Use of an RGS1 inhibitor in the preparation of a therapeutic drug for breast cancer tumor-infiltrating lymphocytes

Abstract

The present invention discloses the use of the RGS1 gene as an intracellular drug inhibition target in immune cells for preparing adoptive cell immunotherapy drugs for tumors. It reveals the negative regulatory effect of overexpression of the RGS1 gene on the infiltration of immune cells into tumors. By using RGS1 as an inhibition target and inhibiting the expression of RGS1 to promote the infiltration of T cells with tumor-killing function or promoting tumor-killing function, the problem that tumor-specific T cells are difficult to infiltrate or survive in the tumor microenvironment is overcome. In addition to being able to amplify T cells that inhibit the expression of RGS1 in vitro to improve the effect of adoptive cell immunotherapy, it is also expected to directly act on T cells in the body with drugs to inhibit the expression of RGS1 and improve the anti-tumor effect of the body's own immune system. It can more effectively combine RGS1 inhibition and immune checkpoint inhibition to achieve a more significant anti-tumor effect, provide a new treatment plan for tumor treatment, and be applied in clinical treatment to improve the tumor treatment effect and the patient survival rate.

Description

Technical Field

[0001] The present invention relates to the field of immunotherapy, and more specifically, to the use of RGS1 inhibitors in the preparation of therapeutic drugs for breast cancer tumor-infiltrating lymphocytes. Background Art

[0002] Adoptive cell transfer therapy (ACT) refers to a method of separating immunocompetent cells from tumor patients, amplifying and functionally identifying them in vitro, and then transfusing them back to the patients to directly kill tumors or stimulate the body's immune response to kill tumor cells for therapeutic purposes. In recent years, such methods have achieved good therapeutic effects in clinical trials of some solid tumors and blood cancers, and are widely used immunotherapy methods in clinical treatment.

[0003] At present, the main ACT treatment strategies applied clinically mainly include tumor infiltrating lymphocyte (TIL) therapy, T-cell receptor (TCR) therapy, and chimeric antigen receptor (CAR)-modified T-cell therapy technology. Tumor infiltrating lymphocyte (TIL) therapy is a cell therapy that isolates lymphocytes with anti-tumor activity from tumor tissues, proliferates them in vitro through IL-2 culture, and then re-injects them into the patient's body; however, it has only been successfully used in the treatment of metastatic melanoma because it is difficult to collect tumor-specific T cells from other types of tumor tissues. T-cell receptor (TCR) therapy is to collect the patient's T cells and introduce TCR sequences that can recognize tumor antigens by means of genetic engineering, enabling them to recognize specific tumor antigens and kill tumor cells; there are research reports that by introducing MART-1 and NY-ESO-1, TCR therapy has achieved certain efficacy in patients with melanoma and synovial cell carcinoma respectively; however, it also has certain application defects, that is, TCR must match the patient's immune type. Chimeric antigen receptor (CAR)-modified T-cell therapy technology combines the high affinity of tumor antigens with the cytotoxic activity of T cells, obtains T cells expressing CAR through gene recombination, activates and amplifies them in vitro and then re-injects them into tumor patients to exercise the function of specifically killing tumor cells; the advantage is that it does not need to match the patient's immune type; at present, CAR-T cell technology has made major breakthroughs in the treatment of B-cell malignancies and has gradually emerged in clinical trials of solid tumors; however, many tumors lack specific antigens, which greatly limits the wide application and in-depth research of CAR-T cell therapy, and the immune suppression mediated by the tumor microenvironment also affects the clinical effect of CAR-T cell therapy to a certain extent.

[0004] That is, the existing traditional ACT treatment strategies still have certain limitations in the application of tumors such as solid tumors, and the curative effect is poor. In addition to the above limitations, adoptive immunotherapy also faces other obstacles in tumor treatment, especially in that tumors inhibit the infiltration of T cells with tumor-killing functions or induce the dysfunction of infiltrating T cells through multiple mechanisms. For example, existing studies have pointed out that blood vessels in tumors express FasL, thereby inducing apoptosis of T cells and preventing functional lymphocytes from reaching the local tumor site; that is, the immunosuppressive effect mediated by the tumor microenvironment hinders the migration of tumor-specific T cells to the local tumor site and affects the survival of T cells. In adoptive immunotherapy, it is easy to occur that anti-tumor T cells are difficult to reach the local tumor infiltration, difficult to survive in the tumor microenvironment, or difficult to exert the efficacy of killing tumors, resulting in tumor immune escape and limited curative effect. Therefore, increasing the infiltration number and immune killing function of tumor-specific T cells is an important strategy to improve the effect of anti-tumor immunotherapy.

[0005] Therefore, the existing technology urgently needs corresponding targets or treatment methods to make up for the limitations of the ACT treatment strategy in the existing technology. At the same time, it is necessary to overcome the problem that lymphocytes with tumor-killing functions cannot reach the local tumor to infiltrate and exert the tumor-killing efficacy, and improve the effect of tumor immunotherapy. Summary of the Invention

[0006] The present invention aims to overcome at least one of the above-mentioned deficiencies of the existing technology, and provides the use of an RGS1 inhibitor in the preparation of a therapeutic drug for breast cancer tumor-infiltrating lymphocytes. Through research, the present invention finds that regulator of G-protein signaling 1 (RGS1) is expressed in T lymphocytes and upregulated after STAT1 signal activation, induces apoptosis of T cells by inhibiting calcium influx in T cells and inhibiting ERK / Akt signal transduction, and reduces the infiltration of T cells into the local tumor site. On this basis, the present invention improves the survival of T lymphocytes by targeting and intervening in the expression of RGS1 in tumor-specific T lymphocytes, promotes lymphocytes with tumor-killing functions to reach the local tumor site, infiltrate at the local tumor site, enhances the ability of lymphocytes to kill tumors, and the therapeutic effect of adoptive immunotherapy.

[0007] An object of the present invention is to provide the use of the RGS1 gene as a drug inhibition target in immune cells in the preparation of adoptive cell immunotherapy drugs for tumors. In the immune response process of tumors, transporting immune cells including tumor antigen-reactive T cells to the tumor microenvironment is a crucial process. The infiltration of tumor-specific T cells is closely related to the survival status of tumors, and when tumor-specific T cells can act on tumors and exert their effects, a certain anti-tumor effect can be achieved. However, some tumors show "cold tumors" with a lack of infiltrating effector T cells in the stroma, and immunotherapy using immune cells often fails to work against such cold tumors. Perhaps only by increasing the infiltration of tumor antigen-reactive T cells in malignant tumors can such tumors be transformed into "hot tumors" to achieve effective immunotherapy. Taking breast cancer as an example, in one embodiment of the present invention, the efficiency of transporting anti-tumor effector T cells (including Th1 cells and effector CTLs) to breast cancer is significantly lower than that of immunosuppressive Th2 cells, resulting in a "cold tumor" microenvironment with immunosuppressive effects in breast cancer; and through further experimental studies, it is found that the main reason for the weakened ability of anti-tumor Th1 cells and effector CTLs to be recruited to tumors is the overexpression of the RGS1 gene. RGS1 acts as a negative regulator, inhibiting the chemotactic effect of effector CTLs and Th1 cells on tumor-related chemokines, thereby greatly inhibiting their ability to be recruited to the tumor microenvironment and destroying their anti-tumor efficacy. On this basis, the present invention studies a treatment strategy with RGS1 as the inhibition target. One or more embodiments of the present invention show that by inhibiting the expression of RGS1, it is possible to promote T cells with tumor-killing effects to reach the local tumor, improve the infiltration degree of T cells, and enhance the tumor-killing effect. Compared with the existing research that generally believes that the low infiltration or ineffective action of T cells is due to the influence of chemokines or ineffective binding to receptors, the present invention, based on the differential expression of the RGS1 gene in different tumor-infiltrating T cells, reveals an important factor affecting the infiltration of tumor-specific T cells including Th1 and CTL in addition to chemokines. In one or more embodiments of the present invention, silencing RGS1 can promote the migration of immune cells to tumor tissues, and the effect of immunotherapy for tumors can be significantly improved by transfusing T cells with silenced RGS1 expression in adoptive therapy.

[0008] Further, the adoptive cellular immunotherapy drug for tumors is an adoptive cellular immunotherapy drug for breast cancer. Adopting natural or genetically modified T cells is a common immunotherapy method in current breast cancer treatment. However, only a small fraction of the adoptively transferred T cells may often infiltrate into the tumor tissue, and there are limitations in the treatment effect. Although some existing technologies attempt to enhance the migration of effector T cells to tumors by engineering relevant chemokine receptors in the adoptively transferred T cells. But in fact, an embodiment of the present invention shows that the expression level of chemokine receptors on effector T cells does not determine their recruitment ability to tumors; the upregulated RGS1 inhibits chemokine signaling by coupling with chemokine receptors, thereby preventing the recruitment of anti-tumor T cells. That is, only engineering chemokine receptors cannot effectively enhance the infiltration of adoptively transferred T cells into tumors, while RGS1 can be used as a target to improve the treatment effect of ACT on breast cancer. And in an embodiment of the present invention, silencing RGS1 in the adoptively transferred CTL can significantly improve the migration of effector CTL to PDXs in the mouse model, greatly enhancing the treatment effect of ACT. That is, in an embodiment of the present invention, through breast tumor cells / tissues, it is verified that the tumor immunotherapy effect is improved after silencing the expression of RGS1 in immune cells in adoptive cellular immunotherapy, indicating that using RGS1 as a drug inhibition target can be applied to the preparation of drugs for adoptive cellular immunotherapy of breast cancer.

[0009] Further, the drug acts on the RGS1 gene and / or the regulatory gene of the RGS1 gene to inhibit the expression of the RGS1 gene. In addition to directly acting on the RGS1 gene to silence its expression, it can also inhibit the expression of the RGS1 gene by affecting the regulatory gene of the RGS1 gene expression.

[0010] Further, the regulatory gene of the RGS1 gene includes the STAT1 gene, and the drug inhibits the expression of the RGS1 gene by inhibiting the STAT1 gene. An embodiment of the present invention shows that the upregulation of the STAT1 gene is included in the reason for the enhanced transcription of the RGS1 gene in effector CTL and Th1 cells; while in other T cell subsets (such as Th2 or Tregs) without activating STAT1, RGS1 shows low expression. On this basis, the present invention further studies based on STAT1 and RGS1 and finds that after inhibiting the expression of the STAT1 gene, the expression of the RGS1 gene is significantly inhibited. Therefore, the STAT1 gene exists as a regulatory gene of the RGS1 gene, and inhibiting its expression can also achieve the RGS1 inhibition effect to promote the tumor immunotherapy effect. Further, existing studies generally believe that the high expression of the STAT1 gene is anti-tumor promoting, while the present invention creatively reveals the negative effect of the upregulation of the STAT1 gene. Therefore, it also provides a new treatment direction for the treatment plan targeting the STAT1 gene in tumor treatment, and its appropriate expression may achieve the best anti-tumor effect.

[0011] Furthermore, the drug includes an RGS1 inhibitor and / or a JAK / STAT1 inhibitor. The RGS1 inhibitor can inhibit RGS1 expression with RGS1 as the direct target, while the JAK / STAT1 inhibitor can indirectly inhibit RGS1 expression by inhibiting the expression of STAT1 or inhibiting its pathway, thereby reducing the inhibition of T cell infiltration and survival caused by RGS1 upregulation. The JAK / STAT1 inhibitor includes FLU, RUX, and STAT1 siRNA.

[0012] Furthermore, the RGS1 inhibitor is siRNA that silences RGS1 expression. The sequences of the siRNA (shRNA) are shRGS1-1: 5'-CCAAGAAGATTAAAGCACCAA-3'; and / or, shRGS1-2: 5'-GCATTCAGATGCTGCTAAACA-3'. Through siRNA, transfection of T cells in adoptive cell immunotherapy can be achieved with the help of vectors such as lentivirus, facilitating efficient preparation and amplification processes.

[0013] Furthermore, the drug contains an immune checkpoint inhibitor or the drug is administered in combination with an immune checkpoint inhibitor.

[0014] Furthermore, the drug contains a PD-L1 antibody or the drug is administered in combination with a PD-L1 antibody. After tumor-specific T cells are recruited to the tumor tissue, they may also become ineffective due to upregulation of immune checkpoints, losing their cytotoxicity to tumor cells, and weakening the therapeutic effect of ACT. Therefore, in one embodiment of the present invention, the strategy of jointly inhibiting RGS1 and an immune checkpoint inhibitor is used for immunotherapy. Taking the applied PDX as an example, compared with the individual action, the combined use of an anti-PD-L1 inhibitor and adoptive transfer of RGS1-knockdown T cells can significantly enhance the infiltration and tumor-killing activity of the transferred T cells, and significantly improve the tumor inhibitory effect. That is, in one embodiment of the present invention, the combined application of a PD-L1 antibody and inhibition of RGS1 expression in tumor treatment can significantly improve the therapeutic effect, which is better than the effect of individual use, and is beneficial to providing a new treatment strategy for clinical application.

[0015] Furthermore, the immune cells include tumor-specific T cells.

[0016] Furthermore, the immune cells include Th1-CD4 + and effector CD8 + T lymphocytes.

[0017] Another object of the present invention is to provide a use of an RGS1 inhibitor in the preparation of a tumor immunotherapy drug. Through the RGS1 inhibitor, in addition to being applicable to T cells to be transfected in vitro, it is expected to directly act on in vivo T cells by utilizing the characteristics of in vivo T cells, thereby improving the tumor infiltration and killing ability of the body's immune cells.

[0018] Furthermore, the drug promotes the infiltration of T lymphocytes in tumors, their survival in the tumor microenvironment, and their killing efficacy against tumors.

[0019] Another object of the present invention is to provide a method for preparing T lymphocytes for adoptive cell immunotherapy, comprising the steps of:

[0020] Obtaining T lymphocytes from a donor and screening for the desired subsets;

[0021] Constructing a lentiviral vector carrying or expressing an RGS1 inhibitor and / or a JAK / STAT1 inhibitor;

[0022] Incubating the screened T lymphocyte subsets with the lentiviral vector, and screening for T lymphocyte subsets transfected with the RGS1 inhibitor and / or the JAK / STAT1 inhibitor to obtain T lymphocytes for adoptive cell immunotherapy.

[0023] Furthermore, the RGS1 inhibitor and / or the JAK / STAT1 inhibitor is siRNA of the corresponding gene. That is, the RGS1 inhibitor is RGS1 siRNA, and the JAK / STAT1 inhibitor is siRNA of JAK and / or STAT1.

[0024] Furthermore, the subsets include Th1-CD4 + , effector CD8 + T lymphocytes.

[0025] Another object of the present invention is to provide a kit for the above preparation method.

[0026] Another object of the present invention is to provide T lymphocytes for adoptive cell immunotherapy obtained by the above preparation method.

[0027] Another object of the present invention is to provide a use of the above T lymphocytes for adoptive cell immunotherapy in the preparation of a tumor treatment drug.

[0028] Compared with the prior art, the beneficial effects of the present invention are as follows: It reveals the influence of the expression of RGS1 gene on immune cell infiltration. Taking RGS1 as an inhibitory target can promote the infiltration of T cells with tumor-killing function or promoting tumor-killing function, overcoming the problem that tumor-specific T cells are difficult to infiltrate or survive in the tumor microenvironment. In addition to being able to expand T cells that inhibit RGS1 expression in vitro to improve the effect of adoptive cell immunotherapy, it is also expected to directly act on T cells in the body with drugs to inhibit the expression of RGS1 in them, thereby enhancing the anti-tumor effect of the body's own immune system. At the same time, the present invention also reveals the gene that causes enhanced transcription of RGS1 - STAT1 gene, and verifies the process that effectively inhibits the expression of RGS1 by silencing STAT1, overcoming the generally recognized view in existing research that the up-regulation of STAT1 gene is beneficial for anti-tumor, providing new treatment targets and directions for tumor treatment, especially tumor immunotherapy. In addition to inhibiting RGS1 alone to improve adoptive immunotherapy, combining with anti-PD-L1 antibody can more significantly induce apoptosis of tumor cells, inhibit tumor growth, and improve the anti-tumor effect. That is, the inhibition of RGS1 combined with immune checkpoint inhibitors can provide a new treatment plan for tumor treatment, especially immunotherapy, and is expected to be applied clinically to improve the tumor treatment effect and patient survival rate. BRIEF DESCRIPTION OF THE DRAWINGS

[0029] Figure 1 Showing low infiltration of Th1-CD4 + and effector CD8 + T cells is associated with poor prognosis of patients.

[0030] Figure 2 Showing that up-regulation of RGS1 expression is associated with weakened ability of Th1 cells and CTLs to recruit to breast cancer tissues and poor prognosis of patients.

[0031] Figure 3 Showing that silencing RGS1 in T cells can enhance the anti-tumor ability of T cells.

[0032] Figure 4 Showing that RGS1 inhibits intracellular signal transduction mediated by G protein-coupled receptor (GPCR).

[0033] Figure 5 Showing that STAT1 signal in effector CTLs and Th1 cells up-regulates RGS1.

[0034] Figure 6 Showing that knockdown of RGS1 in adoptively transferred CTLs can enhance the recruitment and killing effects of adoptively transferred CTLs in breast cancer PDX. DETAILED DESCRIPTION OF THE EMBODIMENTS

[0035] It should be noted that the following detailed description is illustrative and is intended to provide further explanation of the present application. Unless otherwise specified, all technical and scientific terms used herein have the same meaning as commonly understood by those of ordinary skill in the technical field to which this application belongs.

[0036] It should be noted that the terms used herein are for the purpose of describing specific embodiments only and are not intended to limit the exemplary embodiments according to the present application. As used herein, unless the context clearly indicates otherwise, the singular forms are also intended to include the plural forms. In addition, it should be understood that when the terms "comprising" and / or "including" are used in this specification, they specify the presence of features, steps, operations, devices, components, and / or combinations thereof.

[0037] The present invention will be further described in conjunction with specific examples. The following examples are only for explaining the present invention and do not constitute a limitation to the present invention. The test samples and test procedures used in the following examples include the following content (if the specific experimental conditions are not specified in the examples, they are usually in accordance with conventional conditions or the conditions recommended by the reagent company; the reagents, consumables, etc. used in the following examples, unless otherwise specified, can be obtained from commercial channels).

[0038] 1. Patients and tissue samples

[0039] Tumor samples and peripheral blood samples of 46 patients with invasive breast cancer from 2017 to 2018 were obtained from Sun Yat-sen Memorial Hospital, Sun Yat-sen University (Guangzhou, China) for primary T cell isolation and analysis. In addition, 219 invasive ductal breast cancer samples from 2006 to 2018 were obtained from Sun Yat-sen Memorial Hospital, Sun Yat-sen University (Guangzhou, China) for Kaplan-Meier survival analysis. All samples were collected from patients with informed consent, and all relevant procedures were carried out under the approval of the Internal Review and Ethics Committee of Sun Yat-sen Memorial Hospital, Sun Yat-sen University.

[0040] 2. Isolation of primary cells from tumors and peripheral blood of cancer patients

[0041] Primary cells were obtained from blood and tissues. Percoll was used for isolation, and monocytes were collected in the cell layer between the 45% and 60% Percoll interfaces. To obtain a pure population, magnetic-activated cell sorting (MACS) and flow cytometry were used for cell sorting. The CD8 + T cell isolation kit (Miltenyi biotec, catalog number 130-096-495) and CD4 + T cell isolation kit (Miltenyi biotec, catalog number 130-096-533) were used to purify CD8 + and CD4+ T cells. Naive T cells and effector T cells were further purified from isolated CD8 + and CD4 + T cells using CD45RA microbeads (Miltenyi biotec, catalog number 130-045-901) and CD45RO microbeads (Miltenyi biotec, catalog number 130-046-001), respectively. Tregs were purified using the CD4 + CD25 + CD127 - regulatory T cell isolation kit (130-094-775, Miltenyi). Th1 and Th2 were flow sorted according to established surface markers. Th1 (CD4 + CXCR3 + ) and Th2 (CD4 + CXCR3 - CRTH2 + ) were incubated with CXCR3-APC (Biolegend, catalog number 353707) and CRTH2-PE / Cy7 (Biolegend, catalog number 350118) antibodies at 4 °C for 30 min, and then flow cytometry cell sorting was performed using a flow cytometer (BD FACSAria). The purity of the cell population was confirmed to be >90% by flow cytometry analysis.

[0042] 3. Immunofluorescence staining of tissues

[0043] The slides were incubated in 0.01 M citrate buffer (pH 6.0) in a pressure cooker for 5 minutes and then treated with 3% hydrogen peroxide for 5 minutes for antigen retrieval. Then, the slides were incubated overnight at 4°C with the following antibodies: CD8 (Thermo Fisher Scientific, catalog number MA5-14548, 1:200), CD4 (Thermo Fisher Scientific, catalog number PA5-11582, 1:100 or Abcam, catalog number ab34276, 1:20), T-bet (Abcam, catalog number ab150440, 1:30), GATA-3 (Abcam, catalog number ab199428, 1:30), Foxp3 (Abcam, catalog number ab20034, 1:50 or Abcam, catalog number ab54502, 1:50), CD45RA (DAKO, catalog number M0754, 1:50), CD45RO (DAKO, catalog number M0742, 1:200), and RGS1 (Abcam, catalog number ab117077, 1:50). The specimens were incubated with Alexa Fluor secondary antibodies (Thermo Fisher Scientific). For negative controls, isotype-matched antibodies were used. At least 10 fields per section were counted for cells stained with the indicated antibodies at a magnification of 630x.

[0044] 4. Cellular immunofluorescence staining

[0045] Naive CD4 + T cells isolated from healthy donor PB were incubated with anti-CXCR4, anti-CCR4, and / or anti-RGS1 primary antibodies and then with Alexa Fluor 488 donkey anti-rabbit IgG (H+L) and Alexa Fluor 555 donkey anti-goat IgG (H+L). For confocal microscopy, the cells on coverslips were counterstained with DAPI and imaged using a confocal laser scanning microscope (Carl Zeiss) with a core data acquisition system (Applied Precision).

[0046] 5. Primary T cell transduction

[0047] 2 - 4×10 7Lentiviral particles (multiplicity of infection (MOI) = 10 - 20, Genepharma, Shanghai, China) carrying anti-RGS1 shRNA were transduced into T cells in the presence of 8 μg / ml Polybrene (Sigma). After 8 - 10 h, the cell suspension was centrifuged and the growth medium was replaced. Transduction was repeated for two consecutive days, and the transduced T cells were collected for subsequent experiments. The sequences of the shRNAs involved were as follows: shGFP: TAGCGACTAAACACATCAA; shRGS1-1: CCAAGAAGATTAAAGCACCAA; shRGS1-2: GCATTCAGATGCTGCTAAACA.

[0048] 6. Chemotaxis assay

[0049] T cells isolated from the PB of healthy donors or breast cancer patients were allowed to migrate through a 5-μm Transwell filter (Costar, Cambridge, MA, USA) for 6 h into the bottom chamber containing medium with or without 100 ng / ml rhCCL22, 100 ng / ml CXCL12, 100 ng / ml CCL3, 100 ng / ml CCL4, or 100 ng / ml CCL5, and were counted by flow cytometry. The Transwell assay was performed in triplicate and repeated using cells from at least three different donors; and the number of cells migrating towards each chemokine was normalized to the number of cells migrating in medium alone to calculate the chemotaxis index for each T cell subset as described above.

[0050] 7. Ex vivo tumor slice migration assay

[0051] Briefly, freshly excised samples were embedded in 5% agarose (type VII-A), cut into 400-μm sections, and overlaid with 2 × 10 5 Autologous Th1 cells or effector CTLs isolated from PB and labeled with CFSE were incubated in a 24-well plate containing RPMI 1640 plus 10% autologous serum for 3 h. The sections were then rinsed, fixed, and stained with anti-CD8, anti-CD45RO, anti-CD4, or anti-T-bet. Cells were counted in at least 10 fields per section at 400× magnification.

[0052] 8. Generation of DCs and T lymphocytes

[0053] Monocytes were obtained from the peripheral blood of breast cancer patients and cultured in DMEM containing 50 ng / ml GM-CSF, 20 ng / ml IL-4 (PeproTech), and 10% heat-inactivated autologous serum for 6 days. Dendritic cells were induced to mature by incubation with 100 ng / ml LPS and 500 U / ml FN-γ (PeproTech) for 48 h, and then stimulated with autologous tumor lysate (200 μg protein / ml) for 24 h (five freeze-thaw cycles). To generate tumor-specific T cells, naive CD4 / CD8 + T cells isolated from PB were co-cultured with antigen-specific dendritic cells (at a ratio of 5:1) in RPMI 1640 medium containing 25 U / ml IL-2 and 10% heat-inactivated autologous serum for 6 days.

[0054] 9. Cytotoxicity assay

[0055] Primary tumor cells were obtained from breast cancer tissues. The tumor cells were purified with EpCAM + microbeads (Miltenyi Biotec, 130-061-101) and stained with Cell Tracker Deep Red Dye (Thermo Fisher Scientific, C34565) at 37°C for 15 minutes. CD8 + T cells activated by tumor antigens generated by incubation with DCs loaded with tumor antigens as described above were collected with CD8 microbeads (Miltenyi Biotec, 130-045-201) and co-cultured with relevant target cells at an effector cell / target cell ratio of 10:1 for 12 h at 37°C. After 12 h, all cells were harvested and stained with PI (3.75 mM solution, 1:500 final dilution) and immediately analyzed by flow cytometry.

[0056] 10. Induction and evaluation of T cell apoptosis

[0057] Tumor-specific CTL or CD4 + T cells were stimulated with autologous tumor cells at a ratio of 1:1 at 37°C for 18 h. T cell death was evaluated by flow cytometry using an apoptosis detection kit (Biolegend, 640932) according to the manufacturer's instructions, which stains annexin V and PI. The percentage of apoptotic cells includes the percentage of early apoptotic cells (annexin V+PI–) and late apoptotic cells (annexin V+PI+). Specific apoptosis was calculated as: (percentage of induced apoptosis – percentage of spontaneous apoptosis) / (100% – percentage of spontaneous apoptosis) × 100%

[0058] 11. Flow cytometer

[0059] Cells were stained with CD3-eFluor 450 (eBioscience, catalog number 48-0038), CD4-Per-CP-Cyanine5.5 (Biolegend, catalog number 317428), CD8 FITC (eBioscience, catalog number 11-0086-), T-bet-PE (Biolegend, catalog number 644809), GATA-3-PE (Biolegend, catalog number 653803), Foxp3-PE (ThermoFisher Scientific, catalog number A18690), CXCR3-APC (Biolegend, catalog number 353707), CRTH2-PE / Cy7 (Biolegend, catalog number 350118), CD25-APC / H7 (BD Pharmingen, catalog number 560225), Perforine Fluor 450 (eBioscience, catalog number 48-9994-42), Granzyme B Alexa Fluor 647 (Biolegend, catalog number 515406), CD45RO-PE / Cy7 (Biolegend, catalog number 304229), and / or CD45RA PE (Biolegend, catalog number 304108). For intracellular staining, the Intracellular Fixation and Permeabilization Kit (eBioscience, Cat. No. 88-8824) was used to pretreat the cells according to the kit instructions. Subsequently, the cells were analyzed using a multicolor flow cytometer (Gallios, Beckman Coulter, china).

[0060] 12. Immunoblotting

[0061] Proteins were extracted from cells using RIPA buffer, separated by SDS-polyacrylamide gel, and then transferred onto PVDF membranes. The following antibodies were used: Akt (CST, Cat#4685), phospho-Akt (CST, Cat#4060), ERK (CST, Cat#4695), phospho-ERK (CST, Cat#4370), RGS1 (Abcam, catalog number ab117077), CXCR4 (Abcam, catalog number ab124824), GAPDH (Proteintech, catalog number HRP-60004), CCR4 (Abcam catalog number ab83250), CCR5 (Proteintech catalog number 17476-1-1 AP); peroxidase-conjugated secondary antibody (CST) was used, and the antigen-antibody reaction was observed by enhanced chemiluminescence assay (ECL, Thermo); the images were cropped according to the molecular mass marker protein (kDa). The intensity of each band on the Western blot was measured using Image J software and normalized according to the internal reference protein GAPDH. The figure represents the normalized value of the fold change relative to the control condition.

[0062] 13. Quantitative PCR

[0063] Quantitative reverse transcription PCR (qRT-PCR) was performed using SYBR Premix Ex Taq kit (TaKaRa, Japan) according to the manufacturer's instructions. Data were collected and analyzed using a LightCycler 480 instrument (Roche).

[0064] 14. Chromatin immunoprecipitation (ChIP) assay

[0065] A ChIP assay kit (Millipore, Billerica, MA) was used to perform the ChIP assay according to the manufacturer's instructions. Briefly, 5×10 6 T cells were collected and fixed with 1% formaldehyde for 10 min at room temperature. The fixed cells were collected, lysed, and sonicated. Antibody against STAT1 (CST, Cat.No.14994) was used. The precipitated DNA was amplified by PCR.

[0066] 15. EMSA

[0067] Nuclear extracts were prepared using NE-PER Nuclear Extraction Reagent (Pierce, Rockford, IL). DNA binding reactions were performed using the Lightshift Chemiluminescent EMSA Kit (Pierce) according to the manufacturer's instructions. A 50-fold molar excess of unlabeled oligonucleotide was added as a competitor for the biotin-labeled probe. To identify DNA-binding proteins, nuclear extracts were incubated with 3 μg of STAT1 antibody (CST, catalog number 14994) or control IgG for 20 minutes at room temperature before adding the labeled probe. The EMSA probes were ACCTCTGTATGTTTAATTTTCTTTCTTTCT (wt) and ACCTCTGTACACGCAATCGAGATTCTTTCT (mut). The sequence of the OCT1 EMSA probe used as a loading control was TGTCGAATGCAAATCACTAGAA.

[0068] 16. Dual-luciferase reporter assay

[0069] Fragments of -2000 to +1 relative to the transcription start site of the RGS1 genomic sequence and a series of nested deletions and point mutations of RGS1 (-2000 / +1)-luc were fused to the pGL3-Basic vector, respectively. In the luciferase reporter assay, Jurkat cells were electroporated with the indicated constructs (0.4 μg per well) and pRL-TK-Renilla (0.01 μg per well) for 24 h, and then incubated with PHA for 24 h. Dual-luciferase reporter assays were performed using the Dual-Luciferase Reporter Assay System (E1910, Promega, Madison, WI) according to the manufacturer's instructions.

[0070] 17. Implantation of patient-derived xenografts (PDXs)

[0071] Primary breast cancer specimens were collected from breast cancer patients who underwent tumor resection at the Sun Yat-sen Memorial Hospital, Sun Yat-sen University, between October 2017 and April 2019. Three- to four-week-old female NOD.SCID mice under pathogen-free conditions were used for patient-derived xenotransplantation, with at least three mice in each experimental group. A small incision was made on the abdomen of anesthetized NOD.SCID mice to expose and clear the inguinal mammary gland. Then the primary breast tumor samples were minced into fragments of 1-2 mm 3 in size, immersed in Matrigel, and then implanted into the cleared mammary inguinal fat pad, and the incision was sutured with suture. The time from patient collection to mouse implantation was 30 - 180 minutes. In the following three months after implantation, the tumor size was monitored weekly using vernier calipers. When the tumor reached 1500 mm 3At that time, the mice were sacrificed, and the tissue blocks were re-transplanted into another group of mice and frozen for later use and / or for histological, gene expression analysis, and primary cell isolation. Specifically, the formula 0.5 × length × (width) was used. 2 to calculate the tumor volume.

[0072] 18. Adoptive cell transfer therapy

[0073] CD8 T cells were isolated from the peripheral blood of the same breast cancer patients and enriched by human CD8 microbeads according to the manufacturer's protocol. DCs were loaded with autologous tumor lysates and then co-incubated with autologous CD8 T cells transfected with a luciferase-expressing lentiviral vector carrying or not carrying shvec, RGS1 shRNA (shRGS1), or GFP-shRNA (shGFP) for 20 hours (DC / T cell ratio of 1:5). Then, after palpable tumor formation, 2.5 × 10 + T cells and 0.5 × 10 + DC cells were infused into each PDX mouse via the tail vein; in some experiments, the mice were treated with 100 mg / mouse of monoclonal anti-human PD-L1 antibody (catalog number BE0285, BioXcell) or isotype control antibody (IgG) (catalog number BE0086, BioXcell) by intraperitoneal injection every three days. Tumor growth was monitored and recorded every 4 days, and the tumor volume was calculated using the following formula: volume = 0.5 × length × (width) 6 T cells and 0.5 × 10 6 DC cells were infused into each PDX mouse via the tail vein; in some experiments, the mice were treated with 100 mg / mouse of monoclonal anti-human PD-L1 antibody (catalog number BE0285, BioXcell) or isotype control antibody (IgG) (catalog number BE0086, BioXcell) by intraperitoneal injection every three days. Tumor growth was monitored and recorded every 4 days, and the tumor volume was calculated using the following formula: volume = 0.5 × length × (width) 2 . Finally, tumor cells and tumor-infiltrating immune cells were isolated and analyzed by flow cytometry and / or immunohistochemistry.

[0074] 19. PDX dissociation

[0075] The tumors were cut into small fragments (about 1 mm 3 ) and incubated with collagenase type III in RPMI-1640 medium containing 2% fetal bovine serum (5 ml per gram of tumor tissue) at 37 °C for 20 minutes. Then, the tumor pieces were transferred to a tissue digestion C tube and further enzymatically and mechanically dissociated on a gentleMACS dissociator to obtain a single-cell suspension. Finally, CD8 T cells were purified by human CD8 microbeads. + T cells.

[0076] 20. IVIS Lumina imaging

[0077] Pre-transduce primary T cells to be transfected into PDX-bearing mice with lentivirus carrying luciferase plasmid to examine the distribution of T cells in mice by IVIS Lumina Imaging. Administer D-luciferin (300 mg / kg i.v., 10 minutes before imaging) to the mice, anesthetize (3% isoflurane) and image using the Xenogen IVIS Lumina system (Caliper LifeSciences, Hopkinton, MA). Analyze the images using Living Image software and determine the bioluminescence flux (photons / s / cm 2 / steradian) of T cell distribution.

[0078] 21. Positron Emission Tomography / Computed Tomography (PET / CT) Imaging

[0079] Five weeks after ACT treatment, evaluate the treatment effect of PDX by 18 F fluorodeoxyglucose ( 18 F-FDG) PET / CT. Before PET / CT scanning, fast the mice for 8 hours, anesthetize with 400 mg / kg chloral hydrate, and inject 100 μL of saline containing 5 μCi / g 18 F-FDG via the tail vein. At 40 minutes after 18 F-FDG injection, perform a 15-minute static scan using an Inveon microPET / CT scanner (Siemens, Germany). Correct the attenuation, scatter, normalization, and camera dead time of the microPET images and register them with the microCT images. Calculate the uptake of 18 F-FDG in the tumor based on the standardized uptake value (SUV) in the three-dimensional region of interest (ROI).

[0080] 22. Calcium Mobilization Assay

[0081] Isolate naive CD4 + T cells from the peripheral blood (PB) of healthy donors and suspend them at a concentration of 3×10 6 cells / ml in Hank's balanced salt solution (HBSS) with a pH of 7.4 (HBSS-BSA) containing 1 mg / ml bovine serum albumin (BSA) and 10 mM HEPES. Incubate with 1 mM Fura-2-AM (Dojindo, Kumamoto, Japan) for 30 minutes in the dark at room temperature. After washing twice with HBSS-BSA, resuspend the cells at 2.5×10 6Cells / ml concentration was suspended in HBSS-BSA. Then, a quartz cuvette containing 2 ml of cell suspension was placed in a luminescence spectrometer (RF-5000, Shimadzu, Kyoto, Japan), and fluorescence was monitored at an emission wavelength of 510 nm, and excitation wavelengths of 340 and 380 nm were monitored every 20 ms. Fluorescence calibration represented by [Ca 2+ i was calculated from the ratio of 340 / 380 excitation fluorescence values.

[0082] 23. Evaluation of cAMP accumulation

[0083] In all experiments, 2.5×10 5 effector CTLs induced by shRGS1, shGFP or shvec and the phosphodiesterase inhibitor 3-isobutyl-1-methylxanthine (IBMX) (5×10 -4 M) were incubated, and then incubated for 1 hour in the presence or absence of CCL22, CXCL12, CXCL9, CXCL10 and CXCL11. cAMP was measured using an enzyme immunoassay kit (CA-201) (Sigma-Aldrich-Chemie, Munich, Germany) according to the manufacturer's guidelines. Among them, IBMX was added to inhibit cAMP degradation, and all data were from three independent replicate experiments.

[0084] Example 1

[0085] Th1-CD4 + and effector CD8 + T cell low infiltration is associated with poor prognosis of patients

[0086] To evaluate whether the infiltration of effector T cells / memory T cells in the tumor locus has prognostic significance, effector CD4 + T cell subsets (such as, Th1 (CD4 + T-bet + ), Th2 (CD4 + GATA-3 + )) and effector CD8 + cytotoxic T cells (CTLs) (CD8 + CD45RO + ) in breast cancer tissues were detected by immunofluorescence staining, and their counts were correlated with the patient survival. The immunofluorescence staining results showed that the T cell subsets of tumor infiltration (TI) were different in breast cancer patients, such as Figure 1A is shown in the figure. Meanwhile, 219 patients were divided into a high tumor-infiltrating Th1-CD4 T cell group (>8.6 cells / region, n = 147), a low tumor-infiltrating Th1-CD4 T cell group (≤8.6 cells / region, n = 72); a high tumor-infiltrating Th2-CD4 T cell group (>10.4 cells / region, n = 102), a low tumor-infiltrating Th2-CD4 T cell group (≤10.4 cells / region, n = 117); a high tumor-infiltrating effector CTL cell group (>4.3 cells / region, n = 131), a low tumor-infiltrating effector CTL cell group (≤4.3 cells / region, n = 88) using X-tile software. Through Kaplan-Meier survival analysis, it was found that patients with more tumor-infiltrating Th1-CD4 + T cells and CTL cells had a better clinical prognosis, while the abundance of tumor-infiltrating Th2-CD4 + T cells was associated with a shorter disease-free survival (DFS).

[0087] Specifically, Figure 1 In the figure: A: Representative immunofluorescence staining of low (upper) and high (lower) infiltration numbers of Th1, Th2 cells or effector CTL cells in breast cancer specimens, scale bar: 50 µm; B: Kaplan-Meier survival curve analysis of the number of tumor-infiltrating Th1, Th2 cells or effector CTL and the disease-free survival of breast cancer patients (n = 219).

[0088] Example 2

[0089] Upregulation of RGS1 expression is associated with reduced ability of Th1 cells and CTLs to be recruited to breast cancer tissues and poor patient prognosis

[0090] (1) RGS1 expression is related to the reduced ability of Th1 cells and CTLs to be recruited to breast cancer tissues

[0091] It has been reported that the intracellular signal transduction of G protein-coupled receptors of chemokines that control immune cell trafficking is examined by a group of regulators of G protein signaling (RGS), but the expression of this type of RGS in various human T cell subsets has not been elucidated yet. To further explore whether the expression of RGS affects the recruitment of tumor T cells in breast cancer patients, in this example, qRT-PCR was used to compare the expression of RGS1 in Th1 cells isolated from primary tumor tissues of breast cancer patients with high or low Th1 infiltration. The results are as Figure 2 shown in A. A similar situation was also found in infiltrating effector cells CTLs, as shown in Figure 2As shown in Figure A. That is, in Th1 cells with less infiltration in tumor tissues, the expression level of RGS1 is higher; while in Th1 cells with more infiltration in tumor tissues, the expression of RGS1 is less. Similar results were also obtained in tumor-infiltrating CTLs.

[0092] In addition, through immunofluorescence staining ( Figure 2 C) and flow cytometry ( Figure 2 B), it was confirmed that RGS1 was overexpressed in Th1 cells and effector CTLs with weak recruitment ability, that is, through immunofluorescence staining and flow cytometry, it was confirmed that the overexpression of RGS1 in Th1 cells and effector CTLs led to the weakened ability of these cells to be recruited locally to the tumor. Overall, these data indicate that RGS1 is preferentially upregulated in Th1 cells and effector CTLs with weak recruitment ability.

[0093] (2) Upregulation of RGS1 in circulating effector CTLs and Th1 cells is associated with tumor progression in breast cancer patients

[0094] To further evaluate the clinical significance of RGS1, we studied the expression of RGS1 in peripheral blood (PB) T cells of breast cancer patients. The RGS1 expression in Th1 cells and effector CTLs in the peripheral blood of 219 breast cancer patients was correlated with the clinical immunological characteristics of the patients. The optimal cut-off point of RGS1 expression in circulating effector CTLs was determined by qRT-PCR and X-tile analysis (≤0.01 relative to GAPDH normalization was low expression, >0.01 was high expression). High RGS1 expression in circulating effector CTLs was associated with larger tumors, more lymph node metastases, higher proliferation and less apoptosis of tumor cells, but was not related to the age, pathological grade and molecular subtypes of breast cancer of the patients. Similarly, patients with higher RGS1 expression in circulating Th1 cells had larger tumor sizes and less apoptosis of tumor cells, but the expression was not related to tumor molecular subtypes, lymph node metastases and tumor proliferation.

[0095] In addition, we studied the prognostic value of the expression of RGS1 in Th1 circulating cells and effector cells CTL by analyzing its correlation with the disease-free survival (DFS) and overall survival (OS) of 219 breast cancer patients. The results are as Figure 2 shown in Figures D and 2E.

[0096] The Kaplan-Meier survival curves showed that the OS and DFS of patients with higher RGS1 levels (>0.01, n = 134) in circulating effector CTLs were shorter than those of effector CTLs with lower RGS1 levels (≤0.01, n = 85), as Figure 2As shown in D. Similarly, compared with patients with lower RGS1 expression in circulating Th1 cells (≤0.01, n = 109) in cycle Th1, higher RGS1 expression (>0.01, n = 110) in circulating Th1 cells of breast cancer patients was associated with shorter DFS and OS, as Figure 2 shown in E.

[0097] That is, the upregulation of RGS1 expression in Th1 cells and CTLs in peripheral blood is related to disease progression and poor prognosis of breast tumor patients.

[0098] Specifically, Figure 2 in: A: Quantitative PCR was used to detect the expression of RGS1 in Th1 cells (CD3 + CD4 + CXCR3 + ) with less and more infiltration in breast cancer tissues, and effector CTLs (CD3 + CD8 + CD45RO + ); B: Flow cytometry was used to determine the expression of RGS1 in Th1 cells and effector CTLs with less and more infiltration in breast cancer tissues. C: Representative images of immunofluorescence staining of RGS1 expression in Th1 and effector CTL cells infiltrating human breast cancer tissues; D, E: Kaplan-Meier survival curve analysis of the RGS1 expression levels of Th1 and effector CTLs in the peripheral blood of tumor patients and the overall survival and disease-free survival of breast cancer patients.

[0099] Example 3

[0100] Silencing RGS1 in T cells can enhance the anti-tumor ability of T cells

[0101] The role of RGS1 in T cell trafficking was confirmed by tumor slice assay, and it was found that silencing RGS1 enhanced the migration of effector CTLs and Th1 cells to freshly resected breast tumor slices (as Figure 3 shown in A);

[0102] To further investigate the potential role of RGS1 in the survival of effector T cells, shRGS1 was transduced into naive CD4 + or CD8 + T cells isolated from the peripheral blood of breast cancer patients, and tumor-specific T cells were generated by co-culturing naive T cells with autologous dendritic cells (DCs) loaded with autologous tumor lysates.

[0103] By CFSE staining, it was found that silencing RGS1 had no effect on the proliferation of tumor-specific CD8 + T cells, but moderately reduced the apoptosis of effector CTLs induced by autologous tumor cells (as Figure 3As shown in B, the cytotoxicity of effector CTLs against target tumor cells was enhanced (detected by propidium iodide staining). Similarly, the apoptosis of tumor-specific CD4 + T cells was reduced by RGS1 silencing (as Figure 3 shown in B)

[0104] Overall, these data indicate that upregulated RGS1 inhibits the recruitment and survival of Th1 cells and effector CTLs, while silencing of RGS1 in T cells enhances the anti-tumor ability of T cells.

[0105] Specifically, Figure 3 Among them: A: Silencing RGS1 enhances T cell migration; B: Silencing RGS1 inhibits T cell apoptosis; C: Silencing RGS1 increases the ability of T cells to kill tumor cells.

[0106] Example 4

[0107] RGS1 inhibits intracellular signaling mediated by G protein-coupled receptors (GPCRs)

[0108] The RGS family is a class of proteins that interact with G proteins and inhibit G protein signaling by accelerating the intracellular GTPase activity. In this example, it was investigated whether RGS1 affects the chemotaxis of Th1 and effector CTLs by inhibiting the downstream signaling of chemokine receptors.

[0109] Co-immunoprecipitation results showed (as Figure 4 shown in A) that RGS1 specifically binds to CCR4, CXCR4, and CXCR3 in effector CTLs, but not specifically to CCR5, indicating that RGS1 can regulate the downstream signaling of CCR4, CXCR4, and CXCR3. In addition, after treatment with CXCL12, CCL22, or CXCL9 / 10 / 11, silencing of RGS1 in effector CTLs inhibited the increase in cAMP (as Figure 4 shown in B), and enhanced calcium influx after CXCL12 stimulation (as Figure 4 shown in C). At the same time, in effector CTLs treated with CXCL12, silencing of RGS1 significantly enhanced the phosphorylation of ERK and AKT (as Figure 4 shown in D). These data indicate that RGS1 inhibits the intracellular signaling of G protein-coupled receptors.

[0110] Specifically, Figure 4In: A: The binding of RGS1 to CXCR4, CCR4, CXCR3 but not CCR5 in effector CTLs was detected by co-immunoprecipitation and subsequent Western blotting; B: Effector CTLs were isolated from the peripheral blood of healthy donors and transduced with RGS1 shRNA (shRGS1-1, shRGS1-2), GFP shRNA (shGFP) or empty vector (shvec), and then stimulated with CXCL9, CXCL10, CXCL11, CCL22 or CXCL12, and the levels of cAMP in T cells were examined; C: By preloading the calcium-sensitive fluorescent indicator Fura 2-AM into CXCL12-treated effector CTLs, the intracellular Ca 2+ concentration was determined; D: The phosphorylation and total protein levels of ERK and Akt in CXCL12-treated effector CTLs were detected by Western blotting.

[0111] Example 5

[0112] STAT1 signaling in effector CTLs and Th1 cells upregulates RGS1

[0113] To further explore the mechanism of RGS1 upregulation in effector CTLs and Th1 cells, we electroporated the human T cell line Jurkat cells with a series of pGL3 reporter plasmids (the plasmids contained the upstream sequences of the deleted RGS1 5'-flanking region) and found that the deletion of the sequence from -2000 to -200 bp upstream of the transcription start site (TSS) of RGS1 did not affect PHA-induced luciferase activity, while the deletion to -150 bp completely abolished the PHA-induced effect (as Figure 5 shown in A). Sequence analysis showed that the STAT1 binding site was located between -180 and -167 bp upstream of the RGS1 TSS, and the mutation of four nucleotides in the STAT1 binding site significantly inhibited PHA-induced luciferase activity (as Figure 5 shown in B). In addition, compared with naive CD4 + T cells, the binding of STAT1 to the RGS1 TSS was confirmed by chromatin immunoprecipitation (ChIP) experiments in isolated Th1 cells and polarized Th1 cells (as Figure 5 shown in C). Similarly, the binding of STAT1 to the RGS promoter was also found in effector CTLs and PHA-activated naive CD8 + T cells (as Figure 5 shown in C). Further, the JAK1 / STAT1 inhibitor or shRNA silencing of STAT1 significantly reduced the expression of RGS1 in Th1 and effector CTLs (as Figure 5 shown in D), and enhanced the chemotaxis of Th1 and effector CTLs towards CXCL12 (as Figure 5As shown in Figure E. Overall, the data indicate that the enhanced transcription of RGS1 in effector CTLs and Th1 cells is mediated by STAT1 signaling.

[0114] Specifically, Figure 5 In: A, B: Detection of Jurkat cells against the luciferase reporter gene, which were transfected with a reporter plasmid containing a truncated (A) or mutated (B) RGS promoter and treated with PBS or PHA for 24 h. C: ChIP analysis of the localization of STAT1 at the RGS1 promoter in naive CD4 + T cells, induced Th1 cells (naive CD4 + T cells treated with anti-CD3 / CD28 and IL-12) and isolated Th1 cells (CXCR3 + CD4 + cells) and naive CD8 + T cells with or without PHA treatment, and the localization at the RGS1 promoter in isolated effector CTLs; D, E: Transduction of Th1 cells and effector CTLs with shvec, shGFP, shSTAT1-1 and shSTAT1-2, or treatment with DMSO, the JAK1 / STAT1 inhibitor Fludarabine (FLU) (50 μM) or Ruxolitinib (RUX) (10 μM); where (D) the expression of RGS1 in Th1 cells and effector CTLs in the above cases was detected by qRT-PCR, and (E) the chemotaxis of Th1 cells and effector CTLs to CXCL12 was detected by transwell analysis.

[0115] Example 6

[0116] RGS1 knockdown in adoptively transferred CTLs enhances the recruitment and killing effects of adoptively transferred CTLs in breast cancer PDX

[0117] A human tumor xenograft model (PDX) was constructed by transplanting breast cancer patient tumors into immunodeficient NOD.SCID mice. Based on the PDX model, it was explored whether silencing RGS1 in adoptively transferred T cells could improve the ACT treatment effect by enhancing the recruitment of effector CTLs. Under the monitoring of the IVIS Lumina imaging system, CTLs transfected with RGS1-shRNA (shRGS1-CTL) rather than the empty vector (shvec-CTL) or GFP shRNA (shGFP-CTL) were successfully recruited to the PDX tumors. In addition, triple immunostaining showed that the expression of RGS1 in the transferred CTLs was significantly reduced in the xenografts of mice receiving ACT with RGS1-shRNA transduction (as Figure 6 shown in C). Effector CTLs (CD8 + CD45RO+ The infiltration of (cells) was much higher than that of the corresponding CTLs in mice receiving empty vector or GFP shRNA-transduced CTLs (as shown in Figure 6 C).

[0118] In addition, to study the survival of transferred CTLs, immunohistochemistry was performed in PDX tissues to evaluate the proliferation (CD8 + Ki-67 + ) and apoptosis (CD8 + TUNEL + ) of PDX-infiltrating CTLs. Tumor volume measurements (as shown in Figure 6 A) showed that adoptive transfer of shRGS1-CTLs led to more apoptosis of tumor cells (CK + TUNEL + ) (as shown in Figure 6 B), and effectively inhibited tumor growth.

[0119] In addition to using the above-mentioned single immunotherapy strategy for treatment, this example also studied the anti-tumor effect of the combined application of immune checkpoint inhibition (ICI) and ACT.

[0120] The anti-PD-L1 inhibitor slightly increased the infiltration of transferred CTLs (as shown in Figure 6 C), thereby moderately inhibiting the growth of PDX tumors ( Figure 6 A, B). When the anti-PD-L1 antibody was combined with ACT using shRGS1-transduced CTLs, the infiltration of transferred CTLs was significantly increased (as shown in Figure 6 C, and it can also be seen from the comparison of the effects of PD-L1 combined with shvec-CTL or shGFP-CTL), thereby inducing a large amount of apoptosis of tumor cells (as shown in Figure 6 C), and effectively inhibiting tumor growth (as shown in Figure 6 A).

[0121] In addition, after analyzing CTLs isolated from PDX, it was found that the combination of silencing RGS1 and anti-PD-L1 enabled more effector CTLs to infiltrate into the tumor stroma, and increased the content of perforin and granzyme B in CTLs (as shown in Figure 6 D).

[0122] Overall, these findings suggest that silencing RGS1 in transferred CTLs to enhance the recruitment and migration of effector CTLs to tumors may be an effective anti-cancer method clinically, and can be combined with immune checkpoint inhibition to further improve the efficacy of ACT.

[0123] Obviously, the above embodiments of the present invention are merely examples for clearly illustrating the technical solutions of the present invention, rather than limitations on the specific implementation manners of the present invention. Any modifications, equivalent replacements, improvements, etc. made within the spirit and principle of the claims of the present invention shall be included within the protection scope of the claims of the present invention. SEQUENCE LISTING <110> Sun Yat-sen Memorial Hospital, Sun Yat-sen University <120> Use of RGS1 inhibitor in the preparation of a therapeutic drug for breast cancer tumor-infiltrating lymphocytes <130> RHXW2011512 <160> 2 <170> PatentIn version 3.5 <210> 1 <211> 21 <212> RNA <213> Artificial sequence <400> 1 ccaagaagau uaaagcacca a 21 <210> 2 <211> 21 <212> RNA <213> Artificial sequence <400> 2 gcauucagau gcugcuaaac a 21

Claims

1. Use of an RGS1 inhibitor in the preparation of a therapeutic drug for tumor-infiltrating lymphocytes in breast cancer, characterized in that, The RGS1 inhibitor is siRNA that silences the expression of RGS1. The siRNA is shRGS1-1 or shRGS1-2. The sequence of shRGS1-1 is CCAAG AAGAT TAAAG CACCA A, and the sequence of shRGS1-2 is GCATT CAGAT GCTGC TAAAC A.

2. The use according to claim 1, characterized in that, The drug acts on the RGS1 gene or the regulatory gene of the RGS1 gene to inhibit the expression of the RGS1 gene; The regulatory gene of the RGS1 gene is the STAT1 gene, and the drug inhibits the expression of the RGS1 gene by inhibiting the STAT1 gene.

3. The use according to claim 1, characterized in that, The drug comprises a PD-L1 antibody or the drug is administered in combination with a PD-L1 antibody.

4. The use according to any one of claims 1 to 3, characterized in that, The cells on which the drug acts are selected from Th1-CD4 + T lymphocytes and effector CD8 + T lymphocytes.

5. Use of T lymphocytes for tumor-infiltrating lymphocyte therapy in the preparation of a therapeutic drug for breast cancer, characterized in that, The method for preparing the T lymphocytes comprises the steps of: obtaining T lymphocytes from a donor and screening for the desired subset; constructing a lentiviral vector carrying or expressing an RGS1 inhibitor; incubating the screened T lymphocyte subset with the lentiviral vector to obtain T lymphocytes for treating tumor-infiltrating lymphocytes; The RGS1 inhibitor is siRNA that silences the expression of RGS1. The siRNA is shRGS1-1 or shRGS1-2. The sequence of shRGS1-1 is CCAAG AAGAT TAAAG CACCA A, and the sequence of shRGS1-2 is GCATT CAGAT GCTGCTAAAC A.

Images