify SHELL exon 1 variants, we sequenced exon 1 of the SHELL gene in 148 palms from a germplasm collection collected in different geographical regions (64 from Angola, 28 from Ghana, 27 from Nigeria, 27 from Tanzania and 2 from Guinea). The sh AVROS The allele most frequently expected as tenera phenotype (50 palms from Angola, 10 from Ghana, 6 from Nigeria and 22 from Nigeria palms), however, was detected as sh MPOB The allele (Table 4). Allele 4 was detected in 1 palm from Ghana and 2 from Guinea (also detected in small plantation owners and nurseries).

[0165] In addition, 6 novel SHELL alleles were detected. Allele 6 was detected in 4 palms from Tanzania and encodes an aspartic acid to glutamic acid amino acid change at position 12 relative to dura Figure 2 and 3 ). Allele 7 was detected in 1 palm and encodes a 5 amino acid in-frame deletion relative to dura. Alleles 8 and 9 change the same amino acid relative to dura. In allele 8 the conserved arginine is changed to histidine at position 24 and to glycine in allele 9 ​ and 3 ). Allele 10 was detected in one palm from Ghana and encodes a valine to glutamic acid amino acid substitution at position 37 relative to dura. Finally, allele 11 was detected in two palms from Angola and encodes a synonymous single nucleotide polymorphism ​ Notably, as with the sh AVROS and sh MPOB mutations, alleles 3, 5, 7, 8 and 9 all affect part of the highly conserved NLS of the SHELL protein.

[0166] Table 4 determines the SHELL exon 1 genotypes in the germplasm collection

[0167]

[0168] Sequencing of a portion of the palm germplasm collection revealed 32 phenotypes of oil palm fruit (dura, tenera, or pisifera) visible to the naked eye. Of the three Angolan palms classified as tenera, two were sh... AVROS The allele is heterozygous and wild-type (dura) at all other exon 1 nucleotide positions within exon 1. In the two Angolan palm phenotypes that are dura, both are allele 11 variants (allele 11 / Sh). DeliDura The *Tenera* palm is a heterozygote and exhibits wild-type (dura) at all exon 1 nucleotide positions, consistent with the expectation that it is not directly involved in the synonymous change of the *Tenera* / *Pisifera* phenotype. An *Angora palm* species exhibiting *Tenera* phenotype is wild-type (dura) at all exon 1 nucleotide positions. No *Angora palm* species exhibited the *Pisifera* phenotype in this study.

[0169] Of the 10 Ghanaian palms named *Tenera*, one was allele 4 (allele 4 / Sh). DeliDura The four strains are heterozygous for all exons 1 nucleotide position and are wild-type (dura), and are allele 8 (allele 8 / Sh). DeliDura The four strains are heterozygous for all exon 1 nucleotide positions and are wild-type (dura), and are allele 9 (allele 9 / Sh). DeliDura The heterozygote is wild-type (dura) at all other exon 1 nucleotide positions, and one strain is allele 10 (allele 10 / Sh). DeliDura It is a heterozygote of ) and is wild-type (dura) at all other exon 1 nucleotide positions. No Ghana palm in this study was dura phenotyped.

[0170] Of the eight Nigerian palm trees planted in Tenera, three are sh AVROS Alleles (sh AVROS / Sh DeliDura The three strains are heterozygous and wild-type (dura) at all other nucleotide positions. MPOB Alleles (sh MPOB / Sh DeliDura One strain is a heterozygote and is wild-type (dura) at 1 nucleotide position in all other exons, and one strain is an allele (allele 7 / Sh). DeliDuraThe species is a heterozygote of and is wild-type (dura) at all other exon 1 nucleotide positions. One Nigerian palm, *Pistifera tenera*, is wild-type (dura) at all exon 1 nucleotide positions. Of the two Nigerian palms *Pistifera*, one is sh... AVROS The allele is homozygous and wild-type (dura) at nucleotide 1 position in all other exons, while the others are sh. AVROS Alleles (sh AVROS / Sh DeliDura It is a heterozygote of ) and is wild-type (dura) at all other exon 1 nucleotide positions. No Nigerian palm in this study was dura phenotyped.

[0171] Of the two Tanzanian palm phenotypes for *Tenera*, one was sh. AVROS Alleles (sh AVROS / Sh DeliDura The heterozygote is wild-type (dura) at all other exon 1 nucleotide positions, while the others are on one chromosome and six pairs of alleles on other chromosomes (sh). AVROS The compound possessing the shAVROS allele (allele 6) was heterozygous and wild-type (dura) at the 1-nucleotide position of all other exons. Furthermore, three of the three Tanzanian palms that were dura were heterozygous for allele 6. This suggests that while allele 6 may not contribute to the tenera phenotype, markers of tightly linked alleles do. No Tanzanian palms in this study exhibited the pisifera phenotype.

[0172] Of the two Guinean palm species named *tenera*, one is allele 4 (allele 4 / Sh). DeliDura One plant was a heterozygote of allele 4 and was wild-type (dura) at all other exon 1 nucleotide positions. The other plant was homozygous for allele 4 and was wild-type (dura) at all other exon 1 nucleotide positions. None of the guinea palms in this study exhibited the dura or pisifera phenotype.

[0173] References

[0174] Beirnaert, A. and Vanderweyen, R. 1941. Contribution to a variety of species d'Elaeis guineensis Jacq. Publs. INEAC, Series Ser. Sci. (27): 101.

[0175] Bhasker, S. & Mohankumar, C. Association of lignifying enzymes in shell synthesis of oil palm fruit (Elaeis guineensis - dura variety). 2001. Indian J Exp Biol 39: 160-4.

[0176] Billotte, N., Marseillac, N., Risterucci, A. M., Adon, B., Brotteir, P., Baurens, F. C, Singh, R., Herran, A., Asmady, H., Billot, C, Amblard, P Durrand-Gasselin, T., Courtois, B., Asmono, D., Cheah, S. C, Rohde, W and Charrier, A. 2005. Microsatellite-based high density linkage map in oil palm (Elaeis guineensis Jacq.). Theoretical and Applied Genetics 110: 754-765.

[0177] Birchler, J. A., Auger, D. L. & Riddle, N. C. 2003. In search of the molecular basis of heterosis. Plant Cell 15: 2236-9.

[0178] Cheah, S. C. 1996. Restriction Fragment Length Polymorphism (RFLP) in Oil Palm. Project Completion Report No. 0011 / 95, 4 th July 1996, Malaysian Palm Oil Board (MPOB), Bangi, Malaysia.

[0179] Cheah, S. C. and Rajinder, S. 1998. Gene expression during flower development in the oil palm. Project Completion Report No. 0057 / 98, 16th July 1999. Palm Oil Research Institute of Malaysia (PORIM), Bangi, Malaysia.

[0180] Corley, R. H. V. and Tinker, P. B. 2003. Care and maintenance of oil palms. In The Oil Palm (4th edition), pp: 287-326. Oxford: Blackwell Science. th

[0181] Danielsen, F. et al. 2009. Biofuel plantations on forested lands: double jeopardy for biodiversity and climate. Conserv Biol 23: 348-58.

[0182] Devuyst, A. 1953. Selection of the oil palm (Elaeis guineensis) in Africa. Nature 172: 685-686.Dinneny, J. R. and Yanofsky, M. F. 2005. Drawing lines and borders: how the dehiscent fruit of Arabidopsis is patterned. Bioessays 27: 42-9.

[0183] Donough, C. R. and Law, I. H. 1995. Breeding and selection for seed production at Pamol Plantations Sdn Bhd and early performance of Pamol D x P. Planter 71: 513-530.

[0184] Doyle, J. J. and Doyle, J. L. 1990. Isolation of plant DNA from fresh tissue. FOCUS 12: 13-15.

[0185] Ferrandiz, C, Liljegren, S. J. & Yanofsky, M. F. 2000. Negative regulation of the SHATTERPROOF genes by FRUITFULL during Arabidopsis fruit development. Science 289: 436-8.

[0186] Godding, R. 1930. Observation de la production de palmiers selectionnes a Mongana (Equateur). Bull Arig. Congo belge 21 : 1263.

[0187] Gschwend, M. et al. 1996. A locus for Fanconi anemia on 16q determined by homozygosity mapping. Am J Hum Genet 59: 377-84.

[0188] Gu, Q., Ferrandiz, C, Yanofsky, M. F. & Martienssen, R. 1998. The FRUITFULL MADS-box gene mediates cell differentiation during Arabidopsis fruit development. Development 125: 1509-17.

[0189] Gramzow, L. and Theissen, G. 2010. A hitchhiker's guide to the MADS world of plants. Genome Biology 11 : 214-225.

[0190] Hardon, J.J., Rao, V., and Rajanaidu, N. 1985. A review of oil palm breeding. In Progress in Plant Breeding, ed G.E. Rusell, pp 139-163, Butterworths, UK.

[0191] Hartley, C.W.S. 1988. The botany of oil palm. In The oil palm (3 rd edition), pp: 47-94, Longman, London.

[0192] Huang, H., Tudor, M., Su, T., Zhang, Y., Hu, Y., and Ma, H. 1996. DNA binding properties of two Arabidopsis MADS domain proteins: Binding Consensus and Dimer Formation. The Plant Cell 8: 81-94.

[0193] Immink, R.G., Gadella, T.W.J., Ferrario, S., Busscher, M., and Angenent, G. 2002. Proc. Natl. Acad. Sci. 99: 2416-2421.

[0194] Immink, R.G., Kaufmann, K. & Angenent, G.C. 2010. The 'ABC' of MADS domain protein behaviour and interactions. Semin Cell Dev Biol 21 : 87-93.

[0195] Jack, P. L., James, C, Price, Z., Rance, K., Groves, L., Corle Y, R. H. V., Nelson, S. and Rao, V. 1998. Application of DNA markers in oil palm breeding. In: 1998 International Oil Palm Congress - Commodity of the past, today and future, September 23-25, 1998, Bali, Indonesia.

[0196] Krieger, U., Lippman, Z. B. & Zamir, D. 2010. The flowering gene SINGLE FLOWER TRUSS drives heterosis for yield in tomato. Nat Genet 42: 459-63.

[0197] Lander, E. S. and Botstein, D. 1987. Homozygosity mapping: a way to map human recessive traits with the DNA of inbred children. Science 236: 1567-70.

[0198] Latiff, A. 2000. The Biology of the Genus Elaeis. In: Advances in Oil Palm Research, Volume 1, ed. Y. Basiron, B. S. Jalani, and K. W. Chan, pp: 19-38, Malaysian Palm Oil Board (MPOB).

[0199] Liljegren, S. J., Ditta, G. S., Eshed, Y., Savidge, B., Bowman, J. L., Yanofsky, M. F. 2000. SHATTERPROOF MADS-box genes control seed dispersal in Arabidopsis. Nature 404: 766-770.

[0200] Maria, M., Clyde, M. M. and Cheah, S. C. 1995. Cytological analysis of Elaeis guineensis (tenera) chromosomes. Elaeis 7: 122-134.

[0201] Mayes, S., Jack, P. L., Marshall, D. F. and Corley, R. H. V. 1997. Construction of a RFLP genetic linkage map for oil palm (Elaeis guineensis Jacq.). Genome 40: 116-122.

[0202] Moretzsohn, M. C, Nunes, C. D. M., Ferreira, M. E. and Grattapaglia, D. 2000. RAPD linkage mapping of the shell thickness locus in oil palm (Elaeis guineensis Jacq.). Theoretical and Applied Genetics 100: 63-70.

[0203] Ooijen, J. W. V. 2006. JoinMap 4.0: Software for calculation of genetic linkage maps. In experimental populations. Kyazma B. V., Wageningen, Netherlands

[0204] Pinyopich, A. et al. 2003. Assessing the redundancy of MADS-box genes during carpel and ovule development. Nature 424: 85-8.

[0205] Purseglove, J. W. 1972. Tropical Crops. Monocotyledons. Longman, London. pp: 607.

[0206] Rajanaidu, N., Rao, V., Abdul Halim, H. & A. S. H., O. 1989. Genetic resources: New developments in Oil Palm breeding. Elaeis 1 : 1-10.

[0207] Rajanaidu, N. 1990. Major developments in oil palm (Elaeis guineensis) breeding. In Proceedings of the 12 th Plenary Meeting of AETFAT, pp: 39-52. Hamburg, Germany.

[0208] Rajanaidu, N. et al. 2000. in Advances in Oil Palm Research (eds. Basiron, Y., Jalani, B. S. & Chan, K. W.) 171-237 (Malaysian Palm Oil Board (MPOB), Bangi, Selangor).

[0209] Sambrook, J., Fritsch, E. F. and Maniatis, T. 1989. Molecular cloning: A Laboratory manual, (2 nd edition). Cold Spring Harbor Laboratory Press, Cold Spring Harbor, N.Y.

[0210] Singh R, Tan SG, Panandam JM, Rahman RA, Ooi LCL, Low ETL, Sharma M, Jansen J and Cheah SC. 2009. Mapping quantitative trait loci (QTLs) for fatty acid composition in an interspecific cross of oil palm. BMC Plant Biology 9: 114.

[0211] Sousa, J., Barata, A.V., Sousa, C, Casanova, C.C. and Vicente, L. 201 1. Chimpanzee oil-palm use in southern Cantanhez National Park, Guinea-Bissau. Am J Primatol 73:485-97.

[0212] Tani, E., Polidoros, A.N. & Tsaftaris, A.S. Characterization and expression analysis of FRUITFULL- and SHATTERPROOF-like genes from peach (Prunus persica) and their role in split-pit formation. 2007. Tree Physiol 27:649-59.

[0213] Vrebalov, J., Pan, I.L., Arroyo, A.J.M., McQuinn, R., Chung, M., Poole, M., Rose, J., Seymour, G., Grandillo, S., Giovannoni, J., and Irish, V.F. 2009. Fleshy fruit expansion and ripening are regulated by the tomato SHATTERPROOF gene TAGL1. The Plant Cell 21 :3041-3062.

[0214] Whitmore, T.C. 1973. The Palms of Malaya. Longmans, Malaysia, pp: 56-58.

[0215] The terms "a" or "an", are intended to mean "one or more". The term "includes" and variations thereof such as "including", and "comprise" and variations thereof, when preceding the term comprising, are not intended to be exclusive nor to exclude other steps or elements not recited. All patents, patent applications and other published references cited herein are hereby incorporated by reference in their entirety.

[0216] Informal list of exemplary sequences

[0217] SEQ ID NO: 1 is a SHELL predicted protein sequence, underlined, italicized and bold mutations

[0218] [pisifera, Zaire allele; sh AVROS ]

[0219]

[0220] SEQ ID NO: 2 is a SHELL predicted protein sequence, underlined, italicized and bold mutations

[0221] [pisifera, Nigeria allele; sh MPOB ]

[0222]

[0223] SEQ ID NO: 3 is a SHELL predicted protein sequence, underlined, italicized and bold mutations

[0224] [predicted pisifera, allele 3]

[0225]

[0226] SEQ ID NO: 4 is a SHELL predicted protein sequence, underlined, italicized and bold mutations

[0227] [predicted pisifera, allele 4]

[0228]

[0229] SEQ ID NO: 5 is a SHELL predicted protein sequence, underlined, italicized and bold mutations

[0230] [predicted pisifera, allele 5]

[0231]

[0232]

[0233] SEQ ID NO: 6 is a SHELL predicted protein sequence, underlined, italicized and bold mutations

[0234] [predicted pisifera, allele 6]

[0235]

[0236] SEQ ID NO: 7 is a SHELL predicted protein sequence, with missing amino acids indicated by dashes (“-”)

[0237] [Predicted pisifera, allele 7]

[0238] MGRGKIE-----NTTSRQVTFCKRRNGLLKKAYELSVLCDAEVALIVFSSRGRLYEYANNSIRSTIDRYKKACANSSNSGATIEINSQYYQQESAKLRHQIQILQNANRHLMGEALSTLTVKELKQLENRLERGITRIRSKKHELLFAEIEYMQKREVELQNDNMYLRAKIAENERAQQAA

[0239] SEQ ID NO: 8 is a SHELL predicted protein sequence with underlined, italicized, and bold mutations

[0240] [Predicted pisifera, allele 8]

[0241]

[0242] SEQ ID NO: 9 is a SHELL predicted protein sequence with underlined, italicized, and bold mutations

[0243] [Predicted pisifera, allele 9]

[0244]

[0245] SEQ ID NO: 10 is a SHELL predicted protein sequence with underlined, italicized, and bold mutations

[0246] [Predicted pisifera, allele 10]

[0247]

[0248] SEQ ID NO: 11 is a SHELL predicted protein sequence with silent mutations to produce wild type amino acid sequence

[0249] [Predicted pisifera, allele 11]

[0250] MGRGKIEIKRIENTTSRQVTFCKRRNGLLKKAYELSVLCDAEVALIVFSSRGRLYEYANNSIRSTIDRYKKACANSSNSGATIEINSQYYQQESAKLRHQIQILQNANRHLMGEALSTLTVKELKQLENRLERGITRIRSKKHELLFAEIEYMQKREVELQNDNMYLRAKIAENERAQQAA

[0251] SEQ ID NO: 12 is a deletion in intron 1 of the SHELL gene, with deleted nucleotides with respect to the wild type indicated by dashes (“-”)

[0252] GTATGCTTTGATGACGCCTTCTCTTCCTTCGCTCATATCAAG----TTTTATGGCTTCA T

[0253] SEQ ID NO: 13 is the exon 1 sequence of allele 3, with underlined, italicized, and bold mutations

[0254]

[0255] SEQ ID NO: 14 is the exon 1 sequence of allele 4, with underlined, italicized, and bold mutations

[0256]

[0257] SEQ ID NO: 15 is the exon 1 sequence of allele 5, with underlined, italicized, and bold mutations

[0258]

[0259]

[0260] SEQ ID NO: 16 is the exon 1 sequence of allele 6, with underlined, italicized, and bold mutations

[0261]

[0262] SEQ ID NO: 17 is the exon 1 sequence of allele 7, with deleted nucleotides with respect to the wild type indicated by dashes (“-”)

[0263] ATGGGTAGAGGAAAGATTGAGA---------------ACACCACAAGCCGGCAGGTCACTTTCTGCAAACGCCGAAATGGACTGCTGAAGAAAGCTTATGAGTTGTCTGTCCTTTGTGATGCTGAGGTTGCCCTTATTGTCTTCTCCAGCCGGGGCCGCCTCTATGAGTACGCCAATAACAG

[0264] SEQ ID NO: 18 is the exon 1 sequence of allele 8, underlined, italicized and bold mutations

[0265]

[0266] SEQ ID NO: 19 is the exon 1 sequence of allele 9, underlined, italicized and bold mutations

[0267]

[0268] SEQ ID NO: 20 is the exon 1 sequence of allele 10, underlined, italicized and bold mutations

[0269]

[0270] SEQ ID NO: 21 is the exon 1 sequence of allele 11, underlined, italicized and bold mutations

[0271]

[0272] SEQ ID NO: 22 is the exon 1 sequence of sh AVROS allele 12, underlined, italicized and bold mutations

[0273]

[0274] SEQ ID NO: 23 is the exon 1 sequence of sh MPOB allele 13, underlined, italicized and bold mutations

[0275]

[0276] SEQ ID NO: 24 is the wild type SHELL (Sh DeliDura ) predicted protein sequence with mutations in sh AVROS , sh MPOB alleles 3-6 and 8-10 underlined, italicized and bold. Mutations in amino acids in allele 7 are underlined.

[0277] [dura, Sh DeliDura ]

[0278]

[0279] SEQ ID NO: 25 is the wild type (Sh DeliDura ) exon 1 sequence, with the mutated nucleotides in sh AVROS , sh MPOB , and alleles 3-6 and 8-11 underlined, italicized, and bolded. The deleted nucleotides in allele 7 are underlined.

[0280]

[0281] SEQ ID NO: 26 is the wild type SHELL (Sh DeliDura ) exon 1 ATGGGTAGAGGAAAGATTGAGATCAAGAGGATCGAGAACACCACAAGCCGGCAGGTCACTTTCTGCAAACGCCGAAATGGACTGCTGAAGAAAGCTTATGAGTTGTCTGTCCTTTGTGATGCTGAGGTTGCCCTTATTGTCTTCTCCAGCCGGGGCCGCCTCTATGAGTACGCCAATAACAGGTATGCTTTGATGACGCCTTCTCTTCCTTCGCTCATATCAAGTTAATTTTATGGCTTCATTTGTTCTATGGCCAAGCCAAATTCTTTTTAAAGTTCTAGAATGTTAATGATGGTAGTTT SEQUENCE LISTING <110> Singh, Rajinder Ti, Leslie Low Eng Li, Leslie Ooi Cheng Abdullah, Meilina Ong Nookiah, Rajanaidu Ong Nookiah, Rajanaidu Sambanthamurthi, Ravigadevi Van Brung, Andrew Van Brunt, Andrew Budiman, Muhammad A. Smith, Steven W. Lakey, Nathan D. Martienssen, Rob Ordway, Jared <120> GENE CONTROLLING SHELL PHENOTYPE IN PALM <130> 96380‑944615 (000600US) <160> 33 <170> PatentIn version 3.5 <210> 1 <211> 181 <212> PRT <213> Elaeis guineensis <400> 1 Met Gly Arg Gly Lys Ile Glu Ile Lys Arg Ile Glu Asn Thr Thr Ser 1 5 10 15 Arg Gln Val Thr Phe Cys Lys Arg Arg Asn Gly Leu Leu Lys Asn Ala 20 25 30 Tyr Glu Leu Ser Val Leu Cys Asp Ala Glu Val Ala Leu Ile Val Phe 35 40 45 Ser Ser Arg Gly Arg Leu Tyr Glu Tyr Ala Asn Asn Ser Ile Arg Ser 50 55 60 Thr Ile Asp Arg Tyr Lys Lys Ala Cys Ala Asn Ser Ser Asn Ser Gly 65 70 75 80 Ala Thr Ile Glu Ile Asn Ser Gln Tyr Tyr Gln Gln Glu Ser Ala Lys 85 90 95 Leu Arg His Gin lie Gin lie Leu Gin Asn Ala Asn Arg His Leu Met 100 105 110 Gly Glu Ala Leu Ser Thr Leu Thr Val Lys Glu Leu Lys Gin Leu Glu 115 120 125 Asn Arg Leu Glu Arg Gly lie Thr Arg lie Arg Ser Lys Lys His Glu 130 135 140 Leu Leu Phe Ala Glu lie Glu Tyr Met Gin Lys Arg Glu Val Glu Leu 145 150 155 160 Gln Asn Asp Asn Met Tyr Leu Arg Ala Lys lie Ala Glu Asn Glu Arg 165 170 175 Ala Gin Gin Ala Ala 180 <210> 2 <211> 181 <212> PRT <213> Elaeis guineensis <400> 2 Met Gly Arg Gly Lys lie Glu lie Lys Arg lie Glu Asn Thr Thr Ser 1 5 10 15 Arg Gin Val Thr Phe Cys Lys Arg Arg Asn Gly Leu Pro Lys Lys Ala 20 25 30 Tyr Glu Leu Ser Val Leu Cys Asp Ala Glu Val Ala Leu lie Val Phe 35 40 45 Ser Ser Arg Gly Arg Leu Tyr Glu Tyr Ala Asn Asn Ser Ile Arg Ser 50 55 60 Thr Ile Asp Arg Tyr Lys Lys Ala Cys Ala Asn Ser Ser Asn Ser Gly 65 70 75 80 Ala Thr Ile Glu Ile Asn Ser Gln Tyr Tyr Gln Gln Glu Ser Ala Lys 85 90 95 Leu Arg His Gin Ile Gin Ile Leu Gin Asn Ala Asn Arg His Leu Met 100 105 110 Gly Glu Ala Leu Ser Thr Leu Thr Val Lys Glu Leu Lys Gin Leu Glu 115 120 125 Asn Arg Leu Glu Arg Gly Ile Thr Arg Ile Arg Ser Lys Lys His Glu 130 135 140 Leu Leu Phe Ala Glu Ile Glu Tyr Met Gin Lys Arg Glu Val Glu Leu 145 150 155 160 Gln Asn Asp Asn Met Tyr Leu Arg Ala Lys Ile Ala Glu Asn Glu Arg 165 170 175 Ala Gin Gin Ala Ala 180 <210> 3 <211> 181 <212> PRT <213> Elaeis guineensis <400> 3 Met Gly Arg Gly Lys lie Glu lie Lys Arg lie Glu Asn Thr Thr Ser 1 5 10 15 Arg Gin Val Thr Phe Cys Gin Arg Arg Asn Gly Leu Leu Lys Lys Ala 20 25 30 Tyr Glu Leu Ser Val Leu Cys Asp Ala Glu Val Ala Leu lie Val Phe 35 40 45 Ser Ser Arg Gly Arg Leu Tyr Glu Tyr Ala Asn Asn Ser lie Arg Ser 50 55 60 Thr lie Asp Arg Tyr Lys Lys Ala Cys Ala Asn Ser Ser Asn Ser Gly 65 70 75 80 Ala Thr lie Glu lie Asn Ser Gin Tyr Tyr Gin Gin Glu Ser Ala Lys 85 90 95 Leu Arg His Gin lie Gin lie Leu Gin Asn Ala Asn Arg His Leu Met 100 105 110 Gly Glu Ala Leu Ser Thr Leu Thr Val Lys Glu Leu Lys Gin Leu Glu 115 120 125 Asn Arg Leu Glu Arg Gly lie Thr Arg lie Arg Ser Lys Lys His Glu 130 135 140 Leu Leu Phe Ala Glu lie Glu Tyr Met Gin Lys Arg Glu Val Glu Leu 145 150 155 160 Gln Asn Asp Asn Met Tyr Leu Arg Ala Lys Ile Ala Glu Asn Glu Arg 165 170 175 Ala Gln Gln Ala Ala 180 <210> 4 <211> 181 <212> PRT <213> Elaeis guineensis <400> 4 Met Gly Arg Gly Lys Ile Glu Ile Lys Arg Ile Glu Asn Thr Thr Ser 1 5 10 15 Arg Gln Val Thr Phe Cys Lys Arg Arg Asn Gly Leu Leu Lys Lys Ala 20 25 30 Tyr Glu Leu Ser Val Leu Cys Asp Asp Glu Val Ala Leu Ile Val Phe 35 40 45 Ser Ser Arg Gly Arg Leu Tyr Glu Tyr Ala Asn Asn Ser Ile Arg Ser 50 55 60 Thr Ile Asp Arg Tyr Lys Lys Ala Cys Ala Asn Ser Ser Asn Ser Gly 65 70 75 80 Ala Thr Ile Glu Ile Asn Ser Gln Tyr Tyr Gln Gln Glu Ser Ala Lys 85 90 95 Leu Arg His Gln Ile Gln Ile Leu Gln Asn Ala Asn Arg His Leu Met 100 105 110 Gly Glu Ala Leu Ser Thr Leu Thr Val Lys Glu Leu Lys Gin Leu Glu 115 120 125 Asn Arg Leu Glu Arg Gly He Thr Arg He Arg Ser Lys Lys His Glu 130 135 140 Leu Leu Phe Ala Glu He Glu Tyr Met Gin Lys Arg Glu Val Glu Leu 145 150 155 160 Gln Asn Asp Asn Met Tyr Leu Arg Ala Lys He Ala Glu Asn Glu Arg 165 170 175 Ala Gin Gin Ala Ala 180 <210> 5 <211> 181 <212> PRT <213> Elaeis guineensis <400> 5 Met Gly Arg Gly Lys He Glu He Lys Arg He Glu Asn Thr Thr Ser 1 5 10 15 Arg Gin Val Thr Phe Cys Asn Arg Arg Asn Gly Leu Leu Lys Lys Ala 20 25 30 Tyr Glu Leu Ser Val Leu Cys Asp Ala Glu Val Ala Leu He Val Phe 35 40 45 Ser Ser Arg Gly Arg Leu Tyr Glu Tyr Ala Asn Asn Ser He Arg Ser 50 55 60 Thr lie Asp Arg Tyr Lys Lys Ala Cys Ala Asn Ser Ser Asn Ser Gly 65 70 75 80 Ala Thr lie Glu lie Asn Ser Gin Tyr Tyr Gin Gin Glu Ser Ala Lys 85 90 95 Leu Arg His Gin lie Gin lie Leu Gin Asn Ala Asn Arg His Leu Met 100 105 110 Gly Glu Ala Leu Ser Thr Leu Thr Val Lys Glu Leu Lys Gin Leu Glu 115 120 125 Asn Arg Leu Glu Arg Gly lie Thr Arg lie Arg Ser Lys Lys His Glu 130 135 140 Leu Leu Phe Ala Glu lie Glu Tyr Met Gin Lys Arg Glu Val Glu Leu 145 150 155 160 Gln Asn Asp Asn Met Tyr Leu Arg Ala Lys lie Ala Glu Asn Glu Arg 165 170 175 Ala Gin Gin Ala Ala 180 <210> 6 <211> 181 <212> PRT <213> Elaeis guineensis <400> 6 Met Gly Arg Gly Lys lie Glu lie Lys Arg lie Gin Asn Thr Thr Ser 1 5 10 15 Arg Gin Val Thr Phe Cys Lys Arg Arg Asn Gly Leu Leu Lys Lys Ala 20 25 30 Tyr Glu Leu Ser Val Leu Cys Asp Ala Glu Val Ala Leu Ile Val Phe 35 40 45 Ser Ser Arg Gly Arg Leu Tyr Glu Tyr Ala Asn Asn Ser Ile Arg Ser 50 55 60 Thr Ile Asp Arg Tyr Lys Lys Ala Cys Ala Asn Ser Ser Asn Ser Gly 65 70 75 80 Ala Thr Ile Glu Ile Asn Ser Gin Tyr Tyr Gin Gin Glu Ser Ala Lys 85 90 95 Leu Arg His Gin Ile Gin Ile Leu Gin Asn Ala Asn Arg His Leu Met 100 105 110 Gly Glu Ala Leu Ser Thr Leu Thr Val Lys Glu Leu Lys Gin Leu Glu 115 120 125 Asn Arg Leu Glu Arg Gly Ile Thr Arg Ile Arg Ser Lys Lys His Glu 130 135 140 Leu Leu Phe Ala Glu Ile Glu Tyr Met Gin Lys Arg Glu Val Glu Leu 145 150 155 160 Gln Asn Asp Asn Met Tyr Leu Arg Ala Lys Ile Ala Glu Asn Glu Arg 165 170 175 Ala Gin Gin Ala Ala 180 <210> 7 <211> 176 <212> PRT <213> Elaeis guineensis <400> 7 Met Gly Arg Gly Lys lie Glu Asn Thr Thr Ser Arg Gin Val Thr Phe 1 5 10 15 Cys Lys Arg Arg Asn Gly Leu Leu Lys Lys Ala Tyr Glu Leu Ser Val 20 25 30 Leu Cys Asp Ala Glu Val Ala Leu lie Val Phe Ser Ser Arg Gly Arg 35 40 45 Leu Tyr Glu Tyr Ala Asn Asn Ser lie Arg Ser Thr lie Asp Arg Tyr 50 55 60 Lys Lys Ala Cys Ala Asn Ser Ser Asn Ser Gly Ala Thr lie Glu lie 65 70 75 80 Asn Ser Gin Tyr Tyr Gin Gin Glu Ser Ala Lys Leu Arg His Gin lie 85 90 95 Gln lie Leu Gin Asn Ala Asn Arg His Leu Met Gly Glu Ala Leu Ser 100 105 110 Thr Leu Thr Val Lys Glu Leu Lys Gin Leu Glu Asn Arg Leu Glu Arg 115 120 125 Gly Ile Thr Arg Ile Arg Ser Lys Lys His Glu Leu Leu Phe Ala Glu 130 135 140 Ile Glu Tyr Met Gln Lys Arg Glu Val Glu Leu Gln Asn Asp Asn Met 145 150 155 160 Tyr Leu Arg Ala Lys Ile Ala Glu Asn Glu Arg Ala Gln Gln Ala Ala 165 170 175 <210> 8 <211> 181 <212> PRT <213> Elaeis guineensis <400> 8 Met Gly Arg Gly Lys Ile Glu Ile Lys Arg Ile Glu Asn Thr Thr Ser 1 5 10 15 Arg Gln Val Thr Phe Cys Lys His Arg Asn Gly Leu Leu Lys Lys Ala 20 25 30 Tyr Glu Leu Ser Val Leu Cys Asp Ala Glu Val Ala Leu Ile Val Phe 35 40 45 Ser Ser Arg Gly Arg Leu Tyr Glu Tyr Ala Asn Asn Ser Ile Arg Ser 50 55 60 Thr Ile Asp Arg Tyr Lys Lys Ala Cys Ala Asn Ser Ser Asn Ser Gly 65 70 75 80 Ala Thr Ile Glu Ile Asn Ser Gln Tyr Tyr Gln Gln Glu Ser Ala Lys 85 90 95 Leu Arg His Gin lie Gin lie Leu Gin Asn Ala Asn Arg His Leu Met 100 105 110 Gly Glu Ala Leu Ser Thr Leu Thr Val Lys Glu Leu Lys Gin Leu Glu 115 120 125 Asn Arg Leu Glu Arg Gly lie Thr Arg lie Arg Ser Lys Lys His Glu 130 135 140 Leu Leu Phe Ala Glu lie Glu Tyr Met Gin Lys Arg Glu Val Glu Leu 145 150 155 160 Gln Asn Asp Asn Met Tyr Leu Arg Ala Lys lie Ala Glu Asn Glu Arg 165 170 175 Ala Gin Gin Ala Ala 180 <210> 9 <211> 181 <212> PRT <213> Elaeis guineensis <400> 9 Met Gly Arg Gly Lys lie Glu lie Lys Arg lie Glu Asn Thr Thr Ser 1 5 10 15 Arg Gin Val Thr Phe Cys Lys Gly Arg Asn Gly Leu Leu Lys Lys Ala 20 25 30 Tyr Glu Leu Ser Val Leu Cys Asp Ala Glu Val Ala Leu lie Val Phe 35 40 45 Ser Ser Arg Gly Arg Leu Tyr Glu Tyr Ala Asn Asn Ser Ile Arg Ser 50 55 60 Thr Ile Asp Arg Tyr Lys Lys Ala Cys Ala Asn Ser Ser Asn Ser Gly 65 70 75 80 Ala Thr Ile Glu Ile Asn Ser Gln Tyr Tyr Gln Gln Glu Ser Ala Lys 85 90 95 Leu Arg His Gin Ile Gin Ile Leu Gin Asn Ala Asn Arg His Leu Met 100 105 110 Gly Glu Ala Leu Ser Thr Leu Thr Val Lys Glu Leu Lys Gin Leu Glu 115 120 125 Asn Arg Leu Glu Arg Gly Ile Thr Arg Ile Arg Ser Lys Lys His Glu 130 135 140 Leu Leu Phe Ala Glu Ile Glu Tyr Met Gin Lys Arg Glu Val Glu Leu 145 150 155 160 Gln Asn Asp Asn Met Tyr Leu Arg Ala Lys Ile Ala Glu Asn Glu Arg 165 170 175 Ala Gin Gin Ala Ala 180 <210> 10 <211> 181 <212> PRT <213> Elaeis guineensis <400> 10 Met Gly Arg Gly Lys lie Glu lie Lys Arg lie Glu Asn Thr Thr Ser 1 5 10 15 Arg Gin Val Thr Phe Cys Lys Arg Arg Asn Gly Leu Leu Lys Lys Ala 20 25 30 Tyr Glu Leu Ser Asp Leu Cys Asp Ala Glu Val Ala Leu lie Val Phe 35 40 45 Ser Ser Arg Gly Arg Leu Tyr Glu Tyr Ala Asn Asn Ser lie Arg Ser 50 55 60 Thr lie Asp Arg Tyr Lys Lys Ala Cys Ala Asn Ser Ser Asn Ser Gly 65 70 75 80 Ala Thr lie Glu lie Asn Ser Gin Tyr Tyr Gin Gin Glu Ser Ala Lys 85 90 95 Leu Arg His Gin lie Gin lie Leu Gin Asn Ala Asn Arg His Leu Met 100 105 110 Gly Glu Ala Leu Ser Thr Leu Thr Val Lys Glu Leu Lys Gin Leu Glu 115 120 125 Asn Arg Leu Glu Arg Gly lie Thr Arg lie Arg Ser Lys Lys His Glu 130 135 140 Leu Leu Phe Ala Glu lie Glu Tyr Met Gin Lys Arg Glu Val Glu Leu 145 150 155 160 Gln Asn Asp Asn Met Tyr Leu Arg Ala Lys Ile Ala Glu Asn Glu Arg 165 170 175 Ala Gln Gln Ala Ala 180 <210> 11 <211> 181 <212> PRT <213> Elaeis guineensis <400> 11 Met Gly Arg Gly Lys Ile Glu Ile Lys Arg Ile Glu Asn Thr Thr Ser 1 5 10 15 Arg Gln Val Thr Phe Cys Lys Arg Arg Asn Gly Leu Leu Lys Lys Ala 20 25 30 Tyr Glu Leu Ser Val Leu Cys Asp Ala Glu Val Ala Leu Ile Val Phe 35 40 45 Ser Ser Arg Gly Arg Leu Tyr Glu Tyr Ala Asn Asn Ser Ile Arg Ser 50 55 60 Thr Ile Asp Arg Tyr Lys Lys Ala Cys Ala Asn Ser Ser Asn Ser Gly 65 70 75 80 Ala Thr Ile Glu Ile Asn Ser Gln Tyr Tyr Gln Gln Glu Ser Ala Lys 85 90 95 Leu Arg His Gln Ile Gln Ile Leu Gln Asn Ala Asn Arg His Leu Met 100 105 110 Gly Glu Ala Leu Ser Thr Leu Thr Val Lys Glu Leu Lys Gin Leu Glu 115 120 125 Asn Arg Leu Glu Arg Gly He Thr Arg He Arg Ser Lys Lys His Glu 130 135 140 Leu Leu Phe Ala Glu He Glu Tyr Met Gin Lys Arg Glu Val Glu Leu 145 150 155 160 Gln Asn Asp Asn Met Tyr Leu Arg Ala Lys He Ala Glu Asn Glu Arg 165 170 175 Ala Gin Gin Ala Ala 180 <210> 12 <211> 56 <212> DNA <213> Elaeis guineensis <400> 12 gtatgctttg atgacgcctt ctcttccttc gctcatatca agttttatgg cttcat 56 <210> 13 <211> 182 <212> DNA <213> Elaeis guineensis <400> 13 atgggtagag gaaagattga gatcaagagg atcgagaaca ccacaagccg gcaggtcact 60 ttctgccaac gccgaaatgg actgctgaag aaagcttatg agttgtctgt cctttgtgat 120 GCTGAGGTTG CCCTTATTGT CTTCTCCAGC CGGGGCCGCC TCTATGAGTA CGCCAATAAC 180 AG 182 <210> 14 <211> 182 <212> DNA <213> Elaeis guineensis <400> 14 ATGGGTAAGA GAAAGATTGA GATCAAGAGG ATCGAGAACC ACCACAAGCC GGCAGGTCAC T 60 TTCTGCAAAC GCCGAAATGG ACTGCTGAAG AAAGCTTATG AGTTGTCTGT CCTTTGTGAT 120 GATGAGGTTG CCCTTATTGT CTTCTCCAGC CGGGGCCGCC TCTATGAGTA CGCCAATAAC 180 AG 182 <210> 15 <211> 182 <212> DNA <213> Elaeis guineensis <400> 15 ATGGGTAAGA GAAAGATTGA GATCAAGAGG ATCGAGAACC ACCACAAGCC GGCAGGTCAC T 60 TTCTGCAATC GCCGAAATGG ACTGCTGAAG AAAGCTTATG AGTTGTCTGT CCTTTGTGAT 120 GCTGAGGTTG CCCTTATTGT CTTCTCCAGC CGGGGCCGCC TCTATGAGTA CGCCAATAAC 180 AG 182 <210> 16 <211> 182 <212> DNA <213> Elaeis guineensis <400> 16 atgggtagag gaaagattga gatcaagagg atccagaaca ccacaagccg gcaggtcact 60 ttctgcaaac gccgaaatgg actgctgaag aaagcttatg agttgtctgt cctttgtgat 120 gctgaggttg cccttattgt cttctccagc cggggccgcc tctatgagta cgccaataac 180 ag 182 <210> 17 <211> 167 <212> DNA <213> Elaeis guineensis <400> 17 atgggtagag gaaagattga gaacaccaca agccggcagg tcactttctg caaacgccga 60 aatggactgc tgaagaaagc ttatgagttg tctgtccttt gtgatgctga ggttgccctt 120 attgtcttct ccagccgggg ccgcctctat gagtacgcca ataacag 167 <210> 18 <211> 182 <212> DNA <213> Elaeis guineensis <400> 18 atgggtagag gaaagattga gatcaagagg atcgagaaca ccacaagccg gcaggtcact 60 ttctgcaaac accgaaatgg actgctgaag aaagcttatg agttgtctgt cctttgtgat 120 gctgaggttg cccttattgt cttctccagc cggggccgcc tctatgagta cgccaataac 180 ag 182 <210> 19 <211> 182 <212> DNA <213> Elaeis guineensis <400> 19 atgggtagag gaaagattga gatcaagagg atcgagaaca ccacaagccg gcaggtcact 60 ttctgcaaag gccgaaatgg actgctgaag aaagcttatg agttgtctgt cctttgtgat 120 gctgaggttg cccttattgt cttctccagc cggggccgcc tctatgagta cgccaataac 180 ag 182 <210> 20 <211> 182 <212> DNA <213> Elaeis guineensis <400> 20 atgggtagag gaaagattga gatcaagagg atcgagaaca ccacaagccg gcaggtcact 60 ttctgcaaac gccgaaatgg actgctgaag aaagcttatg agttgtctga cctttgtgat 120 gctgaggttg cccttattgt cttctccagc cggggccgcc tctatgagta cgccaataac 180 ag 182 <210> 21 <211> 182 <212> DNA <213> Elaeis guineensis <400> 21 atgggtagag gaaagattga gatcaagagg atcgagaaca ccacaagccg gcaggtcact 60 ttctgcaaac gccgaaatgg actgctgaag aaagcttatg agttgtctgt cctctgtgat 120 gctgaggttg cccttattgt cttctccagc cggggccgcc tctatgagta cgccaataac 180 ag 182 <210> 22 <211> 182 <212> DNA <213> Elaeis guineensis <400> 22 atgggtagag gaaagattga gatcaagagg atcgagaaca ccacaagccg gcaggtcact 60 ttctgcaaac gccgaaatgg actgctgaag aatgcttatg agttgtctgt cctttgtgat 120 gctgaggttg cccttattgt cttctccagc cggggccgcc tctatgagta cgccaataac 180 ag 182 <210> 23 <211> 182 <212> DNA <213> Elaeis guineensis <400> 23 atgggtagag gaaagattga gatcaagagg atcgagaaca ccacaagccg gcaggtcact 60 ttctgcaaac gccgaaatgg actgccgaag aaagcttatg agttgtctgt cctttgtgat 120 gctgaggttg cccttattgt cttctccagc cggggccgcc tctatgagta cgccaataac 180 ag 182 <210> 24 <211> 181 <212> PRT <213> Elaeis guineensis <400> 24 Met Gly Arg Gly Lys Ile Glu Ile Lys Arg Ile Glu Asn Thr Thr Ser 1 5 10 15 Arg Gln Val Thr Phe Cys Lys Arg Arg Asn Gly Leu Leu Lys Lys Ala 20 25 30 Tyr Glu Leu Ser Val Leu Cys Asp Ala Glu Val Ala Leu Ile Val Phe 35 40 45 Ser Ser Arg Gly Arg Leu Tyr Glu Tyr Ala Asn Asn Ser Ile Arg Ser 50 55 60 Thr Ile Asp Arg Tyr Lys Lys Ala Cys Ala Asn Ser Ser Asn Ser Gly 65 70 75 80 Ala Thr Ile Glu Ile Asn Ser Gln Tyr Tyr Gln Gln Glu Ser Ala Lys 85 90 95 Leu Arg His Gln Ile Gln Ile Leu Gln Asn Ala Asn Arg His Leu Met 100 105 110 Gly Glu Ala Leu Ser Thr Leu Thr Val Lys Glu Leu Lys Gln Leu Glu 115 120 125 Asn Arg Leu Glu Arg Gly Ile Thr Arg Ile Arg Ser Lys Lys His Glu 130 135 140 Leu Leu Phe Ala Glu lie Glu Tyr Met Gin Lys Arg Glu Val Glu Leu 145 150 155 160 Gln Asn Asp Asn Met Tyr Leu Arg Ala Lys lie Ala Glu Asn Glu Arg 165 170 175 Ala Gin Gin Ala Ala 180 <210> 25 <211> 182 <212> DNA <213> Elaeis guineensis <400> 25 atgggtagag gaaagattga gatcaagagg atcgagaaca ccacaagccg gcaggtcact 60 ttctgcaaac gccgaaatgg actgctgaag aaagcttatg agttgtctgt cctttgtgat 120 gctgaggttg cccttattgt cttctccagc cggggccgcc tctatgagta cgccaataac 180 ag 182 <210> 26 <211> 301 <212> DNA <213> Elaeis guineensis <400> 26 atgggtagag gaaagattga gatcaagagg atcgagaaca ccacaagccg gcaggtcact 60 ttctgcaaac gccgaaatgg actgctgaag aaagcttatg agttgtctgt cctttgtgat 120 gctgaggttg cccttattgt cttctccagc cggggccgcc tctatgagta cgccaataac 180 aggtatgctt tgatgacgcc ttctcttcct tcgctcatat caagttaatt ttatggcttc 240 atttgttcta tggccaagcc aaattctttt taaagttcta gaatgttaat gatggtagtt 300 t 301

Claims

1. A method for detecting the genotype of a shell phenotype genetic polymorphic marker of a palm family plant or seed, characterized by, The palm plant or seed is oil palm, and the method comprises detecting the genotype of a corresponding polymorphic marker: nucleotide 122 of exon 1 of the SHELL gene; and wherein the detected genotype of the polymorphic marker indicates the presence, absence, or amount of pisifera or dura alleles; detecting a C→A mutation of the polymorphic marker corresponding to nucleotide 122 of exon 1 of the SHELL gene indicates the presence of pisifera alleles; the presence of the pisifera alleles is determined by detecting SEQ ID NO:

14.

2. The method of claim 1, wherein, Also included is predicting the shell phenotype of the palm plant or seed based on the presence, absence, or amount of the pisifera or dura alleles.

3. The method according to any one of claims 1-2, characterized in that, Also included is grouping the palm plants or seeds based on the genotype of the polymorphic marker, wherein at least one group contains only plants or seeds that are (i) predicted to have tenera shell phenotype, or (ii) predicted to have dura shell phenotype, or (iii) predicted to have pisifera shell phenotype; wherein the palm plants or seeds that have both pisifera alleles and dura alleles are predicted to have tenera shell phenotype.

4. The method according to any one of claims 1-2, characterized in that, The plant or seed is produced from (i) attempted cross between a plant having dura shell phenotype and a plant having pisifera shell phenotype, (ii) selfing of a tenera palm, (iii) cross between two plants having tenera shell phenotype, (iv) cross between a dura palm and a tenera palm, or (v) cross between a tenera palm and a pisifera palm.

5. The method according to any of claims 1-2, characterized by, The palm plant is less than 5 years old.

6. The method according to any one of claims 1-2, characterized in that, If the palm plant or seed does not have a genotype predicted to have tenera shell phenotype, the palm plant or seed is discarded.

7. The method according to any one of claims 1-2, characterized in that, If the palm plant or seed has a genotype predicted to have tenera shell phenotype, the palm plant or seed is selected.

8. The method according to any one of claims 1-2, characterized in that, If the palm plant or seed has a genotype predicted to have dura shell phenotype, the palm plant or seed is selected.

9. The method according to any one of claims 1-2, characterized in that, If the palm plant or seed has a genotype predicted to have pisifera shell phenotype, the palm plant or seed is selected.

10. The method according to any one of claims 1-2, characterized in that, Detecting the genotype of the polymorphic marker also includes sequencing.

11. The method according to any one of claims 1-2, characterized in that, The method reduces contamination of plants or seeds by non-tenera.

Images