Anti-cd371 antibodies and uses thereof

Abstract

The presently disclosed subject matter provides antibodies or antigen-binding fragments thereof that bind to CD371, and methods of using such antibodies or antigen-binding fragments thereof. In certain embodiments, an anti-CD371 antibody or antigen-binding fragment thereof comprises a heavy chain variable region comprising an amino acid sequence that is at least about 80%, at least about 85%, at least about 90%, at least about 95%, at least about 96%, at least about 97%, at least about 98%, at least about 99%, at least about 100% homologous or identical to the amino acid sequence set forth in SEQ ID NO: 1, SEQ ID NO: 3, SEQ ID NO: 5, SEQ ID NO: 7, SEQ ID NO: 9, or SEQ ID NO: 11.

Description

[0001] Cross-references to related applications

[0002] This application claims priority to U.S. Provisional Patent Application Serial No. 62 / 900,118, filed September 13, 2019, and U.S. Provisional Patent Application Serial No. 62 / 936,913, filed November 18, 2019, the contents of each of which are incorporated by reference in their entirety and priority to each of which is claimed.

[0003] SEQUENCE LISTING

[0004] The instant application contains a Sequence Listing which has been submitted via EFS-Web and which is hereby incorporated by reference in its entirety. The ASCII copy, created on September 11, 2020, is named “0727341146_ST25” and is 58,682 bytes in size. TECHNICAL FIELD

[0005] The presently disclosed subject matter relates to antibodies that bind CD371 and methods of using such antibodies. BACKGROUND

[0006] CD371 (CEC12A), also known as DCAR-2, MICL or CLL-1, is a 30 kD C-type lectin transmembrane glycoprotein. It is expressed on monocytes, granulocytes, natural killer (NK) cells and basophils. CD371 is an immunoinhibitory receptor that recruits Src homology phosphatases SHP-1 and SHP-2 to its phosphorylated cytoplasmic immunoreceptor tyrosine-based inhibitory motif (ITIM) (Sancho et al., Annu Rev. Immunol (2012); 30:491-529; Yan et al., Front Immunol (2015); 6:408; Lahoud et al., J Immunol (2011); 187:842). CD371 is believed to be a receptor for negatively regulating uric acid crystals (monosodium urate, MSU) that controls autoimmune and inflammatory diseases (Neumann et al., Immunity, (2014); 40:389-99). CD371 is a negative regulator of granulocyte and monocyte function (Marshall et al., J Biol Chem (2004); 279(15): 14792-802; Pye et al., Eur J Immunol (2008); 38(4): 1157-63). Aberrant expression of CD371 has been reported in acute myeloid leukemia (AML) and myelodysplastic syndrome (MDS) (Sadonik et al., Blood, (2016); 128:4234; Toft-Petersen et al., Br J Haematal (2016); 175(3):393-41). Recent studies have shown that CD371 is expressed on 92% of acute myeloid leukemia (AML) and is absent on granulocyte-macrophage progenitor cells (GMP) (Bakker et al., Cancer Res. (2004); 64(22):8443-50). CD371 is also expressed on leukemic stem cells (LSC), which have unlimited self-renewal capacity and generate a large number of daughter blast cells with CD371-specific phenotypes, one of the most important causes of leukemia relapse (Siveen et al., Mol Cancer (2017); 16:13; Yoshida et al., Cancer Sci (2016); 107:5-11). Given the important role of CD371 in disease, antibodies that bind to CD371 and methods of using such drugs are needed. SUMMARY

[0007] The presently disclosed subject matter provides antibodies or antigen-binding fragments thereof that specifically bind to CD371, and methods of using the antibodies or antigen-binding fragments thereof.

[0008] In certain embodiments, the anti-CD371 antibody or antigen-binding fragment thereof comprises a heavy chain variable region comprising an amino acid sequence at least about 80%, at least about 85%, at least about 90%, at least about 95%, at least about 96%, at least about 97%, at least about 98%, at least about 99%, at least about 100% homologous or identical to the amino acid sequence set forth in SEQ ID NO: 1, SEQ ID NO: 3, SEQ ID NO: 5, SEQ ID NO: 7, SEQ ID NO: 9, or SEQ ID NO: 11.

[0009] In certain embodiments, the anti-CD371 antibody or antigen-binding fragment thereof comprises a heavy chain variable region comprising an amino acid sequence at least about 80%, at least about 85%, at least about 90%, at least about 95%, at least about 96%, at least about 97%, at least about 98%, at least about 99%, at least about 100% homologous or identical to the amino acid sequence set forth in SEQ ID NO: 1, SEQ ID NO: 3, SEQ ID NO: 5, SEQ ID NO: 7, SEQ ID NO: 9, or SEQ ID NO: 11.

[0010] In certain embodiments, the anti-CD371 antibody or antigen-binding fragment thereof comprises (a) a heavy chain variable region comprising an amino acid sequence at least about 80%, at least about 85%, at least about 90%, at least about 95%, at least about 96%, at least about 97%, at least about 98%, at least about 99%, at least about 100% homologous or identical to the amino acid sequence set forth in SEQ ID NO: 1, SEQ ID NO: 3, SEQ ID NO: 5, SEQ ID NO: 7, SEQ ID NO: 9, or SEQ ID NO: 11; and (b) a light chain variable region comprising an amino acid sequence at least about 80%, at least about 85%, at least about 90%, at least about 95%, at least about 96%, at least about 97%, at least about 98%, at least about 99%, at least about 100% homologous or identical to the amino acid sequence set forth in SEQ ID NO: 2, SEQ ID NO: 4, SEQ ID NO: 6, SEQ ID NO: 8, SEQ ID NO: 10, or SEQ ID NO: 12.

[0011] In certain embodiments, the heavy chain variable region and the light chain variable region of the anti-CD371 antibody or antigen-binding fragment thereof are selected from the group consisting of:

[0012] (a) a heavy chain variable region comprising an amino acid sequence that is at least about 80%, at least about 85%, at least about 90%, at least about 95%, at least about 96%, at least about 97%, at least about 98%, at least about 99%, at least about 100% homologous or identical to the amino acid sequence set forth in SEQ ID NO: 1, and a light chain variable region comprising an amino acid sequence that is at least about 80%, at least about 85%, at least about 90%, at least about 95%, at least about 96%, at least about 97%, at least about 98%, at least about 99%, at least about 100% homologous or identical to the amino acid sequence set forth in SEQ ID NO: 2;

[0013] (b) a heavy chain variable region comprising an amino acid sequence that is at least about 80%, at least about 85%, at least about 90%, at least about 95%, at least about 96%, at least about 97%, at least about 98%, at least about 99%, at least about 100% homologous or identical to the amino acid sequence set forth in SEQ ID NO: 3, and a light chain variable region comprising an amino acid sequence that is at least about 80%, at least about 85%, at least about 90%, at least about 95%, at least about 96%, at least about 97%, at least about 98%, at least about 99%, at least about 100% homologous or identical to the amino acid sequence set forth in SEQ ID NO: 4;

[0014] (c) a heavy chain variable region comprising an amino acid sequence that is at least about 80%, at least about 85%, at least about 90%, at least about 95%, at least about 96%, at least about 97%, at least about 98%, at least about 99%, at least about 100% homologous or identical to the amino acid sequence set forth in SEQ ID NO: 5, and a light chain variable region comprising an amino acid sequence that is at least about 80%, at least about 85%, at least about 90%, at least about 95%, at least about 96%, at least about 97%, at least about 98%, at least about 99%, at least about 100% homologous or identical to the amino acid sequence set forth in SEQ ID NO: 6;

[0015] (d) a heavy chain variable region comprising an amino acid sequence that is at least about 80%, at least about 85%, at least about 90%, at least about 95%, at least about 96%, at least about 97%, at least about 98%, at least about 99%, at least about 100% homologous or identical to the amino acid sequence set forth in SEQ ID NO: 7, and a light chain variable region comprising an amino acid sequence that is at least about 80%, at least about 85%, at least about 90%, at least about 95%, at least about 96%, at least about 97%, at least about 98%, at least about 99%, at least about 100% homologous or identical to the amino acid sequence set forth in SEQ ID NO: 8;

[0016] (e) a heavy chain variable region comprising an amino acid sequence at least about 80%, at least about 85%, at least about 90%, at least about 95%, at least about 96%, at least about 97%, at least about 98%, at least about 99%, at least about 100% homologous or identical to the amino acid sequence set forth in SEQ ID NO: 9, and a light chain variable region comprising an amino acid sequence at least about 80%, at least about 85%, at least about 90%, at least about 95%, at least about 96%, at least about 97%, at least about 98%, at least about 99%, at least about 100% homologous or identical to the amino acid sequence set forth in SEQ ID NO: 10; and

[0017] (f) a heavy chain variable region comprising an amino acid sequence at least about 80%, at least about 85%, at least about 90%, at least about 95%, at least about 96%, at least about 97%, at least about 98%, at least about 99%, at least about 100% homologous or identical to the amino acid sequence set forth in SEQ ID NO: 11, and a light chain variable region comprising an amino acid sequence at least about 80%, at least about 85%, at least about 90%, at least about 95%, at least about 96%, at least about 97%, at least about 98%, at least about 99%, at least about 100% homologous or identical to the amino acid sequence set forth in SEQ ID NO: 12.

[0018] In certain embodiments, the anti-CD371 antibody or antigen-binding fragment thereof comprises a heavy chain variable region comprising the amino acid sequence set forth in SEQ ID NO: 1, SEQ ID NO: 3, SEQ ID NO: 5, SEQ ID NO: 7, SEQ ID NO: 9, or SEQ ID NO: 11. In certain embodiments, the anti-CD371 antibody or antigen-binding fragment thereof comprises a light chain variable region comprising the amino acid sequence set forth in SEQ ID NO: 2, SEQ ID NO: 4, SEQ ID NO: 6, SEQ ID NO: 8, SEQ ID NO: 10, or SEQ ID NO: 12.

[0019] In certain embodiments, the anti-CD371 antibody or antigen-binding fragment thereof comprises a heavy chain variable region comprising the amino acid sequence set forth in SEQ ID NO: 1, SEQ ID NO: 3, SEQ ID NO: 5, SEQ ID NO: 7, SEQ ID NO: 9, or SEQ ID NO: 11, and a light chain variable region comprising the amino acid sequence set forth in SEQ ID NO: 2, SEQ ID NO: 4, SEQ ID NO: 6, SEQ ID NO: 8, SEQ ID NO: 10, or SEQ ID NO: 12.

[0020] In certain embodiments, the anti-CD371 antibody or antigen-binding fragment thereof comprises a heavy chain variable region and a light chain variable region, wherein the heavy chain variable region and the light chain variable region are selected from the group consisting of:

[0021] (a) a heavy chain variable region comprising the amino acid sequence set forth in SEQ ID NO: 1, and a light chain variable region comprising the amino acid sequence set forth in SEQ ID NO: 2;

[0022] (b) a heavy chain variable region comprising the amino acid sequence set forth in SEQ ID NO: 3, and a light chain variable region comprising the amino acid sequence set forth in SEQ ID NO: 4;

[0023] (c) a heavy chain variable region comprising the amino acid sequence set forth in SEQ ID NO: 5, and a light chain variable region comprising the amino acid sequence set forth in SEQ ID NO: 6;

[0024] (d) a heavy chain variable region comprising the amino acid sequence set forth in SEQ ID NO: 7, and a light chain variable region comprising the amino acid sequence set forth in SEQ ID NO: 8;

[0025] (e) a heavy chain variable region comprising the amino acid sequence set forth in SEQ ID NO: 9, and a light chain variable region comprising the amino acid sequence set forth in SEQ ID NO: 10; and

[0026] (f) a heavy chain variable region comprising the amino acid sequence set forth in SEQ ID NO: 11, and a light chain variable region comprising the amino acid sequence set forth in SEQ ID NO: 12.

[0027] In certain embodiments, the anti-CD371 antibody or antigen-binding fragment thereof comprises: a heavy chain variable region comprising CDR1, CDR2, and CDR3 domains; and a light chain variable region comprising CDR1, CDR2, and CDR3 domains, wherein the heavy chain variable region and the light chain variable region CDR3 domains are selected from the group consisting of:

[0028] (a) a heavy chain variable region CDR3 comprising the amino acid sequence set forth in SEQ ID NO: 30 and conservative modifications thereof; and a light chain variable region CDR3 comprising the amino acid sequence set forth in SEQ ID NO: 33 and conservative modifications thereof;

[0029] (b) a heavy chain variable region CDR3 comprising the amino acid sequence set forth in SEQ ID NO: 36 and conservative modifications thereof; and a light chain variable region CDR3 comprising the amino acid sequence set forth in SEQ ID NO: 39 and conservative modifications thereof;

[0030] (c) a heavy chain variable region CDR3 comprising an amino acid sequence set forth in SEQ ID NO: 42, and conserved modifications thereof; and a light chain variable region CDR3 comprising an amino acid sequence set forth in SEQ ID NO: 45, and conserved modifications thereof;

[0031] (d) a heavy chain variable region CDR3 comprising an amino acid sequence set forth in SEQ ID NO: 48, and conserved modifications thereof; and a light chain variable region CDR3 comprising an amino acid sequence set forth in SEQ ID NO: 51, and conserved modifications thereof;

[0032] (e) a heavy chain variable region CDR3 comprising an amino acid sequence set forth in SEQ ID NO: 54, and conserved modifications thereof; and a light chain variable region CDR3 comprising an amino acid sequence set forth in SEQ ID NO: 57, and conserved modifications thereof; and

[0033] (f) a heavy chain variable region CDR3 comprising an amino acid sequence set forth in SEQ ID NO: 60, and conserved modifications thereof; and a light chain variable region CDR3 comprising an amino acid sequence set forth in SEQ ID NO: 63, and conserved modifications thereof.

[0034] In certain embodiments, the heavy chain variable region and light chain variable region CDR2 domains of the antibody, or antigen binding portion thereof, are selected from:

[0035] (a) a heavy chain variable region CDR2 comprising an amino acid sequence set forth in SEQ ID NO: 29, and conserved modifications thereof; and a light chain variable region CDR2 comprising an amino acid sequence set forth in SEQ ID NO: 32, and conserved modifications thereof;

[0036] (b) a heavy chain variable region CDR2 comprising an amino acid sequence set forth in SEQ ID NO: 35, and conserved modifications thereof; and a light chain variable region CDR2 comprising an amino acid sequence set forth in SEQ ID NO: 38, and conserved modifications thereof;

[0037] (c) a heavy chain variable region CDR2 comprising an amino acid sequence set forth in SEQ ID NO: 41, and conserved modifications thereof; and a light chain variable region CDR2 comprising an amino acid sequence set forth in SEQ ID NO: 44, and conserved modifications thereof;

[0038] (d) a heavy chain variable region CDR2 comprising an amino acid sequence set forth in SEQ ID NO: 47, and conserved modifications thereof; and a light chain variable region CDR2 comprising an amino acid sequence set forth in SEQ ID NO: 50, and conserved modifications thereof;

[0039] (e) a heavy chain variable region CDR2 comprising an amino acid sequence set forth in SEQ ID NO: 53, and conserved modifications thereof; and a light chain variable region CDR2 comprising an amino acid sequence set forth in SEQ ID NO: 56, and conserved modifications thereof; and

[0040] (f) a heavy chain variable region CDR2 comprising an amino acid sequence set forth in SEQ ID NO: 59, and conserved modifications thereof; and a light chain variable region CDR2 comprising an amino acid sequence set forth in SEQ ID NO: 62, and conserved modifications thereof.

[0041] In certain embodiments, the anti-CD371 heavy chain variable region and light chain variable region CDR1 domains of the antibody, or antigen binding portion thereof, are selected from:

[0042] (a) a heavy chain variable region CDR1 comprising an amino acid sequence set forth in SEQ ID NO: 28, and conserved modifications thereof; and a light chain variable region CDR1 comprising an amino acid sequence set forth in SEQ ID NO: 31, and conserved modifications thereof;

[0043] (b) a heavy chain variable region CDR1 comprising an amino acid sequence set forth in SEQ ID NO: 34, and conserved modifications thereof; and a light chain variable region CDR1 comprising an amino acid sequence set forth in SEQ ID NO: 37, and conserved modifications thereof;

[0044] (c) a heavy chain variable region CDR1 comprising an amino acid sequence set forth in SEQ ID NO: 40, and conserved modifications thereof; and a light chain variable region CDR1 comprising an amino acid sequence set forth in SEQ ID NO: 43, and conserved modifications thereof;

[0045] (d) a heavy chain variable region CDR1 comprising an amino acid sequence set forth in SEQ ID NO: 46, and conserved modifications thereof; and a light chain variable region CDR1 comprising an amino acid sequence set forth in SEQ ID NO: 49, and conserved modifications thereof;

[0046] (e) a heavy chain variable region CDR1 comprising an amino acid sequence set forth in SEQ ID NO: 52, and conserved modifications thereof; and a light chain variable region CDR1 comprising an amino acid sequence set forth in SEQ ID NO: 55, and conserved modifications thereof; and

[0047] (f) a heavy chain variable region CDR1 comprising an amino acid sequence set forth in SEQ ID NO: 58, and conserved modifications thereof; and a light chain variable region CDR1 comprising an amino acid sequence set forth in SEQ ID NO: 61, and conserved modifications thereof.

[0048] In certain embodiments, one or more CDR sequences have up to about 5 amino acid substitutions. In certain embodiments, one or more CDR sequences have up to about 3 amino acid substitutions.

[0049] In certain embodiments, the anti-CD371 antibody or antigen-binding fragment thereof comprises:

[0050] (a) a heavy chain variable region CDR1 comprising the amino acid sequence set forth in SEQ ID NO: 28; a heavy chain variable region CDR2 comprising the amino acid sequence set forth in SEQ ID NO: 29; and a heavy chain variable region CDR3 comprising the amino acid sequence set forth in SEQ ID NO: 30;

[0051] (b) a heavy chain variable region CDR1 comprising the amino acid sequence set forth in SEQ ID NO: 34; a heavy chain variable region CDR2 comprising the amino acid sequence set forth in SEQ ID NO: 35; and a heavy chain variable region CDR3 comprising the amino acid sequence set forth in SEQ ID NO: 36;

[0052] (c) a heavy chain variable region CDR1 comprising the amino acid sequence set forth in SEQ ID NO: 40; a heavy chain variable region CDR2 comprising the amino acid sequence set forth in SEQ ID NO: 41; and a heavy chain variable region CDR3 comprising the amino acid sequence set forth in SEQ ID NO: 42;

[0053] (d) a heavy chain variable region CDR1 comprising the amino acid sequence set forth in SEQ ID NO: 46; a heavy chain variable region CDR2 comprising the amino acid sequence set forth in SEQ ID NO: 47; and a heavy chain variable region CDR3 comprising the amino acid sequence set forth in SEQ ID NO: 48;

[0054] (e) a heavy chain variable region CDR1 comprising the amino acid sequence set forth in SEQ ID NO: 52; a heavy chain variable region CDR2 comprising the amino acid sequence set forth in SEQ ID NO: 53; and a heavy chain variable region CDR3 comprising the amino acid sequence set forth in SEQ ID NO: 54, or

[0055] (f) a heavy chain variable region CDR1 comprising the amino acid sequence set forth in SEQ ID NO: 58; a heavy chain variable region CDR2 comprising the amino acid sequence set forth in SEQ ID NO: 59; and a heavy chain variable region CDR3 comprising the amino acid sequence set forth in SEQ ID NO: 60.

[0056] In certain embodiments, the anti-CD371 antibody or antigen-binding fragment thereof comprises:

[0057] (a) a light chain variable region CDR1 comprising the amino acid sequence set forth in SEQ ID NO: 31; a light chain variable region CDR2 comprising the amino acid sequence set forth in SEQ ID NO: 32; and a light chain variable region CDR3 comprising the amino acid sequence set forth in SEQ ID NO: 33;

[0058] (b) a light chain variable region CDR1 comprising the amino acid sequence set forth in SEQ ID NO: 37; a light chain variable region CDR2 comprising the amino acid sequence set forth in SEQ ID NO: 38; and a light chain variable region CDR3 comprising the amino acid sequence set forth in SEQ ID NO: 39;

[0059] (c) a light chain variable region CDR1 comprising the amino acid sequence set forth in SEQ ID NO: 43; a light chain variable region CDR2 comprising the amino acid sequence set forth in SEQ ID NO: 44; and a light chain variable region CDR3 comprising the amino acid sequence set forth in SEQ ID NO: 45;

[0060] (d) a light chain variable region CDR1 comprising the amino acid sequence set forth in SEQ ID NO: 49; a light chain variable region CDR2 comprising the amino acid sequence set forth in SEQ ID NO: 50; and a light chain variable region CDR3 comprising the amino acid sequence set forth in SEQ ID NO: 51;

[0061] (e) a light chain variable region CDR1 comprising the amino acid sequence set forth in SEQ ID NO: 55; a light chain variable region CDR2 comprising the amino acid sequence set forth in SEQ ID NO: 56; and a light chain variable region CDR3 comprising the amino acid sequence set forth in SEQ ID NO: 57, or

[0062] (f) a light chain variable region CDR1 comprising the amino acid sequence set forth in SEQ ID NO: 61; a light chain variable region CDR2 comprising the amino acid sequence set forth in SEQ ID NO: 62; and a light chain variable region CDR3 comprising the amino acid sequence set forth in SEQ ID NO: 63.

[0063] In certain embodiments, the anti-CD371 antibody or antigen-binding fragment thereof comprises:

[0064] (a) a heavy chain variable region CDR1 comprising the amino acid sequence set forth in SEQ ID NO:28; a heavy chain variable region CDR2 comprising the amino acid sequence set forth in SEQ ID NO:29; a heavy chain variable region CDR3 comprising the amino acid sequence set forth in SEQ ID NO:30; a light chain variable region CDR1 comprising the amino acid sequence set forth in SEQ ID NO:31; a light chain variable region CDR2 comprising the amino acid sequence set forth in SEQ ID NO:32; and a light chain variable region CDR3 comprising the amino acid sequence set forth in SEQ ID NO:33;

[0065] (b) a heavy chain variable region CDR1 comprising the amino acid sequence set forth in SEQ ID NO:34; a heavy chain variable region CDR2 comprising the amino acid sequence set forth in SEQ ID NO:35; a heavy chain variable region CDR3 comprising the amino acid sequence set forth in SEQ ID NO:36; a light chain variable region CDR1 comprising the amino acid sequence set forth in SEQ ID NO:37; a light chain variable region CDR2 comprising the amino acid sequence set forth in SEQ ID NO:38; and a light chain variable region CDR3 comprising the amino acid sequence set forth in SEQ ID NO:39;

[0066] (c) a heavy chain variable region CDR1 comprising the amino acid sequence set forth in SEQ ID NO:40; a heavy chain variable region CDR2 comprising the amino acid sequence set forth in SEQ ID NO:41; a heavy chain variable region CDR3 comprising the amino acid sequence set forth in SEQ ID NO:42; a light chain variable region CDR1 comprising the amino acid sequence set forth in SEQ ID NO:43; a light chain variable region CDR2 comprising the amino acid sequence set forth in SEQ ID NO:44; and a light chain variable region CDR3 comprising the amino acid sequence set forth in SEQ ID NO:45;

[0067] (d) a heavy chain variable region CDR1 comprising the amino acid sequence set forth in SEQ ID NO:46; a heavy chain variable region CDR2 comprising the amino acid sequence set forth in SEQ ID NO:47; a heavy chain variable region CDR3 comprising the amino acid sequence set forth in SEQ ID NO:48; a light chain variable region CDR1 comprising the amino acid sequence set forth in SEQ ID NO:49; a light chain variable region CDR2 comprising the amino acid sequence set forth in SEQ ID NO:50; and a light chain variable region CDR3 comprising the amino acid sequence set forth in SEQ ID NO:51;

[0068] (e) a heavy chain variable region CDR1 comprising the amino acid sequence set forth in SEQ ID NO:52; a heavy chain variable region CDR2 comprising the amino acid sequence set forth in SEQ ID NO:53; a heavy chain variable region CDR3 comprising the amino acid sequence set forth in SEQ ID NO:54; a light chain variable region CDR1 comprising the amino acid sequence set forth in SEQ ID NO:55; a light chain variable region CDR2 comprising the amino acid sequence set forth in SEQ ID NO:56; and a light chain variable region CDR3 comprising the amino acid sequence set forth in SEQ ID NO:57; or

[0069] (f) a heavy chain variable region CDR1 comprising the amino acid sequence set forth in SEQ ID NO:58; a heavy chain variable region CDR2 comprising the amino acid sequence set forth in SEQ ID NO:59; a heavy chain variable region CDR3 comprising the amino acid sequence set forth in SEQ ID NO:60; a light chain variable region CDR1 comprising the amino acid sequence set forth in SEQ ID NO:61; a light chain variable region CDR2 comprising the amino acid sequence set forth in SEQ ID NO:62; and a light chain variable region CDR3 comprising the amino acid sequence set forth in SEQ ID NO:63.

[0070] The presently disclosed subject matter provides an antibody or antigen-binding fragment thereof that cross-competes for binding to CD371 with any of the above-described antibodies or antigen-binding fragments thereof.

[0071] The presently disclosed subject matter provides an antibody or antigen-binding fragment thereof that binds to the same epitope on CD371 as any of the above-described antibodies or antigen-binding fragments thereof.

[0072] In certain embodiments, the sequence of the antibody is light-heavy variable chain orientation (V L -V H ). In certain embodiments, the antibody or antigen-binding fragment thereof binds to human CD371 with a dissociation constant (K -7 dissociation constant (K -8 dissociation constant (K -9 dissociation constant (K -8 dissociation constant (K D ) of between about 1 x 10

[0073] In certain embodiments, the antibody or antigen-binding fragment thereof comprises the amino acid sequence set forth in SEQ ID NO: 16, SEQ ID NO: 17, SEQ ID NO: 18, SEQ ID NO: 19, SEQ ID NO: 20, or SEQ ID NO: 21.

[0074] In certain embodiments, the antibody or antigen-binding fragment thereof comprises a human variable region framework region. In certain embodiments, the antibody or antigen-binding fragment thereof is fully human or an antigen-binding fragment thereof. In certain embodiments, the antibody or antigen-binding fragment thereof is a chimeric antibody or antigen-binding fragment thereof. In certain embodiments, the antibody or antigen-binding portion thereof is a humanized antibody or antigen-binding fragment thereof. In certain embodiments, the antigen-binding fragment of the antibody is a Fab, Fab', F(ab')2, variable fragment (Fv), or single-chain variable fragment (scFv).

[0075] The presently disclosed subject matter also provides immunoconjugates comprising an antibody or antigen-binding fragment thereof disclosed herein linked to a therapeutic agent. In certain embodiments, the therapeutic agent is a drug, a cytotoxin, or a radioisotope.

[0076] Further, the presently disclosed subject matter provides bispecific molecules comprising an antibody or antigen-binding fragment thereof disclosed herein linked to a second functional moiety. In certain embodiments, the second functional moiety has a different binding specificity than the antibody or antigen-binding fragment thereof.

[0077] The presently disclosed subject matter also provides compositions comprising an antibody or antigen-binding fragment thereof disclosed herein, an immunoconjugate disclosed herein, or a bispecific antibody disclosed herein. In certain embodiments, the composition is a pharmaceutical composition further comprising a pharmaceutically acceptable carrier.

[0078] Further, the presently disclosed subject matter provides nucleic acids encoding an antibody or antigen-binding fragment thereof disclosed herein, expression vectors comprising the nucleic acid molecules, and host cells comprising the expression vectors.

[0079] The presently disclosed subject matter provides methods of detecting CD371 in a whole cell or tissue. In certain embodiments, the method comprises contacting a cell or tissue with an antibody or antigen-binding fragment thereof disclosed herein, wherein the antibody or antigen-binding fragment thereof comprises a detectable label; and determining the amount of the labeled antibody or antigen-binding fragment thereof bound to the cell or tissue by measuring the amount of detectable label associated with the cell or tissue, wherein the amount of bound antibody or antigen-binding fragment thereof is indicative of the amount of CD371 in the cell or tissue.

[0080] Further, the presently disclosed subject matter provides methods of treating tumor burden in a subject. In certain embodiments, the method comprises administering to the subject an antibody or antigen-binding fragment thereof disclosed herein, an immunoconjugate thereof, a bispecific molecule thereof, or a composition thereof. In certain embodiments, the method reduces the number of tumor cells. In certain embodiments, the method reduces the size of a tumor. In certain embodiments, the method eradicates a tumor in the subject.

[0081] In certain embodiments, the subject is a human.

[0082] Further, the presently disclosed subject matter provides methods of treating and / or preventing a tumor or neoplasia in a subject. In certain embodiments, the methods comprise administering to the subject an antibody or antigen-binding fragment thereof, immunoconjugate thereof, bispecific molecule thereof, or composition thereof, disclosed herein.

[0083] In certain embodiments, the methods eradicate a tumor in the subject. In certain embodiments, the subject is a human.

[0084] Further, the presently disclosed subject matter provides methods of increasing or prolonging survival of a subject having a tumor or neoplasia. In certain embodiments, the methods comprise administering to the subject an antibody or antigen-binding fragment thereof, immunoconjugate thereof, bispecific molecule thereof, or composition thereof, disclosed herein. In certain embodiments, the methods eradicate a tumor in the subject. In certain embodiments, the subject is a human.

[0085] Further, the presently disclosed subject matter provides methods of preventing and / or treating a tumor or neoplasia. In certain embodiments, the methods comprise administering to the subject an antibody or antigen-binding fragment thereof, immunoconjugate thereof, bispecific molecule thereof, or composition thereof, disclosed herein. In certain embodiments, the subject is a human.

[0086] In certain embodiments, the tumor or neoplasia is selected from the group consisting of acute myeloid leukemia (AML), multiple myeloma, non-Hodgkin lymphoma, Hodgkin lymphoma, chronic lymphocytic leukemia (CLL), glioblastoma, myelodysplastic syndrome (MDS), and chronic myeloid leukemia (CML). In certain embodiments, the tumor is AML.

[0087] Further, the presently disclosed subject matter provides kits for treating tumor burden in a subject, treating and / or preventing a tumor or neoplasia, and / or increasing or prolonging survival of a subject having a tumor or neoplasia, comprising an antibody or antigen-binding fragment thereof, immunoconjugate thereof, bispecific molecule thereof, or composition thereof, disclosed herein. In certain embodiments, the kits further comprise written instructions for using the antibody or antigen-binding fragment thereof, immunoconjugate thereof, bispecific molecule thereof, or composition thereof, disclosed herein, to treat tumor burden in a subject, treat and / or prevent a tumor or neoplasia, and / or increase or prolong survival of a subject having a tumor or neoplasia. BRIEF DESCRIPTION OF DRAWINGS

[0088] The following detailed description, given by way of example, can be understood in connection with the accompanying drawings.

[0089] Figure 1 Depiction of binding of anti-CD371 monoclonal phage preparations to HEK293H cells transfected with human CD371.

[0090] Figure 2A and 2B Depiction of binding of 1B10 and 1C3 formatted as human IgG1 to OCI cells. Figure 2A B10 is shown (referred to as "1B10"). Figure 2B C3 is shown (or referred to as "1C3").

[0091] Figure 3 Depiction of binding of scFv-Fc fusion proteins and scFv fragments to HEK293 cells expressing human CD371. DETAILED DESCRIPTION

[0092] The presently disclosed subject matter provides anti-CD371 antibodies. The specification and examples describe non-limiting embodiments of the present disclosure.

[0093] For the purpose of clear disclosure, but not limitation, the detailed description is divided into the following subsections:

[0094] 5.1. Definitions;

[0095] 5.2. CD371;

[0096] 5.3. Anti-CD371 antibodies;

[0097] 5.4. Nucleic acids encoding antibodies or antigen-binding fragments;

[0098] 5.5. Pharmaceutical compositions and methods of treatment;

[0099] 5.6. Kits; and

[0100] 5.7. Detection methods

[0101] 5.1. Definitions

[0102] In the following description, the use of terms will follow certain conventions. In general, the terms used herein are intended to be construed in a manner consistent with their meaning as known to one skilled in the art.

[0103] An "antigen-binding protein" is a protein or polypeptide that includes an antigen- binding region or antigen-binding portion, i.e., has a strong affinity for another molecule with which it binds. Antigen-binding proteins include antibodies, chimeric antigen receptors (CARs), and fusion proteins.

[0104] "Antibodies" and "antibodies" known in the art refer to antigen-binding proteins of the immune system. The term "antibody" as used herein includes full-length antibodies having an antigen-binding region, as well as any fragment thereof in which an "antigen-binding portion" or "antigen-binding region" is retained, or single chains thereof, such as single-chain variable fragments (scFv). A naturally occurring "antibody" is a glycoprotein comprising at least two heavy (H) chains and two light (L) chains interconnected by disulfide bonds. Each heavy chain is comprised of a heavy chain variable region (abbreviated herein as V H ) and a heavy chain constant (CH) region. The heavy chain constant region is comprised of three domains, CH1, CH2 and CH3. Each light chain is comprised of a light chain variable region (abbreviated herein as V L ) and a light chain constant region C L . The light chain constant region is comprised of one domain, C L . The V H and V L regions can be further subdivided into regions of hypervariability, termed complementarity determining regions (CDRs), interspersed with regions that are more conserved, termed framework regions (FRs). Each V H and V L is composed of three CDRs and four FRs, arranged from amino-terminus to carboxy-terminus in the following order: FR1, CDR1, FR2, CDR2, FR3, CDR3, FR4. The variable regions of the heavy and light chains contain a binding domain that interacts with an antigen. The constant regions of the antibodies can mediate the binding of the immunoglobulin to host tissues or factors, including various cells of the immune system (e.g., effector cells) and the first component (Clq) of the classical complement system.

[0105] The term "human antibody" as used herein is intended to include antibodies having variable regions in which both the framework and CDR regions are derived from human germline immunoglobulin sequences. Furthermore, if the antibody includes a constant region, the constant region is also derived from human germline immunoglobulin sequences. The human antibodies of the presently disclosed subject matter can include amino acid residues not encoded by human germline immunoglobulin sequences (e.g., mutations introduced by random or site-specific mutagenesis in vitro or by somatic mutation in vivo).

[0106] The term "monoclonal antibody" as used herein refers to an antibody obtained from a population of substantially homogeneous antibodies, i.e., the individual antibodies comprising the population are identical and / or bind the same epitope, except for possible variants that can arise during production of the monoclonal antibody, such variants are typically present in minor amounts. The monoclonal antibody preparation can be monoclonal antibodies directed against a single determinant (epitope) of the antigen in the preparation, unlike polyclonal antibody preparations which typically include different antibodies directed against different determinants (epitopes). The modifier "monoclonal" indicates the character of the antibody as being obtained from a substantially homogeneous population of antibodies, and is not to be construed as requiring production of the antibody by any particular method. For example, the monoclonal antibodies to be used in accordance with the present disclosure can be made by a variety of techniques, including but not limited to the hybridoma method, recombinant DNA methods, phage-display methods, and transgenic animals containing all or part of the human immunoglobulin loci, as described herein and further described below. Such techniques are well known in the art.

[0107] The term "recombinant human antibody", as used herein, includes all human antibodies that are prepared, expressed, created or isolated by recombinant means, such as (a) antibodies isolated from an animal (e.g., a mouse) that is transgenic or transchromosomal for human immunoglobulin genes or a hybridoma prepared therefrom (described further below), (b) antibodies isolated from a host cell transformed to express human antibody, e.g., from a transfectoma, (c) antibodies isolated from a recombinant, combinatorial human antibody library, and (d) antibodies prepared, expressed, created or isolated by any other means that involve splicing of human immunoglobulin gene sequences to other DNA sequences. Such recombinant human antibodies have variable regions in which the framework and CDR regions are derived from human germline immunoglobulin sequences. In certain embodiments, however, such recombinant human antibodies can be subjected to in vitro mutagenesis (or, when an animal transgenic for human Ig sequences is used, mutagenesis in vivo), and thus the amino acid sequences of the V H and V L regions of the recombinant antibodies are sequences that, while derived from germline V H and V L sequences, can not naturally exist within the human antibody germline repertoire in this format.

[0108] The term "humanized antibody" refers to an antibody in which CDR sequences derived from the germline of another mammalian species, such as a mouse, have been grafted onto human framework sequences. Additional framework region modifications can be made within the human framework sequences.

[0109] The term "chimeric antibody" means an antibody in which the variable region sequences are derived from one species and the constant region sequences are derived from another species, such as an antibody in which the variable region sequences are derived from a mouse antibody and the constant region sequences are derived from a human antibody.

[0110] As used herein, an antibody that "specifically binds CD371" means an antibody that binds CD371 (e.g., human CD371) with a dissociation constant (K d ) of about 5 x 10 -7 M or less, about 1 x 10 -7 M or less, about 5 x 10 -8 M or less, about 1 x 10 -8 M or less, about 5 x 10 -9 M or less, about 1 x 10 -9 M or less, about 5 x 10 -10 M or less, about 1 x 10 -10 M or less, about 5 x 10 -11 M or less, or about 1 x 10 -11 M or less.

[0111] "Antibodies" Harlow and Lane (Cold Spring Harbor Press, Cold Spring Harbor, NY). An antibody that "competes for binding" or an antibody that "cross-competes for binding" with a reference antibody for binding to an antigen (e.g., CD371) means an antibody that blocks binding of the reference antibody to the antigen (e.g., CD371) by 50% or more in a competition assay, and vice versa. A typical competition assay is described in "Antibodies" Harlow and Lane (Cold Spring Harbor Press, Cold Spring Harbor, NY).

[0112] As used herein, "isotype" refers to the antibody class (e.g., IgM or IgGl) that is encoded by heavy chain constant region genes.

[0113] The phrases "an antibody that recognizes an antigen" and "an antigen-specific antibody" are used interchangeably herein with the term "an antibody that specifically binds an antigen (e.g., a CD371 polypeptide)".

[0114] As used herein, the term "antigen binding portion" or "antigen binding region" of an antibody refers to a region or portion of an antibody that binds to an antigen and confers antigen specificity to the antibody; a fragment of an antigen binding protein, e.g., an antibody, that retains the ability to specifically bind to an antigen (e.g., a CD391 polypeptide). It has been shown that the antigen binding function of an antibody can be performed by fragments of a full-length antibody. Examples of antigen-binding fragments encompassed within the term "antibody fragments" herein include Fab fragments, monovalent fragments consisting of the V L , V H , C L , and CHI domains; F(ab)2 fragments, bivalent fragments comprising two Fab fragments linked by a disulfide bridge at the hinge region; a single arm of an F(ab)2 fragment, a monovalent fragment consisting of the V Hand CH1 domains; the Fd fragment consists of the V L and V H Fv fragment composed of V H dAb fragments composed of α-domains (Ward et al., Nature 1989; 341: 544-546); and isolated complementarity determining regions (CDRs).

[0115] In addition, although the two domains V L and V H are encoded by separate genes, but they can be recombinantly linked with synthetic linkers to make them into a single protein chain, where V L and V H The two regions pair to form monovalent molecules. These are called single-chain Fvs (scFvs); see, for example, Bird et al., Science (1988); 242:423-426; and Huston et al., Proc Natl Acad Sci (1998); 85:5879-5883. These antibody fragments are obtained using conventional techniques known to those skilled in the art, and the fragments are screened for use in the same manner as intact antibodies.

[0116] An "antibody" or "antigen binding protein" is one that has been identified, separated and / or recovered from a component of its natural environment. A "synthetic antibody" or "recombinant antibody" is typically produced using recombinant techniques or peptide synthesis techniques known to those skilled in the art.

[0117] As used herein, the term "single-chain variable fragment" or "scFv" is a fragment of a polypeptide that is covalently linked to form a V H :V L Heterodimer immunoglobulin (e.g., mouse or human) heavy chain (V H ) and light chain (V L ) variable region fusion protein. Heavy chain (V H ) and light chain (V L ) are either directly linked or linked via a peptide-encoded linker (e.g., 10, 15, 20, 25 amino acids) to connect V H N-terminal and V L C-terminal, or V H The C-terminus and V L The N-terminus of the protein is cleaved. Linkers are typically rich in glycine for flexibility and serine or threonine for solubility. Linkers can connect the heavy chain variable region and the light chain variable region of the extracellular antigen-binding domain.

[0118] Non-limiting examples of linkers are disclosed in Shen et al., Anal Chem (2008); 80(6): 1910-1917 and WO2014 / 087010, the contents of which are incorporated by reference in their entirety. In certain embodiments, the linker is a G4S linker. In certain embodiments, the linker comprises the amino acid sequence set forth in SEQ ID NO: 13 provided below:

[0119]

[0120] In certain embodiments, the linker comprises the amino acid sequence set forth in SEQ ID NO: 14 provided below:

[0121]

[0122] In certain embodiments, the linker comprises the amino acid sequence set forth in SEQ ID NO: 64 provided below:

[0123]

[0124] In certain embodiments, the linker comprises the amino acid sequence set forth in SEQ ID NO: 65 provided below:

[0125]

[0126] In certain embodiments, the linker comprises the amino acid sequence set forth in SEQ ID NO: 66 provided below:

[0127]

[0128] In certain embodiments, the linker comprises the amino acid sequence set forth in SEQ ID NO: 67 provided below:

[0129]

[0130] Although the constant region is removed and a linker is introduced, the scFv protein retains the specificity of the original immunoglobulin. As described by Huston et al. (Proc. Nat. Acad. Sci. USA, 1988; 85: 5879-5883), single chain Fv polypeptide antibodies can be produced by including V H - and V L- nucleic acid expression of coding sequences. See also U.S. Patent Nos. 5,091,513, 5,132,405, and 4,956,778; and U.S. Patent Publication Nos. 20050196754 and 20050196754. Antagonistic scFvs with inhibitory activity have been described (see, e.g., Zhao et al., Hyrbidoma (Larchmt) 2008; 27(6):455-51; Peter et al., J Cachexia Sarcopenia Muscle 2012 Aug 12; Shieh et al., J Imunol 2009; 183(4):2277-85; Giomarelli et al., Thromb Haemost 2007; 97(6):955-63; Fife et al., J Clin Invst 2006; 116(8):2252-61; Brocks et al., Immunotechnology 1997; 3(3): 173-84; Moosmayer et al., Ther Immunol 1995; 2(10:31-40). Agonistic scFvs with stimulatory activity have been described (see, e.g., Peter et al., J Bioi Chern 2003 25278(38):36740-7; Xie et al., Nat Biotech 1997 15(8):768-71; Ledbetter et al., Crit Rev Immunol 1997; 17(5-6):427-55; Ho et al., BioChim Biophys Acta 2003; 1638(3):257-66).

[0131] As used herein, “F(ab)” refers to an antibody structural fragment that binds to an antigen but is monovalent and does not have an Fc portion, e.g., an antibody digested with papain yields two F(ab) fragments and an Fc fragment (e.g., a heavy (H) chain constant region; Fc region that does not bind to an antigen).

[0132] As used herein, “F(ab’)2” refers to an antibody fragment produced by pepsin digestion of an intact IgG antibody, wherein the fragment has two antigen binding (ab’) (bivalent) regions, wherein each (ab’) region comprises two separate amino acid chains, a portion of a H chain is connected to a light (L) chain by an S-S bond to bind to an antigen, and wherein the remaining H chain portion is connected together. The “F(ab’)2” fragment can be split into two separate Fab’ fragments.

[0133] As used herein, the term "vector" refers to any genetic element, for example, plasmid, phage, transposon, cosmid, chromosome, virus, viral particle, which is capable of replicating and which can transfer gene sequences to cells when joined with appropriate control elements. The term therefore includes cloning and expression vectors, as well as viral vectors and plasmid vectors.

[0134] "CDR" is defined as the complementarity determining region amino acid sequence of an antibody, which is a hypervariable region of immunoglobulin heavy and light chains. See, e.g., Kabat et al., Sequences of Proteins of Immunological Interest, 4th U.S. Department of Health and Human Services, National Institutes of Health (1987), or the IMGT numbering system (Lefranc, The Immunologist (1999); 7: 132-136; Lefranc et al., Dev. Comp. Immunol. (2003); 27: 55-77). As used herein, the term "hypervariable region" or "HVR" refers to the regions of an antibody variable domain that are hypervariable in sequence ("complementarity determining regions" or "CDRs") and / or form an antigen binding surface ("antigen binding site") and / or contain antigen contacts ("antigen contacts"). Generally, antibodies comprise three heavy chain and three light chain CDRs or CDR regions in the variable region. CDRs provide the majority of the binding specificity for an antibody to its antigen or epitope. In certain embodiments, CDRs are identified according to the IMGT system. In certain embodiments, CDRs are identified using the IMGT numbering system, which is accessible at http: / / www.imgt.org / IMGT_vquest / input.

[0135] The term "isolated" denotes the degree of separation from the original source or environment.

[0136] An "isolated antibody" is one which has been separated from a component of its natural environment. In certain embodiments, an antibody is purified to greater than 95% or 99% purity as determined by, for example, electrophoretic (e.g., SDS-PAGE, isoelectric focusing (IEF), capillary electrophoresis) or chromatographic (e.g., ion exchange or reverse HPLC). For a review of methods for assessment of antibody purity, see, e.g., Flatman et al., J. Chromatogr (2007); B 848: 79-87.

[0137] An "isolated nucleic acid" refers to a nucleic acid molecule that has been separated from a component of its natural environment. An isolated nucleic acid includes a nucleic acid molecule contained in cells that typically contain the nucleic acid molecule, but the nucleic acid molecule is present extrachromosomally or at a chromosomal location that is different from where it would normally be found in the native chromosome.

[0138] An "isolated nucleic acid encoding an antibody" (including references to particular antibodies, such as anti-KLB antibodies) refers to one or more nucleic acid molecules encoding the heavy and light chains (or fragments thereof) of the antibody, including such nucleic acid molecule(s) in a single vector, separate vectors, and such nucleic acid molecule(s) present at one or more locations in the genome of a host cell.

[0139] The term "vector," as used herein, refers to a nucleic acid molecule capable of propagating another nucleic acid to which it is linked. The term includes the vector as a self- replicating nucleic acid structure as well as the vector incorporated into the genome of a host cell into which it has been introduced. Certain vectors are capable of directing the expression of nucleic acids to which they are operatively linked. Such vectors are referred to herein as "expression vectors."

[0140] An "immunoconjugate" is an antibody conjugated to one or more heterologous molecule(s), including but not limited to a cytotoxic agent.

[0141] An "effective amount" (or "therapeutically effective amount") is an amount that is sufficient to effect beneficial or desired clinical results upon treatment. An effective amount can be administered to a subject in one or more doses. In terms of therapy, an effective amount is an amount that is sufficient to reduce, ameliorate, stabilize, reverse, or slow the progression of a disease or otherwise reduce the pathological consequences of a disease. An effective amount is generally determined by a medical practitioner in light of the specific circumstances and is within the skill of the artisan. Several factors will typically be considered in determining the appropriate dose to achieve an effective amount. These factors include the age, sex, and weight of the subject, the condition being treated, the severity of the condition, and the form and effective concentration of the cells being administered.

[0142] An "individual" or "subject" herein is a vertebrate, such as a human or a non-human animal, such as a mammal. Mammals include, but are not limited to, humans, primates, farm animals, sport animals, rodents, and pets. Non-limiting examples of non-human animal subjects include rodents, such as mice, rats, hamsters, and guinea pigs; rabbits; dogs; cats; sheep; pigs; goats; cattle; horses; and non-human primates, such as apes and monkeys.

[0143] As used herein, “treatment” (and grammatical alterations thereof, e.g., “treating” or “treat”) refers to clinical intervention with the intent to alter the natural course of the individual being treated, and can be performed either for prophylaxis or during the course of clinical pathology. Desirable effects of treatment include, but are not limited to, preventing occurrence or reoccurrence of disease, alleviation of symptoms, diminishment of any direct or indirect pathological consequences of the disease, preventing metastasis, decreasing the rate of disease progression, amelioration or palliation of the disease state, and remission or improved prognosis. In certain embodiments, antibodies of the presently disclosed subject matter are used to delay development of a disease or to slow the progression of a disease, e.g., “tumor” (acute myeloid leukemia (AML)).

[0144] “Neoplasia” refers to a disease characterized by pathological proliferation of cells or tissues and their subsequent migration or invasion into other tissues or organs. Neoplastic growth is generally uncontrolled and progressive and occurs under conditions that do not cause or lead to cessation of normal cell proliferation.

[0145] The terms “comprise” “comprising”, are intended to have the broad meaning that they have in the United States Patent Law, which can be read to mean “including” “including but not limited to”.

[0146] As used herein, the term “about” or “approximately” means within an acceptable error range for the particular value as determined by one of ordinary skill in the art, which will depend in part on how the value is measured or determined, i.e., the limitations of the measurement system. For example, “about” can mean within 3 or more than 3 standard deviations, per the practice in the art. Alternatively, “about” can mean ranges approximately 20%, preferably approximately 10%, more preferably approximately 5%, and more preferably approximately 1% of a given value. Alternatively, particularly with respect to biological systems or processes, the term can mean within an order of magnitude, preferably within 5-fold and more preferably within 2-fold, of a value.

[0147] As described herein, any concentration range, percentage range, ratio range, or integer range is to be understood to include values within that range that are also divisible by one, two, three, four, five, six, seven, eight, nine, or ten, as applicable, unless otherwise indicated, and includes fractions, such as tenths and hundredths, as applicable.

[0148] Other aspects of the presently disclosed subject matter are described in the following disclosure and are within the scope of the presently disclosed subject matter.

[0149] 5.2. CD371

[0150] CD371 (CEC12A), also known as DCAL-2, MICL or CLL-1, is a 30 kD C-type lectin transmembrane glycoprotein. It is expressed on monocytes, granulocytes, natural killer (NK) cells and basophils. CD371 is an immunoinhibitory receptor that recruits Src homology phosphatases SHP-1 and SHP-2 to its phosphorylated cytoplasmic immunoreceptor tyrosine-based inhibitory motif (ITIM) (Sancho et al., Annu Rev. Immunol (2012); 30:491-529; Yan et al., Front Immunol (2015); 6:408; Lahoud et al., J Immunol (2011); 187:842). CD371 is considered a receptor for negatively regulating uric acid crystals (monosodium urate, MSU) that controls autoimmune and inflammatory diseases (Neumann et al., Immunity (2014); 40:389-99). CD371 is a negative regulator of granulocyte and monocyte function (Marshall et al., J Biol Chem (2004); 279(15):14792-802; Pye et al., Eur J Immunol (2008); 38(4):1157-63).

[0151] In certain embodiments, CD371 is human CD371, which comprises or consists of an amino acid sequence having NCBI Reference Number: NP_612210.4 (SEQ ID NO: 15) or a fragment thereof.

[0152] SEQ ID NO: 15 is provided below:

[0153]

[0154] In certain embodiments, CD371 comprises or consists of an amino acid sequence that is at least about 80%, at least about 85%, at least about 90%, at least about 95%, at least about 96%, at least about 97%, at least about 98%, or at least about 99%, at least about 100% identical to the amino acid sequence set forth in SEQ ID NO: 15 or a fragment thereof.

[0155] 5.3. Anti-CD371 antibodies

[0156] Antibodies of the presently disclosed subject matter are characterized by particular functional features or properties of the antibodies. For example, the antibodies specifically bind CD371 (e.g., bind human CD371).

[0157] In certain embodiments, the antibodies or antigen-binding fragments of the present disclosure bind to CD371 (e.g., human CD371) with a binding affinity of, e.g., 1 x 10 -6M or less (e.g., about 1 x 10 -7 M or less, about 1 x 10 -8 M or less, about 1 x 10 -9 M or less, about 1 x 10 -10 M or less, or about 1 x 10 -11 M or less). In certain embodiments, the antibody or antigen-binding fragment of the present disclosure binds to CD371 (e.g., human CD371) with a K d dissociation constant (K d dissociation constant (K -8 dissociation constant (K -7 dissociation constant (K d dissociation constant (K -9 dissociation constant (K -8 dissociation constant (K d dissociation constant (K -8 dissociation constant (K d dissociation constant (K -8 dissociation constant (K d dissociation constant (K -8 dissociation constant (K d dissociation constant (K -9 dissociation constant (K

[0158] The heavy and light chains of the antibodies or antigen-binding fragments of the present disclosure can be full-length (e.g., the antibody can include at least one (e.g., one or two) complete heavy chain, and at least one (e.g., one or two) complete light chain) or can include an antigen-binding portion (Fab, F(ab')2, Fv, or a single chain Fv fragment (“scFv”)). In certain embodiments, the antibody heavy chain constant region is selected from, for example, IgGl, IgG2, IgG3, IgG4, IgM, IgAl, IgA2, IgD, and IgE, particularly selected from, for example, IgGl, IgG2, IgG3, and IgG4. In certain embodiments, the immunoglobulin isotype is IgGl (e.g., human IgGl). In certain embodiments, the antibody light chain constant region is selected from, for example, kappa or lambda, particularly kappa.

[0159] 5.3.1. Single chain variable fragments (scFv)

[0160] In certain embodiments, the presently disclosed subject matter includes antibodies or antigen-binding fragments thereof having a scFv sequence fused to one or more constant domains to form an antibody with an Fc region of a human immunoglobulin to create a bivalent protein, thereby increasing the overall avidity and stability of the antibody. In addition, the Fc portion allows for the direct coupling of other molecules, including but not limited to fluorescent dyes, cytotoxins, radioisotopes, and the like, to the antibody, for example, for antigen quantitation studies, immobilization of the antibody for affinity measurements, for targeted delivery of therapeutic agents, testing of Fc-mediated cellular cytotoxicity using immune effector cells, and many other applications.

[0161] The results presented herein highlight the specificity, sensitivity, and utility of the antibodies or antigen-binding fragments of the present disclosure in targeting CD371 polypeptides (e.g., human CD371).

[0162] The molecules of the present disclosure are based on the identification and selection of single-chain variable fragments (scFv) using phage display, the amino acid sequences of which confer specificity of the molecules to the target CD371 polypeptide and form the basis of all antigen-binding proteins of the present disclosure. Thus, the scFv can be used to design a variety of “antibody” molecules, including, for example, full-length antibodies, fragments thereof (e.g., Fab and F(ab’)2), minibodies, fusion proteins (including scFv-Fc fusions), multivalent antibodies (i.e., antibodies with more than one specificity for the same antigen or different antigens, e.g., bispecific antibodies, triabodies, etc.) (see Cuesta et al., Multivalent antibodies: when design surpasses evolution. Trends in Biotechnology 28:355-362 2010).

[0163] In certain embodiments, the antigen-binding protein is a full-length antibody, the heavy and light chains of the antibodies of the present disclosure can be full-length (e.g., the antibody can include at least one or two complete heavy chains and at least one, preferably two, complete light chains) or can include an antigen-binding fragment (Fab, F(ab’)2, Fv, or scFv). In certain embodiments, the antibody heavy chain constant region is selected from the group consisting of IgG1, IgG2, IgG3, IgG4, IgM, IgA1, IgA2, IgD, and IgE, among others. In certain embodiments, the immunoglobulin isotype is selected from the group consisting of IgG1, IgG2, IgG3, and IgG4. In certain embodiments, the immunoglobulin isotype is IgG1 (e.g., human IgG1). The choice of antibody isotype can depend on the immune effector function the antibody is designed to elicit.

[0164] In constructing recombinant immunoglobulins, the appropriate amino acid sequences of the constant regions of various immunoglobulin isotypes and methods of producing various antibodies are known to those skilled in the art.

[0165] In certain embodiments, the anti-CD371 scFv is an scFv-Fc fusion protein or has a V H and a V L region or CDR of a full-length human IgG. In certain embodiments, the anti-CD371 scFv includes a V H region having the amino acid sequence set forth in SEQ ID NO: 1. In certain embodiments, the anti-CD371 scFv includes a V L region having the amino acid sequence set forth in SEQ ID NO: 2. In certain embodiments, the scFv is designed as "B031_P1_PH1B10" (also referred to as "B10").

[0166] In certain embodiments, the anti-CD371 scFv includes a V H region having the amino acid sequence set forth in SEQ ID NO: 1 and a V L region having the amino acid sequence set forth in SEQ ID NO: 2. In certain embodiments, the anti-CD371 scFv includes: a V H CDR1 having the amino acid sequence set forth in SEQ ID NO: 29 or conservative modifications thereof, a V H CDR2 having the amino acid sequence set forth in SEQ ID NO: 30 or conservative modifications thereof, and a V H CDR3 having the amino acid sequence set forth in SEQ ID NO: 31 or conservative modifications thereof. SEQ ID NOs: 28-30 are provided in Table 1.

[0167] In certain embodiments, the anti-CD371 scFv includes: a V L CDR1 having the amino acid sequence set forth in SEQ ID NO: 31 or conservative modifications thereof, a V L CDR2 having the amino acid sequence set forth in SEQ ID NO: 32 or conservative modifications thereof, and a V L CDR3 having the amino acid sequence set forth in SEQ ID NO: 33 or conservative modifications thereof. SEQ ID NOs: 31-33 are provided in Table 1.

[0168] In certain embodiments, the anti-CD371 scFv includes: a V HCDR1, V comprising an amino acid sequence set forth in SEQ ID NO: 29, or conservative modifications thereof H CDR2, V comprising an amino acid sequence set forth in SEQ ID NO: 30, or conservative modifications thereof H CDR3, V comprising an amino acid sequence set forth in SEQ ID NO: 31, or conservative modifications thereof L CDR1, V comprising an amino acid sequence set forth in SEQ ID NO: 32, or conservative modifications thereof L CDR2, V comprising an amino acid sequence set forth in SEQ ID NO: 33, or conservative modifications thereof L CDR3.

[0169] In certain embodiments, the anti-CD371 scFv comprises: V H CDR1, V comprising an amino acid sequence set forth in SEQ ID NO: 29 H CDR2, V comprising an amino acid sequence set forth in SEQ ID NO: 30 H CDR3, V comprising an amino acid sequence set forth in SEQ ID NO: 31 L CDR1, V comprising an amino acid sequence set forth in SEQ ID NO: 32 L CDR2, V comprising an amino acid sequence set forth in SEQ ID NO: 33 L CDR3.

[0170] In certain embodiments, the anti-CD371 scFv comprises: V H and V L comprising an amino acid sequence set forth in SEQ ID NO: 2, linked by a linker. In certain embodiments, the V H and V L are linked by a linker. In certain embodiments, the linker comprises an amino acid sequence set forth in SEQ ID NO: 13.

[0171] In certain embodiments, the variable regions are linked one after the other, such that the heavy chain variable region (V H ) is at the N-terminus. In certain embodiments, the variable regions are, from N-terminus to C-terminus: V H -V L In certain embodiments, the anti-CD371 scFv comprises an amino acid sequence set forth in SEQ ID NO: 68 provided in Table 1.

[0172] In certain embodiments, the light chain variable region (VL ) is located at the N-terminus. In certain embodiments, the variable region is located from the N-terminus to the C-terminus: V L -V H In certain embodiments, the anti-CD371 scFv comprises the amino acid sequence set forth in SEQ ID NO: 16. An exemplary nucleotide sequence encoding the amino acid sequence of SEQ ID NO: 16 is set forth in SEQ ID NO: 22. SEQ ID NOS: 16 and 22 are provided in Table 1 below.

[0173] Table 1

[0174]

[0175] In certain embodiments, the anti-CD371 scFv comprises: a V comprising the amino acid sequence shown in SEQ ID NO: 3; H and V comprising the amino acid sequence shown in SEQ ID NO: 4 L , optionally with a linker sequence, such as a linker peptide, between the heavy chain variable region and the light chain variable region. In certain embodiments, the linker comprises the amino acid sequence set forth in SEQ ID NO: 13. SEQ ID NOs: 3 and 4 are provided in Table 2 below. In certain embodiments, the scFv is designated "B031_P1_PH1C3" (also referred to as "C3").

[0176] In certain embodiments, the anti-CD371 scFv is a scFv-Fc fusion protein or has a V selected from Table 2. H and V L In certain embodiments, the anti-CD371 scFv comprises a V comprising the amino acid sequence shown in SEQ ID NO: 3. H , as shown in Table 2. In certain embodiments, the anti-CD371 scFv comprises a V comprising the amino acid sequence shown in SEQ ID NO: 4. L In certain embodiments, the anti-CD371 scFv comprises: a V comprising the amino acid sequence shown in SEQ ID NO: 3; H and V comprising the amino acid sequence shown in SEQ ID NO: 4 L .

[0177] In certain embodiments, the anti-CD371 scFv comprises: a V comprising the amino acid sequence shown in SEQ ID NO: 34 or a conservative modification thereof. H CDR1, V comprising the amino acid sequence shown in SEQ ID NO: 35 or a conservative modification thereof HCDR1, V, CDR2, and V, and CDR3. SEQ ID NOs: 34-36 are provided in Table 2. H CDR1, V, CDR2, and V, and CDR3. SEQ ID NOs: 34-36 are provided in Table 2.

[0178] In certain embodiments, the anti-CD371 scFv comprises: V L CDR1, V, CDR2, and V, and CDR3. SEQ ID NOs: 34-36 are provided in Table 2. L CDR1, V, CDR2, and V, and CDR3. SEQ ID NOs: 34-36 are provided in Table 2. L CDR1, V, CDR2, and V, and CDR3. SEQ ID NOs: 34-36 are provided in Table 2.

[0179] In certain embodiments, the anti-CD371 scFv comprises: V H CDR1, V, CDR2, and V, and CDR3. SEQ ID NOs: 34-36 are provided in Table 2. H CDR1, V, CDR2, and V, and CDR3. SEQ ID NOs: 34-36 are provided in Table 2. H CDR1, V, CDR2, and V, and CDR3. SEQ ID NOs: 34-36 are provided in Table 2. L CDR1, V, CDR2, and V, and CDR3. SEQ ID NOs: 34-36 are provided in Table 2. L CDR1, V, CDR2, and V, and CDR3. SEQ ID NOs: 34-36 are provided in Table 2. L CDR1, V, CDR2, and V, and CDR3. SEQ ID NOs: 34-36 are provided in Table 2.

[0180] In certain embodiments, the anti-CD371 scFv comprises: V H CDR1, V, CDR2, and V, and CDR3. SEQ ID NOs: 34-36 are provided in Table 2. H CDR1, V, CDR2, and V, and CDR3. SEQ ID NOs: 34-36 are provided in Table 2. H CDR1, V, CDR2, and V, and CDR3. SEQ ID NOs: 34-36 are provided in Table 2. L CDR1, V, CDR2, and V, and CDR3. SEQ ID NOs: 34-36 are provided in Table 2. L CDR1, V, CDR2, and V, and CDR3. SEQ ID NOs: 34-36 are provided in Table 2. L CDR1, V, CDR2, and V, and CDR3. SEQ ID NOs: 34-36 are provided in Table 2.

[0181] In certain embodiments, the anti-CD371 scFv comprises: a V H and a V L In certain embodiments, the V H and the V L are connected by a linker. In certain embodiments, the linker comprises the amino acid sequence set forth in SEQ ID NO: 13.

[0182] In certain embodiments, the heavy chain variable region (V H ) is located at the N-terminus. In certain embodiments, the variable regions are located from N-terminus to C-terminus: V H -V L In certain embodiments, the anti-CD371 scFv comprises the amino acid sequence set forth in SEQ ID NO: 69, which is provided in Table 2.

[0183] In certain embodiments, the light chain variable region (V L ) is located at the N-terminus. In certain embodiments, the variable regions are located from N-terminus to C-terminus: V L -V H In certain embodiments, the anti-CD371 scFv comprises the amino acid sequence set forth in SEQ ID NO: 17. An exemplary nucleotide sequence encoding the amino acid sequence of SEQ ID NO: 17 is set forth in SEQ ID NO: 23. SEQ ID NOs: 17 and 23 are provided in Table 2 below.

[0184] Table 2

[0185]

[0186] In certain embodiments, the anti-CD371 scFv comprises: a V H and a V H , optionally with a linker sequence, e.g., a linker peptide, between the heavy chain variable region and the light chain variable region. In certain embodiments, the linker comprises the amino acid sequence set forth in SEQ ID NO: 13. SEQ ID NOs: 5 and 6 are provided in Table 3 below. In certain embodiments, the anti-CD371 scFv is designated as “B031_P1_PH1D6” (also referred to as “D6”).

[0187] In certain embodiments, the anti-CD371 scFv is an scFv-Fc fusion protein or has a V H and a V Lfull-length human IgG. In certain embodiments, the anti-CD371 scFv comprises a V H In certain embodiments, the anti-CD371 scFv comprises a V L .

[0188] In certain embodiments, the anti-CD371 scFv comprises a V H comprising the amino acid sequence set forth in SEQ ID NO: 6 L .

[0189] In certain embodiments, the anti-CD371 scFv comprises a V H CDR1, a V H CDR2, and a V H CDR3 comprising the amino acid sequence set forth in SEQ ID NO: 42, or conservative modifications thereof. SEQ ID NOs: 40-42 are provided in Table 3.

[0190] In certain embodiments, the anti-CD371 scFv comprises a V L CDR1, a V L CDR2, and a V L CDR3 comprising the amino acid sequence set forth in SEQ ID NO: 45, or conservative modifications thereof. SEQ ID NOs: 43-45 are provided in Table 3.

[0191] In certain embodiments, the anti-CD371 scFv comprises a V H CDR1, a V H CDR2, and a V H CDR3 comprising the amino acid sequence set forth in SEQ ID NO: 43, or conservative modifications thereof. V L CDR1, a V LCDR2, and V L CDR3.

[0192] In certain embodiments, the anti-CD371 scFv comprises: V H CDR1, V H CDR2, V H CDR3, V L CDR1, V L CDR2, V L CDR3.

[0193] In certain embodiments, the anti-CD371 scFv comprises: V H and V L In certain embodiments, V H and V L are connected by a linker. In certain embodiments, the linker comprises the amino acid sequence set forth in SEQ ID NO: 13.

[0194] In certain embodiments, the heavy chain variable region (V H ) is located at the N-terminus. In certain embodiments, the variable regions are located from N-terminus to C-terminus: V H -V L In certain embodiments, the anti-CD371 scFv comprises the amino acid sequence set forth in SEQ ID NO: 70 provided in Table 3.

[0195] In certain embodiments, the light chain variable region (V L ) is located at the N-terminus. In certain embodiments, the variable regions are located from N-terminus to C-terminus: V L -V H In certain embodiments, the anti-CD371 scFv comprises the amino acid sequence set forth in SEQ ID NO: 18. An exemplary nucleotide sequence encoding the amino acid sequence of SEQ ID NO: 18 is set forth in SEQ ID NO: 24. SEQ ID NOs: 18 and 24 are provided in Table 3 below.

[0196] Table 3

[0197]

[0198]

[0199] In certain embodiments, the anti-CD371 scFv comprises a V H H and a V L optionally having a linker sequence, e.g., a linker peptide, between the heavy chain variable region and the light chain variable region. In certain embodiments, the linker comprises the amino acid sequence set forth in SEQ ID NO: 13. SEQ ID NOs: 7 and 8 are provided in Table 4 below. In certain embodiments, the anti-CD371

[0200] The scFv is designated as “B031_P1_PH2A11” (also referred to as “A11”).

[0201] In certain embodiments, the anti-CD371 scFv is an scFv-Fc fusion protein or has a full-length human IgG with a V H H and a V L region or CDR selected from Table 4. In certain embodiments, the anti-CD371 scFv comprises a V H H comprising the amino acid sequence set forth in SEQ ID NO: 13. In certain embodiments, the anti-CD371 scFv comprises a V L H comprising the amino acid sequence set forth in SEQ ID NO: 14. In certain embodiments, the anti-CD371 scFv comprises a V H H and a V L H comprising the amino acid sequence set forth in SEQ ID NO: 8. SEQ ID NOs: 7 and 8 are provided in Table 4.

[0202] In certain embodiments, the anti-CD371 scFv comprises a V H H comprising the amino acid sequence set forth in SEQ ID NO: 46 or conservative modifications thereof, a V H H comprising the amino acid sequence set forth in SEQ ID NO: 47 or conservative modifications thereof, and a V H H comprising the amino acid sequence set forth in SEQ ID NO: 48 or conservative modifications thereof. SEQ ID NOs: 46-48 are provided in Table 4.

[0203] In certain embodiments, the anti-CD371 scFv comprises a V L CDR1, a V L CDR2, and a V L CDR3 comprising the amino acid sequence set forth in SEQ ID NO: 49, or conservative modifications thereof. SEQ ID NOs: 49-51 are provided in Table 4.

[0204] In certain embodiments, the anti-CD371 scFv comprises a V H CDR1, a V H CDR2, and a V H CDR3 comprising the amino acid sequence set forth in SEQ ID NO: 49, or conservative modifications thereof. SEQ ID NOs: 49-51 are provided in Table 4. L CDR1, a V L CDR2, and a V L CDR3.

[0205] In certain embodiments, the anti-CD371 scFv comprises a V H CDR1, a V H CDR2, and a V H CDR3 comprising the amino acid sequence set forth in SEQ ID NO: 49, or conservative modifications thereof. SEQ ID NOs: 49-51 are provided in Table 4. L CDR1, a V L CDR2, and a V L CDR3.

[0206] In certain embodiments, the anti-CD371 scFv comprises a V H and a V L In certain embodiments, the anti-CD371 scFv comprises a V H and a VL linked by a linker. In certain embodiments, the linker comprises the amino acid sequence set forth in SEQ ID NO: 13.

[0207] In certain embodiments, the heavy chain variable region (V H ) is located N-terminal. In certain embodiments, the variable regions are located from N-terminal to C-terminal: V H -V L In certain embodiments, the CD371 scFv comprises the amino acid sequence set forth in SEQ ID NO: 71 provided in Table 4.

[0208] In certain embodiments, the light chain variable region (V L ) is located N-terminal. In certain embodiments, the variable regions are located from N-terminal to C-terminal: V L -V H In certain embodiments, the scFv comprises the amino acid sequence set forth in SEQ ID NO: 19. An exemplary nucleotide sequence encoding the amino acid sequence of SEQ ID NO: 19 is set forth in SEQ ID NO: 25. SEQ ID NOs: 19 and 25 are provided in Table 4 below.

[0209] Table 4

[0210]

[0211]

[0212] In certain embodiments, the anti-CD371 scFv comprises a V H comprising the amino acid sequence set forth in SEQ ID NO: 9 and a V L comprising the amino acid sequence set forth in SEQ ID NO: 10, optionally with a linker sequence, e.g., a linker peptide, between the heavy chain variable region and the light chain variable region. In certain embodiments, the linker comprises the amino acid sequence set forth in SEQ ID NO: 13. SEQ ID NOs: 9 and 10 are provided in Table 5. In certain embodiments, the anti-CD371 scFv is designated as “B031_P1_PH2E4” (also referred to as “E4”).

[0213] In certain embodiments, the anti-CD371 scFv is a scFv-Fc fusion protein or a full-length human IgG with a V H and a V L region or CDR selected from Table 5. In certain embodiments, the anti-CD371 scFv comprises a V HIn certain embodiments, the anti-CD371 scFv comprises a V L In certain embodiments, the anti-CD371 scFv comprises a V H CDR1 comprising an amino acid sequence set forth in SEQ ID NO: 9, a V L .

[0214] In certain embodiments, the anti-CD371 scFv comprises a V H CDR1 comprising an amino acid sequence set forth in SEQ ID NO: 52, or a conservative modification thereof, a V H CDR2, and a V H CDR3 comprising an amino acid sequence set forth in SEQ ID NO: 54, or a conservative modification thereof. SEQ ID NOs: 52-54 are provided in Table 5.

[0215] In certain embodiments, the anti-CD371 scFv comprises a V L CDR1 comprising an amino acid sequence set forth in SEQ ID NO: 55, or a conservative modification thereof, a V L CDR2, and a V L CDR3 comprising an amino acid sequence set forth in SEQ ID NO: 57, or a conservative modification thereof. SEQ ID NOs: 55-57 are provided in Table 5. H CDR1 comprising an amino acid sequence set forth in SEQ ID NO: 52, or a conservative modification thereof, a V H CDR2, and a V H CDR3 comprising an amino acid sequence set forth in SEQ ID NO: 54, or a conservative modification thereof, a V L CDR1 comprising an amino acid sequence set forth in SEQ ID NO: 55, or a conservative modification thereof, a V L CDR2, and a V L CDR3 comprising an amino acid sequence set forth in SEQ ID NO: 57, or a conservative modification thereof.

[0216] In certain embodiments, the anti-CD371 scFv comprises a VH CDR1, V containing the amino acid sequence set forth in SEQ ID NO: 53 H CDR2, V containing the amino acid sequence set forth in SEQ ID NO: 54 H CDR3, V containing the amino acid sequence set forth in SEQ ID NO: 55 L CDR1, V containing the amino acid sequence set forth in SEQ ID NO: 56 L CDR2, V containing the amino acid sequence set forth in SEQ ID NO: 57 L CDR3.

[0217] In certain embodiments, the anti-CD371 scFv comprises V H containing the amino acid sequence set forth in SEQ ID NO: 10 L In certain embodiments, V H and V L are connected by a linker. In certain embodiments, the linker comprises the amino acid sequence set forth in SEQ ID NO: 13.

[0218] In certain embodiments, the heavy chain variable region (V H ) is located at the N-terminus. In certain embodiments, the variable regions are located from N-terminus to C-terminus: V H -V L In certain embodiments, the anti-CD371 scFv comprises the amino acid sequence set forth in SEQ ID NO: 72 provided in Table 5.

[0219] In certain embodiments, the light chain variable region (V L ) is located at the N-terminus. In certain embodiments, the variable regions are located from N-terminus to C-terminus: V L -V H In certain embodiments, the anti-CD371 scFv comprises the amino acid sequence set forth in SEQ ID NO: 20. An exemplary nucleotide sequence encoding the amino acid sequence of SEQ ID NO: 20 is set forth in SEQ ID NO: 26. SEQ ID NOs: 20 and 26 are provided in Table 5 below.

[0220] Table 5

[0221]

[0222] In certain embodiments, the anti-CD371 scFv comprises V Hand V L optionally having a linker sequence, e.g., a linker peptide, between the heavy chain variable region and the light chain variable region. In certain embodiments, the linker comprises the amino acid sequence set forth in SEQ ID NO: 13. SEQ ID NOs: 11 and 12 are provided in Table 6 below. In certain embodiments, the anti-CD371 scFv is designated as “B031_P1_PH2E8” (also referred to as “E8”).

[0223] In certain embodiments, the anti-CD371 scFv is an scFv-Fc fusion protein or has a V H and V L region or CDR. In certain embodiments, the anti-CD371 scFv comprises a V H region or CDR. In certain embodiments, the anti-CD371 scFv comprises a V L region or CDR. In certain embodiments, the anti-CD371 scFv comprises a V H and V L .

[0224] In certain embodiments, the anti-CD371 scFv comprises a V H CDR1, a V H CDR2, and a V H CDR3 comprising the amino acid sequence set forth in SEQ ID NO: 58, or a conservative modification thereof. SEQ ID NOs: 58-60 are provided in Table 6.

[0225] In certain embodiments, the anti-CD371 scFv comprises a V L CDR1, a V L CDR2, and a V L CDR3 comprising the amino acid sequence set forth in SEQ ID NO: 61, or a conservative modification thereof. SEQ ID NOs: 61-63 are provided in Table 6.

[0226] In certain embodiments, the anti-CD371 scFv comprises a V H CDR1, a V H CDR2, and a V H CDR3 comprising the amino acid sequence set forth in SEQ ID NO: 61, or conservative modifications thereof. L CDR1, a V L CDR2, and a V L CDR3.

[0227] In certain embodiments, the anti-CD371 scFv comprises a V H and a V L In certain embodiments, the V H and the V L are connected by a linker. In certain embodiments, the linker comprises the amino acid sequence set forth in SEQ ID NO: 13.

[0228] In certain embodiments, the heavy chain variable region (V H ) is located at the N-terminus. In certain embodiments, the variable regions are located from N-terminus to C-terminus: V H -V L In certain embodiments, the anti-CD371 scFv comprises the amino acid sequence set forth in SEQ ID NO: 73 provided in Table 6.

[0229] In certain embodiments, the light chain variable region (V L ) is located at the N-terminus. In certain embodiments, the variable regions are located from N-terminus to C-terminus: V L -V H In certain embodiments, the anti-CD371 scFv comprises the amino acid sequence set forth in SEQ ID NO: 21. An exemplary nucleotide sequence encoding the amino acid sequence of SEQ ID NO: 21 is set forth in SEQ ID NO: 27. SEQ ID NOs: 21 and 27 are provided in Table 6 below.

[0230] Table 6

[0231]

[0232] 5.3.2. Monoclonal antibodies

[0233] The presently disclosed subject matter provides antibodies (e.g., human antibodies, e.g., human monoclonal antibodies) that specifically bind CD371 (e.g., human CD371). The V H amino acid sequences of B10, C3, D6, A11, E4, and E8 are shown in SEQ ID NOs: 1, 3, 5, 7, 9, and 11, respectively. L The amino acid sequences of B10, C3, D6, A11, E4, and E8 are shown in SEQ ID NOs: 2, 4, 6, 8, 10, and 12, respectively.

[0234] In view of the fact that each of B031_P1_PH1B10 (B10), B031_P1_PH1C3 (C3), B031_P1_PH1D6 (D6), B031_P1_PH2A11 (A11), B031_P1_PH2E4 (E4), and B031_P1_PH2E8 (E8) antibodies can bind CD371, the V H and V L sequences can be "mixed and matched" to generate other anti-CD371 binding molecules. CD371 binding of such "mixed and matched" antibodies can be tested using binding assays known in the art, including, e.g., ELISA, Western blot, RIA, Biacore analysis. Preferably, when mixing and matching V H and V L sequences, the V H / V L pairing of a particular V H sequence is replaced with a structurally similar V H sequence. Likewise, the V H / V L pairing of a particular V L sequence is replaced with a structurally similar V L sequence.

[0235] In certain embodiments, the presently disclosed subject matter provides an antibody or antigen binding fragment or portion thereof, comprising: (a) a heavy chain variable region (V H) and (b) a light chain variable region (V L ) that comprises an amino acid sequence selected from the group consisting of SEQ ID NOs: 2, 4, 6, 8, 10, and 12; wherein the antibody or antigen-binding fragment specifically binds CD371, e.g., human CD371. In certain embodiments, the V H and the V L are selected from the group consisting of:

[0236] (a) a heavy chain variable region comprising the amino acid sequence set forth in SEQ ID NO: 1, and a light chain variable region comprising the amino acid sequence set forth in SEQ ID NO: 2; or

[0237] (b) a heavy chain variable region comprising the amino acid sequence set forth in SEQ ID NO: 3, and a light chain variable region comprising the amino acid sequence set forth in SEQ ID NO: 4;

[0238] (c) a heavy chain variable region comprising the amino acid sequence set forth in SEQ ID NO: 5, and a light chain variable region comprising the amino acid sequence set forth in SEQ ID NO: 6;

[0239] (d) a heavy chain variable region comprising the amino acid sequence set forth in SEQ ID NO: 7, and a light chain variable region comprising the amino acid sequence set forth in SEQ ID NO: 8;

[0240] (e) a heavy chain variable region comprising the amino acid sequence set forth in SEQ ID NO: 9, and a light chain variable region comprising the amino acid sequence set forth in SEQ ID NO: 10; and

[0241] (f) a heavy chain variable region comprising the amino acid sequence set forth in SEQ ID NO: 11, and a light chain variable region comprising the amino acid sequence set forth in SEQ ID NO: 12.

[0242] In certain embodiments, the presently disclosed subject matter provides antibodies or antigen-binding fragments thereof that comprise the heavy and light chain CDR1, CDR2, and CDR3 of B10, C3, D6, A11, E4, and E8.

[0243] The amino acid sequences of the V H CDR1 of B10, C3, D6, A11, E4, and E8 are shown in SEQ ID NOs: 28, 34, 40, 46, 52, and 58, respectively. The amino acid sequences of the V H CDR2 of B10, C3, D6, A11, E4, and E8 are shown in SEQ ID NOs: 29, 35, 41, 47, 53, and 59, respectively. The amino acid sequences of the V HThe amino acid sequences of CDR3 are shown in SEQ ID NOs: 30, 36, 42, 48, 54, and 60, respectively.

[0244] V of B10, C3, D6, A11, E4, and E8 L The amino acid sequences of CDR1 are shown in SEQ ID NOs: 31, 37, 43, 49, 55, and 61, respectively. V of B10, C3, D6, A11, E4, and E8 L The amino acid sequences of CDR2 are shown in SEQ ID NOs: 32, 38, 44, 50, 56, and 62, respectively. V of B10, C3, D6, A11, E4, and E8 L The amino acid sequences of CDR3 are shown in SEQ ID NOs: 33, 39, 45, 51, 57, and 63, respectively. CDR regions were delineated using the IMGT system. In certain embodiments, CDR regions are delineated using the IMGT numbering system, which is accessible at http: / / www.imgt.org / IMGT_vquest / input.

[0245] In view of the fact that each of these antibodies or antigen-binding fragments thereof can bind CD371, and that antigen-binding specificity is provided primarily by the CDR1, CDR2, and CDR3 regions, V H CDR1, CDR2, and CDR3 sequences, and V L CDR1, CDR2, and CDR3 sequences can be "mixed and matched" (i.e., CDRs from different antibodies can be mixed and matched, although each antibody must include V H CDR1, CDR2, and CDR3 sequences, and V L CDR1, CDR2, and CDR3) to generate other anti-CD371 binding molecules. CDR371 binding of such "mixed and matched" antibodies can be tested using the binding assays described above. When V H CDR sequences are mixed and matched, the CDR1, CDR2, and / or CDR3 sequences from a particular V H sequence are replaced with structurally similar CDR sequences. Likewise, when V L CDR sequences are mixed and matched, the CDR1, CDR2, and / or CDR3 sequences from a particular V L sequence are preferably replaced with structurally similar CDR sequences. It will be apparent to the ordinarily skilled artisan that new V H and V L sequences can be generated by replacing one or more V H and / or V LCDR region sequences to generate.

[0246] In certain embodiments, the presently disclosed subject matter provides an antibody or antigen-binding fragment or portion thereof, comprising:

[0247] (a) a heavy chain variable region CDR1 comprising an amino acid sequence selected from the group consisting of SEQ ID NOs: 28, 34, 40, 46, 52, and 58;

[0248] (b) a heavy chain variable region CDR2 comprising an amino acid sequence selected from the group consisting of SEQ ID NOs: 29, 35, 41, 47, 53, and 59;

[0249] (c) a heavy chain variable region CDR3 comprising an amino acid sequence selected from the group consisting of SEQ ID NOs: 30, 36, 42, 48, 54, and 60;

[0250] (d) a light chain variable region CDR1 comprising an amino acid sequence selected from the group consisting of SEQ ID NOs: 31, 37, 43, 49, 55, and 61;

[0251] (e) a light chain variable region CDR2 comprising an amino acid sequence selected from the group consisting of SEQ ID NOs: 32, 38, 44, 50, 56, and 62;

[0252] (f) a light chain variable region CDR3 comprising an amino acid sequence selected from the group consisting of SEQ ID NOs: 33, 39, 45, 51, 57, and 63.

[0253] In certain embodiments, the presently disclosed subject matter provides an antibody or antigen-binding fragment or portion thereof, comprising:

[0254] (a) a heavy chain variable region CDR1 comprising an amino acid sequence selected from the group consisting of SEQ ID NOs: 28, 34, 40, 46, 52, and 58;

[0255] (b) a heavy chain variable region CDR2 comprising an amino acid sequence selected from the group consisting of SEQ ID NOs: 29, 35, 41, 47, 53, and 59;

[0256] (c) a heavy chain variable region CDR3 comprising an amino acid sequence selected from the group consisting of SEQ ID NOs: 30, 36, 42, 48, 54, and 60;

[0257] (d) a light chain variable region CDR1 comprising an amino acid sequence selected from the group consisting of SEQ ID NOs: 31, 37, 43, 49, 55, and 61;

[0258] (e) a light chain variable region CDR2 comprising an amino acid sequence selected from the group consisting of SEQ ID NOs: 32, 38, 44, 50, 56, and 62;

[0259] (f) a light chain variable region CDR3 comprising an amino acid sequence as set forth in SEQ ID NO: 39. In certain embodiments, the antibody or antigen-binding fragment thereof comprises:

[0260] (a) a heavy chain variable region CDR1 comprising an amino acid sequence as set forth in SEQ ID NO: 34;

[0261] (b) a heavy chain variable region CDR2 comprising an amino acid sequence as set forth in SEQ ID NO: 35;

[0262] (c) a heavy chain variable region CDR3 comprising an amino acid sequence as set forth in SEQ ID NO: 36;

[0263] (d) a light chain variable region CDR1 comprising an amino acid sequence as set forth in SEQ ID NO: 37;

[0264] (e) a light chain variable region CDR2 comprising an amino acid sequence as set forth in SEQ ID NO: 38;

[0265] (f) a light chain variable region CDR3 comprising an amino acid sequence as set forth in SEQ ID NO: 39.

[0266] In certain embodiments, the antibody or antigen-binding fragment thereof comprises:

[0267] (a) a heavy chain variable region CDR1 comprising an amino acid sequence as set forth in SEQ ID NO: 40;

[0268] (b) a heavy chain variable region CDR2 comprising an amino acid sequence as set forth in SEQ ID NO: 41;

[0269] (c) a heavy chain variable region CDR3 comprising an amino acid sequence as set forth in SEQ ID NO: 42;

[0270] (d) a light chain variable region CDR1 comprising an amino acid sequence as set forth in SEQ ID NO: 43;

[0271] (e) a light chain variable region CDR2 comprising an amino acid sequence as set forth in SEQ ID NO: 44;

[0272] (f) a light chain variable region CDR3 comprising an amino acid sequence as set forth in SEQ ID NO: 45.

[0273] In certain embodiments, the antibody or antigen-binding fragment thereof comprises:

[0274] (a) a heavy chain variable region CDR1 comprising an amino acid sequence as set forth in SEQ ID NO: 46;

[0275] (b) a heavy chain variable region CDR2 comprising the amino acid sequence set forth in SEQ ID NO: 47;

[0276] (c) a heavy chain variable region CDR3 comprising the amino acid sequence set forth in SEQ ID NO: 48;

[0277] (d) a light chain variable region CDR1 comprising the amino acid sequence set forth in SEQ ID NO: 49;

[0278] (e) a light chain variable region CDR2 comprising the amino acid sequence set forth in SEQ ID NO: 50;

[0279] (f) a light chain variable region CDR3 comprising the amino acid sequence set forth in SEQ ID NO: 51.

[0280] In certain embodiments, the antibody or antigen-binding fragment thereof comprises:

[0281] (a) a heavy chain variable region CDR1 comprising the amino acid sequence set forth in SEQ ID NO: 52;

[0282] (b) a heavy chain variable region CDR2 comprising the amino acid sequence set forth in SEQ ID NO: 53;

[0283] (c) a heavy chain variable region CDR3 comprising the amino acid sequence set forth in SEQ ID NO: 54;

[0284] (d) a light chain variable region CDR1 comprising the amino acid sequence set forth in SEQ ID NO: 55;

[0285] (e) a light chain variable region CDR2 comprising the amino acid sequence set forth in SEQ ID NO: 56;

[0286] (f) a light chain variable region CDR3 comprising the amino acid sequence set forth in SEQ ID NO: 57.

[0287] In certain embodiments, the antibody or antigen-binding fragment thereof comprises:

[0288] (a) a heavy chain variable region CDR1 comprising the amino acid sequence set forth in SEQ ID NO: 58;

[0289] (b) a heavy chain variable region CDR2 comprising the amino acid sequence set forth in SEQ ID NO: 59;

[0290] (c) a heavy chain variable region CDR3 comprising the amino acid sequence set forth in SEQ ID NO: 60;

[0291] (d) a light chain variable region CDR1 comprising the amino acid sequence set forth in SEQ ID NO: 61;

[0292] (e) a light chain variable region CDR2 comprising the amino acid sequence set forth in SEQ ID NO: 62;

[0293] (f) a light chain variable region CDR3 comprising the amino acid sequence set forth in SEQ ID NO: 63.

[0294] The constant region / framework region of the anti-CD371 antibodies disclosed herein can be altered, e.g., by amino acid substitution, to modify the properties of the antibody (e.g., to increase or decrease one or more of the following: antigen binding affinity, Fc receptor binding, antibody carbohydrate (e.g., glycosylation, fucosylation, etc.), number of cysteine residues, effector cell function, complement function, or introduction of a binding site).

[0295] In certain embodiments, the anti-CD371 antibodies of the present disclosure are full-length human antibodies, e.g., any of B10, C3, D6, A11, E4, and E8. Full-length human mAbs, when administered to humans, can elicit severe side effects, including anaphylaxis and hypersensitivity reactions.

[0296] The use of phage display libraries has made it possible to select large numbers of antibody libraries for unique and rare Abs against very well-defined epitopes (see McCafferty et al., Phage antibodies: filamentous phage displaying antibody variable domains. Nature, 348:552-554 for more details on phage display). Thus, it has become possible to rapidly identify human Fab or single-chain Fv (scFv) fragments with high specificity for tumor antigen-derived peptide-MHC complex molecules. Furthermore, by using Fab fragments to design full-length monoclonal antibodies (mAbs), it is possible to directly generate therapeutic human Abs, bypassing the months-long work typically required to develop a therapeutic mAb. The presently disclosed subject matter relates to the development of full-length human mAbs that recognize human CD371 polypeptides (e.g., polypeptides having the amino acid sequence set forth in SEQ ID NO: 23), e.g., for use in cancer therapy, such as for use in treating AML.

[0297] 5.3.3. Homologous antibodies

[0298] In certain embodiments, the antibodies or antigen-binding fragments thereof of the present disclosure include heavy and light chain variable regions comprising an amino acid sequence that is homologous or identical to the amino acid sequence of an antibody described herein (e.g., the B10, C3, D6, A11, E4, and E8 antibodies), and wherein the antibody or antigen-binding fragment thereof retains the desired functional properties of the anti-CD371 antibodies or antigen-binding fragments thereof of the present subject matter.

[0299] For example, the present subject matter provides an antibody or antigen-binding fragment or portion thereof comprising a heavy chain variable region and a light chain variable region, wherein:

[0300] (a) the heavy chain variable region comprises an amino acid sequence that is at least about 80%, about 81%, about 82%, about 83%, about 84%, about 85%, about 86%, about 87%, about 88%, about 89%, about 90%, about 91%, about 92%, about 93%, about 94%, about 95%, about 96%, about 97%, about 98%, or about 99% homologous or identical to the amino acid sequence set forth in SEQ ID NO: 1, SEQ ID NO: 3, SEQ ID NO: 5, SEQ ID NO: 7, SEQ ID NO: 9, or SEQ ID NO: 11;

[0301] (b) the light chain variable region comprises an amino acid sequence that is at least about 80%, about 81%, about 82%, about 83%, about 84%, about 85%, about 86%, about 87%, about 88%, about 89%, about 90%, about 91%, about 92%, about 93%, about 94%, about 95%, about 96%, about 97%, about 98%, or about 99% homologous or identical to the amino acid sequence set forth in SEQ ID NO: 2, SEQ ID NO: 4, SEQ ID NO: 6, SEQ ID NO: 8, SEQ ID NO: 10, or SEQ ID NO: 12; and

[0302] wherein the antibody or antigen-binding fragment thereof specifically binds to human CD371 with a K -7 M or less. d or a K -8 M or less. d

[0303] In certain embodiments, V H and / or V L ​The amino acid sequences can have at least about 80%, about 81%, about 82%, about 83%, about 84%, about 85%, about 86%, about 87%, about 88%, about 89%, about 90%, about 91%, about 92%, about 93%, about 94%, about 95%, about 96%, about 97%, about 98%, or about 99% homology or identity to the sequences described above. Antibodies having V H and V L regions having high (i.e., 80% or more) homology or identity to the sequences described above can be obtained by mutagenesis (e.g., site-directed or PCR-mediated mutagenesis) followed by testing the encoded altered antibodies for retained function (i.e., binding affinity) using the binding assays described herein. H and V L regions described above.

[0304] As used herein, the percent homology between two amino acid sequences is equivalent to the percent identity between two sequences. The percent homology or identity between two sequences is a function of the number of identical positions shared by the sequences (i.e., % homology = number of identical positions / total number of positions x 100), taking into account the number of gaps, and the length of each gap, which needs to be introduced to achieve the best alignment of two sequences. Comparison of sequences and determination of the percent homology between two sequences can be accomplished using a mathematical algorithm, as described in the non-limiting examples below.

[0305] The percent homology or identity between two amino acid sequences can be determined using the algorithm of E. Meyers and W. Miller (Comput. Appl. Biosci. (1988); 14: 11-17), which has been incorporated into the ALIGN program (version 2.0), using a PAM120 weight residue table, a gap length penalty of 12, and a gap penalty of 4. Additionally, the percent homology between two amino acid sequences can be determined using the algorithm of Needleman and Wunsch (J Mol Biol. (1970) 48:444-453), which has been incorporated into the GAP program in the GCG software package (available at www.gcg.com), using either a Blossum 62 matrix or a PAM250 matrix, and a gap weight of 16, 14, 12, 10, 8, 6, or 4 and a length weight of 1, 2, 3, 4, 5, or 6.

[0306] Additionally or alternatively, the amino acid sequences of the presently disclosed subject matter can also be used as a "query sequence" to perform a search against a database of, for example, sequences of interest using, for example, the XBLAST program (version 2.0) of Altschul, et al. J Mol Biol (1990); 215:403-10. Such searches can be performed using the XBLAST program with the appropriate settings, e.g., score = 50, wordlength = 3 to achieve optimal alignment. Gapped BLAST can be used as described in Altschul et al. Nucleic Acids Res (1997); 25(17):3389-3402 when gapped alignments are desired. When using BLAST and Gapped BLAST programs, the default parameters of the respective programs (e.g., XBLAST and NBLAST) can be used.

[0307] 5.3.4. Antibodies with conservative modifications

[0308] In certain embodiments, the antibodies or antigen-binding fragments thereof of the present disclosure include a heavy chain variable region including CDR1, CDR2, and CDR3 sequences and a light chain variable region including CDR1, CDR2, and CDR3 sequences, wherein one or more of these CDR sequences includes a particular amino acid sequence based on a preferred antibody described herein (e.g., B10, C3, D6, A11, E4, and E8 antibodies) or conservative modifications thereof, and wherein the antibody retains a desired functional property of an anti-CD371 antibody or antigen-binding fragment thereof of the presently disclosed subject matter. The presently disclosed subject matter provides antibodies or antigen-binding fragments or portions thereof including a heavy chain variable region including CDR1, CDR2, and CDR3 sequences, wherein:

[0309] (a) the heavy chain variable region CDR3 sequence includes an amino acid sequence selected from the group consisting of SEQ ID NOs: 30, 36, 42, 48, 54, and 60, and conservative modifications thereof;

[0310] (b) the light chain variable region CDR3 sequence includes an amino acid sequence selected from the group consisting of SEQ ID NOs: 33, 39, 45, 51, 57, and 63, and conservative modifications thereof; and

[0311] wherein the antibody or antigen-binding fragment thereof binds to human CD371 with a K -7 M or lower. d or 1 x 10 -8 M or lower. d M or lower.

[0312] In certain embodiments, the heavy chain variable region CDR3 sequence comprises an amino acid sequence selected from the group consisting of SEQ ID NOs: 30, 36, 42, 48, 54, and 60, and conservatively modified amino acid sequences thereof; and the light chain variable region CDR3 sequence comprises an amino acid sequence selected from the group consisting of SEQ ID NOs: 33, 39, 45, 51, 57, and 63, and conservatively modified amino acid sequences thereof.

[0313] In certain embodiments, the heavy chain variable region CDR2 sequence comprises an amino acid sequence selected from the group consisting of SEQ ID NOs: 29, 35, 41, 47, 53, and 59, and conservatively modified amino acid sequences thereof; and the light chain variable region CDR2 sequence comprises an amino acid sequence selected from the group consisting of SEQ ID NOs: 32, 38, 44, 50, 56, and 62, and conservatively modified amino acid sequences thereof.

[0314] In certain embodiments, the heavy chain variable region CDR1 sequence comprises an amino acid sequence selected from the group consisting of SEQ ID NOs: 28, 34, 40, 46, 52, and 58, and conservatively modified amino acid sequences thereof; and the light chain variable region CDR1 sequence comprises an amino acid sequence selected from the group consisting of SEQ ID NOs: 31, 37, 43, 49, 55, and 61, and conservatively modified amino acid sequences thereof.

[0315] As used herein, the term "conservative sequence modifications" is intended to refer to amino acid modifications that do not significantly affect or alter the binding characteristics of the antibody comprising the amino acid sequence. Such conservative modifications include amino acid substitutions, additions and deletions. Modifications can be introduced into an antibody of the application by standard techniques known in the art, such as site-directed mutagenesis and PCR-mediated mutagenesis.

[0316] Conservative amino acid substitutions are those in which the amino acid residue is replaced with an amino acid residue having a similar side chain. Families of amino acid residues having similar side chains have been defined in the art. Exemplary conservative amino acid substitutions are shown in Table 7. Amino acid substitutions can be introduced into an antibody of interest and the products screened for a desired activity, such as retained / improved antigen binding, decreased immunogenicity, or improved ADCC or CDC. In certain embodiments, the sequences disclosed herein, such as the CDR sequences, V H sequences, or V L sequences, can have up to about 1, up to about 2, up to about 3, up to about 4, up to about 5, up to about 6, up to about 7, up to about 8, up to about 9, up to about 10 amino acid residues modified and / or replaced.

[0317] Table 7

[0318] Original residue Exemplary conservative amino acid substitutions Ala (A) Val; Leu; lie Arg (R) Lys; Gin; Asn Asn (N) Gin; His; Asp, Lys; Arg Asp (D) Glu; Asn Cys (C) Ser; Ala Gin (Q) Asn; Glu Glu (E) Asp; Gin Gly (G) Ala His (H) Asn; Gin; Lys; Arg lie (I) Leu; Val; Met; Ala; Phe Leu (L) lie; Val; Met; Ala; Phe Lys (K) Arg; Gin; Asn Met (M) Leu; Phe; lie Phe (F) Trp; Leu; Val; lie; Ala; Tyr Pro (P) Ala Ser (S) Thr Thr (T) Val; Ser Trp (W) Tyr; Phe Tyr (Y) Trp; Phe; Thr; Ser Val (V) lie; Leu; Met; Phe; Ala

[0319] Amino acids can be categorized according to common side-chain properties:

[0320] • Hydrophobic: Norleucine, Met, Ala, Val, Leu, He;

[0321] • Neutral Hydrophilic: Cys, Ser, Thr, Asn, Gin;

[0322] • Acidic: Asp, Glu;

[0323] • Basic: His, Lys, Arg;

[0324] • Chain-Interrupting: Gly, Pro;

[0325] • Aromatic: Trp, Tyr, Phe.

[0326] Non-conservative substitutions will require replacement of a member of one of these classes with a member from another class.

[0327] 5.3.5. Anti-CD371 antibodies that cross-compete for binding to CD371 with an anti-CD371 antibody of the application

[0328] The presently disclosed subject matter provides antibodies or antigen-binding fragments thereof that cross-compete for binding to CD371 (e.g., human CD371) with any of the disclosed anti-CD371 antibodies. For example, but not by way of limitation, a cross- competing antibody can bind to the same epitope region, e.g., the same epitope, an adjacent epitope, or an overlap, as any of the anti-CD371 antibodies of the presently disclosed subject matter or antigen-binding fragments thereof. In certain embodiments, the reference antibody or reference antigen-binding fragment thereof for use in cross-competition studies can be any one of the anti-CD371 antibodies or antigen-binding fragments thereof disclosed herein, e.g., the B10, C3, D6, A11, E4, and E8 antibodies.

[0329] Such cross-competing antibodies can be identified based on their ability to cross- compete with any one of the anti-CD371 antibodies of the present disclosure or antigen-binding fragments thereof in a standard CD371 binding assay. For example, Biacore analysis, ELISA assays, or flow cytometry can be used to demonstrate cross-competition with the antibodies of the presently disclosed subject matter. The ability of a test antibody to inhibit the binding of, for example, any one of the anti-CD371 antibodies disclosed herein (e.g., the B10, C3, D6, A11, E4, and E8 antibodies) to CD371 (e.g., human CD371) demonstrates that the test antibody can compete with any one of the anti-CD371 antibodies of the present disclosure or antigen-binding fragments thereof for binding to the same epitope region on CD371 (e.g., human CD371) and thus bind to the same epitope region on CD371 (e.g., human CD371) as any one of the anti-CD371 antibodies of the present disclosure or antigen-binding fragments thereof. In certain embodiments, the cross- competing antibody or antigen-binding fragment thereof binds to the same epitope on CD371 (e.g., human CD371) as any one of the anti-CD371 antibodies of the present disclosure or antigen-binding fragments thereof.

[0330] 5.3.6. Characterization of antibodies that bind antigen

[0331] The antibodies or antigen-binding fragments thereof of the present disclosure can be tested for binding to CD371, for example, by standard ELISA. To determine whether the selected anti-CD371 antibodies bind to a unique epitope, each antibody can be biotinylated using commercially available reagents (Pierce, Rockford, IL). Competition studies using unlabeled monoclonal antibodies and biotinylated monoclonal antibodies can be performed using CD371-coated ELISA plates as described above. Binding of the biotinylated mAb can be detected using a streptavidin-alkaline phosphatase probe.

[0332] To determine the isotype of the purified antibodies, an isotype ELISA can be performed using reagents specific for antibodies of a particular isotype. Anti-CD371 human IgG can be further tested for reactivity with the CD371 antigen by Western blot.

[0333] In certain embodiments, K is measured by radiolabeled antigen binding assay (RIA). d In certain embodiments, RIA is performed using Fab versions of the target antibody and its antigen. For example, by using minimal concentrations of ( 125 The solution binding affinity of the Fab for the antigen is measured by equilibrating the Fab with I) labeled antigen and then capturing the bound antigen using an anti-Fab antibody-coated plate (see, e.g., Chen et al., J Mol Biol (1999); 293:865-881).

[0334] In certain embodiments, using Surface plasmon resonance assay to measure K d For example, using -2000 or The assay was performed using the BIAcore-3000 (BIAcore, Inc., Piscataway, NJ).

[0335] 5.3.7. Immunoconjugates

[0336] The presently disclosed subject matter provides anti-CD371 antibodies or antigen-binding fragments thereof conjugated to a therapeutic moiety such as a cytotoxin, a drug (e.g., an immunosuppressant), or a radioisotope. Such conjugates are referred to herein as “immunoconjugates.” Immunoconjugates comprising one or more cytotoxins are referred to as “immunotoxins.” A cytotoxin or cytotoxic agent includes any agent that is detrimental to cells (e.g., kills cells). Non-limiting examples of cytotoxins include paclitaxel (e.g., ricin, diphtheria, white toxin), cytochalasin B, gramicidin D, ethidium bromide, emetine, mitomycin, etoposide, tenoposide, vincristine, vinblastine, colchicin, doxorubicin, daunorubicin, dihydroxy anthracin dione, mitoxantrone, mithramycin, actinomycin D, 1-dehydrotestosterone, glucocorticoids, procaine, tetracaine, lidocaine, propranolol, and puromycin and analogs or homologs thereof. Therapeutic agents also include, for example, calecheamicins, aureastatins, antimetabolites (e.g., methotrexate, 6-mercaptopurine, 6-thioguanine, cytarabine, 5-fluorouracil decarbazine), alkylating agents (e.g., mechlorethamine, thioepa chlorambucil, melphalan, carmustine (BSNU) and lomustine (CCNU), cyclophosphamide, busulfan, dibromomannitol, streptozotocin, mitomycin C, and cis-dichlorodiamine platinum (II) (DDP) cisplatin), anthracyclines (e.g., daunorubicin (formerly daunomycin) and doxorubicin), antibiotics (e.g., dactinomycin (formerly actinomycin) and bleomycin, mithramycin, and anthramycin (AMC)), demethylating agents (azacitidine and decitabine), and antimitotic agents (e.g., vincristine and vinblastine).

[0337] Other examples of therapeutic cytotoxins that can be conjugated to the anti-CD371 antibodies disclosed herein include duocarmycins, calicheamicins, maytansines, and auristatins, and derivatives thereof. The cytotoxins can be conjugated to the anti-CD371 antibodies or antigen-binding fragments thereof disclosed herein using linker technology available in the art. Examples of linker types that have been used to conjugate cytotoxins to antibodies include, but are not limited to, hydrazones, thioethers, esters, disulfides, and peptide-containing linkers. Linkers susceptible to cleavage within the low pH of the lysosomal compartment or susceptible to cleavage by proteases, such as proteases preferentially expressed in tumor tissue, e.g., cathepsins (e.g., cathepsins B, C, D), can be selected. For further discussion of the types of cytotoxins, linkers, and methods for conjugating therapeutic agents to antibodies, see also Saito, G. et al. (2003) Adv. Drug Deliv. Rev. 55:199-215; Trail, P.A. et al. (2003) Cancer Immunol Immunother. 52:328-337; Payne, G. (2003) Cancer Cell 3:207-212; Allen, T.M. (2002) Nat. Rev. Cancer 2:750-763; Pastan, I. and Kreitman, R.J. (2002) Curr. Opin. Investig. Drugs 3:1089-1091; Senter, P.D. and Springer, C.J. (2001) Adv. Drug Deliv. Rev. 53:247-264.

[0338] The anti-CD371 antibodies or antigen-binding fragments thereof of the presently disclosed subject matter can also be conjugated to a radioisotope to produce a cytotoxic radiopharmaceutical, also known as a radioimmunoconjugate. Non-limiting examples of radioisotopes that can be conjugated to antibodies for use in diagnosis or therapy include 90 Y, 131 1, 225 Ac, 213 Bi, 223 Ra, and 227 Th. Methods for preparing radioimmunoconjugates are established in the art. Examples of radioimmunoconjugates are commercially available, including Zevalin TM (IDEC Pharmaceuticals) and Bexxar TM (Corixa Pharmaceuticals), and similar methods can be used to prepare radioimmunoconjugates using the antibodies of the present application.

[0339] Antibody conjugates of the presently disclosed subject matter can be used to modify a given biological response, and the drug moiety should not be construed as limited to classical chemical therapeutic agents. For example, the drug moiety can be a protein or polypeptide possessing a desired biological activity. Such proteins can include, for example, an enzymatically active toxin, or active fragment thereof, such as abrin, ricin A, pseudomonas exotoxin, or diphtheria toxin; a protein such as tumor necrosis factor (TNF) or interferon-γ; or, biological response modifiers such as, for example, lymphokins, interleukin-1 (IL-1), interleukin-2 (IL-2), interleukin-6 (IL-6), granulocyte macrophage colony stimulating factor (GM-CSF), granulocyte colony stimulating factor (G-CSF), or other growth factors.

[0340] Techniques for conjugating such therapeutic moiety to antibodies are well known, see, e.g., Arnon et al., "Monoclonal Antibodies For Immunotargeting Of Drugs In Cancer Therapy", in Monoclonal Antibodies And Cancer Therapy, Reisfeld et al. (eds.), pp. 243-56 (Alan R. Liss, Inc. 1985); Hellstrom et al., "Antibodies For Drug Delivery", in Controlled Drug Delivery (2nd Ed.), Robinson et al. (eds.), pp. 623-53 (Marcel Dekker, Inc. 1987); Thorpe, "Antibody Carriers Of Cytotoxic Agents In Cancer Therapy: A Review", in Monoclonal Antibodies '84: Biological And Clinical Applications, Pinchera et al. (eds.), pp. 475-506 (1985); "Analysis, Results, And Future Prospective Of The Therapeutic Use Of Radiolabeled Antibody In Cancer Therapy", in Monoclonal Antibodies For Cancer Detection And Therapy, Baldwin et al. (eds.), pp. 303-16 (Academic Press 1985), and Thorpe et al., "The Preparation And Cytotoxic Properties Of Antibody-Toxin Conjugates", Immunol. Rev. 62: 119-58 (1982).

[0341] 5.3.8. Bispecific molecules

[0342] The presently disclosed subject matter provides bispecific molecules comprising an anti-CD371 antibody or fragment thereof disclosed herein. The presently disclosed antibodies or antigen-binding fragments thereof can be derivatized or linked to another functional molecule, such as another peptide or protein (e.g., another antibody or a ligand for a receptor) to produce a bispecific molecule that binds to at least two different binding sites or target molecules. The presently disclosed antibodies or antigen-binding fragments thereof can in fact be derivatized or linked to more than one other functional molecule to produce a multispecific molecule that binds to more than two different binding sites and / or target molecules; such multispecific molecules are also intended to be encompassed by the term "bispecific molecule" as used herein. To generate bispecific molecules, the presently disclosed anti-CD371 antibodies or antigen-binding fragments thereof can be functionally linked (e.g., by chemical coupling, genetic fusion, noncovalent linkage, or other means) to one or more other binding molecules, such as another antibody, antibody fragment, polypeptide, or binding mimic, e.g., a bispecific molecule.

[0343] The presently disclosed subject matter provides bispecific molecules comprising at least a first binding specificity for CD371 and a second binding specificity for a second target epitope. The second target epitope can be a CD371 epitope or a non-CD371 epitope, such as a different antigen. In certain embodiments, the bispecific molecule is multispecific, which molecule can further comprise a third binding specificity. For example, when the first portion of the bispecific antibody binds to an antigen on a tumor cell and the second portion of the bispecific antibody recognizes an antigen on the surface of a human immune effector cell, the antibody is able to recruit the activity of the effector cell by specifically binding to an effector antigen on the human immune effector cell. Thus, in certain embodiments, the bispecific antibody is able to form a link between an effector cell (e.g., a T cell) and a tumor cell, thereby enhancing effector function. In certain embodiments, the bispecific antibody of the present disclosure comprises at least a first binding to CD371 and at least a second binding to an immune cell.

[0344] Bispecific molecules of the presently disclosed subject matter can be prepared by coupling the binding specificities together using methods known in the art. For example, each binding specificity of the bispecific molecule can be produced separately and then coupled to one another. When the binding specificities are proteins or peptides, a variety of coupling techniques are available. For example, the binding specificities can be chemically coupled via a disulfide bond, valency bond, or other similar linkage. Alternatively, the binding specificities can be recombinantly coupled by fusing the binding specificities together, using methods well known in the art. When the binding specificities are antibodies, they can be coupled through the sulfhydryl groups formed by cleavage of the disulfide bridges of the antibodies. In certain embodiments, the hinge regions of the two heavy chains are modified to include an odd number of sulfhydryl residues, preferably one. Alternatively, the two binding specificities can be encoded in the same vector and expressed and assembled in the same host cell. This approach is particularly useful when the bispecific molecule is a mAb x mAb, mAb x Fab, Fab x F(ab')2, or ligand x Fab fusion protein.

[0345] When the binding specificities are antibodies, they can be coupled through the sulfhydryl groups formed by cleavage of the disulfide bridges of the antibodies. In certain embodiments, the hinge regions of the two heavy chains are modified to include an odd number of sulfhydryl residues, preferably one.

[0346] Alternatively, the two binding specificities can be encoded in the same vector and expressed and assembled in the same host cell. This approach is particularly useful when the bispecific molecule is a mAb x mAb, mAb x Fab, Fab x F(ab')2, or ligand x Fab fusion protein.

[0347] Binding of the bispecific molecule to its specific target can be confirmed by, for example, enzyme-linked immunosorbent assay (ELISA), radioimmunoassay (RIA), FACS analysis, bioassay (e.g., growth inhibition), or Western blot assay. Each of these assays generally detects the presence of a protein-antibody complex of particular interest by using a labeled reagent (e.g., an antibody) specific for the complex of interest. Alternatively, any of a variety of other immunoassays can be used to detect the complex. For example, the antibody can be radiolabeled and used in a radioimmunoassay (RIA) (see, e.g., Weintraub, B., Principles of Radioimmunoassays, Seventh Training Course ON Radioligand Assay Techniques, The Endocrine Society, March, 1986, which is incorporated herein by reference). The radioisotope can be detected by use of a gamma counter or a scintillation counter or autoradiography, among other methods.

[0348] 5.3.9. Selection of high affinity ScFv against CD371 polypeptides

[0349] The next step is to screen a phage display library (e.g., a human phage display library) that either does not bind or binds with lower binding affinity to phage that bind to the target antigen of interest (e.g., CD371) with high binding affinity. This can be accomplished by repeated binding of phage to antigen (bound to a solid support such as a bead or a mammalian cell), followed by removal of unbound phage and elution of specifically bound phage. In certain embodiments, the antigen (e.g., CD371) is immobilized on a surface (e.g., a polystyrene surface). The phage library is incubated with the cells, beads, or other solid support and unbound phage is removed by washing. Bound clones are selected and tested.

[0350] Once selected, positive scFv clones are tested for binding to CD371 (e.g., human CD371) on the cell surface by flow cytometry. Briefly, phage clones are incubated with HEK293H cells overexpressing CD371. Cells are washed and then incubated with M13 coat protein mAb. Cells are washed again and labeled with PE-labeled anti-mouse Fab2 prior to flow cytometry.

[0351] In other embodiments, the anti-CD371 antibodies can include one or more framework region amino acid substitutions designed to improve protein stability, antibody binding, expression levels, or to introduce sites for conjugation of therapeutic agents. These scFvs are then used to produce recombinant human monoclonal Igs according to methods known to those of skill in the art.

[0352] 5.3.10. Design of full length mAbs using selected ScFv fragments

[0353] Phage display technology allows rapid selection and production of antigen-specific scFv and Fab fragments, which are useful in their own right, or can be further developed to provide whole antibodies, antigen binding proteins or antigen binding fragments thereof. Full mAbs with Fc domains have a number of advantages over scFv and Fab antibodies. First, only full length Abs exert immune functions mediated through the Fc domain, such as CDC and ADCC. Second, bivalent mAbs provide stronger antigen binding affinity than monomeric Fab Abs. Third, the plasma half-life and kidney clearance of Fab and bivalent mAbs will differ. The specific characteristics and advantages of each can be matched to the planned effector strategy. Fourth, bivalent mAbs can internalize at different rates than scFv and Fab, altering immune function or carrier function. For example, alpha emitters do not require internalization to kill targets, but many drugs and toxins would benefit from internalization of the immune complex. Thus, in certain embodiments, once scFv clones specific for CD371 are obtained from a phage display library, full length IgG mAbs using the scFv fragments are generated.

[0354] To produce recombinant human monoclonal IgG in Chinese hamster ovary (CHO) cells, full-length IgG mAbs can be designed based on methods known to those skilled in the art (Tomomatsu et al., Production of human monoclonal antibody against FceRIa by a method combining in vitro immunization with phage display. Biosci Biotechnol Biochem 73(7): 1465-1469 2009). Briefly, antibody variable regions with matching Lambda or Kappa light chain constant sequences and IgG1 Fc subclass can be subcloned into mammalian expression vectors, (e.g.) (Lidija P et al., An integrated vector system for the eukaryotic expression of antibodies or their fragments after selection from phage display libraries. Gene 1997; 187(1): 9-18; Lisa JH, et al., Crystallographic structure of an intact IgG1 monoclonal antibody. Journal of Molecular Biology 1998; 275(5): 861-872). Kinetic binding analysis (Yasmina NA et al., Probing the binding mechanism and affinity of tanezumab, a recombinant humanized anti-NGF monoclonal antibody, using a repertoire of biosensors, Protein Science 2008; 17(8): 1326-1335) can be used to confirm full-length IgG with Kd in the nanomolar range. The IgG1 Fc constant region can be modified to increase the half-life of the antibody in vivo. For example, the Fc constant region can be modified to increase the binding affinity of the antibody for the neonatal Fc receptor (FcRn), which mediates recycling of the antibody back to the circulation (Hinton et al., Antibodies with different C-terminal residues demonstrate altered interactions with the neonatal Fc receptor. J. Immunol. 2004; 172: 2027-2034; Hinton et al., Glycoengineered antibodies with prolonged half-lives in serum. Protein Engineering Design & Selection 2006; 19: 375- 382; Dübel et al., Engineering antibody Fc variants with improved pharmacokinetic properties. Methods 2011; 54: 271- 278; Dübel et al., Engineering antibody Fc variants with improved pharmacokinetic properties. Methods 2011; 54: 271- 278). The Fc constant region can also be modified to increase the binding affinity of the antibody for the Fc gamma receptors (FcRs), which mediate antibody-dependent cellular cytotoxicity (ADCC) and other immune effector functions (Hinton et al., Glycoengineered antibodies with prolonged half-lives in serum. Protein Engineering Design & Selection 2006; 19: 375-382; Dübel et al., Engineering antibody Fc variants with improved pharmacokinetic properties. Methods 2011; 54: 271-278; Dübel et al., Engineering antibody Fc variants with improved pharmacokinetic properties. Methods 2011; 54: 271-278). d Specific binding to CD371.

[0355] 5.4. Nucleic acids encoding antibodies or antigen binding fragments

[0356] The present disclosure provides nucleic acids encoding the anti-CD371 antibodies or antigen-binding fragments thereof disclosed herein. In certain embodiments, the nucleic acid comprises or consists of the nucleotide sequence set forth in SEQ ID NO: 22, SEQ ID NO: 23, SEQ ID NO: 24, SEQ ID NO: 25, SEQ ID NO: 26, or SEQ ID NO: 27.

[0357] Also provided are vectors comprising the nucleic acids disclosed herein. In certain embodiments, the vector is an expression vector. The disclosed subject matter further provides host cells comprising the expression vectors disclosed herein.

[0358] 5.5. Pharmaceutical compositions and methods of treatment

[0359] The present disclosure provides compositions comprising the anti-CD371 antibodies or antigen-binding fragments thereof, the immunoconjugates, and the bispecific antibodies of the present disclosure. In certain embodiments, the composition is a pharmaceutical composition further comprising a pharmaceutically acceptable carrier.

[0360] The present disclosure provides various methods of using the anti-CD371 antibodies, or antigen-binding fragments thereof, immunoconjugates, bispecific antibodies, and compositions disclosed herein. For example, the present disclosure provides methods of reducing tumor burden in a subject. In certain embodiments, the methods comprise administering to a subject one or more anti-CD371 antibodies, or antigen-binding fragments thereof, immunoconjugates, bispecific antibodies, or compositions disclosed herein. The anti-CD371 antibodies, or antigen-binding fragments thereof, disclosed herein can reduce the number of tumor cells in a subject, reduce the size of a tumor in a subject, and / or eradicate a tumor in a subject.

[0361] The disclosed subject matter also provides methods for increasing or prolonging the survival of a subject suffering from a tumor or neoplasia. In certain embodiments, the methods comprise administering to the subject one or more anti-CD371 antibodies, or antigen-binding fragments thereof, immunoconjugates, bispecific antibodies, or compositions disclosed herein. The methods can reduce or eradicate the tumor burden in the subject.

[0362] The presently disclosed subject matter further provides methods for treating and / or preventing a tumor or neoplasia in a subject. In certain embodiments, the methods comprise administering to the subject one or more anti-CD371 antibodies, or antigen-binding fragments thereof, immunoconjugates, bispecific antibodies, or compositions disclosed herein.

[0363] Such methods include administering an anti-CD371 antibody of the disclosure, or antigen-binding fragment thereof, a composition of the disclosure (e.g., a pharmaceutical composition) in an effective amount to achieve the desired effect, whether alleviating an existing condition or preventing recurrence. For therapy, the amount administered is an effective amount to produce the desired effect. An effective amount can be provided in one or a series of administrations. An effective amount can be provided in the form of a bolus or continuous infusion.

[0364] Non-limiting examples of neoplasia or tumors include acute myeloid leukemia (AML), multiple myeloma, chronic lymphocytic leukemia (CLL), lymphoma (Hodgkin's lymphoma, non-Hodgkin's lymphoma), glioblastoma, myelodysplastic syndrome (MDS), and chronic myelogenous leukemia (CML), bone cancer, intestinal cancer, liver cancer, skin cancer, head and neck cancer, melanoma (cutaneous or intraocular malignant melanoma), kidney cancer (e.g., clear cell carcinoma), laryngeal cancer, prostate cancer (e.g., hormone-refractory prostate adenocarcinoma), blood cancer (e.g., leukemia, lymphoma, and myeloma), uterine cancer, rectal cancer, cancer of the anal region, bladder cancer, brain cancer, stomach cancer, testicular cancer, carcinoma of the fallopian tubes, carcinoma of the endometrium, carcinoma of the cervix, carcinoma of the vagina, carcinoma of the vulva, leukemia (e.g., acute leukemia, acute lymphocytic leukemia, acute myelocytic leukemia, acute myelogenic leukemia, acute promyelocytic leukemia, acute monocytic leukemia, acute erythroleukemia, chronic leukemia, chronic myelocytic leukemia, polycythemia vera, small cell lung cancer, endocrine system cancer, thyroid gland cancer, parathyroid gland cancer, adrenal gland cancer, soft tissue sarcoma, urethral cancer, penile cancer, childhood solid tumors, lymphocytic lymphoma, bladder cancer, kidney or ureter cancer, renal pelvis cancer, central nervous system (CNS) neoplasms, primary CNS lymphoma, tumor angiogenesis, spinal axis tumors, brain stem glioma, pituitary adenoma, Kaposi's sarcoma, epidermoid cancer, squamous cell cancer, T-cell lymphoma, environmentally induced cancers including those induced by asbestos (including Waldenstrom's macroglobulinemia), heavy chain disease, and solid tumors such as sarcomas and carcinomas (e.g., fibrosarcoma, myxosarcoma, liposarcoma, chondrosarcoma, osteogenic sarcoma, chordoma, angiosarcoma, endotheliosarcoma, lymphangiosarcoma, lymphangioendotheliosarcoma, synovioma, mesothelioma, Ewing's tumor, leiomyosarcoma, rhabdomyosarcoma, squamous cell carcinoma, basal cell carcinoma, adenocarcinoma, sweat gland carcinoma, sebaceous gland carcinoma, papillary carcinoma, papillary adenocarcinoma, cystadenocarcinoma, medullary carcinoma, bronchogenic carcinoma, hepatoma, nepheloma, choriocarcinoma, seminoma, embryonal carcinoma, Wilms' tumor, cervical cancer, salivary gland carcinoma, uterine cancer, testicular cancer, bladder carcinoma, epithelial carcinoma, glioma, astrocytoma, medulloblastoma, craniopharyngioma, ependymoma, pinealoma, hemangioblastoma, acoustic neuroma, oligodendroglioma, schwannoma, meningioma, melanoma, neuroblastoma, and retinoblastoma.

[0365] Non-limiting examples of suitable tumors or neoplasms include acute myeloid leukemia (AML), multiple myeloma, non-Hodgkin’s lymphoma, Hodgkin’s lymphoma, chronic lymphocytic leukemia (CLL), glioblastoma, myelodysplastic syndrome (MDS), and chronic myelogenous leukemia (CML). In certain embodiments, the tumor or neoplasm is AML.

[0366] The anti-CD371 antibodies of the present disclosure can be administered using any suitable method or route, and optionally, co-administered with an anti-neoplastic agent. Routes of administration include, but are not limited to, oral, intravenous, intraperitoneal, subcutaneous, intramuscular, intranodal, intratumoral, intraosseous, intrathecal, pleural, intrapleural, and direct administration. It should be emphasized, however, that the presently disclosed subject matter is not limited to any particular method or route of administration.

[0367] The anti-CD371 antibodies of the present disclosure, or antigen-binding fragments thereof, can be administered as conjugates that specifically bind to the receptor and deliver a toxic, lethal payload upon internalization of the ligand-toxin.

[0368] The anti-CD371 antibodies of the present disclosure, or antigen-binding fragments thereof, can be administered in the form of a composition that additionally includes a pharmaceutically acceptable carrier. Suitable pharmaceutically acceptable carriers include, for example, one or more of water, saline, phosphate buffered saline, dextrose, glycerol, ethanol and the like, as well as combinations thereof. Pharmaceutically acceptable carriers can further include minor amounts of auxiliary substances such as wetting or emulsifying agents, preservatives or buffers, which enhance the shelf life or effectiveness of the binding proteins. Compositions for injection can be formulated, as is well known in the art, to provide rapid, sustained or delayed release of the active ingredient after administration to a mammal.

[0369] The presently disclosed subject matter also provides for the use of the antibodies and nucleic acids encoding them for treating tumors or neoplasms (e.g., AML), for diagnostic and prognostic applications, and as research tools for detecting CD371 in cells and tissues. The presently disclosed subject matter encompasses pharmaceutical compositions comprising the antibodies and nucleic acids of the present disclosure. The presently disclosed subject matter also encompasses vectors comprising the nucleic acids of the presently disclosed subject matter for antibody-based therapy by vectored immunotherapy. Vectors include expression vectors capable of expressing and secreting antibodies, as well as vectors for cell surface expression of antigen-binding proteins such as chimeric antigen receptors.

[0370] Cells comprising the nucleic acids, e.g., cells that have been transfected with the vectors of the present disclosure, are also encompassed by the presently disclosed subject matter.

[0371] 5.6. Kits

[0372] The presently disclosed subject matter provides kits for treating and / or preventing a tumor or neoplasia (e.g., AML), for reducing tumor burden, and / or for increasing or prolonging survival of a subject having a tumor or neoplasia (e.g., AML). In certain embodiments, the kits include a composition containing an anti-CD371 antibody or antigen-binding fragment thereof, immunoconjugate, bispecific antibody, or composition of the presently disclosed subject matter in unit dosage form. In certain embodiments, the kits include a sterile container that is filled with a therapeutic or prophylactic vaccine; such container can be a box, an ampoule, a bottle, a vial, a tube, a bag, a pouch, a blister pack, or other suitable container form known in the art. Such container can be of plastic, glass, laminated paper, metal foil, or other materials suitable for holding drugs.

[0373] In certain embodiments, the kits further include instructions for administering an anti-CD371 antibody or antigen-binding fragment thereof, immunoconjugate, bispecific antibody, or composition disclosed herein to a subject. The instructions can generally include information regarding the use of the anti-CD371 antibodies or antigen-binding fragments thereof, immunoconjugates, bispecific antibodies, and compositions disclosed herein for treating and / or preventing a tumor or neoplasia (e.g., AML), for reducing tumor burden, and / or for increasing or prolonging survival of a subject having a tumor or neoplasia. In certain embodiments, the instructions include at least one of the following: a description of the therapeutic agent; a dosage regimen and administration for treating and / or preventing a tumor or neoplasia (e.g., AML) or symptoms thereof; precautions; warnings; indications; contraindications; overdose information; adverse reactions; animal pharmacology; clinical studies; and / or references. The instructions can be printed directly on the container (if present), or as a label applied to the container, or as a separate sheet, pamphlet, card, or folder supplied with the container.

[0374] 5.7. Detection methods

[0375] The presently disclosed subject matter provides methods for detecting CD371 in whole cells or tissues. In certain embodiments, the method comprises:

[0376] a) contacting the cells or tissues with an anti-CD371 antibody or antigen-binding fragment disclosed herein, wherein the antibody or antigen-binding fragment thereof comprises a detectable label; and

[0377] b) determining the amount of the labeled antibody or antigen-binding fragment thereof bound to the cells or tissues.

[0378] In certain embodiments, b) comprises measuring the amount of detectable label associated with the cells or tissues, wherein the amount of the antibody or antigen-binding fragment thereof bound is indicative of the amount of CD371 in the cells or tissues.

[0379] The cell or tissue can be any cell or tissue, including any normal, healthy or cancerous cell and tissue.

[0380] 6. Examples

[0381] The following examples are put forth so as to provide those of ordinary skill in the art with a complete disclosure and description of how to make and use the antibodies, bispecific antibodies, compositions including the same, screening and treatment methods of the disclosed subject matter, and are not intended to limit the scope of what the inventors regard as their disclosed subject matter. It is understood that various modifications can be made in the light of the general description provided herein.

[0382] Example 1 - Generation of Anti-CD371 Antibodies and scFv

[0383] A portion of CD371 (UniProt accession number Q5QGZ9) corresponding to the extracellular domain and amino acids His 65-Ala 265 was recombinantly produced as a soluble protein with a polyhistidine tag for purification. The extracellular domain of murine CD371 (Thr 67-Arg 267) was also produced with a polyhistidine tag to screen antibodies for cross-species reactivity.

[0384] A proprietary, natural semi-synthetic scFv phage display library was screened for antibodies that bind to CD371 protein by using standard solid-phase phage display panning techniques. Briefly, recombinant CD371 was immobilized on a polystyrene surface, then blocked with about 5% milk and incubated with the phage library. Subsequent washing, elution, and phage amplification steps were performed to complete each round of biopanning. Three rounds of panning were completed using the amplified CD371 -binding agent-rich phage pool from the previous round of panning as input for the subsequent round. To identify clones with high specificity for CD371, individual clones from the third round of panning were analyzed for binding to human CD371, murine CD371, and BSA (as a non-specific control) by enzyme-linked immunosorbent assay (ELISA) using anti-M13 phage antibody. Only those monoclonal phage supernatants that exhibited specific binding to CD371 were selected for antibody sequencing, thereby identifying six antibodies with unique sequences (B10 (also referred to as "1B10"), C3 (also referred to as "1C3"), D6 (also referred to as "1D6"), A11 (also referred to as "2A11"), E4 (also referred to as "2E4"), and E8 (also referred to as "2E8")). None of the screened antibodies showed binding to human and mouse CD371 homologs.

[0385] To test whether antibodies recovered from phage panning campaigns were able to bind CD371 on the cell surface in their native conformation, monoclonal phage preparations were also screened on HEK293H cells transfected with CD371 and on wild-type HEK293H cells by flow cytometry. Figure 1 Binding profiles of 1B10, 1C3, 1D6, 2A11, 2E4 and 2E8 antibodies are described.

[0386] Example 2: Antibodies binding to CD371 expressing cell lines

[0387] Based on the preliminary in vitro functional characterization, two mAbs (1B10 and 1C3) were reformatted as human IgG1 and tested for binding to OCI cells (CD371 + AML cell line). As shown in Figure 2A and 2B , both mAbs exhibited dose-dependent binding. B10 was further designed in multiple formats, including scFv-Fc fusions with two orientations of variable domains (V H -V L or V L -V H ). These scFv-Fc fusion constructs showed specific binding to CD371 + cells (see Figure 3 ). Similarly, binding of B10 scFv in V L -V H orientation to cells was detected. However, binding of B10 scFv in V H -V L orientation was not observed by flow cytometry, indicating lower affinity and thus the need for bivalent binding.

[0388] Example 3: Antibodies binding to recombinant CD371 in solution

[0389] Affinity measurements of B10 variants were determined by capturing IgG and Fc fusions with anti-Fc antibody and using soluble CD371 as analyte by bio-layer interferometry. For scFv affinity measurements, biotinylated CD371 was captured with streptavidin and soluble scFv was used as analyte. Table 8 shows the dissociation constants (K D ), association rates (k on ) and dissociation rates (k off ) for the different antibody formats. In line with the flow cytometry results, the intact IgG and scFv-Fc fusions bound stronger than the scFv (Table 8), likely due to their bivalent interaction resulting in avidity effects. Binding of B10 scFv in V H -V LWeak binding of IB10 scFv in the direction, but dissociation constant could not be calculated by any curve fitting method.

[0390] Table 8. Binding affinity of various formats of antibody B10 to soluble CD371

[0391]

[0392] Embodiments of the presently disclosed subject matter

[0393] From the foregoing description, it will be apparent that variations and modifications can be effected within the scope of the present disclosed subject matter to adapt it to various usages and conditions. Such embodiments are also within the scope of the following claims.

[0394] The recitation of elements in any definition herein includes any single element or combination of elements. The recitation of embodiments herein includes embodiments as any single embodiment or in combination with any other embodiment or portion thereof.

[0395] All patents and publications mentioned in this specification are herein incorporated by reference to the same extent as if each independent patent and publication was specifically and individually indicated to be incorporated by reference. SEQUENCE LISTING <110> Memorial Sloan-Kettering Cancer Center <120> Anti-CD371 antibodies and uses thereof <130> 072734.1146 <150> US 62 / 900,118 <151> 2019-09-13 <150> US 62 / 936,913 <151> 2019-11-18 <160> 73 <170> PatentIn version 3.5 <210> 1 <211> 122 <212> PRT <213> Artificial Sequence <220> <223> Synthetic polypeptide <400> 1 Glu Val Gin Leu Leu Glu Ser Gly Gly Gly Leu Val Gin Pro Gly Gly 1 5 10 15 Ser Leu Arg Leu Ser Cys Ala Ala Ser Gly Phe Thr Phe Ser Asp Tyr 20 25 30 Gln Met Ser Trp Val Arg Gin Ala Pro Gly Lys Gly Leu Glu Trp Val 35 40 45 Ser Gly He Gin Gly Gly Gly Gly Ser Thr Tyr Tyr Ala Asp Ser Val 50 55 60 Lys Gly Arg Phe Thr He Ser Arg Asp Asn Ser Lys Asn Thr Leu Tyr 65 70 75 80 Leu Gin Met Asn Ser Leu Arg Ala Glu Asp Thr Ala Val Tyr Tyr Cys 85 90 95 Ala Arg Glu Met Trp Arg Gly Asp Tyr Tyr Ser Gly Met Asp Val Trp 100 105 110 Gly Gin Gly Thr Thr Val Thr Val Ser Ser 115 120 <210> 2 <211> 113 <212> PRT <213> Artificial Sequence <220> <223> Synthetic polypeptide <400> 2 Asp He Val Met Thr Gin Ser Pro Asp Ser Leu Ala Val Ser Leu Gly 1 5 10 15 Glu Arg Ala Thr He Asn Cys Lys Ser Ser Gin Ser Val Leu Asp Ser 20 25 30 Tyr Asn Asn Glu Asn Asn Leu Ala Trp Tyr Gln Gln Lys Pro Gly Gln 35 40 45 Pro Pro Lys Leu Leu Ile Tyr Trp Ala Ser Thr Arg Glu Ser Gly Val 50 55 60 Pro Asp Arg Phe Ser Gly Ser Gly Ser Gly Thr Asp Phe Thr Leu Thr 65 70 75 80 Ile Ser Ser Leu Gln Ala Glu Asp Val Ala Val Tyr Tyr Cys Gln Gln 85 90 95 Tyr Thr Ser Glu Pro Ile Thr Phe Gly Gln Gly Thr Lys Val Glu Ile 100 105 110 Lys <210> 3 <211> 125 <212> PRT <213> Artificial Sequence <220> <223> Synthetic polypeptide <400> 3 Glu Val Gln Leu Leu Glu Ser Gly Gly Gly Leu Val Gln Pro Gly Gly 1 5 10 15 Ser Leu Arg Leu Ser Cys Ala Ala Ser Gly Phe Thr Phe Thr Ser Tyr 20 25 30 Ala Met Ser Trp Val Arg Gln Ala Pro Gly Lys Gly Leu Glu Trp Val 35 40 45 Ser Gly lie Asp Gly Ser Gly Gly Gly Thr Asn Tyr Ala Asp Ser Val 50 55 60 Lys Gly Arg Phe Thr lie Ser Arg Asp Asn Ser Lys Asn Thr Leu Tyr 65 70 75 80 Leu Gin Met Asn Ser Leu Arg Ala Glu Asp Thr Ala Val Tyr Tyr Cys 85 90 95 Ala Arg Ala Tyr Tyr Asp lie Leu Thr Gly Tyr Pro Val Asp Gly Met 100 105 110 Asp Val Trp Gly Gin Gly Thr Thr Val Thr Val Ser Ser 115 120 125 <210> 4 <211> 113 <212> PRT <213> Artificial Sequence <220> <223> Synthetic Polypeptide <400> 4 Asp lie Val Met Thr Gin Ser Pro Asp Ser Leu Ala Val Ser Leu Gly 1 5 10 15 Glu Arg Ala Thr lie Asn Cys Lys Ser Ser Gin Ser Val Leu Ser Ser 20 25 30 Tyr Asn Asn Glu Asn Asn Leu Ala Trp Tyr Gin Gin Lys Pro Gly Gin 35 40 45 Pro Pro Lys Leu Leu lie Tyr Ala Ala Ser Thr Arg Glu Ser Gly Val 50 55 60 Pro Asp Arg Phe Ser Gly Ser Gly Ser Gly Thr Asp Phe Thr Leu Thr 65 70 75 80 Ile Ser Ser Leu Gln Ala Glu Asp Val Ala Val Tyr Tyr Cys Gln Gln 85 90 95 Tyr Tyr Ser Glu Pro Tyr Thr Phe Gly Gln Gly Thr Lys Val Glu Ile 100 105 110 Lys <210> 5 <211> 117 <212> PRT <213> Artificial Sequence <220> <223> Synthetic polypeptide <400> 5 Glu Val Gln Leu Leu Glu Ser Gly Gly Gly Leu Val Gln Pro Gly Gly 1 5 10 15 Ser Leu Arg Leu Ser Cys Ala Ala Ser Gly Phe Thr Phe Thr Asp Tyr 20 25 30 Ala Met Ser Trp Val Arg Gln Ala Pro Gly Lys Gly Leu Glu Trp Val 35 40 45 Ser Asp Ile Asp Gly Ser Gly Gly Ser Thr Asp Tyr Ala Asp Ser Val 50 55 60 Lys Gly Arg Phe Thr Ile Ser Arg Asp Asn Ser Lys Asn Thr Leu Tyr 65 70 75 80 Leu Gin Met Asn Ser Leu Arg Ala Glu Asp Thr Ala Val Tyr Tyr Cys 85 90 95 Ala Leu Glu Leu Gly Ala Thr Thr Val Tyr Trp Gly Gln Gly Thr Leu 100 105 110 Val Thr Val Ser Ser 115 <210> 6 <211> 113 <212> PRT <213> Artificial Sequence <220> <223> Synthetic Polypeptide <400> 6 Asp Ile Val Met Thr Gin Ser Pro Asp Ser Leu Ala Val Ser Leu Gly 1 5 10 15 Glu Arg Ala Thr Ile Asn Cys Lys Ser Ser Gin Ser Val Leu Arg Ser 20 25 30 Ser Asn Asn Lys Asn Asn Leu Ala Trp Tyr Gin Gin Lys Pro Gly Gin 35 40 45 Pro Pro Lys Leu Leu Ile Tyr Ala Ala Ser Thr Arg Glu Ser Gly Val 50 55 60 Pro Asp Arg Phe Ser Gly Ser Gly Ser Gly Thr Asp Phe Thr Leu Thr 65 70 75 80 Ile Ser Ser Leu Gin Ala Glu Asp Val Ala Val Tyr Tyr Cys Gin Gin 85 90 95 Tyr Tyr Arg Glu Pro Leu Thr Phe Gly Gin Gly Thr Lys Val Glu He 100 105 110 Lys <210> 7 <211> 120 <212> PRT <213> Artificial Sequence <220> <223> Synthetic polypeptide <400> 7 Glu Val Gin Leu Leu Glu Ser Gly Gly Gly Leu Val Gin Pro Gly Gly 1 5 10 15 Ser Leu Arg Leu Ser Cys Ala Ala Ser Gly Phe Thr Phe Thr Ser Thr 20 25 30 Gln Met Ser Trp Val Arg Gin Ala Pro Gly Lys Gly Leu Glu Trp Val 35 40 45 Ser Glu He Ser Gly Tyr Gly Gly Ser Thr Tyr Tyr Ala Asp Ser Val 50 55 60 Lys Gly Arg Phe Thr He Ser Arg Asp Asn Ser Lys Asn Thr Leu Tyr 65 70 75 80 Leu Gin Met Asn Ser Leu Arg Ala Glu Asp Thr Ala Val Tyr Tyr Cys 85 90 95 Ala Lys Asp Thr Glu Val Ser Gly Asp Ala Phe Asp He Trp Gly Gin 100 105 110 Gly Thr Met Val Thr Val Ser Ser 115 120 <210> 8 <211> 108 <212> PRT <213> Artificial Sequence <220> <223> Synthetic polypeptide <400> 8 Glu Ile Val Leu Thr Gln Ser Pro Gly Thr Leu Ser Leu Ser Pro Gly 1 5 10 15 Glu Arg Ala Thr Leu Ser Cys Arg Ala Ser Gln Ser Val Asp Ser Ser 20 25 30 Asn Leu Ala Trp Tyr Gln Gln Lys Pro Gly Gln Ala Pro Arg Leu Leu 35 40 45 Ile Tyr Gly Ala Ser Ser Arg Ala Thr Gly Ile Pro Asp Arg Phe Ser 50 55 60 Gly Ser Gly Ser Gly Thr Asp Phe Thr Leu Thr Ile Ser Arg Leu Glu 65 70 75 80 Pro Glu Asp Phe Ala Val Tyr Tyr Cys Gln Gln Tyr Arg Ser Trp Pro 85 90 95 Ile Thr Phe Gly Gln Gly Thr Lys Val Glu Ile Lys 100 105 <210> 9 <211> 122 <212> PRT <213> Artificial Sequence <220> <223> Synthetic polypeptide <400> 9 Glu Val Gin Leu Leu Glu Ser Gly Gly Gly Leu Val Gin Pro Gly Gly 1 5 10 15 Ser Leu Arg Leu Ser Cys Ala Ala Ser Gly Phe Thr Phe Thr Ser Tyr 20 25 30 Tyr Met Ser Trp Val Arg Gin Ala Pro Gly Lys Gly Leu Glu Trp Val 35 40 45 Ser Gly lie Ser Gly Ser Gly Asp Ser Thr Ser Tyr Ala Asp Ser Val 50 55 60 Lys Gly Arg Phe Thr lie Ser Arg Asp Asn Ser Lys Asn Thr Leu Tyr 65 70 75 80 Leu Gin Met Asn Ser Leu Arg Ala Glu Asp Thr Ala Val Tyr Tyr Cys 85 90 95 Ala Arg Glu Ala Gly Gly Asp Tyr Asp Ser Gly Ala Phe Asp lie Trp 100 105 110 Gly Gin Gly Thr Met Val Thr Val Ser Ser 115 120 <210> 10 <211> 113 <212> PRT <213> Artificial Sequence <220> <223> Synthetic Polypeptide <400> 10 Asp lie Val Met Thr Gin Ser Pro Asp Ser Leu Ala Val Ser Leu Gly 1 5 10 15 Glu Arg Ala Thr lie Asn Cys Lys Ser Ser Gin Ser Val Leu Tyr Ser 20 25 30 Gly Asn Asn Lys Asn Tyr Leu Ala Trp Tyr Gin Gin Lys Pro Gly Gin 35 40 45 Pro Pro Lys Leu Leu lie Tyr Gly Ala Ser Thr Arg Gin Ser Gly Val 50 55 60 Pro Asp Arg Phe Ser Gly Ser Gly Ser Gly Thr Asp Phe Thr Leu Thr 65 70 75 80 lie Ser Ser Leu Gin Ala Gin Asp Val Ala Val Tyr Tyr Cys Gin Gin 85 90 95 Tyr Asp Tyr Ala Pro Phe Thr Phe Gly Gin Gly Thr Lys Val Gin lie 100 105 110 Lys <210> 11 <211> 127 <212> PRT <213> Artificial Sequence <220> <223> Synthetic polypeptide <400> 11 Glu Val Gin Leu Leu Gin Ser Gly Gly Gly Leu Val Gin Pro Gly Gly 1 5 10 15 Ser Leu Arg Leu Ser Cys Ala Ala Ser Gly Phe Thr Phe Ser Ser Tyr 20 25 30 Ala Met Ser Trp Val Arg Gin Ala Pro Gly Lys Gly Leu Glu Trp Val 35 40 45 Ser Glu He Asp Gly Glu Gly Gly Tyr Thr Asn Tyr Ala Asp Ser Val 50 55 60 Lys Gly Arg Phe Thr He Ser Arg Asp Asn Ser Lys Asn Thr Leu Tyr 65 70 75 80 Leu Gin Met Asn Ser Leu Arg Ala Glu Asp Thr Ala Val Tyr Tyr Cys 85 90 95 Ala Arg Glu Gly Val Asp Tyr Asp He Leu Thr Gly Tyr Tyr Pro Tyr 100 105 110 Gly Met Asp Val Trp Gly Gin Gly Thr Thr Val Thr Val Ser Ser 115 120 125 <210> 12 <211> 114 <212> PRT <213> Artificial Sequence <220> <223> Synthetic polypeptide <400> 12 Asp He Val Met Thr Gin Ser Pro Asp Ser Leu Ala Val Ser Leu Gly 1 5 10 15 Glu Arg Ala Thr He Asn Cys Lys Ser Ser Gin Ser Val Leu Asp Ser 20 25 30 Ser Asn Asn Lys Asn Tyr Leu Ala Trp Tyr Gin Gin Lys Pro Gly Gin 35 40 45 Pro Pro Lys Leu Leu Ile Tyr Asp Ala Ser Thr Arg Glu Ser Gly Val 50 55 60 Pro Asp Arg Phe Ser Gly Ser Gly Ser Gly Thr Asp Phe Thr Leu Thr 65 70 75 80 Ile Ser Ser Leu Gln Ala Glu Asp Val Ala Val Tyr Tyr Cys Gln Gln 85 90 95 Gly Thr Ser Ser Pro Leu Thr Phe Gly Gln Gly Thr Lys Val Glu Ile 100 105 110 Lys Gly <210> 13 <211> 19 <212> PRT <213> Artificial Sequence <220> <223> Synthetic polypeptide <400> 13 Gly Gly Gly Gly Ser Gly Gly Gly Gly Ser Gly Gly Gly Ser Gly Gly 1 5 10 15 Gly Gly Ser <210> 14 <211> 15 <212> PRT <213> Artificial Sequence <220> <223> Synthetic polypeptide <400> 14 Gly Gly Gly Gly Ser Gly Gly Gly Gly Ser Gly Gly Gly Gly Ser 1 5 10 15 <210> 15 <211> 265 <212> PRT <213> Homo sapiens <400> 15 Met Ser Glu Glu Val Thr Tyr Ala Asp Leu Gin Phe Gin Asn Ser Ser 1 5 10 15 Glu Met Glu Lys He Pro Glu He Gly Lys Phe Gly Glu Lys Ala Pro 20 25 30 Pro Ala Pro Ser His Val Trp Arg Pro Ala Ala Leu Phe Leu Thr Leu 35 40 45 Leu Cys Leu Leu Leu Leu He Gly Leu Gly Val Leu Ala Ser Met Phe 50 55 60 His Val Thr Leu Lys He Glu Met Lys Lys Met Asn Lys Leu Gin Asn 65 70 75 80 He Ser Glu Glu Leu Gin Arg Asn He Ser Leu Gin Leu Met Ser Asn 85 90 95 Met Asn He Ser Asn Lys He Arg Asn Leu Ser Thr Thr Leu Gin Thr 100 105 110 He Ala Thr Lys Leu Cys Arg Glu Leu Tyr Ser Lys Glu Gin Glu His 115 120 125 Lys Cys Lys Pro Cys Pro Arg Arg Trp He Trp His Lys Asp Ser Cys 130 135 140 Tyr Phe Leu Ser Asp Asp Val Gin Thr Trp Gin Glu Ser Lys Met Ala 145 150 155 160 Cys Ala Ala Gin Asn Ala Ser Leu Leu Lys Ile Asn Asn Lys Asn Ala 165 170 175 Leu Gin Phe He Gin Ser Gin Ser Gin Ser Gin Ser Gin Ser Gin Ser Gin 180 185 190 Leu Ser Pro Gin Gin Asp Ser Thr Gin Gin Met Gin Val Asp Gin Ile 195 200 205 Ile Asn Ser Ser Ala Trp Val He Gin Asn Ala Pro Gin Leu Asn Asn 210 215 220 Met Tyr Cys Gin Tyr He Gin Arg Leu Tyr Val Gin Tyr Tyr Gin Cys 225 230 235 240 Thr Tyr Gin Gin Gin Met He Cys Gin Gin Met Gin Gin Gin Gin Gin Gin 245 250 255 Leu Gin Ser Thr Tyr He Gin Gin Gin Gin Gin Gin Gin Gin Gin Gin Gin 260 265 <210> 16 <211> 254 <212> PRT <213> Artificial Sequence <220> <223> Synthetic polypeptide <400> 16 Asp He Val Met Thr Gin Ser Pro Gin Ser Leu Ala Val Ser Leu Gin 1 5 10 15 Glu Arg Ala Thr Ile Asn Cys Lys Ser Ser Gin Ser Val Leu Asp Ser 20 25 30 Tyr Asn Asn Glu Asn Asn Leu Ala Trp Tyr Gin Gin Lys Pro Gly Gin 35 40 45 Pro Pro Lys Leu Leu Ile Tyr Trp Ala Ser Thr Arg Glu Ser Gly Val 50 55 60 Pro Asp Arg Phe Ser Gly Ser Gly Ser Gly Thr Asp Phe Thr Leu Thr 65 70 75 80 Ile Ser Ser Leu Gin Ala Glu Asp Val Ala Val Tyr Tyr Cys Gin Gin 85 90 95 Tyr Thr Ser Glu Pro Ile Thr Phe Gly Gin Gly Thr Lys Val Glu Ile 100 105 110 Lys Gly Gly Gly Gly Ser Gly Gly Gly Gly Ser Gly Gly Gly Ser Gly 115 120 125 Gly Gly Gly Ser Glu Val Gin Leu Leu Glu Ser Gly Gly Gly Leu Val 130 135 140 Gln Pro Gly Gly Ser Leu Arg Leu Ser Cys Ala Ala Ser Gly Phe Thr 145 150 155 160 Phe Ser Asp Tyr Gin Met Ser Trp Val Arg Gin Ala Pro Gly Lys Gly 165 170 175 Leu Glu Trp Val Ser Gly lie Gin Gly Gly Gly Gly Ser Thr Tyr Tyr 180 185 190 Ala Asp Ser Val Lys Gly Arg Phe Thr lie Ser Arg Asp Asn Ser Lys 195 200 205 Asn Thr Leu Tyr Leu Gin Met Asn Ser Leu Arg Ala Glu Asp Thr Ala 210 215 220 Val Tyr Tyr Cys Ala Arg Glu Met Trp Arg Gly Asp Tyr Tyr Ser Gly 225 230 235 240 Met Asp Val Trp Gly Gin Gly Thr Thr Val Thr Val Ser Ser 245 250 <210> 17 <211> 257 <212> PRT <213> Artificial Sequence <220> <223> Synthetic polypeptide <400> 17 Asp lie Val Met Thr Gin Ser Pro Asp Ser Leu Ala Val Ser Leu Gly 1 5 10 15 Glu Arg Ala Thr lie Asn Cys Lys Ser Ser Gin Ser Val Leu Ser Ser 20 25 30 Tyr Asn Asn Glu Asn Asn Leu Ala Trp Tyr Gin Gin Lys Pro Gly Gin 35 40 45 Pro Pro Lys Leu Leu lie Tyr Ala Ala Ser Thr Arg Glu Ser Gly Val 50 55 60 Pro Asp Arg Phe Ser Gly Ser Gly Ser Gly Thr Asp Phe Thr Leu Thr 65 70 75 80 lie Ser Ser Leu Gin Ala Glu Asp Val Ala Val Tyr Tyr Cys Gin Gin 85 90 95 Tyr Tyr Ser Glu Pro Tyr Thr Phe Gly Gin Gly Thr Lys Val Glu lie 100 105 110 Lys Gly Gly Gly Gly Ser Gly Gly Gly Gly Ser Gly Gly Gly Ser Gly 115 120 125 Gly Gly Gly Ser Glu Val Gin Leu Leu Glu Ser Gly Gly Gly Leu Val 130 135 140 Gln Pro Gly Gly Ser Leu Arg Leu Ser Cys Ala Ala Ser Gly Phe Thr 145 150 155 160 Phe Thr Ser Tyr Ala Met Ser Trp Val Arg Gin Ala Pro Gly Lys Gly 165 170 175 Leu Glu Trp Val Ser Gly lie Asp Gly Ser Gly Gly Gly Thr Asn Tyr 180 185 190 Ala Asp Ser Val Lys Gly Arg Phe Thr lie Ser Arg Asp Asn Ser Lys 195 200 205 Asn Thr Leu Tyr Leu Gin Met Asn Ser Leu Arg Ala Glu Asp Thr Ala 210 215 220 Val Tyr Tyr Cys Ala Arg Ala Tyr Tyr Asp Ile Leu Thr Gly Tyr Pro 225 230 235 240 Val Asp Gly Met Asp Val Trp Gly Gin Gly Thr Thr Val Thr Val Ser 245 250 255 Ser <210> 18 <211> 249 <212> PRT <213> Artificial Sequence <220> <223> Synthetic polypeptide <400> 18 Asp Ile Val Met Thr Gin Ser Pro Asp Ser Leu Ala Val Ser Leu Gly 1 5 10 15 Glu Arg Ala Thr Ile Asn Cys Lys Ser Ser Gin Ser Val Leu Arg Ser 20 25 30 Ser Asn Asn Lys Asn Asn Leu Ala Trp Tyr Gin Gin Lys Pro Gly Gin 35 40 45 Pro Pro Lys Leu Leu Ile Tyr Ala Ala Ser Thr Arg Glu Ser Gly Val 50 55 60 Pro Asp Arg Phe Ser Gly Ser Gly Ser Gly Thr Asp Phe Thr Leu Thr 65 70 75 80 Ile Ser Ser Leu Gin Ala Glu Asp Val Ala Val Tyr Tyr Cys Gin Gin 85 90 95 Tyr Tyr Arg Glu Pro Leu Thr Phe Gly Gin Gly Thr Lys Val Glu Ile 100 105 110 Lys Gly Gly Gly Gly Ser Gly Gly Gly Gly Ser Gly Gly Gly Ser Gly 115 120 125 Gly Gly Gly Ser Glu Val Gin Leu Leu Glu Ser Gly Gly Gly Leu Val 130 135 140 Gln Pro Gly Gly Ser Leu Arg Leu Ser Cys Ala Ala Ser Gly Phe Thr 145 150 155 160 Phe Thr Asp Tyr Ala Met Ser Trp Val Arg Gin Ala Pro Gly Lys Gly 165 170 175 Leu Glu Trp Val Ser Asp Ile Asp Gly Ser Gly Gly Ser Thr Asp Tyr 180 185 190 Ala Asp Ser Val Lys Gly Arg Phe Thr Ile Ser Arg Asp Asn Ser Lys 195 200 205 Asn Thr Leu Tyr Leu Gin Met Asn Ser Leu Arg Ala Glu Asp Thr Ala 210 215 220 Val Tyr Tyr Cys Ala Leu Glu Leu Gly Ala Thr Thr Val Tyr Trp Gly 225 230 235 240 Gln Gly Thr Leu Val Thr Val Ser Ser 245 <210> 19 <211> 247 <212> PRT <213> 人工序列 <220> <223> 合成的多肽 <400> 19 Glu Ile Val Leu Thr Gln Ser Pro Gly Thr Leu Ser Leu Ser Pro Gly 1 5 10 15 Glu Arg Ala Thr Leu Ser Cys Arg Ala Ser Gln Ser Val Asp Ser Ser 20 25 30 Asn Leu Ala Trp Tyr Gln Gln Lys Pro Gly Gln Ala Pro Arg Leu Leu 35 40 45 Ile Tyr Gly Ala Ser Ser Arg Ala Thr Gly Ile Pro Asp Arg Phe Ser 50 55 60 Gly Ser Gly Ser Gly Thr Asp Phe Thr Leu Thr Ile Ser Arg Leu Glu 65 70 75 80 Pro Glu Asp Phe Ala Val Tyr Tyr Cys Gln Gln Tyr Arg Ser Trp Pro 85 90 95 Ile Thr Phe Gly Gln Gly Thr Lys Val Glu Ile Lys Gly Gly Gly Gly 100 105 110 Ser Gly Gly Gly Gly Ser Gly Gly Gly Ser Gly Gly Gly Gly Ser Glu 115 120 125 Val Gin Leu Leu Glu Ser Gly Gly Gly Leu Val Gin Pro Gly Gly Ser 130 135 140 Leu Arg Leu Ser Cys Ala Ala Ser Gly Phe Thr Phe Thr Ser Thr Gin 145 150 155 160 Met Ser Trp Val Arg Gin Ala Pro Gly Lys Gly Leu Glu Trp Val Ser 165 170 175 Glu He Ser Gly Tyr Gly Gly Ser Thr Tyr Tyr Ala Asp Ser Val Lys 180 185 190 Gly Arg Phe Thr He Ser Arg Asp Asn Ser Lys Asn Thr Leu Tyr Leu 195 200 205 Gln Met Asn Ser Leu Arg Ala Glu Asp Thr Ala Val Tyr Tyr Cys Ala 210 215 220 Lys Asp Thr Glu Val Ser Gly Asp Ala Phe Asp He Trp Gly Gin Gly 225 230 235 240 Thr Met Val Thr Val Ser Ser 245 <210> 20 <211> 254 <212> PRT <213> Artificial Sequence <220> <223> Synthetic Polypeptide <400> 20 Asp He Val Met Thr Gin Ser Pro Asp Ser Leu Ala Val Ser Leu Gly 1 5 10 15 Glu Arg Ala Thr Ile Asn Cys Lys Ser Ser Gln Ser Val Leu Tyr Ser 20 25 30 Gly Asn Asn Lys Asn Tyr Leu Ala Trp Tyr Gln Gln Lys Pro Gly Gln 35 40 45 Pro Pro Lys Leu Leu Ile Tyr Gly Ala Ser Thr Arg Glu Ser Gly Val 50 55 60 Pro Asp Arg Phe Ser Gly Ser Gly Ser Gly Thr Asp Phe Thr Leu Thr 65 70 75 80 Ile Ser Ser Leu Gln Ala Glu Asp Val Ala Val Tyr Tyr Cys Gln Gln 85 90 95 Tyr Asp Tyr Ala Pro Phe Thr Phe Gly Gln Gly Thr Lys Val Glu Ile 100 105 110 Lys Gly Gly Gly Gly Ser Gly Gly Gly Gly Ser Gly Gly Gly Ser Gly 115 120 125 Gly Gly Gly Ser Glu Val Gln Leu Leu Glu Ser Gly Gly Gly Leu Val 130 135 140 Gln Pro Gly Gly Ser Leu Arg Leu Ser Cys Ala Ala Ser Gly Phe Thr 145 150 155 160 Phe Thr Ser Tyr Tyr Met Ser Trp Val Arg Gln Ala Pro Gly Lys Gly 165 170 175 Leu Glu Trp Val Ser Gly lie Ser Gly Ser Gly Asp Ser Thr Ser Tyr 180 185 190 Ala Asp Ser Val Lys Gly Arg Phe Thr lie Ser Arg Asp Asn Ser Lys 195 200 205 Asn Thr Leu Tyr Leu Gin Met Asn Ser Leu Arg Ala Glu Asp Thr Ala 210 215 220 Val Tyr Tyr Cys Ala Arg Glu Ala Gly Gly Asp Tyr Asp Ser Gly Ala 225 230 235 240 Phe Asp lie Trp Gly Gin Gly Thr Met Val Thr Val Ser Ser 245 250 <210> 21 <211> 259 <212> PRT <213> Artificial Sequence <220> <223> Synthetic Polypeptide <400> 21 Asp lie Val Met Thr Gin Ser Pro Asp Ser Leu Ala Val Ser Leu Gly 1 5 10 15 Glu Arg Ala Thr lie Asn Cys Lys Ser Ser Gin Ser Val Leu Asp Ser 20 25 30 Ser Asn Asn Lys Asn Tyr Leu Ala Trp Tyr Gin Gin Lys Pro Gly Gin 35 40 45 Pro Pro Lys Leu Leu lie Tyr Asp Ala Ser Thr Arg Glu Ser Gly Val 50 55 60 Pro Asp Arg Phe Ser Gly Ser Gly Ser Gly Thr Asp Phe Thr Leu Thr 65 70 75 80 lie Ser Ser Leu Gin Ala Glu Asp Val Ala Val Tyr Tyr Cys Gin Gin 85 90 95 Gly Thr Ser Ser Pro Leu Thr Phe Gly Gin Gly Thr Lys Val Glu lie 100 105 110 Lys Gly Gly Gly Gly Ser Gly Gly Gly Gly Ser Gly Gly Gly Ser Gly 115 120 125 Gly Gly Gly Ser Glu Val Gin Leu Leu Glu Ser Gly Gly Gly Leu Val 130 135 140 Gln Pro Gly Gly Ser Leu Arg Leu Ser Cys Ala Ala Ser Gly Phe Thr 145 150 155 160 Phe Ser Ser Tyr Ala Met Ser Trp Val Arg Gin Ala Pro Gly Lys Gly 165 170 175 Leu Glu Trp Val Ser Glu lie Asp Gly Glu Gly Gly Tyr Thr Asn Tyr 180 185 190 Ala Asp Ser Val Lys Gly Arg Phe Thr lie Ser Arg Asp Asn Ser Lys 195 200 205 Asn Thr Leu Tyr Leu Gin Met Asn Ser Leu Arg Ala Glu Asp Thr Ala 210 215 220 Val Tyr Tyr Cys Ala Arg Glu Gly Val Asp Tyr Asp Ile Leu Thr Gly 225 230 235 240 Tyr Tyr Pro Tyr Gly Met Asp Val Trp Gly Gin Gly Thr Thr Val Thr 245 250 255 Val Ser Ser <210> 22 <211> 762 <212> DNA <213> Artificial Sequence <220> <223> Synthetic Polynucleotide <400> 22 gacatcgtga tgacccagtc tccagactcc ctggctgtgt ctctgggcga gcgtgccacc 60 atcaactgca agtccagcca gagtgtttta gacagctata acaatgagaa caatttagct 120 tggtatcagc agaaaccagg acagcctcct aagctgctca tttactgggc atctacccgg 180 gaatccgggg tccctgaccg attcagtggc agcgggtctg ggacagattt cactctcacc 240 atcagcagcc tgcaggctga agatgtggca gtttattact gtcagcaata taccagcgaa 300 cctatcacgt tcggccaagg taccaaggtg gaaatcaaag gtggtggtgg ttcaggtggt 360 GAGGTGGAGGTGGTT GGTGGTT GGTGGTT GGTGGTT GGTGGTT GGTGGTT GGTG 60 GGAGGCTTGGT ACAGCCTGGG GGTCCCTGCGACTCTCCTGTGCAGCCTCTGGATTCACC 480 TTTAGCGACT ATCAGATGAG CTGGGTCCGC CAGGCTCCAG GGAAGGGGCT GGAGTGGGTG 540 TCAGGCATT CAGGGTGGCG GTGGTAGCAC ATATTACGCA GACTCCGTGA AGGGCCGGTTC 600 ACCATCTCCC GTGACAATTC CAAGAACACG CTGTATCTGC AAATGAACAG C CTGC GTGCC 660 GAGGACACGG CTGTGTATTA CTGTGCGAGA GAGATGTGGC GTGGGGACTA CTACTCCG GT 720 ATGGACGTCT GGGGCCAGGG GACCACGGTC ACCGTCTCCT CA 762 <210> 23 <211> 771 <212> DNA <213> Artificial Sequence <220> <223> Synthetic Polynucleotide <400> 23GACATCGTGA TGACCCAGTC TCCAGACTCC CTGGCTGTGT CTCTGGGC GA GC GTGCCACC 60 ATCAACTGCA AGTCCAGCCA GAGTGTTTTA AGCAGCTATA ACAATGAGAA CAATT TAGCT 120 TGGTATCAGC AGAAACCAGG ACAGCCTCCT AAGCTGCTCA TTTACGCCGC ATCTACCCGG 180 TCAGGCATT CAGGGTGGCG GTGGTAGCAC ATATTACGCA GACTCCGTGA AGGGCCGGTTC 600 ACCATCTCCC GTGACAATTC CAAGAACACG CTGTATCTGC AAATGAACAG C CTGC GTGCC 660gaatccgggg tccctgaccg attcagtggc agcgggtctg ggacagattt cactctcacc 240 atcagcagcc tgcaggctga agatgtggca gtttattact gtcagcaata ttatagcgaa 300 ccttatacgt tcggccaagg taccaaggtg gaaatcaaag gtggtggtgg ttcaggtggt 360 ggtggttctg gcggcggctc cggtggtggt ggatccgagg tgcagctgtt ggagtctggg 420 ggaggcttgg tacagcctgg ggggtccctg cgactctcct gtgcagcctc tggattcacc 480 tttaccagct atgccatgag ctgggtccgc caggctccag ggaaggggct ggagtgggtg 540 tcaggcattg acggtagcgg tggtggcaca aattacgcag actccgtgaa gggccggttc 600 accatctccc gtgacaattc caagaacacg ctgtatctgc aaatgaacag cctgcgtgcc 660 gaggacacgg ctgtgtatta ctgtgcgaga gcgtattacg atattttgac tggttacccc 720 gtggacggta tggacgtctg gggccaaggg accacggtca ccgtctcctc a 771 <210> 24 <211> 747 <212> DNA <213> 人工序列 <220> <223> 合成的多核苷酸 <400> 24 gacatcgtga tgacccagtc tccagactcc ctggctgtgt ctctgggcga gcgtgccacc 60 atcaactgca agtccagcca gagtgtttta cgcagcagca acaataaaaa caatttagct 120 tggtatcagc agaaaccagg acagcctcct aagctgctca tttacgccgc atctacccgg 180 gaatccgggg tccctgaccg attcagtggc agcgggtctg ggacagattt cactctcacc 240 atcagcagcc tgcaggctga agatgtggca gtttattact gtcagcaata ttatcgcgaa 300 cctctgacgt tcggccaagg taccaaggtg gaaatcaaag gtggtggtgg ttcaggtggt 360 ggtggttctg gcggcggctc cggtggtggt ggatccgagg tgcagctgtt ggagtctggg 420 ggaggcttgg tacagcctgg ggggtccctg cgactctcct gtgcagcctc tggattcacc 480 tttaccgact atgccatgag ctgggtccgc caggctccag ggaaggggct ggagtgggtg 540 tcagacattg acggtagcgg tggtagcaca gactacgcag actccgtgaa gggccggttc 600 accatctccc gtgacaattc caagaacacg ctgtatctgc aaatgaacag cctgcgtgcc 660 gaggacacgg ctgtgtatta ctgtgcgcta gagctgggag ctactaccgt ctactggggc 720 cagggaaccc tggtcaccgt ctcctca 747 <210> 25 <211> 741 <212> DNA <213> Artificial sequence <220> <223> Synthetic polynucleotide <400> 25 gaaattgtgt tgacgcagtc tccaggcacc ctgtctttgt ctccagggga acgtgccacc 60 ctctcctgcc gtgccagtca gagtgttgac agcagcaatt tagcctggta tcagcagaaa 120 cctggccagg ctccccgact cctcatctat ggcgcatcta gccgtgccac tggtatccca 180 gaccgtttca gtggcagtgg gtctgggaca gacttcactc tcaccatcag cagactggag 240 cctgaagatt ttgcagtgta ttactgtcag cagtatcgca gctggcctat cacgttcggc 300 caaggtacca aggtggaaat caaaggtggt ggtggttcag gtggtggtgg ttctggcggc 360 ggctccggtg gtggtggatc cgaggtgcag ctgttggagt ctgggggagg cttggtacag 420 cctggggggt ccctgcgact ctcctgtgca gcctctggat tcacctttac cagcacccag 480 atgagctggg tccgccaggc tccagggaag gggctggagt gggtgtcaga gattagcggt 540 TATGGTGGTAGCACATCTACGCAGACTCCGTGAAGGGCCG GTTCACC ATCTCCC GTGAC 600 AATTCCAAGA ACACGCTGTA TCTGCAAATG AACAGCCTGC GTGCCGAGGA CAGGCTGTG 660 TATTACTGTG CAAAAGACAC GGAGGT TTCGGGAGATGCTTTTGATATCTGGGGCCAAGGG 720 ACAATGGTCA CC GTCTCTTCA 741 <210> 26 <211> 762 <212> DNA <213> Artificial Sequence <220> <223> Synthetic Polynucleotide <400> 26 GACATCGTGA TGACCCAGTC TCCAGACTCC CTGGCTGTGT CTCTGGGC GA GC GTGCCACC 60 ATCAACTGCA AGTCCAGCCA GAGTGTTTTA TATAGCGGCA ACAATAAAAA CTATTTAGCT 120 TGGTATCAGC AGAAACCAGG ACAGCCTCCT AAGCTGCTCA TTTACGGCGC ATCTACCCGG 180 GAA TCCGGGGTCCCTGACC GATTCAGTGGC AGC GGGTCTGGGACAGATTT CACTCTCACC 240 ATCAGCAGCC TGCAGGCTGA AGATGTGGCA GTTTATTACT GT CAGCAATAT GACTATGCC 300 CCTTTTACGTT CGGCCAAGGT ACCAAGGTG GAAATCAAAG GTG GTGGTGGTT CAGGTGGT 360 G GTGGTTCTGGCGGC GGCTCCGGTG GTGGTG GTGG ATCCGAGGTGC AGCTGTTGGAGTCTGGG 420 ggaggcttgg tacagcctgg ggggtccctg cgactctcct gtgcagcctc tggattcacc 480 tttaccagct attatatgag ctgggtccgc caggctccag ggaaggggct ggagtgggtg 540 tcaggcatta gcggtagcgg tgacagcaca agctacgcag actccgtgaa gggccggttc 600 accatctccc gtgacaattc caagaacacg ctgtatctgc aaatgaacag cctgcgtgcc 660 gaggacacgg ctgtgtatta ctgtgcgaga gaggcaggtg gtgactacga tagtggtgct 720 tttgatatct ggggccaagg gacaatggtc accgtctctt ca 762 <210> 27 <211> 777 <212> DNA <213> Artificial sequence <220> <223> Synthetic polynucleotide <400> 27 gacatcgtga tgacccagtc tccagactcc ctggctgtgt ctctgggcga gcgtgccacc 60 atcaactgca agtccagcca gagtgtttta gacagcagca acaataaaaa ctatttagct 120 tggtatcagc agaaaccagg acagcctcct aagctgctca tttacgacgc atctacccgg 180 gaatccgggg tccctgaccg attcagtggc agcgggtctg ggacagattt cactctcacc 240 atcagcagcc tgcaggctga agatgtggca gtttattact gtcagcaagg caccagcagc 300 cctctgacgt tcggccaagg taccaaggtg gaaatcaaag gtggtggtgg ttcaggtggt 360 ggtggttctg gcggcggctc cggtggtggt ggatccgagg tgcagctgtt ggagtctggg 420 ggaggcttgg tacagcctgg ggggtccctg cgactctcct gtgcagcctc tggattcacc 480 tttagcagct atgccatgag ctgggtccgc caggctccag ggaaggggct ggagtgggtg 540 tcagagattg acggtgaggg tggttataca aattacgcag actccgtgaa gggccggttc 600 accatctccc gtgacaattc caagaacacg ctgtatctgc aaatgaacag cctgcgtgcc 660 gaggacacgg ccgtgtatta ctgtgcgaga gaaggggtag attacgatat tttgactggt 720 tattatcctt acggtatgga cgtctggggc caagggacca cggtcaccgt ctcctca 777 <210> 28 <211> 8 <212> PRT <213> 人工序列 <220> <223> 合成的多肽 <400> 28 Gly Phe Thr Phe Ser Asp Tyr Gln 1 5 <210> 29 <211> 8 <212> PRT <213> Artificial Sequence <220> <223> Synthetic Polypeptide <400> 29 Ile Gin Gly Gly Gly Gly Ser Thr 1 5 <210> 30 <211> 15 <212> PRT <213> Artificial Sequence <220> <223> Synthetic Polypeptide <400> 30 Ala Arg Glu Met Trp Arg Gly Asp Tyr Tyr Ser Gly Met Asp Val 1 5 10 15 <210> 31 <211> 12 <212> PRT <213> Artificial Sequence <220> <223> Synthetic Polypeptide <400> 31 Gln Ser Val Leu Asp Ser Tyr Asn Asn Glu Asn Asn 1 5 10 <210> 32 <211> 3 <212> PRT <213> Artificial Sequence <220> <223> Synthetic Polypeptide <400> 32 Trp Ala Ser 1 <210> 33 <211> 9 <212> PRT <213> Artificial Sequence <220> <223> Synthetic Polypeptide <400> 33 Gln Gin Tyr Thr Ser Glu Pro Ile Thr 1 5 <210> 34 <211> 8 <212> PRT <213> Artificial Sequence <220> <223> Synthetic polypeptide <400> 34 Gly Phe Thr Phe Thr Ser Tyr Ala 1 5 <210> 35 <211> 8 <212> PRT <213> Artificial Sequence <220> <223> Synthetic polypeptide <400> 35 Ile Asp Gly Ser Gly Gly Gly Thr 1 5 <210> 36 <211> 8 <212> PRT <213> Artificial Sequence <220> <223> Synthetic polypeptide <400> 36 Ala Arg Ala Tyr Tyr Asp Ile Leu 1 5 <210> 37 <211> 12 <212> PRT <213> Artificial Sequence <220> <223> Synthetic polypeptide <400> 37 Gln Ser Val Leu Ser Ser Tyr Asn Asn Glu Asn Asn 1 5 10 <210> 38 <211> 3 <212> PRT <213> Artificial Sequence <220> <223> Synthetic polypeptide <400> 38 Ala Ala Ser 1 <210> 39 <211> 9 <212> PRT <213> Artificial Sequence <220> <223> Synthetic polypeptide <400> 39 Gln Gln Tyr Tyr Ser Glu Pro Tyr Thr 1 5 <210> 40 <211> 8 <212> PRT <213> Artificial Sequence <220> <223> Synthetic polypeptide <400> 40 Gly Phe Thr Phe Thr Asp Tyr Ala 1 5 <210> 41 <211> 8 <212> PRT <213> Artificial Sequence <220> <223> Synthetic polypeptide <400> 41 Ile Asp Gly Ser Gly Gly Ser Thr 1 5 <210> 42 <211> 10 <212> PRT <213> Artificial Sequence <220> <223> Synthetic polypeptide <400> 42 Ala Leu Glu Leu Gly Ala Thr Thr Val Tyr 1 5 10 <210> 43 <211> 12 <212> PRT <213> Artificial Sequence <220> <223> synthetic polypeptide <400> 43 Gln Ser Val Leu Arg Ser Ser Asn Asn Lys Asn Asn 1 5 10 <210> 44 <211> 3 <212> PRT <213> artificial sequence <220> <223> synthetic polypeptide <400> 44 Ala Ala Ser 1 <210> 45 <211> 9 <212> PRT <213> artificial sequence <220> <223> synthetic polypeptide <400> 45 Gln Gln Tyr Tyr Arg Glu Pro Leu Thr 1 5 <210> 46 <211> 8 <212> PRT <213> artificial sequence <220> <223> synthetic polypeptide <400> 46 Gly Phe Thr Phe Thr Ser Thr Gln 1 5 <210> 47 <211> 8 <212> PRT <213> artificial sequence <220> <223> synthetic polypeptide <400> 47 Ile Ser Gly Tyr Gly Gly Ser Thr 1 5 <210> 48 <211> 13 <212> PRT <213> Artificial sequence <220> <223> Synthetic peptides <400> 48 Ala Lys Asp Thr Glu Val Ser Gly Asp Ala Phe Asp Ile 1 5 10 <210> 49 <211> 7 <212> PRT <213> Artificial sequence <220> <223> Synthetic peptides <400> 49 Gln Ser Val Asp Ser Ser Asn 1 5 <210> 50 <211> 3 <212> PRT <213> Artificial sequence <220> <223> Synthetic peptides <400> 50 Gly Ala Ser 1 <210> 51 <211> 9 <212> PRT <213> Artificial sequence <220> <223> Synthetic peptides <400> 51 Gln Gln Tyr Arg Ser Trp Pro Ile Thr 1 5 <210> 52 <211> 8 <212> PRT <213> Artificial sequence <220> <223> Synthetic peptides <400> 52 Gly Phe Thr Phe Thr Ser Tyr Tyr 1 5 <210> 53 <211> 8 <212> PRT <213> Artificial Sequence <220> <223> Synthetic polypeptide <400> 53 Ile Ser Gly Ser Gly Asp Ser Thr 1 5 <210> 54 <211> 15 <212> PRT <213> Artificial Sequence <220> <223> Synthetic polypeptide <400> 54 Ala Arg Glu Ala Gly Gly Asp Tyr Asp Ser Gly Ala Phe Asp Ile 1 5 10 15 <210> 55 <211> 12 <212> PRT <213> Artificial Sequence <220> <223> Synthetic polypeptide <400> 55 Gln Ser Val Leu Tyr Ser Gly Asn Asn Lys Asn Tyr 1 5 10 <210> 56 <211> 3 <212> PRT <213> Artificial Sequence <220> <223> Synthetic polypeptide <400> 56 Gly Ala Ser 1 <210> 57 <211> 9 <212> PRT <213> Artificial Sequence <220> <223> Synthetic polypeptide <400> 57 Gln Gln Tyr Asp Tyr Ala Pro Phe Thr 1 5 <210> 58 <211> 8 <212> PRT <213> Artificial Sequence <220> <223> Synthetic polypeptide <400> 58 Gly Phe Thr Phe Ser Ser Tyr Ala 1 5 <210> 59 <211> 8 <212> PRT <213> Artificial Sequence <220> <223> Synthetic polypeptide <400> 59 Ile Asp Gly Glu Gly Gly Tyr Thr 1 5 <210> 60 <211> 20 <212> PRT <213> Artificial Sequence <220> <223> Synthetic polypeptide <400> 60 Ala Arg Glu Gly Val Asp Tyr Asp Ile Leu Thr Gly Tyr Tyr Pro Tyr 1 5 10 15 Gly Met Asp Val 20 <210> 61 <211> 12 <212> PRT <213> Artificial Sequence <220> <223> Synthetic polypeptide <400> 61 Gln Ser Val Leu Asp Ser Ser Asn Asn Lys Asn Tyr 1 5 10 <210> 62 <211> 3 <212> PRT <213> Artificial Sequence <220> <223> Synthetic polypeptide <400> 62 Asp Ala Ser 1 <210> 63 <211> 9 <212> PRT <213> Artificial Sequence <220> <223> Synthetic polypeptide <400> 63 Gln Gln Gly Thr Ser Ser Pro Leu Thr 1 5 <210> 64 <211> 24 <212> PRT <213> Artificial Sequence <220> <223> Synthetic polypeptide <400> 64 Gly Gly Gly Gly Ser Gly Gly Gly Gly Ser Gly Gly Gly Gly Ser Gly 1 5 10 15 Gly Gly Ser Gly Gly Gly Gly Ser 20 <210> 65 <211> 29 <212> PRT <213> Artificial Sequence <220> <223> Synthetic polypeptide <400> 65 Gly Gly Gly Gly Ser Gly Gly Gly Gly Ser Gly Gly Gly Gly Ser Gly​ 1 5 10 15 Gly Gly Gly Ser Gly Gly Gly Ser Gly Gly Gly Gly Ser 20 25 <210> 66 <211> 5 <212> PRT <213> Artificial Sequence <220> <223> Synthetic polypeptide <400> 66 Gly Gly Gly Gly Ser 1 5 <210> 67 <211> 10 <212> PRT <213> Artificial Sequence <220> <223> Synthetic polypeptide <400> 67 Gly Gly Gly Gly Ser Gly Gly Gly Gly Ser 1 5 10 <210> 68 <211> 254 <212> PRT <213> Artificial Sequence <220> <223> Synthetic polypeptide <400> 68 Glu Val Gln Leu Leu Glu Ser Gly Gly Gly Leu Val Gln Pro Gly Gly 1 5 10 15 Ser Leu Arg Leu Ser Cys Ala Ala Ser Gly Phe Thr Phe Ser Asp Tyr 20 25 30 Gln Met Ser Trp Val Arg Gln Ala Pro Gly Lys Gly Leu Glu Trp Val 35 40 45 Ser Gly lie Gin Gly Gly Gly Gly Ser Thr Tyr Tyr Ala Asp Ser Val 50 55 60 Lys Gly Arg Phe Thr lie Ser Arg Asp Asn Ser Lys Asn Thr Leu Tyr 65 70 75 80 Leu Gin Met Asn Ser Leu Arg Ala Glu Asp Thr Ala Val Tyr Tyr Cys 85 90 95 Ala Arg Glu Met Trp Arg Gly Asp Tyr Tyr Ser Gly Met Asp Val Trp 100 105 110 Gly Gin Gly Thr Thr Val Thr Val Ser Ser Gly Gly Gly Gly Ser Gly 115 120 125 Gly Gly Gly Ser Gly Gly Gly Ser Gly Gly Gly Gly Ser Asp lie Val 130 135 140 Met Thr Gin Ser Pro Asp Ser Leu Ala Val Ser Leu Gly Glu Arg Ala 145 150 155 160 Thr lie Asn Cys Lys Ser Ser Gin Ser Val Leu Asp Ser Tyr Asn Asn 165 170 175 Glu Asn Asn Leu Ala Trp Tyr Gin Gin Lys Pro Gly Gin Pro Pro Lys 180 185 190 Leu Leu lie Tyr Trp Ala Ser Thr Arg Glu Ser Gly Val Pro Asp Arg 195 200 205 Phe Ser Gly Ser Gly Ser Gly Thr Asp Phe Thr Leu Thr Ile Ser Ser 210 215 220 Leu Gln Ala Glu Asp Val Ala Val Tyr Tyr Cys Gln Gln Tyr Thr Ser 225 230 235 240 Glu Pro Ile Thr Phe Gly Gln Gly Thr Lys Val Glu Ile Lys 245 250 <210> 69 <211> 257 <212> PRT <213> Artificial Sequence <220> <223> Synthetic polypeptide <400> 69 Glu Val Gln Leu Leu Glu Ser Gly Gly Gly Leu Val Gln Pro Gly Gly 1 5 10 15 Ser Leu Arg Leu Ser Cys Ala Ala Ser Gly Phe Thr Phe Thr Ser Tyr 20 25 30 Ala Met Ser Trp Val Arg Gln Ala Pro Gly Lys Gly Leu Glu Trp Val 35 40 45 Ser Gly Ile Asp Gly Ser Gly Gly Gly Thr Asn Tyr Ala Asp Ser Val 50 55 60 Lys Gly Arg Phe Thr Ile Ser Arg Asp Asn Ser Lys Asn Thr Leu Tyr 65 70 75 80 Leu Gln Met Asn Ser Leu Arg Ala Glu Asp Thr Ala Val Tyr Tyr Cys 85 90 95 Ala Arg Ala Tyr Tyr Asp Ile Leu Thr Gly Tyr Pro Val Asp Gly Met 100 105 110 Asp Val Trp Gly Gln Gly Thr Thr Val Thr Val Ser Ser Gly Gly Gly 115 120 125 Gly Ser Gly Gly Gly Gly Ser Gly Gly Gly Ser Gly Gly Gly Gly Ser 130 135 140 Asp Ile Val Met Thr Gln Ser Pro Asp Ser Leu Ala Val Ser Leu Gly 145 150 155 160 Glu Arg Ala Thr Ile Asn Cys Lys Ser Ser Gln Ser Val Leu Ser Ser 165 170 175 Tyr Asn Asn Glu Asn Asn Leu Ala Trp Tyr Gln Gln Lys Pro Gly Gln 180 185 190 Pro Pro Lys Leu Leu Ile Tyr Ala Ala Ser Thr Arg Glu Ser Gly Val 195 200 205 Pro Asp Arg Phe Ser Gly Ser Gly Ser Gly Thr Asp Phe Thr Leu Thr 210 215 220 Ile Ser Ser Leu Gln Ala Glu Asp Val Ala Val Tyr Tyr Cys Gln Gln 225 230 235 240 Tyr Tyr Ser Glu Pro Tyr Thr Phe Gly Gin Gly Thr Lys Val Glu lie 245 250 255 Lys <210> 70 <211> 249 <212> PRT <213> Artificial Sequence <220> <223> Synthetic polypeptide <400> 70 Glu Val Gin Leu Leu Glu Ser Gly Gly Gly Leu Val Gin Pro Gly Gly 1 5 10 15 Ser Leu Arg Leu Ser Cys Ala Ala Ser Gly Phe Thr Phe Thr Asp Tyr 20 25 30 Ala Met Ser Trp Val Arg Gin Ala Pro Gly Lys Gly Leu Glu Trp Val 35 40 45 Ser Asp lie Asp Gly Ser Gly Gly Ser Thr Asp Tyr Ala Asp Ser Val 50 55 60 Lys Gly Arg Phe Thr lie Ser Arg Asp Asn Ser Lys Asn Thr Leu Tyr 65 70 75 80 Leu Gin Met Asn Ser Leu Arg Ala Glu Asp Thr Ala Val Tyr Tyr Cys 85 90 95 Ala Leu Glu Leu Gly Ala Thr Thr Val Tyr Trp Gly Gin Gly Thr Leu 100 105 110 Val Thr Val Ser Ser Gly Gly Gly Gly Ser Gly Gly Gly Gly Ser Gly 115 120 125 Gly Gly Ser Gly Gly Gly Gly Ser Asp Ile Val Met Thr Gln Ser Pro 130 135 140 Asp Ser Leu Ala Val Ser Leu Gly Glu Arg Ala Thr Ile Asn Cys Lys 145 150 155 160 Ser Ser Gln Ser Val Leu Arg Ser Ser Asn Asn Lys Asn Asn Leu Ala 165 170 175 Trp Tyr Gln Gln Lys Pro Gly Gln Pro Pro Lys Leu Leu Ile Tyr Ala 180 185 190 Ala Ser Thr Arg Glu Ser Gly Val Pro Asp Arg Phe Ser Gly Ser Gly 195 200 205 Ser Gly Thr Asp Phe Thr Leu Thr Ile Ser Ser Leu Gln Ala Glu Asp 210 215 220 Val Ala Val Tyr Tyr Cys Gln Gln Tyr Tyr Arg Glu Pro Leu Thr Phe 225 230 235 240 Gly Gln Gly Thr Lys Val Glu Ile Lys 245 <210> 71 <211> 247 <212> PRT <213> Artificial sequence <220> <223> Synthetic polypeptide <400> 71 Glu Val Gin Leu Leu Glu Ser Gly Gly Gly Leu Val Gin Pro Gly Gly 1 5 10 15 Ser Leu Arg Leu Ser Cys Ala Ala Ser Gly Phe Thr Phe Thr Ser Thr 20 25 30 Gln Met Ser Trp Val Arg Gin Ala Pro Gly Lys Gly Leu Glu Trp Val 35 40 45 Ser Glu He Ser Gly Tyr Gly Gly Ser Thr Tyr Tyr Ala Asp Ser Val 50 55 60 Lys Gly Arg Phe Thr He Ser Arg Asp Asn Ser Lys Asn Thr Leu Tyr 65 70 75 80 Leu Gin Met Asn Ser Leu Arg Ala Glu Asp Thr Ala Val Tyr Tyr Cys 85 90 95 Ala Lys Asp Thr Glu Val Ser Gly Asp Ala Phe Asp He Trp Gly Gin 100 105 110 Gly Thr Met Val Thr Val Ser Ser Gly Gly Gly Gly Ser Gly Gly Gly 115 120 125 Gly Ser Gly Gly Gly Ser Gly Gly Gly Gly Ser Glu He Val Leu Thr 130 135 140 Gln Ser Pro Gly Thr Leu Ser Leu Ser Pro Gly Glu Arg Ala Thr Leu 145 150 155 160 Ser Cys Arg Ala Ser Gin Ser Val Asp Ser Ser Asn Leu Ala Trp Tyr 165 170 175 Gln Gin Lys Pro Gly Gin Ala Pro Arg Leu Leu He Tyr Gly Ala Ser 180 185 190 Ser Arg Ala Thr Gly He Pro Asp Arg Phe Ser Gly Ser Gly Ser Gly 195 200 205 Thr Asp Phe Thr Leu Thr He Ser Arg Leu Glu Pro Glu Asp Phe Ala 210 215 220 Val Tyr Tyr Cys Gin Gin Tyr Arg Ser Trp Pro He Thr Phe Gly Gin 225 230 235 240 Gly Thr Lys Val Glu He Lys 245 <210> 72 <211> 254 <212> PRT <213> Artificial Sequence <220> <223> Synthetic polypeptide <400> 72 Glu Val Gin Leu Leu Glu Ser Gly Gly Gly Leu Val Gin Pro Gly Gly 1 5 10 15 Ser Leu Arg Leu Ser Cys Ala Ala Ser Gly Phe Thr Phe Thr Ser Tyr 20 25 30 Tyr Met Ser Trp Val Arg Gin Ala Pro Gly Lys Gly Leu Glu Trp Val 35 40 45 Ser Gly Ile Ser Gly Ser Gly Asp Ser Thr Ser Tyr Ala Asp Ser Val 50 55 60 Lys Gly Arg Phe Thr Ile Ser Arg Asp Asn Ser Lys Asn Thr Leu Tyr 65 70 75 80 Leu Gln Met Asn Ser Leu Arg Ala Glu Asp Thr Ala Val Tyr Tyr Cys 85 90 95 Ala Arg Glu Ala Gly Gly Asp Tyr Asp Ser Gly Ala Phe Asp Ile Trp 100 105 110 Gly Gln Gly Thr Met Val Thr Val Ser Ser Gly Gly Gly Gly Ser Gly 115 120 125 Gly Gly Gly Ser Gly Gly Gly Ser Gly Gly Gly Gly Ser Asp Ile Val 130 135 140 Met Thr Gln Ser Pro Asp Ser Leu Ala Val Ser Leu Gly Glu Arg Ala 145 150 155 160 Thr Ile Asn Cys Lys Ser Ser Gln Ser Val Leu Tyr Ser Gly Asn Asn 165 170 175 Lys Asn Tyr Leu Ala Trp Tyr Gln Gln Lys Pro Gly Gln Pro Pro Lys 180 185 190 Leu Leu Ile Tyr Gly Ala Ser Thr Arg Glu Ser Gly Val Pro Asp Arg 195 200 205 Phe Ser Gly Ser Gly Ser Gly Thr Asp Phe Thr Leu Thr Ile Ser Ser 210 215 220 Leu Gln Ala Glu Asp Val Ala Val Tyr Tyr Cys Gln Gln Tyr Asp Tyr 225 230 235 240 Ala Pro Phe Thr Phe Gly Gln Gly Thr Lys Val Glu Ile Lys 245 250 <210> 73 <211> 259 <212> PRT <213> Artificial Sequence <220> <223> Synthetic polypeptide <400> 73 Glu Val Gln Leu Leu Glu Ser Gly Gly Gly Leu Val Gln Pro Gly Gly 1 5 10 15 Ser Leu Arg Leu Ser Cys Ala Ala Ser Gly Phe Thr Phe Ser Ser Tyr 20 25 30 Ala Met Ser Trp Val Arg Gln Ala Pro Gly Lys Gly Leu Glu Trp Val 35 40 45 Ser Glu Ile Asp Gly Glu Gly Gly Tyr Thr Asn Tyr Ala Asp Ser Val 50 55 60 Lys Gly Arg Phe Thr Ile Ser Arg Asp Asn Ser Lys Asn Thr Leu Tyr 65 70 75 80 Leu Gin Met Asn Ser Leu Arg Ala Glu Asp Thr Ala Val Tyr Tyr Cys 85 90 95 Ala Arg Glu Gly Val Asp Tyr Asp Ile Leu Thr Gly Tyr Tyr Pro Tyr 100 105 110 Gly Met Asp Val Trp Gly Gln Gly Thr Thr Val Thr Val Ser Ser Gly 115 120 125 Gly Gly Gly Ser Gly Gly Gly Gly Ser Gly Gly Gly Ser Gly Gly Gly 130 135 140 Gly Ser Asp Ile Val Met Thr Gin Ser Pro Asp Ser Leu Ala Val Ser 145 150 155 160 Leu Gly Glu Arg Ala Thr Ile Asn Cys Lys Ser Ser Gin Ser Val Leu 165 170 175 Asp Ser Ser Asn Asn Lys Asn Tyr Leu Ala Trp Tyr Gin Gin Lys Pro 180 185 190 Gly Gin Pro Pro Lys Leu Leu Ile Tyr Asp Ala Ser Thr Arg Glu Ser 195 200 205 Gly Val Pro Asp Arg Phe Ser Gly Ser Gly Ser Gly Thr Asp Phe Thr 210 215 220 Leu Thr Ile Ser Ser Leu Gin Ala Glu Asp Val Ala Val Tyr Tyr Cys 225 230 235 240 Gln Gln Gly Thr Ser Ser Pro Leu Thr Phe Gly Gln Gly Thr Lys Val 245 250 255 Glu Ile Lys

Claims

1. An anti-CD371 antibody or an antigen-binding fragment thereof, comprising a heavy chain variable region (VH), wherein the VH comprises a CDR1 having an amino acid sequence as shown in SEQ ID NO: 28, a CDR2 having an amino acid sequence as shown in SEQ ID NO: 29, and a CDR3 having an amino acid sequence as shown in SEQ ID NO: 30; and a light chain variable region (VL), wherein the VL comprises a CDR1 having an amino acid sequence as shown in SEQ ID NO: 31, a CDR2 having an amino acid sequence as shown in SEQ ID NO: 32, and a CDR3 having an amino acid sequence as shown in SEQ ID NO:

33. 2 . The anti-CD371 antibody or antigen-binding fragment thereof according to claim 1 , wherein the VH comprises an amino acid sequence that is at least 80% identical to the amino acid sequence shown in SEQ ID NO:

1.

3. The anti-CD371 antibody or antigen-binding fragment thereof according to claim 1, wherein the VL comprises an amino acid sequence that is at least 80% identical to the amino acid sequence shown in SEQ ID NO:

2.

4. The anti-CD371 antibody or antigen-binding fragment thereof according to claim 1, wherein (a) the VH comprises an amino acid sequence that is at least 80% identical to the amino acid sequence shown in SEQ ID NO: 1; and (b) the VL comprises an amino acid sequence that is at least 80% identical to the amino acid sequence shown in SEQ ID NO:

2. 5 . The anti-CD371 antibody or antigen-binding fragment thereof according to claim 1 , wherein the VH comprises the amino acid sequence shown in SEQ ID NO:

1. 6 . The anti-CD371 antibody or antigen-binding fragment thereof according to claim 1 , wherein the VL comprises the amino acid sequence shown in SEQ ID NO:

2.

7. An anti-CD371 antibody or an antigen-binding fragment thereof, comprising (a) a heavy chain variable region comprising the amino acid sequence shown in SEQ ID NO: 1; and (b) a light chain variable region comprising the amino acid sequence shown in SEQ ID NO:

2.

8. The antibody or antigen-binding fragment thereof according to claim 1, comprising: The heavy chain variable region comprises the amino acid sequence shown in SEQ ID NO: 1, and the light chain variable region comprises the amino acid sequence shown in SEQ ID NO:

2.

9. The antibody or antigen-binding fragment thereof according to any one of claims 1 to 8, wherein the antibody sequence is in the heavy-light variable chain direction (V H -V L ).

10. The antibody or antigen-binding fragment thereof according to any one of claims 1 to 8, wherein the antibody or antigen-binding fragment thereof is expressed in 1×10 -7 M and 1×10 -8 The dissociation constant (K D ) binds to human CD371.

11. The antibody or antigen-binding fragment thereof according to any one of claims 1 to 8, wherein the antibody or antigen-binding fragment thereof is expressed in 1×10 -9 M and 1×10 -8 The dissociation constant (K D ) binds to human CD371.

12. An anti-CD371 antibody or an antigen-binding fragment thereof, comprising the amino acid sequence shown in SEQ ID NO:

68.

13. The antibody or antigen-binding fragment thereof according to any one of claims 1, 7 and 12, wherein the antibody comprises human variable region framework regions.

14. The antibody or antigen-binding fragment thereof according to any one of claims 1, 7 and 12, which is a full-length human antibody or antigen-binding fragment thereof.

15. The antibody or antigen-binding fragment thereof according to any one of claims 1, 7 and 12, which is a chimeric antibody or antigen-binding fragment thereof.

16. The antibody or antigen-binding portion thereof according to any one of claims 1, 7 and 12, which is a humanized antibody or antigen-binding fragment thereof.

17. The antibody or antigen-binding fragment thereof according to any one of claims 1, 7 and 12, wherein the antigen-binding fragment of the antibody is Fab, Fab', F(ab')2, variable fragment (Fv) or single-chain variable region (scFv).

18. A composition comprising the antibody or antigen-binding fragment thereof according to any one of claims 1 to 17. The composition according to claim 18 , which is a pharmaceutical composition further comprising a pharmaceutically acceptable carrier.

20. An immunoconjugate comprising the antibody or antigen-binding fragment thereof of any one of claims 1-17 linked to a therapeutic agent.

21. The immunoconjugate of claim 20, wherein the therapeutic agent is a drug, a cytotoxin, or a radioisotope.

22. A composition comprising the immunoconjugate of claim 20 or 21.

23. The composition according to claim 22, which is a pharmaceutical composition further comprising a pharmaceutically acceptable carrier.

24. A bispecific molecule comprising the antibody or antigen-binding fragment thereof of any one of claims 1-17 linked to a second functional moiety.

25. The bispecific molecule of claim 24, wherein the second functional moiety has a different binding specificity than the antibody or antigen-binding fragment thereof.

26. A composition comprising the bispecific molecule of claim 24 or 25. The composition according to claim 26 , which is a pharmaceutical composition further comprising a pharmaceutically acceptable carrier.

28. A nucleic acid encoding the antibody or antigen-binding fragment thereof of any one of claims 1-17.

29. An expression vector comprising the nucleic acid molecule according to claim 28.

30. A host cell comprising the expression vector according to claim 29.

31. A non-disease diagnostic method for detecting CD371 in whole cells or tissues, comprising: contacting the cell or tissue with the antibody or antigen-binding fragment thereof of any one of claims 1 to 17, wherein the antibody or antigen-binding fragment thereof comprises a detectable label; and The amount of labeled antibody or antigen-binding fragment thereof bound to the cell or tissue is determined by measuring the amount of detectable label associated with the cell or tissue, wherein the amount of bound antibody or antigen-binding fragment thereof is indicative of the amount of CD371 in the cell or tissue.

32. Use of the antibody or antigen-binding fragment thereof according to any one of claims 1 to 17, the immunoconjugate according to claim 20 or 21, the bispecific molecule according to claim 24 or 25, or the composition according to any one of claims 18, 19, 22, 23, 26 and 27 in the preparation of a medicament for killing tumor cells expressing CD371; The tumor cells expressing CD371 are cells of a tumor or neoplasia selected from the group consisting of acute myeloid leukemia (AML), multiple myeloma, non-Hodgkin's lymphoma, Hodgkin's lymphoma, chronic lymphocytic leukemia (CLL), glioblastoma, myelodysplastic syndrome (MDS), and chronic myeloid leukemia (CML).

33. The use according to claim 32, wherein the tumor cells expressing CD371 are AML cells.

Images