A fluorescence biosensor for the combined detection of glutathione and ATP

Abstract

The present invention belongs to the technical field of biological detection, and provides a fluorescence biosensor for jointly detecting glutathione and ATP, comprising: a ligation probe L with nucleotide sequences shown in SEQ ID NO: 1-4, a padlock probe M, an ATP block strand, a reporter probe S, and Mg<supgt;2+< / supgt;, phi29 DNA polymerase, T4 DNA ligase, dNTP; the 5'-end of the padlock probe M is phosphorylated; the 8th and 9th positions of the ATP block strand are modified with disulfide bonds, and the 3'-end is modified with Inverted dT; the 13th and 14th positions of the reporter probe S are ribonucleotides; a fluorescence quenching group is modified before the 13th position, and a fluorescence reporting group is modified after the 14th position. The sensor of the present invention has the advantages of fast detection speed, low detection limit, high specificity, etc., realizes the joint detection of two target substances by one method, can make up for the defects and deficiencies of the existing detection methods, and realizes fast and accurate quantitative detection.

Description

Technical Field

[0001] The present invention belongs to the technical field of biological detection, and particularly relates to a fluorescence biosensor for jointly detecting glutathione and ATP. Background Art

[0002] Adenosine triphosphate (ATP) is an important biomolecule in living organisms and is an essential energy source for cell synthesis, having an important impact on various life activities. Glutathione (GSH) is a thiol-containing tripeptide substance that is relatively abundant in mammals. It is composed of glutamic acid, cysteine, and glycine, and has the ability to antioxidant, scavenge free radicals, and regulate important intracellular physiological processes.

[0003] During the ATP synthesis process in cancer cells, an abnormal amount of reactive oxygen species (ROS) is produced as a by-product of activating oxidative stress. To prevent the lethal effects of excessive ROS, cancer cells produce a large amount of glutathione (GSH) to cope with the redox stress and promote tumor progression. Given the mutual correlation between ATP and GSH, tools capable of correlating their detection need to be deeply understood.

[0004] Currently, methods for detecting ATP include electrochemical method, surface-enhanced Raman scattering method, etc., and methods for detecting glutathione include colorimetric method, two-photon emission method, etc. However, they all have disadvantages such as time-consuming, expensive instruments, complex operations, etc., and there are few detection methods that associate the correlation between GSH and ATP. Therefore, developing a method for bivariate, rapid, and sensitive detection of ATP and glutathione is of great significance for disease detection. Summary of the Invention

[0005] In view of the problems in the prior art, the present invention provides a fluorescence biosensor for jointly detecting glutathione and ATP, which has a low detection limit and good specificity.

[0006] To achieve the above object, the present invention adopts the following technical solutions.

[0007] A fluorescence biosensor for jointly detecting glutathione and ATP, comprising:

[0008] Linking probe L, padlock probe M, ATP block chain, reporter probe S, and Mg with nucleotide sequences shown in SEQ ID NO: 1-4 2+ , phi29 DNA polymerase, T4 DNA ligase, dNTP;

[0009] The 5'-end of the padlock probe M is phosphorylated;

[0010] The 8th and 9th positions of the ATP block chain are modified with disulfide bonds, and the 3'-end is modified with Inverted dT;

[0011] The 13th and 14th positions of the reporting probe S are ribonucleotides; a fluorescence quenching group is modified before the 13th position, and a fluorescence reporting group is modified after the 14th position.

[0012] Preferably, the ligation probe L, the padlock probe M and the T4 DNA ligase are replaced with a circular template.

[0013] The construction method of the circular template includes the following steps:

[0014] Hybridize the padlock probe M and the ligation probe L in the T4 DNA ligase buffer, then add T4 DNA ligase and react at low temperature, and then inactivate the T4 DNA ligase; obtain the circular template after purification.

[0015] Preferably, the biosensor further includes a buffer solution; more preferably, the buffer solution contains Mg 2+ .

[0016] A kit for detecting glutathione and ATP containing the above fluorescence biosensor.

[0017] Preferably, the kit further includes standard samples of glutathione and ATP.

[0018] A method for detecting glutathione and ATP using the above biosensor or kit, including the following steps:

[0019] (1) Obtain a circular template by catalyzing the ligation probe L and the padlock probe M with T4 DNA ligase;

[0020] (2) Incubate the circular template, Mg 2+ , phi29 DNA polymerase, dNTP, ATP block chain, and reporting probe S in a buffer at 30 °C; then inactivate the phi29 DNA polymerase;

[0021] (3) Add a series of concentration solutions of the sample to be tested or standard samples of glutathione or ATP to the system in step (2), incubate at 37 °C, and then perform fluorescence detection.

[0022] Preferably, the above method further includes the steps of making a standard curve of glutathione or ATP and calculating the concentration of the target in the sample to be tested.

[0023] The detection principle of the present invention is as Figure 1 shown:

[0024] The following sequences are used in the biosensor:

[0025] L: 5'-CCGGGGAAAAAAAAAAAAAACCTC-3'

[0026] M: 5'-P-TTTTTT CCCCGGAGCGGTCGTTGT AAAA ACCTTCCTCCGCAATACTCCCCC

[0027] AGGT TTTT AGCTAGCCTGGCCGAGG TTTTTTTT-3'

[0028] ATP block: 5'-CTCCGCAA / iHS-SH / CCCAGGTTTTTAGCTAG-Inverted dT-3'

[0029] S: 5'-AAACCGGAGCGG(Dabcyl) / rA / / rU / G(FAM)GCCGAGGAAA-3'

[0030] RCA product: [AAAAAAAA CCTCGGCCAGGCTAGCT AAAA ACCTGGGGGAGTATTGCG

[0031] GAGGAAGGT TTTT ACAACGACCGCTCCGGGG AAAAAA] n

[0032] The circular template (i.e., the circular M sequence) undergoes rolling circle amplification under the action of Phi29 polymerase. The circular template contains the complementary sequence of the ATP aptamer (underlined sequence), and the split DNAzyme complementary sequences (italic sequences, distributed at both ends of the complementary sequence of the ATP aptamer). Therefore, the RCA product after rolling circle amplification contains the ATP aptamer sequence (underlined part, i.e., Figure 1 the dark-colored sequence in the RCA product), the split DNAzyme sequence (italic sequence, i.e., Figure 1 the light-colored sequence in the RCA product). The ATP block chain containing a disulfide bond can hybridize with the ATP aptamer sequence in the product and bind to the product, avoiding the exposure of the ATP aptamer and preventing ATP from directly binding to the product. Based on the cleavage function of the target substance GSH on the disulfide bond (S-S), the ATP block chain is damaged and falls off from the product, exposing the ATP aptamer sequence in the product, enabling another target substance ATP to bind to its aptamer, bringing the split DNAzymes at both ends of the ATP aptamer closer, forming the active structure of the DNAzyme. With the assistance of Mg 2+ ions, the reporter probe S is cleaved, emitting fluorescence. By detecting the presence or absence of fluorescence and the intensity of fluorescence, the presence or absence and concentration of the target substance can be determined.

[0033] The present invention has the following advantages:

[0034] The sensor of the present invention utilizes rolling circle amplification and DNAzyme cleavage of a reporter probe, which plays a role in signal amplification and improves the detection sensitivity. By using the specific property of GSH to cleave disulfide bonds and the specific recognition of ATP and aptamer, the highly specific co-detection of dual targets is achieved. The reaction conditions of this sensor are mild and the reaction rate is fast. The main process of the detection principle is realized in homogeneous phase, which improves the reaction rate, reduces the complexity of operation, and enables the rapid, simple, and sensitive detection of the target. The preparation method of this sensor is simple, with stable properties and good repeatability, and is suitable for the detection of targets in samples and the practical application of biosensor industrialization.

[0035] Based on rolling circle amplification signal amplification, GSH cleavage of disulfide bonds, ATP binding to aptamer, pulling the split DNAzyme closer to form an active structure, activating its specific cleavage ability, cleaving the reporter probe, and generating a fluorescence signal, the present invention constructs an optical biosensor. This sensor has the advantages of fast detection speed, low detection limit, and high specificity. Most importantly, the present invention realizes the co-detection of dual targets by one method, which can make up for the defects and deficiencies of existing detection methods and achieve rapid and accurate quantitative detection. BRIEF DESCRIPTION OF THE DRAWINGS

[0036] Figure 1 is the schematic diagram of this biosensor;

[0037] Figure 2 is the optimization of the concentration of reporter probe S;

[0038] Figure 3 is the working curve of GSH;

[0039] Figure 4 is the working curve of ATP. DETAILED DESCRIPTION OF THE EMBODIMENTS

[0040] The present invention will be further described below in conjunction with embodiments and drawings, but the present invention is not limited by the following embodiments.

[0041] Example 1 Screening of the Concentration of Reporter Probe S

[0042] (1) Synthesize the ligation probe L, padlock probe M, ATP block chain, and reporter probe S according to the sequences shown in SEQ ID NO: 1-4; and perform the following modifications: phosphorylate the 5' end of the padlock probe M; modify disulfide bonds at the 8th and 9th positions of the ATP block chain, and modify Inverted dT at the 3' end; the 13th and 14th positions of the reporter probe S are ribonucleotides; modify the fluorescence quenching group Dabcyl between the 12th and 13th positions, and modify the fluorescence reporting group FAM between the 14th and 15th positions;

[0043] (2)Construct a circular template according to the following steps:

[0044] a) Prepare a 10×T4 DNA ligase buffer containing 500 mM Tris-HCl, 100 mM MgCl2, 100 mM DTT, and 10 mM ATP;

[0045] b) Mix 39 μL of sterilized water, 6 μL of padlock probe M (10 μM), 6 μL of ligation probe L (10 μM), and 6 μL of 10×T4 DNA ligase buffer, denature at 95°C for 5 min, then slowly cool to room temperature to complete hybridization. Then add 3 μL of T4 DNA ligase (400 U / μL) to the reaction system and react it at 16°C for 20 h; after that, incubate the reaction system in a water bath at 65°C for 15 minutes to inactivate T4 DNA ligase, obtaining a circular template, and store it at 4°C for standby;

[0046] (3)Prepare a buffer solution containing 50 mM Tris-HCl, 10 mM MgCl2, 10 mM (NH4)2SO4, 4 mM DTT, and pH 7.5;

[0047] Add 3 μL of circular template (1 μM), 2 μL of dNTP (1 mM), 3 μL of phi29 DNA polymerase (1 U / μL), 9 μL of ATP block chain (3 μM), 5 μL of reporter probe S (concentrations of 0 μM, 200 nM, 400 nM, 600 nM, 800 nM, 1 μM, 1.2 μM, 1.4 μM) into a centrifuge tube, mix well with 3 μL of buffer solution and 5 μL of sterilized water, and react at a constant temperature of 37°C for 90 min; then add 5 μL of ATP (3 mM) and 5 μL of GSH (5 mM), mix well and react at a constant temperature of 37°C for 60 min;

[0048] (4)Dilute the reacted solution (40 μL) to 100 μL, set the excitation wavelength to 485 nm, and detect the change in fluorescence signal at 520 nm;

[0049] The results are shown in Figure 2 , it can be seen from the figure that as the concentration of reporter probe S increases, the fluorescence intensity obtained experimentally continuously increases. After the concentration reaches 1.0 μM, the fluorescence intensity remains basically unchanged, indicating that the optimal concentration of reporter probe S is 1.0 μM.

[0050] Example 2 Detection of GSH by Biosensor

[0051] Detection was carried out in the same manner as in Example 1, except that in step (3), the concentration of the reporting probe S was 1.0 μM, and the concentrations of GSH were 0 μM, 100 μM, 200 μM, 500 μM, 1 mM, 3 mM, and 5 mM; in step (4), fluorescence detection scanned the change in fluorescence signal at 500 - 650 nm and recorded the fluorescence signal at 520 nm.

[0052] The results are shown in Figure 3 , and it can be seen from the figure that the detected fluorescence signal increases as the concentration of the target GSH increases in the range of 0 μM - 5 mM. The fitting curve is: I = 363.88 + 228.8lgC (mM) (where C represents the concentration of GSH, R 2 = 0.984). Continuing to detect at lower concentrations based on a concentration of 100 μM, it was detected that when the concentration was lower than 95 nM, the logarithm of the GSH concentration no longer exactly conformed to the fitting curve law with the fluorescence intensity, that is, the lowest value of the fluorescence intensity in the figure. Therefore, the lower limit of GSH detection by this method can be obtained as 95 nM.

[0053] Example 3 Detection of ATP by the Biosensor

[0054] Detection was carried out in the same manner as in Example 1, except that in step (3), the concentration of the reporting probe S was 1.0 μM, and the concentrations of ATP were 0 μM, 100 μM, 200 μM, 500 μM, 1 mM, and 3 mM; in step (4), fluorescence detection scanned the change in fluorescence signal at 500 - 650 nm and recorded the fluorescence signal at 520 nm.

[0055] The results are shown in Figure 4 , and it can be seen from the figure that the detected fluorescence signal increases as the concentration of the target ATP increases in the range of 0 μM - 3 mM. The fitting curve is: I = 632.626 + 318.75lgC(mM) (where C represents the concentration of ATP, R 2 = 0.991). Continuing to detect at lower concentrations based on a concentration of 100 μM, it was detected that when the concentration was lower than 37 nM, the logarithm of the ATP concentration no longer exactly conformed to the fitting curve law with the fluorescence intensity, that is, the lowest value of the fluorescence intensity in the figure. Therefore, the lower limit of ATP detection by this method can be obtained as 37 nM. Sequence Listing <110> University of Jinan <120> Fluorescent Biosensor for the Combined Detection of Glutathione and ATP <160> 5 <170> SIPOSequenceListing 1.0 <210> 1 <211> 24 <212> DNA <213> Artificial Sequence <400> 1 ccggggaaaa aaaaaaaaaa cctc 24 <210> 2 <211> 84 <212> DNA <213> Artificial Sequence <400> 2 ttttttcccc ggagcggtcg ttgtaaaaac cttcctccgc aatactcccc caggttttta 60 gctagcctgg ccgaggtttt tttt 84 <210> 3 <211> 25 <212> DNA <213> Artificial Sequence <400> 3 ctccgcaacc caggttttta gctag 25 <210> 4 <211> 25 <212> DNA / RNA <213> Artificial Sequence <400> 4 aaaccggagc ggauggccga ggaaa 25 <210> 5 <211> 84 <212> DNA <213> Artificial Sequence <400> 5 aaaaaaaacc tcggccaggc tagctaaaaa cctgggggag tattgcggag gaaggttttt 60 acaacgaccg ctccggggaa aaaa 84

Claims

1. A fluorescence biosensor for the joint detection of glutathione and ATP, characterized in that, Comprising: The ligation probe L, padlock probe M, ATP block strand, reporter probe S and Mg with nucleotide sequences as shown in SEQ ID NO: 1-4 2+ , phi29 DNA polymerase, T4 DNA ligase, dNTP; 5'-end phosphorylation treatment of the padlock probe M described above; The 8th and 9th positions of the ATP block chain are modified with disulfide bonds, and the 3'-end is modified with Inverted dT; The 13th and 14th positions of the reporter probe S are ribonucleotides; a fluorescence quenching group is modified before the 13th position, and a fluorescence reporting group is modified after the 14th position.

2. The fluorescence biosensor according to claim 1, wherein The ligation probe L, the padlock probe M and the T4 DNA ligase are replaced with a circular template; The construction method of the circular template comprises the following steps: Hybridize the padlock probe M with the ligation probe L in the T4 DNA ligase buffer, then add T4 DNA ligase and react at low temperature, and then inactivate T4 DNA ligase; after purification, a circular template is obtained.

3. The fluorescence biosensor according to claim 1, wherein The fluorescent biosensor further includes a buffer solution; the buffer solution contains Mg 2+ .

4. A kit for detecting glutathione and ATP comprising the fluorescence biosensor according to any one of claims 1-3.

5. The kit according to claim 4, wherein The kit further comprises standard samples of glutathione and ATP.

6. A method for detecting glutathione and ATP using the fluorescence biosensor according to any one of claims 1-3 or the kit according to claim 4 or 5, characterized in that, Comprising the following steps: (1) Obtain a circular template by catalyzing the ligation probe L and the padlock probe M with T4 DNA ligase; (2) Circular template, Mg 2+ , phi29 DNA polymerase, dNTP, ATP block chain, and reporter probe S are incubated in a buffer at 30 °C; then phi29 DNA polymerase is inactivated; (3) Add a series of concentration solutions of the sample to be tested or the standard samples of glutathione or ATP to the system in step (2), incubate at 37 °C, and then perform fluorescence detection.

7. The method according to claim 6, wherein It further comprises the steps of making a standard curve of glutathione or ATP and calculating the concentration of the target substance in the sample to be tested.

Images