RNAi plant expression vector and use thereof

Abstract

The application provides an RNAi plant expression vector and application thereof, and the RNAi plant expression vector contains a hairpin expression cassette, wherein the hairpin expression cassette contains a hairpin structure formed by a DNA fragment shown in SEQ ID No. 1-3. The RNAi plant expression vector of the application is transformed into rice, and the expression of a gene HIS1 can be successfully inhibited, and the rice is changed from being resistant to herbicides to being sensitive, so that the sensitive plants can be removed by applying herbicides, thereby cultivating a rice which is dominant sensitive to herbicides. The rice has important application values in aspects of cultivating a transgenic new variety, hybrid rice seed production, and preventing transgenic escape.

Description

TECHNICAL FIELD

[0001] The present application belongs to the field of agricultural biotechnology, and particularly relates to a RNAi plant expression vector and application thereof. BACKGROUND

[0002] Genetic modification technology is increasingly widely used in various crops, and transgenic products need to be strictly controlled and regulated, and it is particularly important to prevent transgenic drift from polluting other varieties or even other species. Therefore, a mechanism for targeted removal of hybrid seeds or transgenic plants needs to be established. Breeding herbicide-sensitive sterile lines or restorer lines is one of the effective means to solve the problem.

[0003] β-triketone herbicides (bTHs) are 4-hydroxyphenylpyruvate dioxygenase (HPPD) inhibitors, which are widely used in agriculture and can effectively control a variety of broadleaf weeds and grass weeds. Benzobicyclon (BBC), a bTH used for weed control in rice fields, has obvious efficacy against rice weeds that are resistant to other types of herbicides, including sulfonylureas (Kraehmer, et al. "Herbicides as Weed Control Agents: State of the Art: I. Weed Control Research and Safener Technology: The Path to Modern Agriculture." Plant Physiology (2014).). Therefore, β-triketone herbicides are often used to remove most broadleaf weeds and grass weeds in rice fields, and studies have shown that the candidate gene for resistance to BBC in rice is HIS1 (HPPD inhibitor sensitivity 1). HIS1 encodes a 351-amino-acid Fe(II) / 2-ketoglutarate-dependent oxygenase protein, and the 28-bp deletion in the IV exon of the BBC-sensitive variety results in a functional loss (Maeda, Hideo, et al. "A rice gene that confers broad-spectrum resistance to β-triketone herbicides." Nature 365.6451 (2019): 393-396.).

[0004] If a rice that is dominant sensitive to β-triketone herbicides can be bred, it will have important application value in breeding new transgenic varieties, hybrid rice seed production, and preventing transgenic escape. SUMMARY

[0005] The present application aims to provide a RNAi plant expression vector capable of effectively affecting the expression of HPPD inhibitor-sensitive 1 gene (HIS1) and application thereof.

[0006] To achieve the above-mentioned purpose, the present application provides a RNAi plant expression vector for inhibiting the expression of HPPD inhibitor-sensitive 1 gene (HIS1), comprising a hairpin expression cassette, wherein the hairpin expression cassette comprises a hairpin structure formed by DNA fragments shown in SEQ ID No. 1-3.

[0007] The DNA fragment shown in SEQ ID No. 1 is a forward DNA fragment with a length of 228 bp based on the coding frame of HIS1, and the DNA fragment shown in SEQ ID No. 3 is a DNA fragment with a length of 228 bp complementary to the DNA fragment shown in SEQ ID No. 1 based on the coding frame of HIS1. SEQ ID No. 2 is an intron sequence from a rice Zinc finger gene (Rice intron).

[0008] The DNA fragments shown in SEQ ID No. 1-3 are arranged in the order from upstream to downstream. The hairpin expression cassette can be transcribed to form a hairpin secondary structure in the transformed plant cells, the DNA fragment shown in SEQ ID No. 2 forms the "loop" of the hairpin, and the DNA fragments shown in SEQ ID No. 1 and 3 form the "stem" of the hairpin.

[0009] The hairpin expression cassette further comprises a plant constitutive promoter or a plant tissue-specific promoter upstream of the hairpin structure, and a terminator downstream of the hairpin structure.

[0010] The plant constitutive promoter is preferably a Ubi promoter, a Rubisco small subunit promoter, a Cab promoter, a CAMV 35S promoter or an Actin promoter of rice or corn. Preferably, when the promoter is a Ubi promoter of rice or corn, a very strong effect of interfering the expression of HIS1 gene can be achieved.

[0011] The terminator comprises a DNA sequence capable of terminating gene transcription in plants, such as a NOS terminator, a Ubi terminator, etc. Preferably, the terminator is a NOS terminator.

[0012] The RNAi plant expression vector also comprises a selection marker expression cassette, which contains a promoter, a marker gene and a terminator, wherein the promoter is a Ubi promoter, a CAMV 35S promoter or an Actin promoter of rice or corn, preferably, when the promoter is a CAMV 35S promoter, a good driving effect of the selection marker gene overexpression in plants can be achieved. The terminator is a NOS terminator or a Ubi terminator, preferably a NOS terminator.

[0013] The marker gene is a gene of an enzyme that can produce color change (such as a GUS gene, a luciferase gene, etc.), a fluorescent marker gene (such as a fluorescent protein gene), an antibiotic marker gene (such as a hygromycin, a gentamicin, a kanamycin gene), a herbicide screening marker gene (such as a glyphosate-resistant gene, a bis-achieve-resistant gene, etc.) or a chemical reagent-resistant marker gene (such as a herbicide-resistant gene, etc.). Particularly preferably, the marker gene is a hygromycin gene.

[0014] In a preferred embodiment of the present application, the RNAi plant expression vector is obtained by connecting the DNA fragments shown in SEQ ID No. 1-3 to the Sac I and BamH I sites of the plant binary transformation vector pTCK303 by an overlapping method.

[0015] Particularly preferably, the RNAi plant expression vector has the nucleotide sequence shown in SEQ ID No. 4.

[0016] Preferably, the plant is a transgenic rice strain.

[0017] It is worth noting that the intermediate vector for the construction of the RNAi plant expression vector and the RNAi expression vector with the selection marker gene, the engineering bacteria and the cells, callus, transgenic seedlings, seeds containing the HIS1i-1 stem loop structure all belong to the protection scope of the present application.

[0018] Another aspect of the present application also provides a method for constructing an RNAi plant expression vector, comprising connecting the DNA fragments shown in SEQ ID No. 1-3 to a plant binary transformation vector by an overlapping method.

[0019] A preferred embodiment of the present application is to connect the DNA fragments shown in SEQ ID No. 1-3 to the Sac I and BamH I sites of the plant binary transformation vector pTCK303 by an overlapping method, to obtain the RNAi plant expression vector pTCK303-HIS1i-1.

[0020] Specifically, the method can be carried out according to the following steps:

[0021] (1) Design 3 pairs of primers to amplify the DNA fragments shown in SEQ ID No. 1-3, wherein the 5' end of the upstream and downstream primers of the adjacent two fragments has about 15 nucleotide sequences repeated with the corresponding connection position of the fragment or vector, so as to be connected by Gibson Assembly recombination.

[0022] HIS1i-1-F: ATCGGGGAAATTCGAGCTcATGGCTGACGAGTCATGGAGG

[0023] HIS1i-1-Rv1: GAGATTTTCACAGGAAGAAGCCCCAATTCTGC

[0024] HIS1i-1-F2: CTTCTTCCTGTGAAAATCTCGAAACAGCCGTGT

[0025] HIS1i-1-Rv2: CTTCTTCCTGGGTAAGTTACTACAAACCTTTTTGTATTTATGTTCC

[0026] HIS1i-1-F3: AGTAACTTACCCAGGAAGAAGCCCCAATTCTGC

[0027] HIS1i-1-Rv: CTGCAGGTCGACTCTAGAGgatccATGGCTGACGAGTCATGGAGG

[0028] (2) Construction and transformation of RNAi plant expression vector

[0029] PCR was used to amplify HIS1i-1 gene fragments 1 and 3 using the above primers and rice cDNA as a template. The amplification system and procedure are as follows:

[0030] Procedure: 94℃ pre-denaturation for 5-10min, 94℃ denaturation for 30s, 60℃ annealing for 30s, 72℃ extension for 30s, 30-35 cycles, 72℃ re-extension for 5min; end at 16℃.

[0031]

[0032] Procedure: 94℃ pre-denaturation for 5-10min, 94℃ denaturation for 30s, 60℃ annealing for 30s, 72℃ extension for 30s, 30-35 cycles, 72℃ re-extension for 5min; end at 16℃.

[0033]

[0034]

[0035] PCR amplification of the HIS1i-1 gene fragment 2 was performed using the above primers with rice DNA as template. The amplification system and procedure were as follows:

[0036] Procedure: 94℃ pre-denaturation for 5-10 min, 94℃ denaturation for 30 s, 58℃ annealing for 30 s, 72℃ extension for 30 s, 30-35 cycles, 72℃ re-extension for 5 min, and ending at 16℃.

[0037]

[0038] The PCR product fragments were recovered and named as HIS1i-1-1 (the sequence shown in SEQ ID No. 1), HIS1i-1-2 (the sequence shown in SEQ ID No. 2) and HIS1i-1-3 (the sequence shown in SEQ ID No. 3), respectively. The plant binary transformation vector pTCK303 was digested with Sac I + BamH I, and the target fragments HIS1i-1-1, HIS1i-1-2 and HIS1i-1-3 were directly connected into the digested pTCK303 plasmid to obtain the vector pTCK303-HIS1i-1.

[0039] The application also provides a use of the RNAi plant expression vector in preparing herbicide dominant sensitive plants by interfering with the expression of the plant HPPD inhibitor sensitive type 1 gene HIS1.

[0040] The RNAi plant expression vector of the application can be transformed into plant cells or tissues by conventional biological methods such as Agrobacterium-mediated genetic transformation, gene gun method, pollen tube channel method, etc.

[0041] Preferably, the use comprises introducing pTCK303-HIS1i-1 into Agrobacterium EHA105 strain and transforming callus. The callus can be anther-induced callus, mature embryo-induced callus, young embryo-induced callus, young ear-induced callus.

[0042] An aspect of the application also provides a method for obtaining a β-triketone herbicide herbicide dominant sensitive plant, which comprises transforming a plant with the RNAi plant expression vector to interfere with the expression of the plant HPPD inhibitor sensitive type 1 gene HIS1.

[0043] In an embodiment of the application, the method for obtaining a β-triketone herbicide herbicide dominant sensitive plant comprises:

[0044] (1) Constructing the RNAi plant expression vector: the DNA fragments shown in SEQ ID No. 1-3 are connected to the Sac I and BamH I sites of the plant binary transformation vector pTCK303 by overlapping method to obtain the RNAi plant expression vector pTCK303-HIS1i-1;

[0045] (2) Transformation: pTCK303-HIS1i-1 is introduced into Agrobacterium EHA105 strain, and the transformed callus is induced and differentiated to obtain herbicide dominant sensitive plants.

[0046] The RNAi plant expression vector pTCK303-HIS1i-1 has the nucleotide sequence shown in SEQ ID No. 4.

[0047] The beta-triketone herbicide includes but is not limited to mesotrione, bicyclopyrone. In the embodiment of the present application, it is verified that the minimum concentration for screening the bicyclopyrone sensitive transgenic line is 1800 mg / L bicyclopyrone, and the minimum concentration for screening the mesotrione sensitive transgenic line is 9 mg / L mesotrione.

[0048] The plant is rice, preferably, the plant is a transgenic rice line.

[0049] The present application provides the application of the RNAi plant expression vector in cultivating transgenic new varieties, hybrid rice seed production or preventing transgenic escape.

[0050] The present application is based on RNAi technology, and a plant binary transgenic vector for the rice HPPD inhibitor sensitive type 1 gene HIS1 is constructed by screening, the vector can efficiently inhibit the HPPD inhibitor sensitive type 1 gene HIS1 vector, and the sequence is completely a rice endogenous sequence, which can effectively eliminate the risk and worry caused by the exogenous gene transgene. The vector is transformed into rice, the expression of the HIS1 gene is successfully inhibited, and the rice is changed from being resistant to beta-triketone herbicide to being sensitive, so that a rice which is dominant sensitive to beta-triketone herbicide is cultivated. The transgenic plant can be removed by applying herbicide. The rice has very important application value in cultivating transgenic new varieties, hybrid rice seed production, preventing transgenic escape and the like. BRIEF DESCRIPTION OF DRAWINGS

[0051] Figure 1The electrophoresis map of amplification and recovery of the target fragments of HIS1i-1-1, HIS1i-1-2 and HIS1i-1-3 in Example 2. Lanes 1-6 are the target fragments of HIS1i-1-1; lanes 8-13 are the target fragments of HIS1i-1-3; and lanes 15-20 are the target fragments of HIS1i-1-2.

[0052] Figure 2 The electrophoresis map of enzyme digestion and recovery of the pTCK303 backbone vector. CK is the pTCK303 backbone vector as a control; and lanes 1-5 are the pTCK303 backbone vector digested with Sac I / BamH I.

[0053] Figure 3 The electrophoresis map of the pTCK303-HIS1i-1 vector digested with Sac I and BamH I. CK is the pTCK303-HIS1i-1 monoclonal recombinant plasmid; lanes 1-4 are the digested monoclonal recombinant plasmids, respectively; and M is a marker. The size of the cut-out fragment is 934 bp, including the forward and reverse complementary sequences of the target fragment and the rice intron sequence.

[0054] Figure 4 The electrophoresis map of PCR detection of the hygromycin resistance gene of the transgenic lines. Lane 1, H2O; lane 2, negative control (Zhonghua 11 non-transgenic plant); lane 3, positive control (pTCK303-HIS1i-1 plasmid); lanes 4-23, transgenic lines (among which lanes 4, 13, 14 and 22 are transgenic negative lines); and M, marker.

[0055] Figure 5 The sensitivity test of the leaves of the pTCK303-HIS1i-1 transgenic T0 generation three-leaf stage seedlings to 2250 mg / L dicyclometoxin solution. WT is a ZH11 non-transgenic plant, and the leaf wilting is a sensitive line. 0 d is before spraying; 7 d and 14 d are 7 days and 14 days after spraying, respectively.

[0056] Figure 6 The sensitivity test of the leaves of the pTCK303-HIS1i-1 transgenic T0 generation three-leaf stage seedlings to 15 mg / L mesotrione solution for 14 d. WT is a ZH11 non-transgenic plant, and 59-2 and 106-1 are sensitive lines.

[0057] Figure 7 The results of the transgenic seedlings sprayed with 6000 mg / L dicyclometoxin for 14 d after the RNAi vector is constructed by replacing the loop sequence with the sequence shown in SEQ ID No. 11 in Comparative Example 1. The arrow indicates a sensitive line. DETAILED DESCRIPTION

[0058] The present application will be described in detail below with reference to specific embodiments.

[0059] The following examples are intended to illustrate the present application but not to limit the scope of the present application. If not specifically mentioned, the technical means used in the examples are the conventional means well known to those skilled in the art, and the raw materials used are commercially available.

[0060] Obtaining of strains and plasmids and synthesis of PCR primers in Example 1

[0061] (1) Strains and plasmids

[0062] The plant binary transformation vector pTCK303 as a backbone vector contains a hygromycin resistance gene, a maize Ubi promoter and a NOS terminator. The Escherichia coli strain is DH5α; the Agrobacterim tumefacieus strain is EHA105.

[0063] (2) Sequence of PCR primers

[0064] Three pairs of primers were designed to amplify the DNA fragments shown in SEQ ID No. 1-3, respectively. There are about 15 nucleotide sequences at the 5' end of the upstream and downstream primers of adjacent two fragments, which are repeated with the corresponding connection position of the fragment or vector, so as to be connected by Gibson Assembly recombination.

[0065] HIS1i-1-F: ATCGGGGAAATTCGAGCTcATGGCTGACGAGTCATGGAGG

[0066] HIS1i-1-Rv1: GAGATTTTCACAGGAAGAAGCCCCAATTCTGC

[0067] HIS1i-1-F2: CTTCTTCCTGTGAAAATCTCGAAACAGCCGTGT

[0068] HIS1i-1-Rv2: CTTCTTCCTGGGTAAGTTACTACAAACCTTTTTGTATTTATGTTCC

[0069] HIS1i-1-F3: AGTAACTTACCCAGGAAGAAGCCCCAATTCTGC

[0070] HIS1i-1-Rv: CTGCAGGTCGACTCTAGAGgatccATGGCTGACGAGTCATGGAGG

[0071] Construction and transformation of RNAi plant expression vector

[0072] (1) To construct the interference vector of HPPD inhibitor sensitive 1 gene HIS1, the HIS1 i-1 gene fragments 1 and 3 were amplified by PCR using the rice cDNA as template and the primers of Example 1. The amplification system and procedure were as follows:

[0073] Procedure: 94°C pre-denaturation for 5-10 min, 94°C denaturation for 30 s, 60°C annealing for 30 s, 72°C extension for 30 s, 30-35 cycles, 72°C re-extension for 5 min; 16°C end.

[0074]

[0075] Procedure: 94°C pre-denaturation for 5-10 min, 94°C denaturation for 30 s, 60°C annealing for 30 s, 72°C extension for 30 s, 30-35 cycles, 72°C re-extension for 5 min; 16°C end.

[0076]

[0077] (2) The HIS1 i-1 gene fragment 2 was amplified by PCR using the above primers and the rice DNA as template. The amplification system and procedure were as follows:

[0078] Procedure: 94°C pre-denaturation for 5-10 min, 94°C denaturation for 30 s, 58°C annealing for 30 s, 72°C extension for 30 s, 30-35 cycles, 72°C re-extension for 5 min; 16°C end.

[0079]

[0080] After agarose gel electrophoresis, the PCR product fragments were recovered by E.Z.N.A. Extraction kit (Omega, same below), with the sizes of 228 bp, 478 bp and 228 bp, and named as HIS1 i-1-1, HIS1 i-1-2 and HIS1 i-1-3, respectively, as shown in Figure 1 The vector plasmid pTCK303 was double digested by Sac I + BamH I, and after agarose gel electrophoresis, the band of about 14 kb was recovered by E.Z.N.A. Extraction kit (Omega, same below), to obtain the linear fragment of pTCK303 Figure 2 ).

[0081] The double digestion reaction system of Sac I + BamH I was as follows:

[0082]

[0083] (3) 2x Lightening Cloning Kit The three fragments of HIS1i-1-1, HIS1i-1-2 and HIS1i-1-3 were connected to the pTCK303 vector, and the connection system was as follows:

[0084]

[0085] The connection procedure was 30 min at 50°C.

[0086] The connection product was transformed into E. coli DH5a competent cells. The recombinant plasmid was double-digested by Sac I and BamH I, the size of the target fragment was consistent with the expectation ( Figure 3 ), and the recombinant was sent for sequencing verification. The pTCK303-HIS1i-1 RNAi vector was constructed with the Rice intron as a ring, and the vector was named pTCK303-HIS1i-1.

[0087] Example 3: Agrobacterium transformation of rice and identification of transgenic plants

[0088] The pTCK303-HIS1i-1 recombinant plasmid was introduced into the Agrobacterium EHA105 strain, and the japonica rice Zhonghua 11 callus was transformed. After hygromycin resistance screening, differentiation and rooting, 20 regenerated transgenic lines were obtained. The hygromycin resistance gene introduced into the transgenic plants was identified by PCR, and the results showed that 16 PCR positive plants were obtained ( Figure 4 ). The positive plants were transplanted into soil, and 15 survived.

[0089] Example 4: Obtaining of transgenic lines with sensitivity and resistance to the β-triketone herbicide bicyclophosulfone in rice

[0090] In order to detect the effect of the designed interference vector fragment in transgenic plants, 25% bicyclophosulfone stock solution (Japan Shidisi Biological Science Co., Ltd., batch number 2019050603) was used to prepare 1800 mg / L-4500 mg / L bicyclophosulfone solution, which was sprayed on the leaves of the pTCK303-HIS1i-1 transgenic T0 three-leaf stage seedlings obtained in Example 3, and continuous observation was carried out after spraying.

[0091] After 14 days of spraying with 2250 mg / L bicyclophosulfone, 5 of the 12 HIS1i-1 transgenic lines showed leaf whitening to wilting, which belonged to highly sensitive lines; 3 lines showed yellowing of leaf tips, which belonged to medium sensitive lines ( Figure 5 ); and 4 lines showed no reaction, which belonged to resistant lines.

[0092] Further use low concentration of bicyclopyrone 1800 mg / L spray HIS1i-1 transgenic 8 strains, 14d after spraying, 3 strains appear leaf white to wither, belong to high sensitive strains; 1 strain appears leaf white to leaf tip yellow, belong to medium sensitive strain; 4 strains appear individual leaf tip yellow, belong to low sensitive or insensitive strain.

[0093] Example 5 Obtaining of rice mesotrione (nicosulfuron) sensitive and resistant transgenic strains

[0094] In order to detect the effect of the designed interference vector fragment in transgenic plants, mesotrione stock solution (Jiangsu Fenshan Group Co., Ltd., batch number 20190119004) was used to prepare 15 mg / L-750 mg / L mesotrione solution, which was sprayed on the pTCK303-HIS1i-1 transgenic T0 three-leaf stage seedlings obtained in Example 3, and continuous observation was carried out after spraying.

[0095] Spray 15 mg / L mesotrione on the leaves of 3 HIS1i-1 transgenic strains, 7d after spraying, the leaf tips of some strains of HIS1i-1 transgenic T0 seedlings were curled, and the leaves were slightly white; 14d after spraying, 2 strains appeared leaf white to wither, belonging to high sensitive strain Figure 6 ); 1 strain showed no obvious leaf reaction before and after spraying, belonging to resistant strain.

[0096] It should be emphasized that although this example uses 15 mg / L mesotrione to screen mesotrione sensitive transgenic strains, the screening of sensitive strains is not limited to 15 mg / L. Further experiments found that 9 mg / L of mesotrione was sprayed on the leaves of 3 HIS1i-1 transgenic strains, 14d after spraying, 2 strains appeared leaf white curling to wither, belonging to high sensitive strain. 9 mg / L is the lowest concentration of mesotrione applied in this application. The above results show that we have successfully obtained herbicide dominant sensitive transgenic materials.

[0097] Comparative Example 1

[0098] In order to test the effect of different stem loops on interference efficiency, the intron sequence in SEQ ID No. 2 was shortened to 300 bp (see SEQ ID No. 11), and the vector was constructed and transformed into Arabidopsis thaliana to obtain transgenic strains.

[0099] The transgenic lines were respectively sprayed with dicyclomet with a concentration of 2250 mg / L-4500 mg / L, and it was found that the transgenic lines showed higher resistance. When dicyclomet was sprayed with a concentration of 6000 mg / L or more, the sensitive phenotype was shown, and the proportion of sensitive lines was low, indicating that the interference efficiency of OsHIS1i designed by SEQ ID No. 11 on the HIS1 gene was poor. The test results of transgenic lines T0 generation 3-5 leaf stage seedlings on 6000 mg / L dicyclomet are shown in Table 1. Figure 7 .

[0100] Comparative Example 2

[0101] Further shorten the intron sequence in SEQ ID No. 2 to 240 bp (see SEQ ID No. 12), construct a vector and transform Zhonghua 11 to obtain transgenic lines.

[0102] The above transgenic lines were respectively sprayed with high concentration dicyclomet, and it was found that the transgenic lines also showed higher resistance, and the results were similar to those in Comparative Example 1, indicating that the interference efficiency of OsHIS1i designed according to this method on the HIS1 gene was poor.

[0103] In addition to the above two comparative examples, in the research process of the present application, the full intron sequence of the OsHIS1 gene intron sequence and the sequence of different truncated sizes in the OsHIS1 gene intron sequence were selected to form a hairpin structure with the DNA fragments shown in SEQ ID No. 1 and 3, but it was found that the DNA fragments shown by these intron sequences could not form a hairpin "loop" or the formed stem loop structure was poor, and further made them unable to form a hairpin "stem" after replacing the sequence shown in SEQ ID No. 2. The DNA fragments shown in SEQ ID No. 1 and 3 were successfully formed into double-stranded short RNA in vivo. This fully shows that the intron sequence in SEQ ID No. 2 forms a hairpin structure with the DNA fragments shown in SEQ ID No. 1 and 3, and the plant expression vector constructed can well inhibit the HIS1 gene, has high interference efficiency, and makes the transgenic plants show significant sensitivity to β-triketone herbicides.

[0104] Although the present application has been described in detail in the foregoing description with general principles and specific embodiments, some modifications or improvements can be made on the basis of the present application, which is obvious to those skilled in the art. Therefore, these modifications or improvements made on the basis of not deviating from the spirit of the present application, all belong to the scope of protection claimed by the present application. SEQUENCE LISTING <110> Hainan Bolian Rice Gene Technology Co., Ltd. <120> An RNAi plant expression vector and use thereof <130> KHP201115219.2 <160> 12 <170> SIPOSequenceListing 1.0 <210> 1 <211> 228 <212> DNA <213> Artificial Sequence (Artificial Sequence) <400> 1 atggctgacg agtcatggag ggcgccggcg atagtgcaag agctggcggc agccggcgtc 60 gaggagccgc cgagccgata cctgctacgg gagaaagacc gttctgacgt caagctggtc 120 gccgccgagc tgccggagcc cctccccgtc gttgatctca gccggctaga tggtgccgag 180 gaggccacca agctcagggt ggctctgcag aattggggct tcttcctg 228 <210> 2 <211> 478 <212> DNA <213> Artificial Sequence (Artificial Sequence) <400> 2 tgaaaatctc gaaacagccg tgtcatagtc aatcattagg tgttatagga acaatcaaag 60 gttttttcaa gtgttaatct tcatactaat atatacagtg ggtactcttt atctactgcc 120 gtggaactgt catatttgat tatgaaattt tagctctaga aaatatttga tcatcaatgt 180 caagacttta tgaccttgca aaatacattt cctaattgag aacagggtaa aattatgaac 240 tatgcctctg aaccttcata cacaggcagc acattttttg ttgtaaaatt catcttaata 300 tcagcggaaa gactggacca gagaaagaaa aagttaagac aggcatatac tcttgatcct 360 ctaaaagaga tgaggcggta caatgatcaa ccatgaacat taaagtgata cgtggaacat 420 gagaacacaa ataattgtca ctggaacata aatacaaaaa ggtttgtagt aacttacc 478 <210> 3 <211> 228 <212> DNA <213> Artificial Sequence <400> 3 caggaagaag ccccaattct gcagagccac cctgagcttg gtggcctcct cggcaccatc 60 tagccggctg agatcaacga cggggagggg ctccggcagc tcggcggcga ccagcttgac 120 gtcagaacgg tctttctccc gtagcaggta tcggctcggc ggctcctcga cgccggctgc 180 cgccagctct tgcactatcg ccggcgccct ccatgactcg tcagccat 228 <210> 4 <211> 15004 <212> DNA <213> Artificial Sequence <400> 4 catggtagat ctgagggtaa atttctagtt tttctccttc attttcttgg ttaggaccct 60 tttctctttt tatttttttg agctttgatc tttctttaaa ctgatctatt ttttaattga 120 ttggttatgg tgtaaatatt acatagcttt aactgataat ctgattactt tatttcgtgt 180 gtctatgatg atgatgatag ttacagaacc gacgactcgt ccgtcctgta gaacgtgaaa 240 tcaaaaaact cgacggcctg tgggcattca gtctggatcg cgaaaactgt ggaattgatc 300 agcgttggtg ggaaagcgcg ttacaagaaa gccgggcaat tgctgtgcca ggcagtttta 360 acgatcagtt cgccgatgca gatattcgta attatgcggg caacgtctgg tatcagcgcg 420 aagtctttat accgaaaggt tgggcaggcc agcgtatcgt gctgcgtttc gatgcggtca 480 ctcattacgg caaagtgtgg gtcaataatc aggaagtgat ggagcatcag ggcggctata 540 cgccatttga agccgatgtc acgccgtatg ttattgccgg gaaaagtgta cgtatcaccg 600 tttgtgtgaa caacgaactg aactggcaga ctatcccgcc gggaatggtg attaccgacg 660 aaaacggcaa gaaaaagcag tcttacttcc atgatttctt taactatgcc ggaatccatc 720 GCTGGAGTGG GAGTGGTTAC ATGCTGCTGA CCGGAGAAGA GCTGAAGCCG GAGGAGGTT 60 ATGTCTGCGA AGACTGTAGC CACGCCTCTG TTGACTGGCA GGTGGTGGCC AATGCTGATG 840 TCAGCGTTGA ACTGCCTGAT GCAGATCAAC AGGTGTTTGC AACTGGACAA GGCCTAGCG 900 GGACTTTGCA AGTGGTGAAT CCAGCCTCTG GCAACCAGGT GAAGGTGATC TCTATGAAC 960 TGTGCCTCAC AGCCAAAAGC CAGACAGAGT GTGATATCTA CCCGCTTCGC GTTGGATCC 1020 GGTCAGTGGC AGTGAAGGGC GAACAGTTCC TGATTAACCA CAAACCCTTC TACTTTACTG 1080 GCTTTGGTCG TCTGAAGATG CGGACTTACG TGGCAAAGGA TTCGATAACG TGCTGATGG 1140 TGCACGACCA CGCCTAATGG ACTGGATCGG GGCCAACCTC CTACCCTACC TCGCCTTACC 1200 CTTACGCTGA AGAGATGCTC GACTGGGCAG ATGAACATGG CATCGTGGTG ATCGATGAAA 1260 CTGCTGCTGT CGGCTTTAAC CTCTCTTTAG GCCTGGTTTC GAAGCGGGCA ACAAGCCGA 1320 AAGAAGTGTA CAGCGAAGAG GCAGTCAACG GGGAAACTCA GCAAGCGCAC TTACAGCGA 1380 TTAAAGAGCT GATAGCGCGT GACAAAAACC ACCCAAGCGT GGTGATGTGG AGTATTGCCA 1440 GCGGCCGCTTAAGAATTCGATATACCGCGAATTCGGATCC 5' - Primer GCGGCCGCTTAAGAATTCGATATACCGCGAATTCGGATCC 5' - Primer GCGGCCGCTTAAGAATTCGATATACCGCGAATTCGGATCC 5' - Primer GCGGCCGCTTAAGAATTCGATATACCGCGAATTCGGATCC 5' - Primer GCGGCCGCTTAAGAATTCGATATACCGCGAATTCGGATCC 5' - Primer GCGGCCGCTTAAGAATTCGATATACCGCGAATTCGGATCC 5' - Primer GCGGCCGCTTAAGAATTCGATATACCGCGAATTCGGATCC 5' - Primer GCGGCCGCTTAAGAATTCGATATACCGCGAATTCGGATCC 5' - Primer GCGGCCGCTTAAGAATTCGATATACCGCGAATTCGGATCC 5' - Primer GCGGCCGCTTAAGAATTCGATATACCGCGAATTCGGATCC 5' - Primer GCGGCCGCTTAAGAATTCGATATACCGCGAATTCGGATCC 5' - Primer GCGGCCGCTTAAGAATTCGATATACCGCGAATTCGGATCC 5' - Primer GTAAGCATGTAATAATTAATCATGTAATGCATGACGTTATTATGAGATGGGTTTTATG 2220 ATTAGAGTCCC GCAATTATAC ATTTAATACG CGATAGAAACA AAATATAGCG CGCAAC 2280 TAGGATAAATT ATCGCGCGCG GTGT CATCT ATGTTACTAG ATCGGGAATT AAAC TATCAG 2340 TGT T TGACAG GATATATTGG CGGGTAAACC TAAGAGAAAG AGCGTTTATT AGAATAACG 2400 GATATTTAAA AGGGCGTGAAG AGGTTTATCG TTCGTCCTTT GTATGTGCAT GCCAACC 2460 ACAGGGTTCCC CTCGGGATCAA AGTACTTTGA TCCAACCCCT CC GCTGCTAT AGTGCAGT 2520 CGGCTTCTGA CGTTCAGTGC AGCCGTCTTC TGAAAACGAC ATGTCGCACA AGTCCTAAGT 2580 TACGCGACAG GCTGCCGCCC T GCCCTTTTC CTGGCGTTTT CTTGTCGCGT GTTTTAGTCG 2640 CATAAAGTAG AAT ACTTGC GACTAGAACCG GAGACATTA CGCCATGAAC AAGAGCGCCGC 2700 CGCTGGCCTG CTGGGCTATG CCCGC GTCAGC ACCGACGACC AGGACTTGAC CAACCAACG 2760 GGCCGAAC TGC ACGCGGCGGG CTGC ACCAAG CTGTTTTCCG AGAAGATCACCGGC ACCAG 2820 GC GCGACC GC CCGGAGCTGG CCAGGATGC TTGACCACCT ACGCCCTGGCG AC GTTGTGAC 2880 agtgaccagg ctagaccgcc tggcccgcag cacccgcgac ctactggaca ttgccgagcg 2940 catccaggag gccggcgcgg gcctgcgtag cctggcagag ccgtgggccg acaccaccac 3000 gccggccggc cgcatggtgt tgaccgtgtt cgccggcatt gccgagttcg agcgttccct 3060 aatcatcgac cgcacccgga gcgggcgcga ggccgccaag gcccgaggcg tgaagtttgg 3120 cccccgccct accctcaccc cggcacagat cgcgcacgcc cgcgagctga tcgaccagga 3180 aggccgcacc gtgaaagagg cggctgcact gcttggcgtg catcgctcga ccctgtaccg 3240 cgcacttgag cgcagcgagg aagtgacgcc caccgaggcc aggcggcgcg gtgccttccg 3300 tgaggacgca ttgaccgagg ccgacgccct ggcggccgcc gagaatgaac gccaagagga 3360 acaagcatga aaccgcacca ggacggccag gacgaaccgt ttttcattac cgaagagatc 3420 gaggcggaga tgatcgcggc cgggtacgtg ttcgagccgc ccgcgcacgt ctcaaccgtg 3480 cggctgcatg aaatcctggc cggtttgtct gatgccaagc tggcggcctg gccggccagc 3540 ttggccgctg aagaaaccga gcgccgccgt ctaaaaaggt gatgtgtatt tgagtaaaac 3600 agcttgcgtc atgcggtcgc tgcgtatatg atgcgatgag taaataaaca aatacgcaag 3660 gggaacgcat gaaggttatc gctgtactla accagaaagg cgggtcaggc aagacgacca 3720 tcgcaaccca tctagcccgc gccctgcaac tcgccggggc cgatgttctg ttagtcgatt 3780 ccgatcccca gggcagtgcc cgcgattggg cggccgtgcg ggaagatcaa ccgctaaccg 3840 ttgtcggcat cgaccgcccg acgattgacc gcgacgtgaa ggccatcggc cggcgcgact 3900 tcgtagtgat cgacggagcg ccccaggcgg cggacttggc tgtgtccgcg atcaaggcag 3960 ccgacttcgt gctgattccg gtgcagccaa gcccttacga catatgggcc accgccgacc 4020 tggtggagct ggttaagcag cgcattgagg tcacggatgg aaggctacaa gcggcctttg 4080 tcgtgtcgcg ggcgatcaaa ggcacgcgca tcggcggtga ggttgccgag gcgctggccg 4140 ggtacgagct gcccattctt gagtcccgta tcacgcagcg cgtgagctac ccaggcactg 4200 ccgccgccgg cacaaccgtt cttgaatcag aacccgaggg cgacgctgcc cgcgaggtcc 4260 aggcgctggc cgctgaaatt aaatcaaaac tcatttgagt taatgaggta aagagaaaat 4320 GAGCAAAAGC ACAAACACGCTAAGTGGCCGGCCGTCCGAGCGCACGCAGCAGCAAGGCTGC 4380 AACGTTGGCCAGCCTGGCAGACACGCCAGCCATGAAGCGG GTCACTTT CAGTTGCCGGC 4440 GGAGGATCACACCAAGCTGAAGATGTACGCGTACGCCAAGGCAAGACCATTACC GAGCT 4500 GCTATCTGAATACATCGCGCAGCTACCA GAGTAAATGAGCAAATGAATAAATGAGTAGAT 4560 GAATTTTAGCGGCTAAAGGAGGC GG CATGG AAAATCAAGACAACCAGGC ACCGACGCCG 4620 TGGAATGCCCCATGTGTGGAGGAACGGGCGGTTGGCCAGGC GTAAGCGCTGGGTTGTCT 4680 GCCGGCCCTGCAATGGC ACTGGAACCCCCAAGCCCGAGGAATCGC GTGACG GTCGCAA A 4740 CCATCCGGCCCGGTACAAATCGGC GC GGCTGGGTGATGACCTGGTGGAGAAGTTGAAG 4800 GCCGC GCAGGCCGCC CAGCGGCAACGCATCGAGGCAGAAGCACGCCCGGTGAA TC GTGG 4860 CAAGCGGCCGCTGATCGAATCCGCAAAGAATCCC GGCAACCGCCGGCAGCCGGTGC GCCG 4920 TCGATTAGGAAGCCGCCCAAGGGCGACGAGCAACCAGATTTTTCGTTC CGATGCTCTAT 4980 GACGTGGGCA CCCGCGATAGTCGCAGCATCATGGACGTGGCCGTTTTCGTCTGTCGAAG 5040 cgtgaccgac gagctggcga ggtgatccgc tacgagcttc cagacgggca cgtagaggtt 5100 tccgcagggc cggccggcat ggccagtgtg tgggattacg acctggtact gatggcggtt 5160 tcccatctaa ccgaatccat gaaccgatac cgggaaggga agggagacaa gcccggccgc 5220 gtgttccgtc cacacgttgc ggacgtactc aagttctgcc ggcgagccga tggcggaaag 5280 cagaaagacg acctggtaga aacctgcatt cggttaaaca ccacgcacgt tgccatgcag 5340 cgtacgaaga aggccaagaa cggccgcctg gtgacggtat ccgagggtga agccttgatt 5400 agccgctaca agatcgtaaa gagcgaaacc gggcggccgg agtacatcga gatcgagcta 5460 gctgattgga tgtaccgcga gatcacagaa ggcaagaacc cggacgtgct gacggttcac 5520 cccgattact ttttgatcga tcccggcatc ggccgttttc tctaccgcct ggcacgccgc 5580 gccgcaggca aggcagaagc cagatggttg ttcaagacga tctacgaacg cagtggcagc 5640 gccggagagt tcaagaagtt ctgtttcacc gtgcgcaagc tgatcgggtc aaatgacctg 5700 ccggagtacg atttgaagga ggaggcgggg caggctggcc cgatcctagt catgcgctac 5760 cgcaacctga tcgagggcga agcatccgcc ggttcctaat gtacggagca gatgctaggg 5820 caaattgccc tagcaggggga aaaaggtcga aaaggtctct ttcctgtgga tagcacgtac 5880 attgggaacc caaagccgta cattgggaac cggaacccgt acattgggaa cccaaagccg 5940 tacattggga accggtcaca catgtaagtg actgatataa aagagaaaaa aggcgatttt 6000 tccgcctaaa actctttaaa actttataaa actcttaaaa cccgcctggc ctgtgcataa 6060 ctgtctggcc agcgcacagc cgaagagctg caaaaagcgc ctacccttcg gtcgctgcgc 6120 tccctacgcc ccgccgcttc gcgtcggcct atcgcggccg ctggccgctc aaaaatggct 6180 ggcctacggc caggcaatct accagggcgc ggacaagccg cgccgtcgcc actcgaccgc 6240 cggcgcccac atcaaggcac cctgcctcgc gcgtttcggt gatgacggtg aaaacctctg 6300 acacatgcag ctccccggaga cggtcacagc ttgtctgtaa gcggatgccg ggagcagaca 6360 agcccgtcag ggcgcgtcag cgggtgttgg cgggtgtcgg ggcgcagcca tgacccagtc 6420 acgtagcgat agcggagtgt atactggctt aactatgcgg catcagagca gattgtactg 6480 AGAGTTGCTG ATAGCTGCGG TAAAGCTGCG GAGCGGTAAC GGTGATCCAC AGAATCAGG GGATAACGCC 60 AGCGCGTTAT ATAGCTGCGG TAAAGCTGCG GAGCGGTAAC GGTGATCCAC AGAATCAGG GGATAACGCC 60 CGCGCGTTAT ATAGCTGCGG TAAAGCTGCG GAGCGGTAAC GGTGATCCAC AGAATCAGG GGATAACGCC 60 CGCGCGTTAT ATAGCTGCGG TAAAGCTGCG GAGCGGTAAC GGTGATCCAC AGAATCAGG GGATAACGCC 60 CGCGCGTTAT ATAGCTGCGG TAAAGCTGCG GAGCGGTAAC GGTGATCCAC AGAATCAGG GGATAACGCC 60 CGCGCGTTAT ATAGCTGCGG TAAAGCTGCG GAGCGGTAAC GGTGATCCAC AGAATCAGG GGATAACGCC 60 CGCGCGTTAT ATAGCTGCGG TAAAGCTGCG GAGCGGTAAC GGTGATCCAC AGAATCAGG GGATAACGCC 60 CGCGCGTTAT ATAGCTGCGG TAAAGCTGCG GAGCGGTAAC GGTGATCCAC AGAATCAGG GGATAACGCC 60 CGCGCGTTAT ATAGCTGCGG TAAAGCTGCG GAGCGGTAAC GGTGATCCAC AGAATCAGG GGATAACGCC 60 CGCGCGTTAT ATAGCTGCGG TAAAGCTGCG GAGCGGTAAC GGTGATCCAC AGAATCAGG GGATAACGCC 60 CGCGCGTTAT ATAGCTGCGG TAAAGCTGCG GAGCGGTAAC GGTGATCCAC AGAATCAGG GGATAACGCC 60 CGCGCGTTAT ATAGCTGCGG TAAAGCTGCG GAGCGGTAAC GGTGATCCAC AGAATCAGG GGATAACGCC 60 ccagttacct tcggaaaaag agttggtagc tcttgatccg gcaaacaaac caccgctggt 7260 agcggtggtt tttttgtttg caagcagcag attacgcgca gaaaaaaagg atctcaagaa 7320 gatcctttga tcttttctac ggggtctgac gctcagtgga acgaaaactc acgttaaggg 7380 attttggtca tgcattctag gtactaaaac aattcatcca gtaaaatata atattttatt 7440 ttctcccaat caggcttgat ccccagtaag tcaaaaaata gctcgacata ctgttcttcc 7500 ccgatatcct ccctgatcga ccggacgcag aaggcaatgt cataccactt gtccgccctg 7560 ccgcttctcc caagatcaat aaagccactt actttgccat ctttcacaaa gatgttgctg 7620 tctcccaggt cgccgtggga aaagacaagt tcctcttcgg gcttttccgt ctttaaaaaa 7680 tcatacagct cgcgcggatc tttaaatgga gtgtcttctt cccagttttc gcaatccaca 7740 tcggccagat cgttattcag taagtaatcc aattcggcta agcggctgtc taagctattc 7800 gtatagggac aatccgatat gtcgatggag tgaaagagcc tgatgcactc cgcatacagc 7860 tcgataatct tttcagggct ttgttcatct tcatactctt ccgagcaaag gacgccatcg 7920 gcctcactca tgagcagatt gctccagcca tcatgccgtt caaagtgcag gacctttgga 7980 acaggcagct ttccttccag ccatagcatc atgtcctttt cccgttccac atcataggtg 8040 gtccctttat accggctgtc cgtcattttt aaatataggt tttcattttc tcccaccagc 8100 ttatatacct tagcaggaga cattccttcc gtatctttta cgcagcggta tttttcgatc 8160 agttttttca attccggtga tattctcatt ttagccattt attatttcct tcctcttttc 8220 tacagtattt aaagataccc caagaagcta attataacaa gacgaactcc aattcactgt 8280 tccttgcatt ctaaaacctt aaataccaga aaacagcttt ttcaaagttg ttttcaaagt 8340 tggcgtataa catagtatcg acggagccga ttttgaaacc gcggtgatca caggcagcaa 8400 cgctctgtca tcgttacaat caacatgcta ccctccgcga gatcatccgt gtttcaaacc 8460 cggcagctta gttgccgttc ttccgaatag catcggtaac atgagcaaag tctgccgcct 8520 tacaacggct ctcccgctga cgccgtcccg gactgatggg ctgcctgtat cgagtggtga 8580 ttttgtgccg agctgccggt cggggagctg ttggctggct ggtggcagga tatattgtgg 8640 TGTAACAAAA TTGACGCTTA GACAAC TTA T AACACATTG CGGACGTTTT TAATGTACTG 8700 AATTAACGCC GAATTAATTC GGGGGATCTG GATTTTAGTA CTGGATTTTG GTTTTAGGAA 8760 T TAGAAATTT TATTGATAGA AGTATT TTAC AAATACAAT ACATCTAAG G GTTTCTTAT 8820 ATGCTCAACA CATGAGCGAA ACCCTATAGG AACCCTAATT CCCTTATCTG GGAAC TACTC 8880 ACACATTATT ATGGAGAAAC TCGAGCTTGTC GATCGACAGA TCCGGTCGGC ATCTACTCT 8940 ATTTCTTTGCC CTCGGACGAG TGCTGGGGCGTCGGTTTCC ACTATCGGCG AGTACTTCTA 9000 CACAGCCATC GGTCCAGACG GCCGCGCTTC TGC GGGCGATT TGTGTACGCC CGACAGTCC 9060 CGGCTCCGGA TC GGACGATT GC GTCGATC GACCCTGC GC CCAAGCTGCAT CATCGAAAT 9120 TGCCGTCAAC CAAGCTCTGA TAGAGTTGGT CAAGACCAAT GC GGAGCATAT ACGCCCGGA 9180 GTCTGGGGAT CCTGCAAGCT CC GGATGCCTC CGCTCGAAGT AGCGCGTC TGCTGCTCCA 9240 TACAAGCCAA CCACGGCCTC CAGAAGAAGA TGTTGGCGAC CTCGTATTGG GAATCCCCGA 9300 ACATCGCCTC GCTCCAGTCA ATGACC GCT GTTATGC GGCC ATTGTCCGTC AGGACATTGT 9360 tggagccgaa atccgcgtgc acgaggtgcc ggacttcggg gcagtcctcg gcccaaagca 9420 tcagctcatc gagagcctgc gcgacggacg cactgacggt gtcgtccatc acagtttgcc 9480 agtgatacac atggggatca gcaatcgcgc atatgaaatc acgccatgta gtgtattgac 9540 cgattccttg cggtccgaat gggccgaacc cgctcgtctg gctaagatcg gccgcagcga 9600 tcgcatccat agcctccgcg accggttgta gaacagcggg cagttcggtt tcaggcaggt 9660 cttgcaacgt gacaccctgt gcacggcggg agatgcaata ggtcaggctc tcgctaaact 9720 ccccaatgtc aagcacttcc ggaatcggga gcgcggccga tgcaaagtgc cgataaacat 9780 aacgatcttt gtagaaacca tcggcgcagc tatttacccg caggacatat ccacgccctc 9840 ctacatcgaa gctgaaagca cgagattctt cgccctccga gagctgcatc aggtcggaga 9900 cgctgtcgaa cttttcgatc agaaacttct cgacagacgt cgcggtgagt tcaggctttt 9960 tcatatctca ttgccccccc ggatctgcga aagctcgaga gagatagatt tgtagagaga 10020 gactggtgat ttcagcgtgt cctctccaaa tgaaatgaac ttccttatat agaggaaggt 10080 cttgcgaagg atagtgggat tgtgcgtcat cccttacgtc agtggagata tcacatcaat 10140 ccacttgctt tgaagacgtg gttggaacgt cttctttttc cacgatgctc ctcgtgggtg 10200 ggggtccatc tttgggacca ctgtcggcag aggcatcttg aacgatagcc tttcctttat 10260 cgcaatgatg gcatttgtag gtgccacctt ccttttctac tgtccttttg atgaagtgac 10320 agatagctgg gcaatggaat ccgaggaggt ttcccgatat taccctttgt tgaaaagtct 10380 caatagccct ttggtcttct gagactgtat ctttgatatt cttggagtag acgagagtgt 10440 cgtgctccac catgttatca catcaatcca cttgctttga agacgtggtt ggaacgtctt 10500 ctttttccac gatgctcctc gtgggtgggg gtccatcttt gggaccactg tcggcagagg 10560 catcttgaac gatagccttt cctttatcgc aatgatggca tttgtaggtg ccaccttcct 10620 tttctactgt ccttttgatg aagtgacaga tagctgggca atggaatccg aggaggtttc 10680 ccgatattac cctttgttga aaagtctcaa tagccctttg gtcttctgag actgtatctt 10740 tgatattctt ggagtagacg agagtgtcgt gctccaccat gttggcaagc tgctctagcc 10800 aatacgcaaa ccgcctctcc ccgcgcgttg gccgattcat taatgcagct ggcacgacag 10860 gtttcccgac tggaaagcgg gcagtgagcg caacgcaatt aatgtgagtt agctcactca 10920 ttaggcaccc caggctttac actttatgct tccggctcgt atgttgtgtg gaattgtgag 10980 cggataacaa tttcacacag gaaacagcta tgaccatgat tacgaattcc ccgatctagt 11040 aacatagatg acaccgcgcg cgataattta tcctagtttg cgcgctatat tttgttttct 11100 atcgcgtatt aaatgtataa ttgcgggact ctaatcataa aaacccatct cataaataac 11160 gtcatgcatt acatgttaat tattacatgc ttaacgtaat tcaacagaaa ttatatgata 11220 atcatcgcaa gaccggcaac aggattcaat cttaagaaac tttattgcca aatgtttgaa 11280 cgatcgggga aattcgagct catggctgac gagtcatgga gggcgccggc gatagtgcaa 11340 gagctggcgg cagccggcgt cgaggagccg ccgagccgat acctgctacg ggagaaagac 11400 cgttctgacg tcaagctggt cgccgccgag ctgccggagc ccctccccgt cgttgatctc 11460 agccggctag atggtgccga ggaggccacc aagctcaggg tggctctgca gaattggggc 11520 ttcttcctgt gaaaatctcg aaacagccgt gtcatagtca atcattaggt gttataggaa 11580 caatcaaagg ttttttcaag tgttaatctt catactaata tatacagtgg gtactcttta 11640 tctactgccg tggaactgtc atatttgatt atgaaatttt agctctagaa aatatttgat 11700 catcaatgtc aagactttat gaccttgcaa aatacatttc ctaattgaga acagggtaaa 11760 attatgaact atgcctctga accttcatac acaggcagca cattttttgt tgtaaaattc 11820 atcttaatat cagcggaaag actggaccag agaaagaaaa agttaagaca ggcatatact 11880 cttgatcctc taaaagagat gaggcggtac aatgatcaac catgaacatt aaagtgatac 11940 gtggaacatg agaacacaaa taattgtcac tggaacataa atacaaaaag gtttgtagta 12000 acttacccag gaagaagccc caattctgca gagccaccct gagcttggtg gcctcctcgg 12060 caccatctag ccggctgaga tcaacgacgg ggaggggctc cggcagctcg gcggcgacca 12120 gcttgacgtc agaacggtct ttctcccgta gcaggtatcg gctcggcggc tcctcgacgc 12180 cggctgccgc cagctcttgc actatcgccg gcgccctcca tgactcgtca gccatggatc 12240 ctctagagtc gacctgcaga agtaacacca aacaacaggg tgagcatcga caaaagaaac 12300 agtaccaagc aaataatag cgtatgaagg cagggctaaa aaaatccaca tatagctgct 12360 gcatatgcca tcatccaagt atatcaagat caaaataatt ataaaacata cttgtttatt 12420 ataatagata ggtactcaag gttagagcat atgaatagat gctgcatatg ccatcatgta 12480 tatgcatcag taaaacccac atcaacatgt atacctatcc tagatcgata tttccatcca 12540 tcttaaactc gtaactatga agatgtatga cacacacata cagttccaaa attaataaat 12600 acaccaggta gtttgaaaca gtattctact ccgatctaga acgaatgaac gaccgcccaa 12660 ccacaccaca tcatcacaac caagcgaaca aaaagcatct ctgtatatgc atcagtaaaa 12720 cccgcatcaa catgtatacc tatcctagat cgatatttcc atccatcatc ttcaattcgt 12780 aactatgaat atgtatggca cacacataca gatccaaaat tataaatcc accaggtagt 12840 ttgaaaaga attctactcc gatctagaac gaccgcccaa ccagaccaca tcatcacaac 12900 caagacaaaa aaaagcatga aaagatgacc cgacaaacaa gtgcacggca tatattgaaa 12960 taaaggaaaa gggcaaacca aaccctatgc aacgaaaca aaaaaatcat gaaatcgatc 13020 ccgtctgcgg aacggctga gccatcccag gattccccaa agaaacac tggcaagtta 13080 gcaatcagaa cgtgtctgac gtacaggtcg catccgtgta cgaacgctag cagcacggat 13140 ctaacacaaa cacggatcta acacaaacat gaacagaagt agaactaccg ggccctaacc 13200 atggaccgga acgccgatct agagaaggta gagaggggg gggggggagg acgagcggcg 13260 taccttgaag cggaggtgcc gacgggtgga tttgggggag atctggttgt gtgtgtgtgc 13320 gctccgaaca acacgaggtt ggggaaagag ggtgtggagg gggtgtctat ttattacggc 13380 gggcgaggaa gggaaagcga aggagcggtg ggaaaggaat cccccgtagc tgccggtgcc 13440 gtgagagg ggaggccg cctgccgtgc cggctcacgt ctgccgctcc gccacgcaat 13500 ttctggatgc cgacagcgga gcaagtccaa cggtggagcg gaactctcga gaggggtcca 13560 GAGGCGAGCAG AGATGCCGTG CCCTTCTGCT TCGCTTGGCC CGACGCAGCT GCTGGT 13620 TCGCTGGTTG TGTCCGTTAG ACTCGTCGAC GGCCTTAACA GGCTGGCATT ATCTACTC 13680 GAAACAAGAAA ATGTTCCTTA GTTTTTTTTA TTTCCTTAAG GGTATTTGTT TAATTTT 13740 TAGTCACCTT ATTTTCCTCT ATTTTATATC TAAATTATTA AATAAAAAAA CTAAT 13800 GTTTCTTAAT TTAGAGGCTA AAAATAGATA AAAATGTAAC AAAATATAGA 13860 GTCTATAAAA CCTAACCCTA AACCCTAATG GATGTACTAA TAAATGGATG AAGTA 13920 TTATATAGGT GAAGCTATTT GCAAAAAAAA AGGAGAACAC ATGCACACTA AAAAGATAAA 13980 ACTGCTAGAG TCCTGTTGTC AAAATACTCA ATTGTCCTTT AGACCATGTC TAACCGTTCA 14040 TTATATGATT CTCTAAAACA CTGATATTAT TGTAATCTAT AGATTATATT ATTCGTA 14100 GTAAGTTTAA ATATATGTAT AAAGATAGAA TACTGCCTTA AAACAAATGT GACAAAA 14160 AAAATATGTG GTCATTTTTT ATAACCTTAG ACATGCAATG CTCATTATCT CTA 14220 cacgaccggg tcacgctgca caagcttggc actggccgtc gttttacaac gtcgtgactg 14280 ggaaaaccct ggcgttaccc aacttaatcg ccttgcagca catccccctt tcgccagctg 14340 gcgtaatagc gaagaggccc gcaccgatcg cccttcccaa cagttgcgca gcctgaatgg 14400 cgaatgctag agcagcttga gcttggatca gattgtcgtt tcccgccttc agtttagctt 14460 catggagtca aagattcaaa tagaggacct aacagaactc gccgtaaaga ctggcgaaca 14520 gttcatacag agtctcttac gactcaatga caagaagaaa atcttcgtca acatggtgga 14580 gcacgacaca cttgtctact ccaaaaatat caaagataca gtctcagaag accaaagggc 14640 aattgagact tttcaacaaa gggtaatatc cggaaacctc ctcggattcc attgcccagc 14700 tatctgtcac tttattgtga agatagtgga aaaggaaggt ggctcctaca aatgccatca 14760 ttgcgataaa ggaaaggcca tcgttgaaga tgcctctgcc gacagtggtc ccaaagatgg 14820 acccccaccc acgaggagca tcgtggaaaa agaagacgtt ccaaccacgt cttcaaagca 14880 agtggattga tgtgatatct ccactgacgt aagggatgac gcacaatccc actatccttc 14940 gcaagaccct tcctctatat aaggaagttc atttcatttg gagagaacac gggggactct 15000 tgac 15004 <210> 5 <211> 40 <212> DNA <213> Artificial Sequence <400> 5 atcggggaaa ttcgagctca tggctgacga gtcatggagg 40 <210> 6 <211> 32 <212> DNA <213> Artificial Sequence <400> 6 gagattttca caggaagaag ccccaattct gc 32 <210> 7 <211> 33 <212> DNA <213> Artificial Sequence <400> 7 cttcttcctg tgaaaatctc gaaacagccg tgt 33 <210> 8 <211> 46 <212> DNA <213> Artificial Sequence <400> 8 cttcttcctg ggtaagttac tacaaacctt tttgtattta tgttcc 46 <210> 9 <211> 33 <212> DNA <213> Artificial Sequence <400> 9 agtaacttac ccaggaagaa gccccaattc tgc 33 <210> 10 <211> 45 <212> DNA <213> Artificial Sequence <400> 10 ctgcaggtcg actctagagg atccatggct gacgagtcat ggagg 45 <210> 11 <211> 300 <212> DNA <213> Artificial Sequence <400> 11 tgaaaatctc gaaacagccg tgtcatagtc aatcattagg tgttatagga acaatcaaag 60 gttttttcaa gtgttaatct tcatactaat atatacagtg ggtactcttt atctactgcc 120 gtggaactgt catatttgat tatgaaattt tagctctaga aaatatttga tcatcaatgt 180 caagacttta tgaccttgca aaatacattt cctaattgag aacagggtaa aattatgaac 240 tatgcctctg aaccttcata cacaggcagc acattttttg ttgtaaaatt catcttaata 300 <210> 12 <211> 240 <212> DNA <213> Artificial Sequence <400> 12 tgaaaatctc gaaacagccg tgtcatagtc aatcattagg tgttatagga acaatcaaag 60 GTTTTTTCAAGTGTAAATCTTCATACTAATATATACAGTGGGTACTCTTTATCTACTGCC 120 GTGGAACCGT CATATTTCAT TATGAAATTT TAGCTCTAGAAATATTTGATCATCAATGT 180 CAAGACTTTATGACCTTGC AAAATACATTT CCTAATTGAG AACAGGGTAA AATTATGAAC 240

Claims

1. An RNAi plant expression vector, characterized in that, A hairpin structure expression cassette, wherein the hairpin structure expression cassette contains a hairpin structure formed by DNA fragments shown in SEQ ID No. 1-3; The DNA fragments shown in SEQ ID No. 1 to 3 are arranged sequentially from upstream to downstream.

2. The RNAi plant expression vector according to claim 1, characterized in that, The promoter of the hairpin structure expression box is one of the following: rice or maize Ubi promoter, Rubisco small subunit promoter, Cab promoter, CAMV 35S promoter, or Actin promoter.

3. The RNAi plant expression vector according to claim 2, characterized in that, The promoter is the Ubi promoter of rice or corn.

4. The RNAi plant expression vector according to claim 1, characterized in that, It also includes a selectable marker expression cassette containing a promoter, a marker gene, and a terminator, wherein the promoter is a rice or maize Ubi promoter, a CAMV 35S promoter, or an Actin promoter; the marker gene is a gene for an enzyme that produces a color change, a fluorescent marker gene, an antibiotic marker gene, a herbicide selection marker gene, or a chemical resistance marker gene; and the terminator is a NOS terminator or a Ubi terminator.

5. The RNAi plant expression vector according to any one of claims 1-4, characterized in that, It has the nucleotide sequence shown in SEQ ID No.

4.

6. A biological material containing the RNAi plant expression vector according to any one of claims 1-5, wherein the biological material is an engineered bacterium, cell, or callus tissue, and the biological material cannot develop into a plant individual.

7. The method for constructing the RNAi plant expression vector according to any one of claims 1-5, comprising ligating the DNA fragments shown in SEQ ID No. 1-3 to the plant binary transformation vector using an overlapping method.

8. A gene that interferes with the sensitivity of plant HPPD inhibitors. HIS1 The method of expression is characterized by, Transform a plant using the RNAi plant expression vector according to any one of claims 1-5; the plant is rice.

9. The method according to claim 8, characterized in that, include: (1) Constructing an RNAi plant expression vector: The DNA fragment shown in SEQ ID No. 1-3 was ligated between the SacⅠ and BamHI sites of the plant binary transformation vector pTCK303 using the overlapping method to obtain the RNAi plant expression vector pTCK303-HIS1i-1; (2) Transformation: pTCK303-HIS1i-1 was introduced into Agrobacterium EHA105 strain and transformed into callus tissue. The transformed callus tissue was then induced to differentiate into plants that were β-triketone herbicides susceptible. The DNA fragments shown in SEQ ID No. 1 to 3 are arranged sequentially from upstream to downstream.

10. The RNAi plant expression vector according to any one of claims 1-5 in interfering with plant expression. HIS1 Application of gene expression and preparation of β-triketone herbicides in plants that are susceptible to dominant herbicides, wherein the plant is rice.

11. The application of the RNAi plant expression vector according to any one of claims 1-5 in the breeding of new transgenic rice varieties, hybrid rice seed production, or in preventing transgenic escape.

Images