Extracellular vesicles connected to molecules and their uses

Abstract

The present disclosure relates to extracellular vesicles (e.g., exosomes) comprising biologically active molecules covalently linked to the extracellular vesicles via an anchoring moiety, which can be used as agents for preventing or treating cancer or other diseases. Also provided herein are methods for producing the extracellular vesicles and methods for using the extracellular vesicles to treat diseases or disorders.

Description

[0001] CROSS-REFERENCE TO RELATED APPLICATIONS

[0002] This PCT application claims the benefit of priority to U.S. Provisional Application No. 62 / 886,941, filed on August 14, 2019, and U.S. Provisional Application No. 62 / 895,398, filed on September 3, 2019, each of which is incorporated herein by reference in its entirety.

[0003] References to sequence listings submitted electronically via EFS-WEB

[0004] The contents of the electronically submitted sequence listing submitted in this application (Name: 4000.057PC02_Seqlisting_ST25.txt, Size: 765,394 bytes; and Creation Date: August 14, 2020) are incorporated herein by reference in their entirety. Technical Field

[0005] The present disclosure provides extracellular vesicles (EVs), such as exosomes, comprising at least one biologically active molecule covalently linked to the extracellular vesicle (e.g., exosome) via an anchoring moiety, which can be used as an agent for preventing or treating cancer and other diseases. Background Art

[0006] Many bioactive compounds have effective biological activity with therapeutic significance. However, these compounds usually show toxicity in non-target organs. One way to limit non-target tissue exposure is to chemically conjugate small molecules to affinity-based reagents (such as antibodies), which can guide therapeutic compounds to specific cell types (Dosio, F. et al., Toxins (Basel) 3 (7): 848-883 (2011)), but this method is limited by the number of target compound molecules that can be connected to antibodies (usually 2-6 molecules per antibody) and the availability / presence of antibodies that specifically bind to targeted, relevant diseased / effector cells but not to non-target cells. These two problems limit the use of antibody-drug conjugates (ADCs) by reducing efficacy and increasing systemic toxicity, respectively. Therefore, there is a need for a delivery system with a higher payload than ADC, which can selectively target specific tissues or organs while limiting the overall systemic exposure to therapeutic compounds.

[0007] EV (e.g., exosomes) are important mediators of intercellular communication. They are also important biomarkers in the diagnosis and prognosis of many diseases (such as cancer). As a drug delivery carrier, EV (e.g., exosomes) provide many advantages over traditional drug delivery methods (e.g., peptide immunity, DNA vaccines) as a new treatment method in many therapeutic areas. However, despite its advantages, the clinical efficacy of many EVs (e.g., exosomes) is limited. For example, dendritic cell-derived exosomes (DEX) were studied in a phase II clinical trial as maintenance immunotherapy after first-line chemotherapy in patients with inoperable non-small cell lung cancer (NSCLC). However, the trial was terminated due to failure to reach the primary endpoint (at least 50% of patients had progression-free survival (PFS) 4 months after chemotherapy cessation). Besse, B., et al., Oncoimmunology 5 (4): e1071008 (2015).

[0008] Therefore, new and more efficient engineered EVs (e.g., exosomes) are needed to better realize the therapeutic uses and other applications of EV-based technologies. Summary of the invention

[0009] The present disclosure relates to an extracellular vesicle (EV) comprising a biologically active molecule (BAM) covalently linked to the EV via an anchoring moiety (AM), wherein the anchoring moiety comprises:

[0010] [AM]-[Linker]n-[BAM] Formula (I)

[0011] Wherein n is any integer. In some aspects, n is any integer between 0 and 10.

[0012] In other aspects, the anchoring moiety comprises a sterol, GM1, a lipid (e.g., a phospholipid or a fatty acid), a vitamin, a small molecule, a peptide, or a combination thereof. For example, the anchoring moiety comprises at least 6 carbon atoms, at least 7 carbon atoms, at least 8 carbon atoms, at least 9 carbon atoms, at least 10 carbon atoms, at least 11 carbon atoms, at least 12 carbon atoms, at least 13 carbon atoms, at least 14 carbon atoms, at least 15 carbon atoms, at least 16 carbon atoms, at least 17 carbon atoms, at least 18 carbon atoms, at least 19 carbon atoms, at least 20 carbon atoms, at least 25 carbon atoms, at least 30 carbon atoms, at least 35 carbon atoms, at least 40 carbon atoms, at least 45 carbon atoms, at least 50 carbon atoms, at least 55 carbon atoms, at least at least 60 carbon atoms, at least 65 carbon atoms, at least 70 carbon atoms, at least 75 carbon atoms, at least 80 carbon atoms, at least 85 carbon atoms, or at least 90 carbon atoms.

[0013] In other aspects, the anchoring moiety comprises a sterol, a steroid, a hopane, a hydroxysteroid, a secosteroid, an analog thereof, or any combination thereof. In some other aspects, the anchoring moiety comprises ergosterol, 7-dehydrocholesterol, cholesterol, 24S-hydroxycholesterol, lanosterol, cycloartenol, fucosterol, sargassum sterol, campesterol, β-sitosterol, sitostanol, fecal sterol, avenasterol, stigmasterol, or any combination thereof.

[0014] In some aspects, the anchoring moiety is cholesterol having the structure:

[0015]

[0016] In some aspects, the anchoring portion has the structure

[0017]

[0018]

[0019] In some aspects, the anchoring moiety comprises a steroid that is dihydrotestosterone, ursutol, agagenin, diosgenin, progesterone, cortisol, or any combination thereof.

[0020] In some aspects, the anchoring moiety comprises a lipid. In other aspects, the anchoring moiety comprises a C 2 -C 60 In some aspects, the anchoring portion comprises C 4 -C 40 , C 2 -C 38 , C 2 -C 36 , C 2 -C 34 , C 2 -C 32 , C 2 -C 30 , C 4 -C 30 , C 2 -C 28 , C 4 -C 28 , C 2 -C 26 , C 4 -C 26 , C 2 -C 24 , C 4 -C 24 , C 6 -C 24 , C 8 -C24 、C 10 -C 24 、C 2 -C 22 、C 4 -C 22 、C 6 -C 22 、C 8 -C 22 、C 10 -C 22 、C 2 -C 20 、C 4 -C 20 、C 6 -C 20 、C 8 -C 20 、C 10 -C 20 、C 2 -C 18 、C 4 -C 18 、C 6 -C 18 、C 8 -C 18 、C 10 -C 18 、C 12 -C 18 、C 14 -C 18 、C 16 -C 18 、C 2 -C 16 、C 4 -C 16 、C 6 -C 16 、C 8 -C 16 、C 10 -C 16 、C 12 -C 16 、C 14 -C 16 、C 2 -C 15 、C 4 -C 15 、C 6 -C 15 、C 8 -C 15 、C 9 -C 15 、C 10 -C 15 、C 11 -C 15、C 12 -C 15 、C 13 -C 15 、C 2 -C 14 、C 4 -C 14 、C 6 -C 14 、C 8 -C 14 、C 9 -C 14 、C 10 -C 14 、C 11 -C 14 、C 12 -C 14 、C 2 -C 13 、C 4 -C 13 、C 6 -C 13 、C 7 -C 13 、C 8 -C 13 、C 9 -C 13 、C 10 -C 13 、C 10 -C 13 、C 11 -C 13 、C 2 -C 12 、C 4 -C 12 、C 6 -C 12 、C 7 -C 12 、C 8 -C 12 、C 9 -C 12 、C 10 -C 12 、C 2 -C 11 、C 4 -C 11 、C 6 -C 11 、C 7 -C 11 、C 8 -C 11 、C 9 -C 11 、C 2 -C 10 、C4 -C 10 , C 2 -C 9 , C 4 -C 9 , C 2 -C 8 , C 2 -C 7 , C 4 -C 7 , C 2 -C 6 or C 4 -C 6 chain.

[0021] In some aspects, the anchoring moiety comprises a straight chain fatty acid, a branched chain fatty acid, an unsaturated fatty acid, a monounsaturated fatty acid, a polyunsaturated fatty acid, a hydroxy fatty acid, a polycarboxylic acid, or any combination thereof. In some aspects, the anchoring moiety comprises a straight chain fatty acid, and the straight chain fatty acid is butyric acid, caproic acid, caprylic acid, capric acid, lauric acid, myristic acid, palmitic acid, stearic acid, arachidic acid, behenic acid, lignoceric acid, hexacosanoic acid, octacosanoic acid, triacontanic acid, and n-dotriacontanic acid, as well as those with an odd number of carbon atoms, such as propionic acid, n-pentanoic acid, heptanoic acid, nonanoic acid, undecanoic acid, tridecanoic acid, pentadecanoic acid, heptadecanoic acid, nonadecanoic acid, heneicosanoic acid, tricosanoic acid, pentacosanoic acid, heptadicosanoic acid, or any combination thereof.

[0022] In some aspects, the anchoring moiety comprises a branched fatty acid selected from the group consisting of isobutyric acid, isohexanoic acid, isooctanoic acid, isodecanoic acid, isolauric acid, 11-methyldodecanoic acid, isomyristic acid, 13-methyl-tetradecanoic acid, isopalmitic acid, 15-methyl-hexadecanoic acid, isostearic acid, 17-methyloctadecanoic acid, isoarachidic acid, 19-methyl-eicosanoic acid, α-ethyl-hexanoic acid, α-hexyldecanoic acid, α-heptylundecanoic acid, 2-decyltetradecanoic acid, 2-undecyltetradecanoic acid, 2-decylpentadecanoic acid, 2-undecylpentadecanoic acid, Fine oxocol 1800 acid (Nissan Chemical Industries, Ltd.), an anteiso fatty acid terminated with an isobutyl group, such as 6-methyl-octanoic acid, 8-methyl-decanoic acid, 10-methyl-dodecanoic acid, 12-methyl-tetradecanoic acid, 14-methyl-hexadecanoic acid, 16-methyl-octadecanoic acid, 18-methyl-eicosanoic acid, 20-methyl-docosanoic acid, 22-methyl-tetracosanoic acid, 24-methyl-hexacosanoic acid and 26-methyloctacosanoic acid, or any combination thereof.

[0023] In some aspects, the anchoring moiety comprises an unsaturated fatty acid, and the unsaturated fatty acid is 4-decenoic acid, decenoic acid, 4-dodecenoic acid, 5-dodecenoic acid, laureic acid, 4-tetradecenoic acid, 5-tetradecenoic acid, 9-tetradecenoic acid, palmitoleic acid, 6-octadecenoic acid, oleic acid, 9-octadecenoic acid, 11-octadecenoic acid, 9-eicosenoic acid, cis-11-eicosenoic acid, cetoleic acid, 13-docosenoic acid, 15-tetradecenoic acid, The present invention can be selected from the group consisting of oleic acid, 17-hexadecenoic acid, 6,9,12,15-hexadecatetraenoic acid, linoleic acid, linolenic acid, α-eleostearic acid, β-eleostearic acid, punicic acid, 6,9,12,15-octadecatetraenoic acid, euphorbic acid, 5,8,11,14-eicosatetraenoic acid, 5,8,11,14,17-eicosapentaenoic acid, 7,10,13,16,19-docosapentaenoic acid, 4,7,10,13,16,19-docosahexaenoic acid, or any combination thereof. In some aspects, the anchoring moiety comprises a hydroxy fatty acid, which is α-hydroxylauric acid, α-hydroxymyristic acid, α-hydroxypalmitic acid, α-hydroxystearic acid, ω-hydroxylauric acid, α-hydroxyarachidic acid, 9-hydroxy-12-octadecenoic acid, ricinoleic acid, α-hydroxybehenic acid, 9-hydroxy-trans-10,12-octadecadienoic acid, kamolenic acid, safranic acid, 9,10-dihydroxystearic acid, 12-hydroxystearic acid, or a combination thereof. In some aspects, the anchoring moiety comprises a polycarboxylic acid, which is oxalic acid, malonic acid, succinic acid, glutaric acid, adipic acid, pimelic acid, suberic acid, azelaic acid, sebacic acid, D,L-malic acid, or any combination thereof.

[0024] In some aspects, the anchoring moiety comprises a phospholipid. In some aspects, the phospholipid is phosphatidylcholine, phosphatidylethanolamine, phosphatidylglycerol, phosphatidylserine, phosphatidic acid, 2-lysophosphatidylcholine, sphingomyelin or any combination thereof. In some aspects, the phospholipid is phosphatidylethanolamine, and the phosphatidylethanolamine is dilauroylphosphatidylethanolamine, dimyristoylphosphatidylethanolamine, dipalmitoylphosphatidylethanolamine, distearoylphosphatidylethanolamine, dioleoylphosphatidylethanolamine, 1-palmitoyl-2-oleylphosphatidylethanolamine, 1-oleyl-2-palmitoylphosphatidylethanolamine, dierucylphosphatidylethanolamine or any combination thereof. In some aspects, the phospholipid is a phosphatidylglycerol, and the phosphatidylglycerol is dilauroylphosphatidylglycerol, dimyristoylphosphatidylglycerol, dipalmitoylphosphatidylglycerol, distearoylphosphatidylglycerol, dioleoylphosphatidylglycerol, 1-palmitoyl-2-oleyl-phosphatidylglycerol, 1-oleyl-2-palmitoyl-phosphatidylglycerol, dierucylphosphatidylglycerol or any combination thereof. In some aspects, the phospholipid is a phosphatidylserine, and the phosphatidylserine is dilauroylphosphatidylserine, dimyristoylphosphatidylserine, dipalmitoylphosphatidylserine, distearoylphosphatidylserine, dioleoylphosphatidylserine, 1-palmitoyl-2-oleyl-phosphatidylserine, 1-oleyl-2-palmitoyl-phosphatidylserine, dierucylphosphatidylserine or any combination thereof. In some aspects, the phospholipid is phosphatidic acid, and the phosphatidic acid is dilauroyl phosphatidic acid, dimyristoyl phosphatidic acid, dipalmitoyl phosphatidic acid, distearoyl phosphatidic acid, dioleoyl phosphatidic acid, 1-palmitoyl-2-oleyl phosphatidic acid, 1-oleyl-2-palmitoyl-phosphatidic acid, dierucyl phosphatidic acid or any combination thereof. In some aspects, the phospholipid is phosphatidylinositol, and the phosphatidylinositol is dilauroyl phosphatidylinositol, dimyristoyl phosphatidylinositol, dipalmitoyl phosphatidylinositol, distearoyl phosphatidylinositol, dioleoyl phosphatidylinositol, 1-palmitoyl-2-oleyl-phosphatidylinositol, 1-oleyl-2-palmitoyl-phosphatidylinositol, dierucyl phosphatidylinositol or any combination thereof. In some aspects, the phospholipid is a symmetric phospholipid, and the symmetric phospholipid is 1,2 dipropionyl sn-glyceryl 3 phosphocholine (03:0PC); 1,2 dibutyryl sn-glyceryl 3 phosphocholine (04:0PC); 1,2 divaleranoyl sn-glyceryl 3 phosphocholine (05:0PC); 1,2 dihexanoyl sn-glyceryl 3 phosphocholine (06:0PC); 1,2 diheptanoyl sn-glyceryl 3 phosphocholine (07:0PC); 1,2 dioctanoyl sn-glyceryl 3 phosphocholine (08:0PC); 1,2 dinonanoyl sn-glyceryl 3 phosphocholine (09:0PC); 1,2 didecanoyl sn-glyceryl 3 phosphocholine (10:0PC);1,2-diundecanoyl sn-glyceryl-3-phosphocholine (11:0PC, DUPC); 1,2-dilauroyl sn-glyceryl-3-phosphocholine (12:0PC); 1,2-ditridecanoyl sn-glyceryl-3-phosphocholine (13:0PC); 1,2-dimyristoyl sn-glyceryl-3-phosphocholine (14:0PC, DMPC); 1,2-dipentadecanoyl sn-glyceryl-3-phosphocholine (15:0PC); 1,2-dipalmitoyl sn-glyceryl-3-phosphocholine (16:0PC, DPPC); 1,2-diphytanoyl sn-glyceryl-3-phosphocholine (4ME 1,2-diheptadecanoyl sn-glyceryl-3-phosphocholine (17:0PC); 1,2-distearoyl sn-glyceryl-3-phosphocholine (18:0PC, DSPC); 1,2-dinonadecanoyl sn-glyceryl-3-phosphocholine (19:0PC); 1,2-diicosanoyl sn-glyceryl-3-phosphocholine (20:0PC); 1,2-diheneicosanoyl sn-glyceryl-3-phosphocholine (21:0PC); 1,2-dibehenoyl sn-glyceryl-3-phosphocholine (22:0PC); 1,2-ditricosanoyl sn-glyceryl-3-phosphocholine Acid choline (23:0PC); 1,2-diisocyanoyl sn-glycero-3-phosphocholine (24:0PC); 1,2-dimyristoyl sn-glycero-3-phosphocholine (14:1(Δ9-cis)PC); 1,2-ditransmyristoyl sn-glycero-3-phosphocholine (14:1(Δ9-trans)PC); 1,2-dipalmitoleoyl sn-glycero-3-phosphocholine (16:1(Δ9-cis)PC); 1,2-ditranspalmitoleoyl sn-glycero-3-phosphocholine (16:1(Δ9-trans)PC); 1,2-diisocyanoyl sn-glycero 1,2-dioleoyl sn-glyceryl-3-phosphocholine (18:1(Δ6-cis)PC); 1,2-dioleoyl sn-glyceryl-3-phosphocholine (18:1(Δ9-cis)PC, DOPC); 1,2-dioleoyl sn-glyceryl-3-phosphocholine (18:1(Δ9-trans)PC); 1,2-dilinoleoyl sn-glyceryl-3-phosphocholine (18:2(cis)PC, DLPC); 1,2-dilinolenoyl sn-glyceryl-3-phosphocholine (18:3(cis)PC, DLnPC); 1,2-di-eicosenoyl sn-glyceryl-3-phosphocholine (20:1(cis)PC, DOPC); C); 1,2-arachidonoyl sn-glycero-3-phosphocholine (20:4 (cis) PC, DAPC); 1,2-erucyl sn-glycero-3-phosphocholine (22:1 (cis) PC); 1,2-didocosahexaenoyl sn-glycero-3-phosphocholine (22:6 (cis) PC, DHAPC); 1,2-dineuroyl sn-glycero-3-phosphocholine (24:1 (cis) PC); 1,2-dihexanoyl sn-glycero-3-phosphoethanolamine (06:0PE); 1,2-dioctanoyl sn-glycero-3-phosphoethanolamine (08:0PE);1,2-didecanoyl sn-glyceryl-3-phosphoethanolamine (10:0PE); 1,2-dilauroyl sn-glyceryl-3-phosphoethanolamine (12:0PE); 1,2-dimyristoyl sn-glyceryl-3-phosphoethanolamine (14:0PE); 1,2-dipentadecanoyl sn-glyceryl-3-phosphoethanolamine (15:0PE); 1,2-dipalmitoyl sn-glyceryl-3-phosphoethanolamine (16:0PE); 1,2-diphytanoyl sn-glyceryl-3-phosphoethanolamine (4ME 16:0PE); 1,2-diheptadecanoyl sn-glyceryl-3-phosphoethanolamine (17:0PE); 1,2-distearoyl sn-glyceryl-3-phosphoethanolamine (18:0PE, DSPE); 1,2-dipalmitoleoyl sn-glyceryl-3-phosphoethanolamine (16:1PE); 1,2-dioleoyl sn-glyceryl-3-phosphoethanolamine (18:1(Δ9-cis)PE, DOPE); 1,2-ditransoleoyl sn-glyceryl-3-phosphoethanolamine (18:1(Δ9-trans)PE); 1,2-dilinoleoyl sn-glyceryl-3-phosphoethanolamine (18:2PE, DLPE); 1,2 dilinolenoyl sn glyceryl 3 phosphoethanolamine (18:3PE, DLnPE); 1,2 diarachidonoyl sn glyceryl 3 phosphoethanolamine (20:4PE, DAPE); 1,2 didocosahexaenoyl sn glyceryl 3 phosphoethanolamine (22:6PE, DHAPE); 1,2 dioctadecenyl sn glyceryl 3 phosphocholine (18:0 diether PC); 1,2 dioleoyl sn glyceryl 3 phosphate racemic (1 glycerol) sodium salt (DOPG) or any combination thereof. ;

[0025] In some aspects, the phospholipid is an asymmetric phospholipid, and the asymmetric phospholipid is 1 myristoyl 2 palmitoyl sn glyceryl 3 phosphocholine (14:0-16:0PC, MPPC); 1 myristoyl 2 stearoyl sn glyceryl 3 phosphocholine (14:0-18:0PC, MSPC); 1 palmitoyl 2 acetyl sn glyceryl 3 phosphocholine (16:0-02:0PC); 1 palmitoyl 2 myristoyl sn glyceryl 3 phosphocholine (16:0-14:0PC, PMPC); 1 palmitoyl 2 stearoyl sn glyceryl 3 phosphocholine (16:0-18:0PC, PSPC); 1 palmitoyl 2 oleoyl sn glyceryl 3 phosphocholine (16: 0-18:1PC, POPC); 1 palmitoyl 2 linoleoyl sn glyceryl 3 phosphocholine (16:0-18:2PC, PLPC); 1 palmitoyl 2 arachidonoyl sn glyceryl 3 phosphocholine (16:0-20:4PC); 1 palmitoyl 2 docosahexaenoyl sn glyceryl 3 phosphocholine (14:0-22:6PC); 1 stearoyl 2 myristoyl sn glyceryl 3 phosphocholine (18:0-14:0PC, SMPC); 1 stearoyl 2 palmitoyl sn glyceryl 3 phosphocholine (18:0-16:0PC, SPPC); 1 stearoyl 2 oleoyl sn glyceryl 3 phosphocholine (18:0-18:1PC, SOPC PC); 1 stearoyl 2 linoleoyl sn glyceryl 3 phosphocholine (18:0-18:2PC); 1 stearoyl 2 arachidonoyl sn glyceryl 3 phosphocholine (18:0-20:4PC); 1 stearoyl 2 docosahexaenoyl sn glyceryl 3 phosphocholine (18:0-22:6PC); 1 oleoyl 2 myristoyl sn glyceryl 3 phosphocholine (18:1-14:0PC, OMPC); 1 oleoyl 2 palmitoyl sn glyceryl 3 phosphocholine (18:1-16:0PC, OPPC); 1 oleoyl 2 stearoyl sn glyceryl 3 phosphocholine (18:1-18:0PC, OSPC); 1 palmitoyl 2 oleoyl sn glyceryl 3 phosphoethanolamine (16:0-18:1PE, POPE); 1 palmitoyl 2 linoleoyl sn glyceryl 3 phosphoethanolamine (16:0-18:2PE); 1 palmitoyl 2 arachidonoyl sn glyceryl 3 phosphoethanolamine (16:0-20:4PE); 1 palmitoyl 2 docosahexaenoyl sn glyceryl 3 phosphoethanolamine (16:0-22:6PE); 1 stearoyl 2 oleoyl sn glyceryl 3 phosphoethanolamine (18:0-18:1PE); 1 stearoyl 2 linoleoyl sn glyceryl 3 phosphoethanolamine (18:0-18:2PE); 1 stearoyl 2 arachidonoyl sn glyceryl 3 phosphoethanolamine (18:0-20:4PE);1 stearoyl 2 docosahexaenoyl sn glyceryl 3 phosphoethanolamine (18:0-22:6PE); 1 oleoyl 2 cholesteryl hemisuccinyl sn glyceryl 3 phosphocholine (OChemsPC) or any combination thereof. ;

[0026] In some aspects, the phospholipid is a lysolipid. In some aspects, the phospholipid is a lysoglycerophospholipid, a lysoglycosphingolipid, a lysophosphatidylcholine, a lysophosphatidylethanolamine, a lysophosphatidylinositol, a lysophosphatidylserine, or any combination thereof. In some aspects, the phospholipid is 1 hexanoyl 2 hydroxy sn glyceryl 3 phosphocholine (06:0 Lyso PC); 1 heptanoyl 2 hydroxy sn glyceryl 3 phosphocholine (07:0 Lyso PC); 1 octanoyl 2 hydroxy sn glyceryl 3 phosphocholine (08:0 Lyso PC); 1 nonanoyl 2 hydroxy sn glyceryl 3 phosphocholine (09:0 Lyso PC); 1 decanoyl 2 hydroxy sn glyceryl 3 phosphocholine (10:0 Lyso PC); 1 undecanoyl 2 hydroxy sn glyceryl 3 phosphocholine (11:0 Lyso PC); 1 lauroyl 2 hydroxy sn glyceryl 3 phosphocholine (12:0 Lyso PC); 1 tridecanoyl 2 hydroxy sn glyceryl 3 phosphocholine (13:0 Lyso PC); 1 myristoyl 2 hydroxy sn glyceryl 3 phosphocholine (14:0 Lyso PC). PC); 1 pentadecanoyl 2 hydroxy sn glyceryl 3 phosphocholine (15:0 Lyso PC); 1 palmitoyl 2 hydroxy sn glyceryl 3 phosphocholine (16:0 Lyso PC); 1 heptadecanoyl 2 hydroxy sn glyceryl 3 phosphocholine (17:0 Lyso PC); 1 stearoyl 2 hydroxy sn glyceryl 3 phosphocholine (18:0 Lyso PC); 1 oleoyl 2 hydroxy sn glyceryl 3 phosphocholine (18:1 LysoPC); 1 nonadecanoyl 2 hydroxy sn glyceryl 3 phosphocholine (19:0 Lyso PC); 1 eicosanoyl 2 hydroxy sn glyceryl 3 phosphocholine (20:0 Lyso PC); 1 behenoyl 2 hydroxy sn glyceryl 3 phosphocholine (22:0 Lyso PC); 1 tetracosanoyl 2 hydroxy sn glyceryl 3 phosphocholine (24:0 Lyso PC); 1 hexadecanoyl 2 hydroxy sn glyceryl 3 phosphocholine (26:0 Lyso PC); 1 myristoyl 2 hydroxy sn glyceryl 3 phosphoethanolamine (14:0 Lyso PE); 1 palmitoyl 2 hydroxy sn glyceryl 3 phosphoethanolamine (16:0 Lyso PE); 1 stearoyl 2 hydroxy sn glyceryl 3 phosphoethanolamine (18:0 Lyso PE); 1 oleoyl 2 hydroxy sn glyceryl 3 phosphoethanolamine (18:1 Lyso PE); 1 hexadecyl sn glyceryl 3 phosphocholine (C16 Lyso PC); or any combination thereof.

[0027] In some aspects, the anchoring moiety comprises a vitamin. In some aspects, the anchoring moiety comprises vitamin D, vitamin K, vitamin E, or any combination thereof. In some aspects, the anchoring moiety further comprises a linker between the biologically active molecule and the anchoring moiety.

[0028] In some aspects, the linker comprises a non-cleavable linker. In some aspects, the non-cleavable linker comprises polyethylene glycol (PEG), glycerol, alkyl, succinimide, maleimide, or any combination thereof. In some aspects, the non-cleavable linker comprises a linker characterized by the formula R3-(O-CH 2 -CH 2 ) n - or R3-(0-CH 2 -CH 2 ) n -O-, wherein R3 is hydrogen, methyl or ethyl, and n is an integer between 2 and 200. In some aspects, the non-cleavable linker comprises diethylene glycol, triethylene glycol, tetraethylene glycol (TEG), hexaethylene glycol (HEG), pentaethylene glycol, or any combination thereof.

[0029] In some aspects, the linker comprises a 2 —CHOH—CH 2 O) n —) polyglycerol (PG), wherein R3 is hydrogen, methyl or ethyl, and n is an integer between 3 and 200. In some aspects, the linker comprises diglycerol, triglycerol, tetraglycerol (TG), pentaglycerol, hexaglycerol (HG), or any combination thereof.

[0030] In some aspects, the linker comprises an alkyl group. In some aspects, the linker comprises an alkenyl group, an alkynyl group, an arylalkyl group, an arylalkenyl group, an arylalkynyl group, a heteroarylalkyl group, a heteroarylalkenyl group, a heteroarylalkynyl group, a heterocyclylalkyl group, a heterocyclylalkenyl group, a heterocyclylalkynyl group, an aryl group, a heteroaryl group, a heterocyclyl group, a cycloalkyl group, a cycloalkenyl group, an alkylarylalkyl group, an alkylarylalkenyl group, an alkylarylalkynyl group, an alkenylarylalkyl group, an alkenylReylalkenyl group, an alkenylarylalkynyl group, an alkynylarylalkyl group, an alkynylarylalkenyl group The invention relates to a cycloalkyl radical comprising the following: cycloalkyl, ...

[0031] In some aspects, the linker includes a cleavable linker. In some aspects, the cleavable linker is a redox cleavable linker, an active oxygen cleavable linker, a pH-dependent cleavable linker, an enzyme cleavable linker, a protease cleavable linker, an esterase cleavable linker, a phosphatase cleavable linker, a photoactivated cleavable linker, a self-degradable linker or any combination thereof. In some aspects, the cleavable linker is a self-degradable linker. In some aspects, the cleavable linker is a cinnamyl, naphthyl, biphenyl, heterocycle, homologous aromatic group, coumarin, furan, thiophene, thiazole, oxazole, isoxazole, pyrrole, pyrazole, pyridine, imidazolide, triazole or any combination thereof.

[0032] In some aspects, the linker has the formula:

[0033] -A a -Y y -

[0034] wherein each -A- is independently an amino acid unit, a is independently an integer from 1 to 12; -Y- is a spacer unit, and y is 0, 1 or 2. In some aspects, the -A a - is a dipeptide, tripeptide, tetrapeptide, pentapeptide or hexapeptide. In some aspects, a is 2 and -A a - is selected from the group consisting of: valine-alanine, valine-citrulline, phenylalanine-lysine, N-methylvaline-citrulline, cyclohexylalanine-lysine and β-alanine-lysine. a - is valine-alanine or valine-citrulline. In some aspects, y is 1. In some aspects, -Y- is a self-immolative spacer. In some aspects, -Y y - having formula (V):

[0035]

[0036] Each R 2 Independently C 1-8 Alkyl, -O-(C 1-8 In some aspects, m is 0, 1 or 2. In some aspects, m is 0.

[0037] In some aspects, the cleavable linker is valine-alanine-p-aminobenzyl carbamate or valine-citrulline-p-aminobenzyl carbamate. In some aspects, -Y- is a non-self-immolative spacer. In some aspects, the non-self-immolative spacer is -Gly- or -Gly-Gly-.

[0038] In some aspects, the anchoring moiety comprises:

[0039]

[0040] In some aspects, the EV comprises an anchor portion selected from SEQ ID NO: 301-324, 401-567, fragments thereof, or combinations thereof, and a linker selected from the linker combinations of Table 1 and Table 2.

[0041] In some aspects, the anchoring portion comprises a scaffold protein. In some aspects, the EV further comprises a scaffold portion. In some aspects, the anchoring portion and / or the scaffold portion is scaffold X. In some aspects, the scaffold X is selected from the group consisting of: prostaglandin F2 receptor negative regulator (PTGFRN protein); basigin (BSG protein); immunoglobulin superfamily member 2 (IGSF2 protein); immunoglobulin superfamily member 3 (IGSF3 protein); immunoglobulin superfamily member 8 (IGSF8 protein); integrin beta-1 (ITGB1 protein); integrin alpha-4 (ITGA4 protein); 4F2 cell surface antigen heavy chain (SLC3A2 protein); a class of ATP transporters (ATP1A1, ATP1A2, ATP1A3, ATP1A4, ATP1B3, ATP2B1, ATP2B2, ATP2B3, ATP2B4 proteins); their functional fragments; and any combination thereof. In some aspects, the scaffold X is a PTGFRN protein or a functional fragment thereof. In some aspects, the scaffold X comprises an amino acid sequence as set forth in SEQ ID NOs: 301-324, fragments thereof, and combinations thereof.

[0042] In some aspects, the anchoring portion and / or the scaffold portion is scaffold Y. In some aspects, the scaffold Y is a scaffold protein capable of anchoring the bioactive molecule on the luminal surface of the extracellular vesicle and / or on the outer surface of the extracellular vesicle. In some aspects, the scaffold Y is selected from the group consisting of: protein kinase C substrate rich in myristoylated alanine (MARCKS protein), protein kinase C substrate-like 1 rich in myristoylated alanine (MARCKSL1 protein), brain acid soluble protein 1 (BASP1 protein), their functional fragments and any combination thereof. In some aspects, the scaffold Y is BASP1 protein or its functional fragment. In some aspects, the scaffold X comprises an amino acid sequence as listed in SEQ ID NO: 401-567, a fragment thereof and a combination thereof.

[0043] In some aspects, the bioactive molecule is connected to the anchoring portion and / or the scaffolding portion on the outer surface of the EV. In some aspects, the bioactive molecule is connected to the anchoring portion and / or the scaffolding portion on the luminal surface of the EV. In some aspects, the bioactive molecule is a polypeptide, a peptide, a polynucleotide (DNA and / or RNA), a chemical compound, or any combination thereof. In some aspects, the bioactive molecule is a chemical compound. In some aspects, the chemical compound is a small molecule. In some aspects, the bioactive molecule includes antisense oligonucleotides (ASO), siRNA, miRNA, shRNA, nucleic acids, or any combination thereof. In some aspects, the bioactive molecule includes peptides, proteins, antibodies, or their antigen-binding fragments, or any combination thereof. In some aspects, the antigen-binding fragments thereof include scFv, (scFv) 2, Fab, Fab', F(ab') 2, F(ab1) 2, Fv, dAb and Fd fragments, bifunctional antibodies, antibody-related polypeptides, or any fragments thereof. In some aspects, the bioactive molecule includes ASO. In some aspects, the ASO targets a transcript, which is a STAT6 transcript, a CEBP / β transcript, a STAT3 transcript, a KRAS transcript, a NRAS transcript, a NLPR3 transcript, a PMP22 transcript, or any combination thereof. In some aspects, the STAT6 transcript comprises SEQ ID NO: 11 or SEQ ID NO: 13. In some aspects, the STAT6 ASO comprises a sequence selected from the group consisting of: SEQ ID NO: 601 to SEQ ID NO: 703. In some aspects, the CEBP / β transcript comprises SEQ ID NO: 21 or SEQ ID NO: 23. In some aspects, the CEBP / β ASO comprises a sequence selected from the group consisting of: SEQ ID NO: 704 to SEQ ID NO: 806. In some aspects, the STAT3 transcript comprises SEQ ID NO: 41 or SEQ ID NO: 43. In some aspects, the STAT3 ASO comprises a sequence selected from the group consisting of: SEQ ID NO: 889 to SEQ ID NO: 988. In some aspects, the NRAS transcript comprises SEQ ID NO: 51 or SEQ ID NO: 53. In some aspects, the NRAS ASO comprises a sequence selected from the group consisting of: SEQ ID NO: 989 to SEQ ID NO: 1088. In some aspects, the NLPR3 transcript comprises SEQ ID NO: 1 or SEQ ID NO: 3. In some aspects, the ASO comprises a sequence selected from the group consisting of: SEQ ID NO: 101 to SEQ ID NO: 200.In some aspects, the KRAS transcript is a KRAS mutant transcript. In some aspects, the KRAS mutant is KRAS G12D. In some aspects, the KRAS transcript comprises SEQ ID NO: 31 or SEQ ID NO: 33. In some aspects, the ASO comprises a sequence selected from the group consisting of: SEQ ID NO: 807 to SEQ ID NO: 888. In some aspects, the PMP22 transcript comprises SEQ ID NO: 58. In some aspects, the ASO comprises a sequence selected from the group consisting of: SEQ ID NO: 62-95 and 201-270.

[0044] In some aspects, the EVs are exosomes.

[0045] In some aspects, the present disclosure relates to a pharmaceutical composition comprising an extracellular vesicle and a pharmaceutically acceptable carrier.

[0046] In some aspects, the present disclosure relates to a method of conjugating a biologically active molecule to an EV, the method comprising attaching an anchoring moiety to the EV; a kit comprising the EV and instructions for use.

[0047] In some aspects, the present disclosure relates to a method of treating or preventing a disease or condition in a subject in need thereof, the method comprising administering the EV to the subject. In some aspects, the disease or condition is cancer, an inflammatory disorder, a neurodegenerative disorder, a central nervous system disease, or a metabolic disease. In some aspects, the EV is administered intravenously, intraperitoneally, nasally, orally, intramuscularly, subcutaneously, parenterally, or intratumorally. BRIEF DESCRIPTION OF THE DRAWINGS

[0048] Figure 1A A table listing various ASO sequences targeting NLPR3 transcripts is shown. The table includes the following information (from left to right): (i) SEQ ID numbers specified only for ASO sequences, (ii) target start and end positions on NLPR3 genomic sequence (SEQ ID NO: 1), (iii) target start and end positions on NLPR3 mRNA sequence (SEQ ID NO: 2), (iv) ASO sequences without any specific design or chemical structure, and (v) ASO sequences with chemical structures. ASOs are from 5' to 3'. The symbols in the chemical structure are as follows: Nb represents LNA; dN represents DNA; 5MdC represents 5-methyl-dC; Nm represents MOE; and s represents phosphorothioate.

[0049] Figure 1BA table listing the various STAT6 ASO sequences described herein and the position of the complementary sequence of each in the mRNA sequence is shown. The ASOs are from 5' to 3'. The symbols in the chemical structure are as follows: Nb represents LNA; dN represents DNA; 5MdC represents 5-methyl-dC; Nm represents MOE; and s represents phosphorothioate.

[0050] Figure 1C A table listing the various CEBP / β ASO sequences described herein and the position of the complementary sequence of each in the mRNA sequence is shown. The ASOs are from 5' to 3'. The symbols in the chemical structures are as follows: Nb represents LNA; dN represents DNA; 5MdC represents 5-methyl-dC; Nm represents MOE; and s represents phosphorothioate.

[0051] Figure 1D A table listing the various STAT3 ASO sequences described herein and the position of the complementary sequence of each in the mRNA sequence is shown. The ASOs are from 5' to 3'. The symbols in the chemical structure are as follows: Nb represents LNA; dN represents DNA; 5MdC represents 5-methyl-dC; Nm represents MOE; and s represents phosphorothioate.

[0052] Figure 1E A table listing the various NRas ASO sequences described herein and the position of the complementary sequence of each in the mRNA sequence is shown. The ASO is from 5' to 3'. The symbols in the chemical structure are as follows: Nb represents LNA; dN represents DNA; 5MdC represents 5-methyl-dC; Nm represents MOE; and s represents phosphorothioate.

[0053] Figure 1F A table listing the various KRAS ASO sequences described herein and the position of the complementary sequence of each in the pre-mRNA (SEQ ID NO: 30) or mRNA sequence (SEQ ID NO: 32) is shown. The ASOs are from 5' to 3'. The symbols in the chemical structure are as follows: Nb represents LNA; dN represents DNA; 5MdC represents 5-methyl-dC; Nm represents MOE; and s represents phosphorothioate.

[0054] Figure 2A-2C are monocytes ( Figure 2A ), M0 macrophages ( Figure 2B ) and mouse BMDM ( Figure 2C ). The NLRP3 pathway was activated in each sample type by treatment with LPS for 3 hours and ATP for 3 hours. Samples were then treated with increasing concentrations of MCC950 (log μM), as indicated, and IL-1β levels (pg / mL) were measured.

[0055] Figure 3A is a timeline illustrating the dosing and sample collection schedule for intraperitoneal LPS challenge in mice. Figure 3B is a graphical representation of serum IL-1β levels in mouse sera following administration of increasing amounts of MCC950.

[0056] Figures 4A-4D is a graphical representation of Cy5 levels as detected by fluorescence (MFI) and normalized to PBS control. Figure 4A ),liver( Figure 4B ),spleen( Figure 4C ) and tumors (CT26; Figure 4D ) were used as a marker for uptake of exosomes containing Cy5 ASO ("Exo ASO"; left) or free ASO (right) in various cell types isolated from . The horizontal line represents the mean MFI. Figure 4E-4J are fluorescent images of bone marrow tissue samples obtained from two donors, showing the difference between the samples and the PBS negative control ( Figures 4I-4J ), compared with exosomes containing Cy5-reporter ASO ( Figures 4E-4F ) or free ASO ( Figure 4G-4H ) intake.

[0057] Figure 5A-5B The expression of STAT6 in polarized macrophages was detected after treatment with STAT6 Exo ASO, STAT6 free ASO or scrambled Exo ASO (negative control). Figure 5A ) and CD163( Figure 5B ) as indicated ( Figure 5A-5B ).

[0058] Figure 5C-5D The expression of STAT6 in polarized macrophages was detected after treatment with STAT6 Exo ASO, STAT6 free ASO or scrambled Exo ASO (negative control). Figure 5C ) and CD163( Figure 5D ) as indicated ( Figure 5C-5D ).

[0059] Figures 6A-6J TGFβ1 ( Fig. 6A )、CD163( Figure 6B )、STAT5b( Figure 6C )、STAT6( Fig.6D )、CEBP / β( Fig. 6E )、IL12β( Fig. 6F )、AIF1( Figure 6G )、MYC( Figure 6H )、HLA DQA( Fig.6I ) and CD74(MIF)( Fig. 6A ) is a graphical representation of the expression of .

[0060] Figures 7A-7F Is used to isolate CD11b + Graphical representation of the results of flow cytometry of cells. Figures 7A-7C Before treatment ( Fig. 7A ), and using negative control (scrambled Exo ASO; Figure 7B ) or treated with Exo-ASO( Figure 7C ) after treatment with CD45. Figure 7D-7F Before treatment ( Fig.7D ), and using negative control (scrambled Exo ASO; Fig. 7E ) or treated with Exo-ASO( Figure 7F ) after treatment with CD11b. Figure 7G It was shown that tumor volume was significantly lower in Exo-STAT6-ASO-treated mice and Exo-CEBP / β-ASO-treated mice relative to mice treated with scrambled Exo-ASO controls, and mice treated with Exo-STAT6-ASO or Exo-CEBP / β-ASO tended to have smaller tumors compared to mice treated with STAT6 free ASO.

[0061] Figures 8A-8C In the case of exposure to scrambled Exo-ASO ( Figures 8A-8C )、STAT6 free ASO( Fig. 8A and 8C )、CEBP / β free ASO( Figure 8B )、STAT6-Exo-ASO( Fig. 8A and 8C ) or CEBP / β-Exo-ASO( Figures 8B-8C ), STAT6 was expressed in CD11b-enriched cells compared with non-enriched cells. Fig. 8A )、CEBP / β( Figure 8B ) and ARG1( Figure 8C ) is a graphical representation of the expression of .

[0062] Figures 9A-9LSTAT6 ( Fig.9A )、CEBP / β( Fig. 9B )、TGFβ1( Fig. 9C )、STAT3( Fig.9D )、SIRP-α( Fig.9E )、CD47( Fig.9F )、NOS2( Figure 9G )、ARG1( Figure 9H )、CD206( Fig.9I )、CD274( Figure 9J )、NLRP3( Figure 9K )、CSF1R( Figure 9L )、CD36( Figure 9M )、STAB1( Figure 9N )、IL13( Fig.9O )、PI3KG( Figure 9P )、LY6C( Figure 9Q ), LY6G( Figure 9R )、IFNβ1( Figure 9S )、IFNγ( Figure 9T )、IFNα1( Figure 9U ) and IL6Rα( Figure 9V ) is a graphical representation of the expression of .

[0063] Fig. 10A and 10C As indicated, STAT6 ( Fig. 10A ) and TGFβ1( Fig. 10C ) is a graphical representation of normalized gene expression (%).

[0064] Fig. 10B and 10D As indicated, CEBP / β ( Fig. 10B ) and TGFβ1( Fig. 10D ) is a graphical representation of normalized gene expression (%).

[0065] Fig.11is a graphical representation of exosome uptake in lung TD2 as evidenced by Cy5 levels following nasal administration of negative control (-C) or Exo-ASO-Cy5 ("IN") to naive mice or mice treated with bleomycin to induce pulmonary fibrosis ("bleo").

[0066] Figures 12A-12H are images of fluorescence in situ hybridization to detect exosome uptake in normal lung tissue and induced fibrotic lung tissue.

[0067] Figures 13A-13H are images of in situ hybridization to detect exosome uptake in normal lung tissue and induced fibrotic lung tissue.

[0068] Fig.13I is a graphical representation showing the saturation levels in in situ hybridization images, indicating the levels of exosome uptake in normal and fibrotic tissues.

[0069] Figures 14A-14F Figure 2 is an image of fluorescence in situ hybridization to detect exosome uptake in lung tissues in Hepa1-6 mice.

[0070] Figures 15A-15F are images of in situ hybridization to detect exosome uptake in lung tissues in Hepa1-6 mice.

[0071] Figures 16A-16J Shown are the results of various IC50 experiments using NRas ASO.

[0072] Figures 17A-17N Shown are the results of various IC50 experiments using STAT3 ASOs.

[0073] Fig.18 Shown is a graph depicting the results of a STAT3 ASO experiment showing overall mRNA depletion.

[0074] Fig.19 Shown is a graph depicting the results of the NRas ASO experiment showing overall mRNA depletion.

[0075] Fig. 20 Shown are the tumor volume response curves after inoculation using STAT3 Exo-ASO and STAT3 free ASO.

[0076] Fig.21 Shown are STAT3 gene expression profile responses using STAT3, Exo-ASO, STAT3 free ASO, and STAT3 free ASO 2X.

[0077] Fig. 22Shown are the percentages of infiltrating MDSC / CD45 (CD11b high F40 / 80 high / CD45) after exposure to PBS, scrambled Exo-ASO, STAT3 Exo-ASO MOE, and STAT3 free ASO MOE.

[0078] Fig.23 Shown are the percentages of infiltrating MDSC / total MDSC (Ly6G high CD11b high / IA / IE low) after exposure to PBS, scrambled Exo-ASO, STAT3 Exo-ASO MOE, and STAT3 free ASO MOE.

[0079] Fig.24 Shown are normalized mRNA counts after treatment with PBS, scrambled Exo-ASO, STAT3 Exo-ASO, and STAT3 free ASO.

[0080] Fig.25 A table is presented showing that the amount of ASO molecules loaded per engineered exosome is affected by the linker structure. The structures of the constructs used are also shown.

[0081] Fig.26 A table is presented showing that the amount of ASO molecules loaded per native exosome is affected by the linker structure. The structures of the constructs used are also shown.

[0082] Figures 27A-27C The results show that the efficacy of Exo-ASO is affected by the ASO linker structure. The structures of constructs C1-C9, T1-T9 and L1-L3 are Fig.25 Those described in . Fig.27A The efficacy of the construct with a cholesterol-C6 lipid anchor is shown. Fig.27B The efficacy of constructs with tocopherol-C8 (L1) or tocopherol palmitate-C6 (L2 and L3) lipid anchors is shown. Fig.27C The efficacy of the construct with a cholesterol-TEG lipid anchor is shown.

[0083] Fig.28 is a table showing the sequences of ASO molecules targeting Pmp22.

[0084] Fig.29 is a table showing additional sequences of ASO molecules targeting Pmp22. DETAILED DESCRIPTION

[0085] The present disclosure relates to extracellular vesicles (EVs) (e.g., exosomes), comprising at least one biologically active molecule covalently linked to the EVs (e.g., exosomes) via an anchoring moiety; and uses of the extracellular vesicles. Non-limiting examples of various aspects are shown in the present disclosure.

[0086] Before describing the present disclosure in more detail, it should be understood that the present invention is not limited to the specific compositions or method steps described, and therefore such compositions or method steps may of course vary. As will be apparent to those skilled in the art after reading the present disclosure, each individual aspect described and illustrated herein has discrete components and features that can be easily separated or combined with features of any of the other several aspects without departing from the scope or spirit of the present invention. Any narrated method can be performed in the order of events narrated or in any other order that is logically possible.

[0087] The headings provided herein do not limit the various aspects of the disclosure, which can be defined by reference to the entire specification. It should also be understood that the terminology used herein is for the purpose of describing particular aspects only, and is not intended to be limiting, as the scope of the disclosure will be limited only by the appended claims.

[0088] Accordingly, the terms defined immediately below are more fully defined by reference to the Specification as a whole.

[0089] I. Definitions

[0090] In order to make this specification more easily understood, certain terms are first defined. Additional definitions are set forth throughout the detailed description.

[0091] It should be noted that the term "a or an" entity refers to one or more of said entities; for example, "a nucleotide sequence" should be understood to mean one or more nucleotide sequences. Therefore, the terms "a or an", "one or more", and "at least one" are used interchangeably herein. It should be further noted that the claims may be drafted to exclude any optional elements. Therefore, this statement is intended to serve as a prior basis for the use of such exclusive terms as "solely", "only", etc., in conjunction with the description of claim elements, or for the use of a "negative" limitation.

[0092] Furthermore, "and / or" as used herein should be considered to specifically disclose that each of the two specified features or components is present with or without the other. Thus, the term "and / or" as used in phrases such as "A and / or B" is intended to include "A and B," "A or B," "A" (alone), and "B" (alone). Similarly, the term "and / or" as used in phrases such as "A, B, and / or C" is intended to include each of the following aspects: A, B, and C; A, B or C; A or C; A or B; B or C; A and C; A and B; B and C; A (alone); B (alone); and C (alone).

[0093] It should be understood that wherever aspects are described herein with the phrase "comprising," other similar aspects described with "consisting of" and / or "consisting essentially of" are also provided.

[0094] Unless otherwise defined, all technical and scientific terms used herein have the same meaning as commonly understood by one of ordinary skill in the art to which the present disclosure relates. For example, the Concie Dictionary of Biomedicine and Molecular Biology, Juo, Pei-Show, 2nd edition, 2002, CRC Press; The Dictionary of Cell and Molecular Biology, 3rd edition, 1999, Academic Press; and the Oxford Dictionary Of Biochemistry And Molecular Biology, Revised, 2000, Oxford University Press provide a general dictionary of many of the terms used in the present disclosure for one of ordinary skill.

[0095] Units, prefixes and symbols are expressed in their international system of units (Système International de Unites) (SI) recognized forms. Numerical ranges include the numerical values ​​that define the range. In the case of enumerated value ranges, it should be understood that each intermediate integer value and each fraction thereof between the enumerated upper and lower limits of the range, and each subrange between such values ​​are also specifically disclosed. The upper and lower limits of any range may be independently included in the range or excluded from the range, and each range including any one of the two limits, neither of the two limits, or both limits are included is also covered in the present disclosure. Therefore, the ranges listed herein should be understood as abbreviations for all values ​​(including the enumerated endpoints) in the range. For example, a range of 1 to 10 is understood to include any numerical value, numerical combination or subrange from the group consisting of 1, 2, 3, 4, 5, 6, 7, 8, 9 and 10.

[0096] Where values ​​are explicitly enumerated, it is understood that values ​​of quantities or amounts that are substantially the same as the enumerated values ​​are also within the scope of the present disclosure. Where combinations are disclosed, each subcombination of the elements of the combination is also specifically disclosed and within the scope of the present disclosure. Conversely, where different elements or groups of elements are disclosed separately, combinations of the elements or groups of elements are also disclosed. Where any element of the present disclosure is disclosed as having multiple alternatives, embodiments of the present disclosure in which each alternative is excluded, either individually or in combination with other alternatives, are also hereby disclosed; more than one element of the present disclosure may have such exclusions, and all combinations of elements with such exclusions are hereby disclosed.

[0097] Nucleotide is referred to by its generally accepted single letter code.Unless otherwise indicated, nucleotide sequence is written from left to right in 5' to 3' direction.Nucleotide is referred to herein by its well-known single letter symbol recommended by IUPAC-IUB Biochemical Nomenclature Committee.Therefore, A represents adenine, C represents cytosine, G represents guanine, T represents thymine, and U represents uracil.

[0098] Amino acid sequences are written left to right in amino to carboxyl orientation.Amino acids are referred to herein by either their commonly known three letter symbols or by the one-letter symbols recommended by the IUPAC-IUB Biochemical Nomenclature Commission.

[0099] The term "about" is used herein to mean approximately, roughly, about, or around. When the term "about" is used in conjunction with a numerical range, it modifies the range by extending the boundaries above and below the numerical values ​​set forth. In general, the term "about" can modify a numerical value above or below the set forth value by, for example, a 10% variation upward or downward (increased or decreased).

[0100] The terms "administration", "administering" and grammatical variations thereof refer to the introduction of a composition such as an EV (e.g., exosome) of the present disclosure into a subject by a pharmaceutically acceptable route. A composition such as an EV (e.g., exosome) of the present disclosure is introduced into a subject by any suitable route, including intratumoral, oral, pulmonary, intranasal, parenteral (intravenous, intraarterial, intramuscular, intraperitoneal or subcutaneous), rectal, intralymphatic, intrathecal, periocular or topical. Administration includes self-administration and administration by another person. A suitable route of administration allows the composition or agent to perform its intended function. For example, if the suitable route is an intravenous route, the composition is administered by introducing the composition or agent into a vein of the subject.

[0101] As used herein, the term "agonist" refers to a molecule that binds to a receptor and activates the receptor to produce a biological response. Receptors can be activated by endogenous or exogenous agonists. Non-limiting examples of endogenous agonists include hormones, neurotransmitters, and cyclic dinucleotides. Non-limiting examples of exogenous agonists include drugs, small molecules, and cyclic dinucleotides. Agonists can be full agonists, partial agonists, or inverse agonists.

[0102] The term "amino acid substitution" refers to replacing the amino acid residue present in a parent or reference sequence (e.g., wild-type sequence) with another amino acid residue. Amino acids can be substituted in a parent or reference sequence (e.g., wild-type polypeptide sequence), for example, via chemical peptide synthesis or by recombinant methods known in the art. Therefore, reference to "substitution at position X" refers to substitution of the amino acid present at position X with an alternative amino acid residue. In some aspects, the substitution pattern can be described according to the scheme AnY, wherein A is a single-letter code corresponding to the amino acid present naturally or originally at position n, and Y is a substituted amino acid residue. In other aspects, the substitution pattern can be described according to the scheme An(YZ), wherein A is a single-letter code corresponding to the amino acid residue present naturally or originally at substitution position n, and Y and Z are alternative substitution amino acid residues that can replace A.

[0103] As used herein, the term "antagonist" refers to a molecule that blocks or inhibits an agonist-mediated response, rather than a molecule that itself initiates a biological response when bound to a receptor. Many antagonists achieve their effectiveness by competing with endogenous ligands or substrates at structurally defined binding sites on receptors. Non-limiting examples of antagonists include alpha blockers, beta blockers, and calcium channel blockers. Antagonists can be competitive antagonists, non-competitive antagonists, or non-competitive antagonists.

[0104] As used herein, the term "antibody" encompasses immunoglobulins (whether naturally occurring or partially or completely synthetically produced) and fragments thereof. The term also covers any protein having a binding domain homologous to an immunoglobulin binding domain. "Antibody" also includes polypeptides comprising a framework region from an immunoglobulin gene or a fragment thereof that specifically binds and recognizes an antigen. The use of the term antibody is intended to include complete antibodies, polyclonal antibodies, monoclonal antibodies and recombinant antibodies, fragments thereof, and also includes single-chain antibodies, humanized antibodies, murine antibodies, chimeric monoclonal antibodies, mouse-human monoclonal antibodies, mouse-primate monoclonal antibodies, primate-human monoclonal antibodies, anti-idiotypic antibodies, antibody fragments (such as, for example, scFv, (scFv) 2 , Fab, Fab' and F(ab') 2 、F(ab1) 2, Fv, dAb and Fd fragments), bifunctional antibodies and antibody-related polypeptides. Antibodies include bispecific antibodies and multispecific antibodies, as long as they exhibit the desired biological activity or function. In some aspects of the present disclosure, the biologically active molecule is an antibody or a molecule comprising an antigen-binding fragment thereof.

[0105] The terms "antibody-drug conjugate" and "ADC" are used interchangeably and refer to an antibody covalently linked, for example, to one or more therapeutic agents (sometimes referred to herein as agents, drugs, or active pharmaceutical ingredients). In some aspects of the disclosure, the biologically active molecule is an antibody-drug conjugate.

[0106] As used herein, the term "approximately" when applied to one or more target values ​​refers to a value similar to the reference value set forth. In certain aspects, the term "approximately" refers to a range of values ​​within (greater than or less than) 10%, 9%, 8%, 7%, 6%, 5%, 4%, 3%, 2%, 1% or less in either direction of the reference value set forth, unless otherwise stated or otherwise apparent from the context (except where such a value would exceed 100% of the possible value).

[0107] "Aryl" refers to a carbocyclic aromatic group. Examples of aryl groups include, but are not limited to, phenyl, naphthyl, and anthracenyl. A carbocyclic aromatic group may be unsubstituted or substituted with one or more groups including, but not limited to, -C 1-8 Alkyl, -O-(C 1-8 alkyl), -aryl, -C(O)R', -OC(O)R', -C(O)OR', -C(O)NH 2 、-C(O)NHR'、-C(O)N(R') 2 -、-NHC(O)R'、-S(O) 2 R', -S(O)R', -OH, -halogen, -N 3 、-NH 2 、-NH(R')、-N(R') 2 and –CN, where each R' is independently H, -C 1-8 Alkyl or aryl.

[0108] The term "arylene" refers to an aryl group having two covalent bonds and which may be in an ortho, meta, or para configuration as shown in the following structure:

[0109]

[0110] The phenyl group may be unsubstituted or substituted with up to four groups including but not limited to: -C 1-8 Alkyl, -O-(C 1-8alkyl), -aryl, -C(O)R', -OC(O)R', -C(O)OR', -C(O)NH 2 、-C(O)NHR'、-C(O)N(R') 2 -、-NHC(O)R'、-S(O) 2 R', -S(O)R', -OH, -halogen, -N 3 、-NH 2 、-NH(R')、-N(R') 2 and –CN, where each R' is independently H, -C 1-8 Alkyl or aryl.

[0111] As used herein, the term "bioactive molecule" refers to any molecule that can be connected to an EV (e.g., an exosome) via an anchoring moiety, wherein the molecule can have a therapeutic or prophylactic effect in a subject in need, or can be used for diagnostic purposes. Thus, for example, the term bioactive molecule includes proteins (e.g., antibodies, proteins, polypeptides, and derivatives, fragments, and variants thereof), lipids and derivatives thereof, carbohydrates (e.g., glycan moieties in glycoproteins), or small molecules. In some aspects, the bioactive molecule is a radioactive isotope. In some aspects, the bioactive molecule is a detectable moiety, such as a radionuclide, a fluorescent molecule, or a contrast agent.

[0112] As used herein, the term "C 1-8 "Alkyl" refers to a straight or branched chain saturated hydrocarbon having 1 to 8 carbon atoms. Representative "C 1-8 “Alkyl” includes, but is not limited to, methyl, ethyl, n-propyl, n-butyl, n-pentyl, n-hexyl, n-heptyl, n-octyl, isopropyl, sec-butyl, isobutyl, tert-butyl, isopentyl and 2-methylbutyl.

[0113] The term "C 1-10 "Alkylene" refers to a group of the formula -(CH 2 ) 1-10 - a saturated straight chain hydrocarbon group. 1-10 Examples of the alkylene group include a methylene group, an ethylene group, a propylene group, a butylene group, a pentylene group, a hexylene group, a heptylene group, an octylene group, a nonylene group, and a decylene group.

[0114] The term "C 3-8 "Carbocycle" refers to a 3-, 4-, 5-, 6-, 7- or 8-membered saturated or unsaturated non-aromatic carbon ring. Representative C 3-8 Carbocycles include, but are not limited to, cyclopropyl, cyclobutyl, cyclopentyl, cyclopentadienyl, cyclohexyl, cyclohexenyl, 1,3-cyclohexadienyl, 1,4-cyclohexadienyl, cycloheptyl, 1,3-cycloheptadienyl, 1,3,5-cycloheptatrienyl, cyclooctyl, and cyclooctadienyl. 3-8The carbocyclic group may be unsubstituted or substituted with one or more groups including but not limited to: -C 1-8 Alkyl, -O-(C 1-8 alkyl), aryl, -C(O)R', -OC(O)R', -C(O)OR', -C(O)NH 2 、-C(O)NHR'、-C(O)N(R') 2 -、NHC(O)R'、-S(O) 2 R', -S(O)R', -OH, -halogen, -N 3 、-NH 2 、-NH(R')、-N(R') 2 and –CN, where each R' is independently H, -C 1-8 Alkyl or aryl.

[0115] The term "C 3-8 "Carbocyclo" refers to a C ring as defined above in which one or more hydrogen atoms of the carbon ring are replaced by a bond. 3-8 Carbocyclic group.

[0116] The term "C 3-8 "Heterocycle" refers to an aromatic or non-aromatic C 3-8 A carbocyclic ring wherein one to four ring carbon atoms are independently replaced by heteroatoms selected from the group consisting of O, S and N. 3-8 Representative examples of heterocycles include, but are not limited to, benzofuranyl, benzothiophene, indolyl, benzopyrazolyl, coumarinyl, isoquinolinyl, pyrrolyl, thienyl, furanyl, thiazolyl, imidazolyl, pyrazolyl, triazolyl, quinolinyl, pyrimidinyl, pyridinyl, pyridonyl, pyrazinyl, pyridazinyl, isothiazolyl, isoxazolyl, and tetrazolyl. 3-8 The heterocyclic ring may be unsubstituted or substituted with up to seven groups including, but not limited to, the following: -C 1-8 Alkyl, -O-(C 1-8 alkyl), -aryl, -C(O)R', -OC(O)R', -C(O)OR', -C(O)NH 2 、-C(O)NHR'、-C(O)N(R') 2 -、-NHC(O)R'、-S(O) 2 R', -S(O)R', -OH, -halogen, -N 3 、-NH 2 、-NH(R')、-N(R') 2 and –CN, where each R' is independently H, -C 1-8 Alkyl or aryl.

[0117] The term "C 3-8"Heterocyclo" refers to a C 3-8 Heterocyclic group. 3-8 The heterocyclyl group may be unsubstituted or substituted with up to six groups including, but not limited to, the following: -C 1-8 Alkyl, -O-(C 1-8 alkyl), -aryl, -C(O)R', -OC(O)R', -C(O)OR', -C(O)NH 2 、-C(O)NHR'、-C(O)N(R') 2 -、-NHC(O)R'、-S(O) 2 R', -S(O)R', -OH, -halogen, -N 3 、-NH 2 、-NH(R')、-N(R') 2 and –CN, where each R' is independently H, -C 1-8 Alkyl or aryl.

[0118] A "conservative amino acid substitution" is an amino acid substitution in which an amino acid residue is replaced by an amino acid residue with a similar side chain. Families of amino acid residues with similar side chains have been defined in the art, including basic side chains (e.g., lysine, arginine, histidine), acidic side chains (e.g., aspartic acid, glutamic acid), uncharged polar side chains (e.g., glycine, asparagine, glutamine, serine, threonine, tyrosine, cysteine), non-polar side chains (e.g., alanine, valine, leucine, isoleucine, proline, phenylalanine, methionine, tryptophan), beta-branched side chains (e.g., threonine, valine, isoleucine), and aromatic side chains (e.g., tyrosine, phenylalanine, tryptophan, histidine). Thus, if an amino acid in a polypeptide is replaced by another amino acid from the same side chain family, the substitution is considered conservative. In another aspect, a string of amino acids can be conservatively replaced by a structurally similar string that differs in the order and / or composition of the side chain family members.

[0119] As used herein, the term "conserved" refers to nucleotides or amino acid residues of polynucleotide sequences or polypeptide sequences that are not changed at the same position in two or more sequences being compared, respectively. Relatively conserved nucleotides or amino acids are those that are conserved between relatively related sequences compared to nucleotides or amino acids that occur elsewhere in the sequence.

[0120] In some aspects, if two or more sequences are 100% identical to each other, they are referred to as "fully conserved". In some aspects, if two or more sequences are at least 70% identical, at least 80% identical, at least 90% identical, or at least 95% identical to each other, they are referred to as "highly conserved". In some aspects, if two or more sequences are about 70% identical, about 80% identical, about 90% identical, about 95%, about 98% or about 99% identical to each other, they are referred to as "highly conserved". In some aspects, if two or more sequences are at least 30% identical, at least 40% identical, at least 50% identical, at least 60% identical, at least 70% identical, at least 80% identical, at least 90% identical, or at least 95% identical to each other, they are referred to as "conserved". In some aspects, two or more sequences are referred to as "conserved" if they are about 30% identical, about 40% identical, about 50% identical, about 60% identical, about 70% identical, about 80% identical, about 90% identical, about 95% identical, about 98% identical, or about 99% identical to each other. Conservation of sequence can apply to the entire length of a polynucleotide or polypeptide or to portions, regions, or features thereof.

[0121] As used herein, the term "conventional EV protein" refers to a protein that was previously known to be enriched in EVs.

[0122] As used herein, the term "conventional exosomal proteins" refers to proteins previously known to be enriched in exosomes, including but not limited to CD9, CD63, CD81, PDGFR, GPI anchor proteins, lactadherins LAMP2 and LAMP2B, fragments thereof, or peptides bound thereto.

[0123] As used herein, the term "derivative" refers to an EV (e.g., exosome) component (e.g., protein, such as Scaffold X and / or Scaffold Y, lipid or carbohydrate) or a bioactive molecule (e.g., polypeptide, polynucleotide, lipid, carbohydrate, antibody or fragment thereof, PROTAC, etc.) that has been chemically modified to introduce a reactive maleimide group or a thiol group that is susceptible to reaction with a maleimide group. For example, an antibody modified with a bifunctional reagent comprising (i) a group that reacts, for example, with a free amino group and (ii) a maleimide group can produce an antibody derivative comprising a reactive maleimide group that can react with a free thiol group in a Scaffold X protein on an EV (e.g., exosome). Conversely, a Scaffold X on an EV (e.g., exosome) can be modified with a bifunctional reagent comprising (i) a group that reacts, for example, with a free amino group and (ii) a maleimide group, thereby producing a Scaffold X derivative comprising a reactive maleimide group that can react with a free thiol group in a bioactive molecule (e.g., antibody).

[0124] The terms "excipient" and "carrier" are used interchangeably and refer to an inert substance added to a pharmaceutical composition to further facilitate administration of a compound.

[0125] As used herein, the terms "extracellular vesicle", "EV" and grammatical variants thereof are used interchangeably and refer to a cell-derived vesicle comprising a membrane encapsulating an internal space. Extracellular vesicles include all membrane-bound vesicles (e.g., exosomes, nanovesicles) whose diameter is less than the diameter of the cell from which they are derived. In some aspects, the diameter of the extracellular vesicle is in the range of 20nm to 1000nm, and may be contained in the internal space (i.e., cavity), displayed on the outer surface of the extracellular vesicle and / or across the membrane. In some aspects, the payload may include nucleic acids, proteins, carbohydrates, lipids, small molecules and / or combinations thereof. In certain aspects, the extracellular vesicle comprises a scaffold portion. By way of example and not limitation, extracellular vesicles include apoptotic bodies, cell fragments, vesicles derived from cells by direct or indirect manipulation (e.g., by continuous extrusion or treatment with alkaline solutions), organelles containing vesicles, and vesicles produced by living cells (e.g., by direct plasma membrane budding or fusion of late endosomes with the plasma membrane). Extracellular vesicles can be derived from living or dead organisms, explanted tissues or organs, prokaryotic or eukaryotic cells, and / or cultured cells. In some aspects, extracellular vesicles are produced by cells expressing one or more transgenic products.

[0126] As used herein, the term "exosome" refers to an extracellular vesicle with a diameter between 20-300nm (e.g., between 40-200nm). Exosomes include a membrane that encapsulates an internal space (i.e., a cavity), and in some aspects, can be produced from cells (e.g., production cells) by direct plasma membrane budding or by fusion of late endosomes with plasma membranes. In certain aspects, exosomes include a scaffold portion. As described below, exosomes may be derived from production cells and separated from production cells based on their size, density, biochemical parameters, or a combination thereof. In some aspects, the exosomes disclosed herein are produced by cells expressing one or more transgenic products.

[0127] In some aspects, the EVs (e.g., exosomes, e.g., nanovesicles) of the present disclosure are engineered by covalently linking at least one biologically active molecule (e.g., a protein such as an antibody or ADC, an RNA or DNA such as an antisense oligonucleotide, a small molecule drug, a toxin) to the EVs (e.g., exosomes, e.g., nanovesicles) via an anchoring moiety.

[0128] In some aspects, the EV (e.g., exosome or nanovesicle) of the present disclosure may be contained in the internal space (i.e., cavity), displayed on the external (external / exterior) surface or internal (cavity) surface of the EV and / or various macromolecular payloads across the membrane. In some aspects, the payload may include, for example, nucleic acids, proteins, carbohydrates, lipids, small molecules and / or combinations thereof. In certain aspects, EV (e.g., exosome) comprises a scaffold portion (e.g., scaffold X). Extracellular vesicles (e.g., exosomes) may be derived from living or dead organisms, explanted tissues or organs, prokaryotic or eukaryotic cells and / or cultured cells. In some aspects, EV (e.g., exosomes) are produced by cells expressing one or more transgenic products. In other aspects, the EV of the present disclosure is, but is not limited to, nanovesicles, microsomes, microvesicles, extracellular bodies or apoptotic bodies.

[0129] As used herein, the term "fragment" of a protein (e.g., a biologically active molecule such as a therapeutic protein, or a scaffold protein such as scaffold X or scaffold Y) refers to an amino acid sequence of a protein that is shorter than the naturally occurring sequence, and the N- and / or C-terminus of the protein is deleted or any part thereof is deleted compared to the naturally occurring protein.

[0130] As used herein, the term "functional fragment" refers to a protein fragment that retains protein function. Thus, in some aspects, a functional fragment of a scaffold protein (e.g., scaffold X protein) retains the ability to anchor a bioactive molecule on the luminal or external surface of an EV (e.g., exosome) via a maleimide moiety. Similarly, in some aspects, a functional fragment of a scaffold Y protein retains the ability to anchor a moiety on the luminal surface of an EV (e.g., exosome).

[0131] Whether a fragment is a functional fragment can be assessed by any method known in the art for determining the protein content of EVs (e.g., exosomes), including Western blot, FACS analysis, and fusion of the fragment with an autofluorescent protein (such as, for example, GFP). In certain aspects, the functional fragment of the Scaffold X protein retains, for example, at least about 50%, at least about 60%, at least about 70%, at least about 80%, at least about 90%, or at least about 100% of the ability of the naturally occurring Scaffold X protein to anchor a biologically active molecule on the luminal surface or the outer surface of an EV (e.g., exosome) via a maleimide moiety.

[0132] As used herein, "anchoring" a bioactive molecule on the luminal surface or external surface of an EV (e.g., exosome) of the present disclosure by a scaffold protein refers to covalently linking the bioactive molecule to a portion of the scaffold molecule located on the luminal surface or external surface of the EV (e.g., exosome), respectively.

[0133] In certain aspects, the functional fragment of the Scaffold Y protein retains, for example, at least about 50%, at least about 60%, at least about 70%, at least about 80%, at least about 90%, or at least about 100% of the ability of the naturally occurring Scaffold Y protein to anchor a moiety on the luminal surface of an EV (e.g., an exosome).

[0134] As used herein, the term "homology" refers to the overall relatedness between polymer molecules, such as nucleic acid molecules (e.g., DNA molecules and / or RNA molecules) and / or polypeptide molecules. In general, the term "homology" means the evolutionary relationship between two molecules. Therefore, two molecules of homology will have a common evolutionary ancestor. In the context of the present disclosure, the term homology encompasses both identity and similarity.

[0135] In some aspects, if at least 25%, 30%, 35%, 40%, 45%, 50%, 55%, 60%, 65%, 70%, 75%, 80%, 85%, 90%, 95% or 99% of the monomers in the polymer molecule are identical (identical monomers) or similar (conservative substitutions), the molecules are considered to be "homologous" to each other. The term "homologous" necessarily refers to a comparison between at least two sequences (polynucleotide sequences or polypeptide sequences).

[0136] In the context of the present disclosure, substitutions (even when they are referred to as amino acid substitutions) are made at the nucleic acid level, ie replacement of an amino acid residue with an alternative amino acid residue is performed by replacing the codon encoding a first amino acid with a codon encoding a second amino acid.

[0137] As used herein, the term "identity" refers to the overall monomer conservation between polymer molecules, such as polypeptide molecules or polynucleotide molecules (such as DNA molecules and / or RNA molecules). The term "identical" without any additional qualifiers, such as protein A is identical to protein B, means that the sequences are 100% identical (100% sequence identity). Describing two sequences as, for example, "70% identical" is equivalent to describing them as having, for example, "70% sequence identity".

[0138] The calculation of the percent identity of two polypeptide sequences can be performed, for example, by aligning the two sequences for optimal comparison purposes (e.g., gaps can be introduced into one or both of the first and second polypeptide sequences for optimal alignment and non-identical sequences can be disregarded for comparison purposes). In certain aspects, the length of the sequence aligned for comparison purposes is at least 30%, at least 40%, at least 50%, at least 60%, at least 70%, at least 80%, at least 90%, at least 95%, or 100% of the length of the reference sequence. The amino acids at corresponding amino acid positions are then compared.

[0139] When a position in the first sequence is occupied by the same amino acid as the corresponding position in the second sequence, then the molecules are identical at that position. The percent identity between the two sequences is a function of the number of identical positions shared by the sequences, taking into account the number of gaps that need to be introduced for optimal alignment of the two sequences and the length of each gap. The comparison of sequences and determination of percent identity between two sequences can be accomplished using a mathematical algorithm.

[0140] Suitable software programs are available from various sources and are used for the comparison of protein and nucleotide sequences. A suitable program for determining the sequence identity percentage is bl2seq, which is a part of the BLAST program suite available from the BLAST website (blast.ncbi.nlm.nih.gov) of the National Center for Biotechnology Information of the U.S. Government. Bl2seq uses BLASTN or BLASTP algorithms to compare between two sequences. BLASTN is used to compare nucleic acid sequences, and BLASTP is used to compare amino acid sequences. Other suitable programs are, for example, Needle, Stretcher, Water or Matcher, which are a part of the EMBOSS suite of bioinformatics programs, and can also be obtained from the European Bioinformatics Institute (EBI) at www.ebi.ac.uk / Tools / psa.

[0141] Sequence alignment can be performed using methods known in the art, such as MAFFT, Clustal (ClustalW, Clustal X or Clustal Omega), MUSCLE, and the like.

[0142] Different regions within a single polynucleotide or polypeptide target sequence aligned to a polynucleotide or polypeptide reference sequence can each have their own percent sequence identity. It should be noted that percent sequence identity values ​​are rounded to the nearest tenth. For example, 80.11, 80.12, 80.13, and 80.14 are rounded down to 80.1, while 80.15, 80.16, 80.17, 80.18, and 80.19 are rounded up to 80.2. It should also be noted that length values ​​will always be integers.

[0143] In certain aspects, the percent identity (%ID) of a first amino acid sequence (or nucleic acid sequence) to a second amino acid sequence (or nucleic acid sequence) is calculated as %ID=100x(Y / Z), wherein Y is the number of amino acid residues (or nucleobases) scored as identical matches in the alignment of the first sequence and the second sequence (as aligned by visual inspection or a specific sequence alignment program), and Z is the total number of residues in the second sequence. If the length of the first sequence is longer than the second sequence, the percent identity of the first sequence to the second sequence will be higher than the percent identity of the second sequence to the first sequence.

[0144] It will be appreciated by those skilled in the art that the generation of sequence alignments for calculating sequence identity percentages is not limited to binary sequence-sequence comparisons driven only by primary sequence data. It should also be appreciated that sequence alignments can be generated by integrating sequence data with data from heterogeneous sources such as structural data (e.g., crystallographic protein structures), functional data (e.g., the position of mutations), or phylogenetic data. An appropriate program for integrating heterogeneous data to generate multiple sequence alignments is T-Coffee, which can be obtained at www.tcoffee.org and can alternatively be obtained, for example, from EBI. It should also be appreciated that the final alignment for calculating percentage sequence identity can be verified automatically or manually.

[0145] As used herein, the term "immunomodulator" refers to an agent that acts on a target (e.g., a target cell) in contact with an EV (e.g., an exosome) and regulates the immune system. Non-limiting examples of immunomodulators that can be introduced into EVs (e.g., exosomes) and / or production cells include agents such as regulators of checkpoint inhibitors, ligands of checkpoint inhibitors, cytokines, derivatives thereof, or any combination thereof. Immunomodulators may also include agonists, antagonists, antibodies, antigen binding fragments, polynucleotides (e.g., siRNA, miRNA, lncRNA, mRNA, or DNA) or small molecules. In some aspects of the present disclosure, the bioactive molecule is an immunomodulator.

[0146] As used herein, "immune response" refers to the biological response of external factors or abnormalities such as cancer cells in vertebrates, and the response protects organisms from these factors and diseases caused by them. Immune response is by one or more cells of the immune system (for example, T lymphocytes, B lymphocytes, natural killer (NK) cells, macrophages, eosinophils, mast cells, dendritic cells or neutrophils) and the effect of soluble macromolecules (including antibodies, cytokines and complement) produced by any one of these cells or liver, the effect leads to the selective targeting, combination, damage, destruction and / or removal of normal human cells or tissues in the case of autoimmunity or pathological inflammation. Immune response (immunereaction) includes, for example, T cells, such as activation or suppression of effector T cells, Th cells, CD4+ cells, CD8+T cells or Treg cells, or activation or suppression of any other cells (such as NK cells) of the immune system. Thus, an immune response may include a humoral immune response (eg, mediated by B cells), a cellular immune response (eg, mediated by T cells), or both a humoral immune response and a cellular immune response.In some aspects of the disclosure, a biologically active molecule is a molecule capable of eliciting an immune response.

[0147] In some aspects, the immune response is an "inhibitory" immune response. An inhibitory immune response is an immune response that blocks or reduces the effect of a stimulus (e.g., an antigen). In some aspects, an inhibitory immune response includes producing inhibitory antibodies against a stimulus. In some aspects, an immune response is a "stimulatory" immune response. A stimulatory immune response is an immune response that results in the production of effector cells (e.g., cytotoxic T lymphocytes) that can destroy and remove a target antigen (e.g., a tumor antigen or a virus).

[0148] The term "immunoconjugate" as used herein refers to a compound comprising a binding molecule (e.g., an antibody) and one or more parts (e.g., a therapeutic or diagnostic part) chemically conjugated to the binding molecule. In general, an immunoconjugate is defined by the following general formula: A-(LM)n, wherein A is a binding molecule (e.g., an antibody), L is an optional linker, and M is a heterologous part, which can be, for example, a therapeutic agent, a detectable label, etc., and n is an integer. In some aspects, multiple heterologous parts can be chemically conjugated to different connection points in the same binding molecule (e.g., an antibody). In other aspects, multiple heterologous parts can be cascaded and connected to the connection point in the binding molecule (e.g., an antibody). In some aspects, multiple heterologous parts (same or different) can be conjugated to a binding molecule (e.g., an antibody).

[0149] Immunoconjugates can also be defined by the general formula in reverse order. In some aspects, the immunoconjugate is an "antibody-drug conjugate" ("ADC"). In the context of the present disclosure, the term "immunoconjugate" is not limited to chemical or enzymatic conjugate molecules. The term "immunoconjugate" as used in the present disclosure also includes genetic fusions. In some aspects of the present disclosure, the biologically active molecule is an immunoconjugate.

[0150] As used herein, the terms "isolated," "purified," "extracted," and grammatical variations thereof are used interchangeably and refer to the state of a preparation of desired EVs (e.g., a plurality of known or unknown amounts and / or concentrations of EVs) that have been subjected to one or more purification processes (e.g., selection or enrichment of a desired EV (e.g., exosome) preparation). In some aspects, separation or purification as used herein is a process of removing, partially removing (e.g., a portion of) EVs (e.g., exosomes) from a sample containing producer cells. In some aspects, the isolated EV (e.g., exosome) composition has no detectable undesirable activity, or alternatively, the level or amount of the undesirable activity is at or below an acceptable level or amount. In other aspects, the amount and / or concentration of the desired EVs (e.g., exosomes) of the isolated EV (e.g., exosome) composition is at or above an acceptable amount and / or concentration. In other aspects, the isolated EV (e.g., exosome) composition is enriched compared to the starting material (e.g., producer cell preparation) from which the composition is obtained. Such enrichment can be at least about 10%, at least about 20%, at least about 30%, at least about 40%, at least about 50%, at least about 60%, at least about 70%, at least about 80%, at least about 90%, at least about 95%, at least about 96%, at least about 97%, at least about 98%, at least about 99%, at least about 99.9%, at least about 99.99%, at least about 99.999%, at least about 99.9999%, or greater than 99.9999% enriched compared to the starting material. In some aspects, the isolated EV (e.g., exosome) preparation is substantially free of residual biological products. In some aspects, the isolated EV (e.g., exosome) preparation is 100% free, at least about 99% free, at least about 98% free, at least about 97% free, at least about 96% free, at least about 95% free, at least about 94% free, at least about 93% free, at least about 92% free, at least about 91% free, or at least about 90% free of any contaminating biological material. Residual biological products may include non-biological materials (including chemicals) or unwanted nucleic acids, proteins, lipids, or metabolites. Substantially free of residual biological products can also mean that the EV (e.g., exosome) composition does not contain detectable producer cells, and only EVs (e.g., exosomes) are detectable.

[0151] The terms "connected", "fused" and grammatical variants thereof are used interchangeably and refer to a first portion (e.g., a first amino acid sequence or a nucleotide sequence) that is covalently or non-covalently connected to a second portion (e.g., a second amino acid sequence or a nucleotide sequence), respectively. The first portion may be directly connected to the second portion or juxtaposed with the second portion, or alternatively an intervening portion may covalently connect the first portion to the second portion. The term "connected" not only means the fusion of the first portion with the second portion at the C-terminus or N-terminus, but also includes inserting the entire first portion (or the second portion) into any two points (e.g., amino acids) in the second portion (or the first portion, respectively). In one aspect, the first portion is connected to the second portion by a peptide bond or a linker. The first portion may be connected to the second portion by a phosphodiester bond or a linker. The linker may be a peptide or polypeptide (for a polypeptide chain) or a nucleotide or a nucleotide chain (for a nucleotide chain) or any chemical moiety (for a polypeptide or polynucleotide chain or any chemical molecule). The term "connected" is also represented by a hyphen (-). In some aspects, the scaffold X protein on the EV (eg, exosome) can be linked or fused to a biologically active molecule via a maleimide moiety.

[0152] As used herein, the term "luminal engineered EV" refers to an EV (e.g., exosome) in which the luminal surface of the membrane or lumen of the EV (e.g., exosome) is modified in its composition so that the luminal surface or lumen of the engineered EV (e.g., exosome) is different from the luminal surface or lumen of the EV (e.g., exosome) before modification or the luminal surface or lumen of a naturally occurring EV (e.g., exosome).

[0153] Engineering can be performed directly in the cavity (i.e., the space within the EV) or in the membrane of the EV (e.g., exosome), in particular on the luminal surface of the EV, so that the cavity and / or luminal surface of the EV (e.g., exosome) is changed. For example, the membrane is modified in terms of its composition of proteins, lipids, small molecules, carbohydrates, etc., so that the luminal surface of the EV (e.g., exosome) is modified. Similarly, the contents in the cavity can be modified. The composition can be changed by chemical, physical or biological methods or by production by cells previously modified by chemical, physical or biological methods. Specifically, the composition can be changed by genetic engineering or by production by cells previously modified by genetic engineering. In some aspects, the lumen-engineered EV (e.g., lumen-engineered exosome) comprises an exogenous protein (i.e., a protein that is not naturally expressed by the EV (e.g., exosome)) or a fragment or variant thereof, which may be exposed on the lumenal surface or lumen of the EV (e.g., exosome), or may be an anchor point (linkage) for a portion exposed on the inner layer of the EV (e.g., exosome). In other aspects, the lumen-engineered EV (e.g., lumen-engineered exosome) comprises a higher expression of a native EV (e.g., exosome) protein (e.g., Scaffold X or Scaffold Y) or a fragment or variant thereof, which may be exposed on the lumen of the EV (e.g., exosome), or may be an anchor point (linkage) for a portion exposed on the lumenal surface of the EV (e.g., exosome).

[0154] As used herein, the term "macromolecule" refers to nucleic acids, proteins, lipids, carbohydrates, metabolites, or combinations thereof.

[0155] As used herein, the term "macromolecule" refers to nucleic acids, proteins, lipids, carbohydrates, metabolites, or combinations thereof.

[0156] The term "modified" when used in the context of EVs (e.g., exosomes) described herein refers to changes or engineering of EVs (e.g., exosomes and / or their production cells) so that the modified EVs (e.g., exosomes) are different from naturally occurring EVs (e.g., exosomes). In some aspects, the modified EVs (e.g., exosomes) described herein comprise membranes that differ in composition of proteins, lipids, small molecules, carbohydrates, etc. compared to the membranes of naturally occurring EVs (e.g., exosomes). For example, the membrane comprises a higher density or amount of natural EV (e.g., exosome) proteins and / or the membrane comprises proteins that do not naturally occur in EVs (e.g., exosomes). In some aspects, such modifications to the membrane change the outer surface of the EVs (e.g., exosomes) (e.g., surface engineered EVs and exosomes described herein). In some aspects, such modifications to the membrane change the luminal surface of the EVs (e.g., exosomes) (e.g., luminal engineered EVs and exosomes described herein).

[0157] As used herein, the term "modified protein" or "protein modification" refers to a protein that has at least 15% identity to the non-mutated amino acid sequence of the protein. Modifications of the protein include fragments or variants of the protein. Modifications of the protein may also include chemical or physical modifications to fragments or variants of the protein.

[0158] As used herein, the terms "modulate", "modify" and grammatical variants thereof, when applied to a specific concentration, level, expression, function or behavior, generally refer to the ability to change by increasing or decreasing, e.g., directly or indirectly promoting / stimulating / upregulating or interfering / inhibiting / downregulating a specific concentration, level, expression, function or behavior, such as, for example, to act as an antagonist or agonist. In some cases, a modulator may increase and / or decrease a specific concentration, level, activity or function relative to a control, or relative to a generally expected average activity level, or relative to a control activity level.

[0159] As used herein, the term "nanovesicle" refers to an extracellular vesicle with a diameter between 20-250nm (e.g., between 30-150nm), and is produced by a cell (e.g., a production cell) by direct or indirect manipulation, so that the cell will not produce nanovesicles without manipulation. Suitable manipulations of cells for the production of nanovesicles include, but are not limited to, continuous extrusion, treatment with an alkaline solution, ultrasonic treatment, or a combination thereof. In some aspects, the production of nanovesicles may result in the destruction of production cells. In some aspects, the nanovesicle population described herein is substantially free of vesicles derived from cells by direct budding from the plasma membrane or late endosome fusion with the plasma membrane. In some aspects, the nanovesicle comprises a scaffold portion, such as a scaffold X and / or a scaffold Y. Nanovesicles, once derived from production cells, can be separated from production cells based on their size, density, biochemical parameters, or a combination thereof.

[0160] As used herein, the term "payload" refers to a bioactive molecule (e.g., a therapeutic agent) that acts on a target (e.g., a target cell) in contact with the EV (e.g., an exosome) of the present disclosure. Non-limiting examples of payloads that can be introduced into EVs (e.g., exosomes) include therapeutic agents such as nucleotides (e.g., nucleotides containing a detectable portion or toxin or disrupting transcription), nucleic acids (e.g., DNA or mRNA molecules encoding polypeptides such as enzymes, or RNA molecules with regulatory functions such as miRNA, dsDNA, lncRNA, and siRNA), amino acids (e.g., containing a detectable portion or toxin or disrupting translation), polypeptides (e.g., enzymes), lipids, carbohydrates, and small molecules (e.g., small molecule drugs and toxins). In some aspects, the payload comprises an antigen. As used herein, the term "antigen" refers to any agent that triggers an immune response (cell or body fluid) against itself when introduced into a subject. In some aspects, the payload molecule is covalently linked to the EV (e.g., exosome) via a maleimide moiety. In other aspects, the payload comprises an adjuvant.

[0161] The term "pharmaceutically acceptable carrier" or "pharmaceutically acceptable excipient" and grammatical variations thereof encompass any agent approved by regulatory agencies of the U.S. federal government or listed in the U.S. Pharmacopeia for use in animals, including humans, and any carrier or diluent that does not cause undesirable physiological effects to such an extent that administration of the composition to a subject is prohibited and does not abrogate the biological activity and properties of the administered compound. Excipients and carriers that are useful in preparing pharmaceutical compositions and that are generally safe, nontoxic and desirable are included.

[0162] As used herein, the term "pharmaceutical composition" refers to one or more compounds described herein, such as, for example, EVs (e.g., exosomes) of the present disclosure mixed or admixed or suspended therein with one or more other chemical components such as pharmaceutically acceptable carriers and excipients. One purpose of a pharmaceutical composition is to facilitate administration of an EV (e.g., exosome) preparation to a subject.

[0163] As used herein, the term "polynucleotide" refers to a nucleotide polymer of any length, including ribonucleotides, deoxyribonucleotides, analogs thereof, or mixtures thereof. This term refers to the primary structure of the molecule. Thus, the term includes triple-stranded, double-stranded, and single-stranded deoxyribonucleic acids ("DNA"), and triple-stranded, double-stranded, and single-stranded ribonucleic acids ("RNA"). It also includes modified (e.g., by alkylation and / or by capping) and unmodified forms of polynucleotides. More specifically, the term "polynucleotide" includes polydeoxyribonucleotides (containing 2-deoxy-D-ribose); polyribonucleotides (containing D-ribose), including tRNA, rRNA, hRNA, siRNA and mRNA, whether spliced ​​or unspliced; any other type of polynucleotide that is an N- or C-glycoside of a purine or pyrimidine base; and other polymers containing an orthonucleotide backbone, such as polyamides (e.g., peptide nucleic acids "PNA") and polymorpholino polymers; and other synthetic sequence-specific nucleic acid polymers, provided that the polymer contains a nucleobase in a configuration that allows base pairing and base stacking, such as found in DNA and RNA. In some aspects of the present disclosure, the biologically active molecule attached to an EV (e.g., an exosome) via a maleimide moiety is a polynucleotide, such as an antisense oligonucleotide. In a specific aspect, the polynucleotide comprises an mRNA. In another aspect, the mRNA is a synthetic mRNA. In some aspects, the synthetic mRNA comprises at least one non-natural nucleobase. In some aspects, all nucleobases of a certain class have been replaced by non-natural nucleobases (e.g., all uridines in the polynucleotides disclosed herein can be replaced by non-natural nucleobases, such as 5-methoxyuridine). In some aspects of the disclosure, the biologically active molecule is a polynucleotide.

[0164] The terms "polypeptide", "peptide" and "protein" are used interchangeably herein to refer to amino acid polymers of any length. The polymer may comprise modified amino acids. The term also encompasses amino acid polymers that have been modified naturally or by intervention; for example, disulfide bond formation, glycosylation, lipidation, acetylation, phosphorylation, or any other manipulation or modification, such as conjugation with a labeling component. Also included in the definition are, for example, polypeptides containing one or more amino acid analogs (including, for example, non-natural amino acids such as homocysteine, ornithine, para-acetylphenylalanine, D-amino acids, and creatine) and other modifications known in the art. In some aspects of the present disclosure, the biologically active molecule connected to an EV (e.g., an exosome) via a maleimide moiety is a polypeptide, such as an antibody or a derivative thereof, such as an ADC, a PROTAC, a toxin, a fusion protein, or an enzyme.

[0165] As used herein, the term "polypeptide" refers to proteins, polypeptides and peptides of any size, structure or function. Polypeptides include gene products, naturally occurring polypeptides, synthetic polypeptides, homologues, orthologues, lateral homologues, fragments of the aforementioned and other equivalents, variants and analogs. Polypeptides can be single polypeptides or can be multimolecular complexes, such as dimers, trimers or tetramers. They can also contain single-chain or multi-chain polypeptides. Most commonly, disulfide bonds are present in multi-chain polypeptides. The term polypeptide can also be applied to amino acid polymers in which one or more amino acid residues are artificial chemical analogs of the corresponding naturally occurring amino acids. In some aspects, a "peptide" can be less than or equal to 50 amino acids long, for example, about 5, 10, 15, 20, 25, 30, 35, 40, 45 or 50 amino acids long.

[0166] As used herein, the terms "prevent," "preventing," and variations thereof refer to partially or completely delaying the onset of a disease, disorder, and / or condition; partially or completely delaying the onset of one or more symptoms, features, or clinical manifestations of a particular disease, disorder, and / or condition; partially or completely delaying the onset of one or more symptoms, features, or manifestations of a particular disease, disorder, and / or condition; partially or completely delaying progression from a particular disease, disorder, and / or condition; and / or reducing the risk of developing pathology associated with a disease, disorder, and / or condition. In some aspects, a preventive outcome is achieved by prophylactic treatment.

[0167] As used herein, the term "producer cell" refers to a cell used to produce EVs (e.g., exosomes). Producer cells can be cells cultured in vitro, or in vivo. Producer cells include, but are not limited to, cells known to effectively produce EVs (e.g., exosomes), such as HEK293 cells, Chinese hamster ovary (CHO) cells, mesenchymal stem cells (MSCs), BJ human foreskin fibroblasts, fHDF fibroblasts, Neuronal precursor cells, Amniotic fluid cells, adipose mesenchymal stem cells, RPTEC / TERT1 cells. In some aspects, the production cells are not antigen presenting cells. In some aspects, the production cells are not dendritic cells, B cells, mast cells, macrophages, neutrophils, Kupffer-Browicz cells, cells derived from any of these cells, or any combination thereof.

[0168] As used herein, "prophylactic" refers to a treatment or course of action intended to prevent the onset of a disease or disorder or to prevent or delay the symptoms associated with a disease or disorder.

[0169] As used herein, "prophylaxis" refers to measures taken to maintain health and prevent or delay the onset of a bleeding episode or to prevent or delay symptoms associated with a disease or disorder.

[0170] A "recombinant" polypeptide or protein refers to a polypeptide or protein produced by recombinant DNA technology. For the purposes of this disclosure, recombinantly produced polypeptides and proteins expressed in engineered host cells are considered isolated, and natural or recombinant polypeptides that have been separated, fractionated, or partially or substantially purified by any suitable technique are also considered isolated. The polypeptides disclosed herein can be recombinantly produced using methods known in the art. Alternatively, the proteins and peptides disclosed herein can be chemically synthesized. In some aspects of the present disclosure, the scaffold X and / or scaffold Y proteins present in EVs (e.g., exosomes) are recombinantly produced by overexpressing the scaffold proteins in production cells, so that the level of the scaffold protein in the resulting EVs (e.g., exosomes) is significantly increased relative to the level of the scaffold protein present in the EVs (e.g., exosomes) of production cells that do not overexpress such scaffold proteins.

[0171] As used herein, the term "scaffold moiety" refers to a molecule that can be used to anchor a payload (e.g., a bioactive molecule) to an EV (e.g., an exosome), anchored on the luminal surface or on the outer surface of an EV (e.g., an exosome), such as a protein such as Scaffold X or Scaffold Y. In certain aspects, the scaffold moiety comprises a synthetic molecule. In some aspects, the scaffold moiety comprises a non-polypeptide moiety. In other aspects, the scaffold moiety comprises, for example, a lipid, carbohydrate, protein, or combination thereof (e.g., a glycoprotein or proteolipid) that is naturally present in an EV (e.g., an exosome). In some aspects, the scaffold moiety comprises a lipid, carbohydrate, or protein that is not naturally present in an EV (e.g., an exosome). In some aspects, the scaffold moiety comprises a lipid or carbohydrate that is naturally present in an EV (e.g., an exosome), but has been enriched in the EV (e.g., exosome) relative to the basal / natural / wild-type level. In some aspects, the scaffold portion comprises a protein that is naturally present in EVs (e.g., exosomes), but has been enriched in EVs (e.g., exosomes) relative to basal / native / wild-type levels, for example, by recombinant overexpression in production cells. In certain aspects, the scaffold portion is Scaffold X. In some aspects, the scaffold portion is Scaffold Y. In further aspects, the scaffold portion includes both Scaffold X and Scaffold Y.

[0172] As used herein, the term "scaffold X" refers to an EV (e.g., exosome) protein identified on the surface of an EV (e.g., exosome). See, e.g., U.S. Patent No. 10,195,290, which is incorporated herein by reference in its entirety. Non-limiting examples of scaffold X proteins include: prostaglandin F2 receptor negative regulator ("PTGFRN"); basigin (BSG); immunoglobulin superfamily member 2 ("IGSF2"); immunoglobulin superfamily member 3 ("IGSF3"); immunoglobulin superfamily member 8 ("IGSF8"); integrin beta-1 ("ITGB1"); integrin alpha-4 ("ITGA4"); 4F2 cell surface antigen heavy chain ("SLC3A2"); and a class of ATP transporters ("ATP1A1", "ATP1A2", "ATP1A3", "ATP1A4", "ATP1B3", "ATP2B1", "ATP2B2", "ATP2B3", "ATP2B"). In some aspects, the scaffold X protein can be a complete protein or a fragment thereof (e.g., a functional fragment, e.g., the smallest fragment capable of anchoring another moiety on the outer surface or on the luminal surface of an EV (e.g., an exosome). In some aspects, the scaffold X can anchor a bioactive molecule to the outer surface or lumen of an EV (e.g., an exosome). In some aspects of the present disclosure, the bioactive molecule can be covalently linked to the scaffold X via a maleimide moiety. In some aspects, the bioactive molecule can be linked to the scaffold X on the luminal surface of an EV (e.g., an exosome) via a maleimide moiety. Non-limiting examples of other scaffold moieties that can be used in the present disclosure include: aminopeptidase N (CD13); enkephalinase, AKA membrane metalloendopeptidase (MME); ectonucleotide pyrophosphatase / phosphodiesterase family member 1 (ENPP1); neuropilin-1 (NRP1); CD9, CD63, CD81, PDGFR, GPI anchor protein, lactadherin, LAMP2, and LAMP2B.

[0173] As used herein, the term "scaffold Y" refers to an EV (e.g., exosome) protein identified in the lumen of an EV (e.g., exosome). See, for example, International Application No. PCT / US2018 / 061679, which is incorporated herein by reference in its entirety. Non-limiting examples of scaffold Y proteins include: protein kinase C substrate rich in myristoylated alanine ("MARCKS"); protein kinase C substrate-like 1 rich in myristoylated alanine ("MARCKSL1"); and brain acid soluble protein 1 ("BASP1"). In some aspects, the scaffold Y protein can be a complete protein or a fragment thereof (e.g., a functional fragment, e.g., a minimal fragment capable of anchoring a portion on the luminal surface of an EV (e.g., an exosome). In some aspects, scaffold Y can anchor a portion to the luminal surface of an EV (e.g., an exosome). In some aspects of the present disclosure, a portion can be covalently attached to scaffold Y. In some aspects, a portion can be attached to scaffold Y on the luminal surface of an EV (e.g., an exosome).

[0174] The term "self-immolative spacer" as used herein refers to a spacer as defined below that will spontaneously separate from a second moiety (eg, a biologically active molecule) if the bond of the spacer to the first moiety (eg, a cleavable linker) is cleaved.

[0175] As used herein, the term "similarity" refers to the overall relatedness between polymer molecules, such as between polynucleotide molecules (e.g., DNA molecules and / or RNA molecules) and / or between polypeptide molecules. The calculation of the percentage of similarity between polymer molecules can be performed in the same manner as the percentage of identity calculation, except that the percentage of similarity calculation takes into account conservative substitutions as understood in the art. It should be understood that the percentage of similarity depends on the comparison scale used, i.e., whether the amino acids are compared, for example, based on their evolutionary proximity, charge, volume, flexibility, polarity, hydrophobicity, aromaticity, isoelectric point, antigenicity, or a combination thereof.

[0176] As used herein, the term "spacer" refers to a bifunctional chemical moiety capable of covalently linking two spaced-apart moieties (eg, a cleavable linker and a biologically active molecule) together into a typically stable dipartate molecule.

[0177] Unless otherwise stated, reference to a compound having one or more stereocenters is intended to refer to each and all combinations of stereoisomers thereof.

[0178] The terms "subject", "patient", "individual" and "host" and their variants are used interchangeably herein and refer to any mammalian subject in need of diagnosis, treatment or therapy, including but not limited to humans, domestic animals (e.g., dogs, cats, etc.), farm animals (e.g., cattle, sheep, pigs, horses, etc.) and laboratory animals (e.g., monkeys, rats, mice, rabbits, guinea pigs, etc.), particularly humans. The methods described herein are applicable to both human therapy and veterinary applications.

[0179] As used herein, the term "substantially free" means that a sample comprising EVs (e.g., exosomes) comprises less than 10% of macromolecules (e.g., contaminants) by mass / volume (m / v) percentage concentration. Some fractions may contain less than 0.001%, less than 0.01%, less than 0.05%, less than 0.1%, less than 0.2%, less than 0.3%, less than 0.4%, less than 0.5%, less than 0.6%, less than 0.7%, less than 0.8%, less than 0.9%, less than 1%, less than 2%, less than 3%, less than 4%, less than 5%, less than 6%, less than 7%, less than 8%, less than 9%, or less than 10% (m / v) macromolecules.

[0180] As used herein, the term "surface engineered EVs" (e.g., scaffold X engineered exosomes) refers to EVs whose membrane or surface is modified in its composition such that the surface of the engineered EV is different from the surface of the EV before modification or the surface of a naturally occurring EV.

[0181] As used herein, the term "surface engineered exosomes" (e.g., scaffold X engineered exosomes) refers to exosomes whose membrane or surface (external surface or luminal surface) is modified in its composition such that the surface of the engineered exosome is different from the surface of the exosome before modification or the surface of a naturally occurring exosome.

[0182] Engineering can be performed on the surface of EV (e.g., exosome) or in the membrane of EV (e.g., exosome) so that the surface of EV (e.g., exosome) is changed. For example, the membrane can be modified in terms of its composition, such as proteins, lipids, small molecules, carbohydrates, or combinations thereof. The composition can be changed by chemical, physical or biological methods or by production by cells previously or simultaneously modified by chemical, physical or biological methods. Specifically, the composition can be changed by genetic engineering or by production by cells previously modified by genetic engineering. In some aspects, the surface engineered EV (e.g., exosome) comprises an exogenous protein (i.e., a protein that is not naturally expressed by EV (e.g., exosome)) or a fragment or variant thereof, which can be exposed to the surface of EV (e.g., exosome), or can be an anchor point (connection) of a portion exposed on the surface of EV (e.g., exosome). In other aspects, the surface engineered EV (e.g., exosome) comprises a higher expression (e.g., higher number) of a native EV (e.g., exosome) protein (e.g., Scaffold X) or a fragment or variant thereof, which may be exposed on the surface of the EV (e.g., exosome) or may be an anchor point (linkage) for a moiety exposed on the surface of the EV (e.g., exosome). In a specific aspect, the surface engineered EV (e.g., exosome) comprises modification of one or more membrane components (e.g., proteins such as Scaffold X, lipids, small molecules, carbohydrates, or combinations thereof), wherein at least one of the components is covalently linked to a bioactive molecule via a maleimide moiety.

[0183] As used herein, the term "therapeutically effective amount" refers to an amount of an agent or pharmaceutical compound comprising EVs or exosomes of the present disclosure sufficient to produce the desired therapeutic, pharmacological and / or physiological effect on a subject in need thereof. When prevention and treatment can be considered a therapy, the therapeutically effective amount can be a "preventive and therapeutic effective amount".

[0184] As used herein, the terms "treat," "treatment," or "treating" refer to, for example, a reduction in the severity of a disease or disorder; a shortening of the duration of a disease course; an improvement or elimination of one or more symptoms associated with a disease or disorder; providing a beneficial effect to a subject with a disease or disorder, but not necessarily curing the disease or disorder. The terms also include the prevention or prophylaxis of a disease or disorder or its symptoms. In one aspect, the terms "treating" or "treatment" refer to inducing an immune response to an antigen in a subject.

[0185] As used herein, the term "variant" of a molecule (e.g., a functional molecule, an antigen, or scaffold X and / or scaffold Y) refers to a molecule that shares certain structural and functional attributes with another molecule after comparison by methods known in the art. For example, a variant of a protein may include a substitution, insertion, deletion, frameshift, or rearrangement in another protein.

[0186] In some aspects, variants or derivatives of Scaffold X include Scaffold X variants having at least about 70% identity to full-length, mature PTGFRN, BSG, IGSF2, IGSF3, IGSF8, ITGB1, ITGA4, SLC3A2, or ATP transporter, or fragments (e.g., functional fragments) of PTGFRN, BSG, IGSF2, IGSF3, IGSF8, ITGB1, ITGA4, SLC3A2, or ATP transporter.

[0187] In some aspects, variants or fragments of the Scaffold X protein disclosed herein or derivatives thereof retain the ability to specifically target EVs (e.g., exosomes). In some aspects, Scaffold X or Scaffold X derivatives comprise one or more mutations, such as conservative amino acid substitutions.

[0188] In some aspects, variants of Scaffold Y or derivatives thereof include variants that are at least 70% identical to MARCKS, MARCKSL1, BASP1, or a fragment of MARCKS, MARCKSL1, or BASP1.

[0189] In some aspects, variants or variants of fragments of Scaffold Y protein or derivatives thereof retain the ability to specifically target the luminal surface of EVs (e.g., exosomes). In some aspects, Scaffold Y comprises one or more mutations, such as conservative amino acid substitutions.

[0190] Naturally occurring variants are referred to as "allelic variants" and refer to one of several alternative forms of a gene occupying a given locus on a chromosome of an organism (Genes II, Lewin, B. ed., John Wiley & Sons, New York (1985)). These allelic variants may vary at the polynucleotide and / or polypeptide level and are included in the present disclosure. Alternatively, non-naturally occurring variants may be produced by mutagenesis techniques or direct synthesis.

[0191] Using known methods of protein engineering and recombinant DNA technology, variants can be produced to improve or change the characteristics of a polypeptide. For example, one or more amino acids can be deleted from the N-terminus or C-terminus of a secreted protein without substantially losing biological function. Ron et al., J.Biol.Chem.268:2984-2988 (1993) (incorporated herein in its entirety by reference) reported variant KGF proteins that still had heparin binding activity even after the deletion of 3, 8 or 27 amino-terminal amino acid residues. Similarly, interferon gamma exhibited up to 10 times the activity after the deletion of 8-10 amino acid residues from the carboxyl terminus of this protein to. (Dobeli et al., J.Biotechnology 7:199-216 (1988), incorporated herein in its entirety by reference).

[0192] In addition, a large amount of evidence shows that variants generally retain biological activities similar to naturally occurring proteins. For example, Gayle and colleagues (J.Biol.Chem 268:22105-22111 (1993), incorporated herein by reference in its entirety) conducted extensive mutation analysis of human cytokine IL-1a. They used random mutagenesis to generate more than 3,500 separate IL-1a mutants, with each variant having an average of 2.5 amino acid changes over the entire length of the molecule. Multiple mutations were examined at every possible amino acid position. The researchers found that "[most] molecules can be changed with little effect on [binding or biological activity]." (See Abstract). In fact, of the more than 3,500 nucleotide sequences examined, only 23 unique amino acid sequences produced proteins that were significantly different from wild-type activity.

[0193] As mentioned above, variants or derivatives include, for example, modified polypeptides. In some aspects, variants or derivatives of, for example, polypeptides, polynucleotides, lipids, glycoproteins are the result of chemical modification and / or endogenous modification. In some aspects, variants or derivatives are the result of in vivo modification. In some aspects, variants or derivatives are the result of in vitro modification. In other aspects, variants or derivatives are the result of intracellular modification in production cells.

[0194] Modifications present in variants and derivatives include, for example, acetylation, acylation, ADP-ribosylation, amidation, covalent attachment of flavin, covalent attachment of a heme moiety, covalent attachment of a nucleotide or nucleotide derivative, covalent attachment of a lipid or lipid derivative, covalent attachment of a phosphatidylinositol, cross-linking, cyclization, disulfide bond formation, demethylation, formation of covalent cross-links, formation of cysteine, formation of pyroglutamate, formylation, γ-carboxylation, glycosylation, GPI anchor formation, hydroxylation, iodination, methylation, myristoylation, oxidation, pegylation (Mei et al., Blood 116:270-79 (2010), which is incorporated herein by reference in its entirety), proteolytic processing, phosphorylation, prenylation, racemization, selenoylation, sulfation, transfer RNA-mediated addition of amino acids to proteins, such as arginylation and ubiquitination.

[0195] In some aspects, Scaffold X and / or Scaffold Y can be modified at any convenient position. In some aspects, biologically active molecules can be modified at any convenient position. In specific aspects of the present disclosure, EV (e.g., exosome) components (e.g., proteins, lipids, or glycans such as Scaffold X and / or Scaffold Y) and / or biologically active molecules (e.g., antibodies or ADCs, PROTACs, small molecules such as cyclic dinucleotides, toxins such as MMAE, STING agonists, tolerizers, or antisense oligonucleotides) can be modified to produce derivatives comprising at least one maleimide moiety.

[0196] II. Conjugated EVs (eg, exosomes) of the present disclosure

[0197] Extracellular vesicles (EVs) typically have a diameter of 20 nm to 1000 nm; for example, exosomes, which are small extracellular vesicles, typically have a diameter of 100-200 nm. EVs (e.g., exosomes) consist of a confining lipid bilayer and a set of different proteins and nucleic acids (Maas, SLN, et al., Trends. Cell Biol. 27(3): 172-188 (2017)). EVs (e.g., exosomes) exhibit preferential uptake in discrete cell types and tissues, and their tropism can be directed by adding proteins to their surface that interact with receptors on the surface of target cells (Alvarez-Erviti, L., et al., Nat. Biotechnol. 29(4): 341-345 (2011)).

[0198] Unlike antibodies, EVs (e.g., exosomes) can accommodate a large number of molecules attached to their surface, on the order of thousands to tens of thousands of molecules per EV (e.g., exosome). Therefore, EV (e.g., exosome)-drug conjugates represent a platform for delivering high concentrations of therapeutic compounds to discrete cell types while limiting overall systemic exposure to the compounds, thereby reducing off-target toxicity.

[0199] In some aspects, the present disclosure provides a "modified biologically active molecule" (MBAM), such as an ASO, comprising a "biologically active molecule" (BAM), such as an ASO, modified by having one or more anchoring moieties directly or indirectly, such as through one or more linker combinations, bound (e.g., covalently) to a BAM (e.g., ASO). The modified BAM disclosed herein may comprise an "anchoring moiety" (AM) and optionally one or more linkers ("linker combinations") that connect the AM to the BAM, as schematically represented below:

[0200] [AM]-[Connector]n-[BAM]

[0201] Where n is an integer between 0 and 10.

[0202] BAM can be linked to an anchoring moiety or linker combination via a reaction between a "reactive group" (RG; e.g., amine, thiol, hydroxyl, carboxylic acid, or azide) and a "reactive moiety" (RM; e.g., maleimide, succinate, NHS). Several potential synthetic pathways are envisioned, for example:

[0203] [AM]- / Reactive moiety / + / Reactive group / -[BAM]

[0204] [AM]-[Linker]n- / Reactive moiety / + / Reactive group / -[BAM]

[0205] [AM]- / Reactive moiety / + / Reactive group / -[Linker]n-[BAM]

[0206] [AM]-[Linker]n- / Reactive moiety / + / Reactive group / -[Linker]n-[BAM]

[0207] The anchoring moiety can be inserted into the lipid bilayer of EVs (e.g., exosomes), thereby allowing the exosomes to be loaded with BAMs, such as ASOs. Currently, the main obstacle to the commercialization of exosomes as delivery vehicles for polar BAMs (e.g., ASOs) is the very inefficient loading. This obstacle can be overcome by modifying the BAMs (e.g., ASOs) before loading them into exosomes. Therefore, as described herein, the modification of BAMs (e.g., ASOs) helps to load them into exosomes.

[0208] Compared to previously reported loading efficiencies of introducing unmodified BAM into exosomes by, for example, electroporation or cationic lipid transfection, the methods described herein for loading exosomes with modified BAMs (eg, ASOs) significantly improve loading efficiencies.

[0209] In some aspects, the modifications increase the hydrophobicity of the BAM (e.g., ASO) by at least about 1, at least about 2, at least about 3, at least about 4, at least about 5, at least about 6, at least about 7, at least about 8, at least about 9, or at least about 10 fold relative to native (unmodified) BAM (e.g., a corresponding unmodified ASO). In some aspects, the modifications increase the hydrophobicity of the BAM (e.g., ASO) by at least about 1, at least about 2, at least about 3, at least about 4, at least about 5, at least about 6, at least about 7, at least about 8, at least about 9, or at least about 10 orders of magnitude relative to native (unmodified) BAM (e.g., a corresponding unmodified ASO).

[0210] In some aspects, the modification increases the hydrophobicity of the BAM (e.g., ASO) by at least about 10%, at least about 20%, at least about 30%, at least about 40%, at least about 50%, at least about 60%, at least about 70%, at least about 80%, at least about 90%, at least about 100%, at least about 125%, at least about 150%, at least about 175%, at least about 200%, at least about 250%, at least about 300%, at least about 350%, at least about 400%, at least about 450%, at least about 500%, at least about 600%, at least about 700%, at least about 800%, at least about 900%, or at least about 1000% relative to a native (unmodified) BAM (e.g., a corresponding unmodified ASO). The increase in hydrophobicity can be assessed using any suitable method. For example, hydrophobicity can be determined by measuring the percent solubility in an organic solvent such as octanol compared to the solubility in an aqueous solvent such as water.

[0211] In some aspects, the anchoring moiety can be chemically conjugated to BAM (e.g., ASO) to enhance its hydrophobic properties. In exemplary aspects, the anchoring moiety is a sterol (e.g., cholesterol), GM1, a lipid, a vitamin, a small molecule, a peptide, or a combination thereof. In some aspects, the moiety is a lipid. In some aspects, the anchoring moiety is a sterol, such as cholesterol. Other moieties include, for example, phospholipids, lysophospholipids, fatty acids, or vitamins (e.g., vitamin D or vitamin E).

[0212] In some aspects, the anchoring moiety is conjugated directly or through one or more linkers at the end of the BAM (eg, ASO) (ie, "terminal modification"). In other aspects, the anchoring moiety is conjugated to other parts of the BM (eg, ASO).

[0213] In some aspects, the ASO comprises a continuous nucleotide sequence of about 10 to about 30, such as 10-20, 14-20, 16-20 or 15-25 nucleotides in length. In some aspects, the length of the ASO is 20 nucleotides. In some aspects, the length of the ASO is 18 nucleotides. In some aspects, the length of the ASO is 19 nucleotides. In some aspects, the length of the ASO is 17 nucleotides. In some aspects, the length of the ASO is 16 nucleotides. In some aspects, the length of the ASO is 15 nucleotides. In some aspects, the length of the ASO is 14 nucleotides. In some aspects, the length of the ASO is 13 nucleotides. In some aspects, the length of the ASO is 12 nucleotides. In some aspects, the length of the ASO is 11 nucleotides. In some aspects, the length of the ASO is 10 nucleotides.

[0214] In some aspects, the ASO comprises a continuous nucleotide sequence of about 10 to about 50 nucleotides in length, for example, about 10 to about 45, about 10 to about 40, about 10 or about 35, or about 10 to about 30 nucleotides. In some aspects, the length of the ASO is 21 nucleotides. In some aspects, the length of the ASO is 22 nucleotides. In some aspects, the length of the ASO is 23 nucleotides. In some aspects, the length of the ASO is 24 nucleotides. In some aspects, the length of the ASO is 25 nucleotides. In some aspects, the length of the ASO is 26 nucleotides. In some aspects, the length of the ASO is 27 nucleotides. In some aspects, the length of the ASO is 28 nucleotides. In some aspects, the length of the ASO is 29 nucleotides. In some aspects, the length of the ASO is 30 nucleotides. In some aspects, the length of the ASO is 31 nucleotides. In some aspects, the length of the ASO is 32 nucleotides. In some aspects, the length of the ASO is 33 nucleotides. In some aspects, the length of the ASO is 34 nucleotides. In some aspects, the length of the ASO is 35 nucleotides. In some aspects, the length of the ASO is 36 nucleotides. In some aspects, the length of the ASO is 37 nucleotides. In some aspects, the length of the ASO is 38 nucleotides. In some aspects, the length of the ASO is 39 nucleotides. In some aspects, the length of the ASO is 40 nucleotides. In some aspects, the length of the ASO is 41 nucleotides. In some aspects, the length of the ASO is 42 nucleotides. In some aspects, the length of the ASO is 43 nucleotides. In some aspects, the length of the ASO is 44 nucleotides. In some aspects, the length of the ASO is 45 nucleotides. In some aspects, the length of the ASO is 46 nucleotides. In some aspects, the length of the ASO is 47 nucleotides. In some aspects, the length of the ASO is 48 nucleotides. In some aspects, the length of the ASO is 49 nucleotides. In some aspects, the length of the ASO is 50 nucleotides.

[0215] In some aspects, the modified BAM (e.g., ASO) may include a detectable label. Exemplary labels include fluorescent labels and / or radioactive labels. In some aspects, where the modified BAM (e.g., ASO) is fluorescently labeled, the detectable label may be, for example, Cy3. Adding a detectable label to a modified BAM (e.g., ASO) can be used as a way to label exosomes and track their biodistribution. In other aspects, the detectable label may be directly attached to the exosome, for example by labeling exosomal lipids and / or exosomal peptides.

[0216] The different components of the modified BAM (i.e., the anchoring moiety, linker and linker combinations, and the BAM, such as an ASO) can be connected by amide, ester, ether, thioether, disulfide, phosphoramidate, phosphotriester, phosphorodithioate, methylphosphonate, phosphodiester or phosphorothioate linkages or alternatively any or other linkages.

[0217] In some aspects, the different components of the modified BAM can be linkers using bifunctional linkers (i.e., linkers containing two functional groups), such as N-succinimidyl-3-(2-pyridyldithio) propionate, N-4-maleimidobutyric acid, S-(2-pyridyldithio)cysteamine, iodoacetoxysuccinimide, N-(4-maleimidobutyloxy)succinimide, N-[5-(3'-maleimidopropylamide)-1-carboxypentyl]iminodiacetic acid, N-(5-aminopentyl)-iminodiacetic acid, etc.

[0218] II.A. Anchoring

[0219] As described in detail below, suitable anchoring moieties capable of anchoring BAM to the surface of an EV (eg, an exosome) include, for example, sterols (eg, cholesterol), lipids, lysophospholipids, fatty acids, or fat-soluble vitamins.

[0220] In some aspects, the anchoring moiety can be a lipid. The lipid anchoring moiety can be any lipid known in the art, such as palmitic acid or glycosylphosphatidylinositol. In some aspects, the lipid is a fatty acid, a phospholipid, a phospholipid (e.g., phosphatidylcholine, phosphatidylserine or phosphatidylethanolamine) or its analog (e.g., phosphatidylcholine, lecithin, phosphatidylethanolamine, cephalin or phosphatidylserine or its analog or part, such as a part of its partial hydrolysis).

[0221] Typically, the anchoring moiety is chemically connected. However, the anchoring moiety can be enzymatically connected to BAM. In some aspects, it is possible to connect the anchoring moiety to BAM by changing the cell culture conditions. For example, by using a culture medium that limits myristic acid, some other fatty acids (including short-chain and unsaturated fatty acids) can be connected to the N-terminal glycine. For example, it is reported that in the BK channel, myristic acid is connected to an internal serine / threonine or tyrosine residue after translation through a hydroxyester linkage.

[0222] The anchoring moiety can be conjugated to the BAM at any chemically feasible position, such as at the 5' and / or 3' end of the nucleotide sequence (e.g., ASO), directly or indirectly through a combination of linkers. In one aspect, the anchoring moiety is conjugated only to the 3' end of the BAM. In one aspect, the anchoring moiety is conjugated only to the 5' end of the nucleotide sequence (e.g., ASO). In one aspect, the anchoring moiety is conjugated at a position that is not the 3' end or the 5' end of the nucleotide sequence (e.g., ASO).

[0223] Some types of membrane anchors that can be used to practice the methods of the present disclosure are presented in the following table:

[0224]

[0225] In some aspects, the anchoring moiety of the present disclosure may comprise two or more types of anchoring moieties disclosed herein. For example, in some aspects, the anchoring moiety may comprise two lipids (e.g., a phospholipid and a fatty acid), or two phospholipids, or two fatty acids, or a lipid and a vitamin, or cholesterol and a vitamin, etc., together having 6-80 carbon atoms (i.e., an equivalent carbon number (ECN) of 6-80).

[0226] In some aspects, the combination of anchoring moieties, e.g., combinations of lipids (e.g., fatty acids) has 6-80, 8-80, 10-80, 12-80, 14-80, 16-80, 18-80, 20-80, 22-80, 24-80, 26-80, 28-80, 30-80, 4-76, 6-76, 8-76, 10-76, 12-76, 14-76, 16-76, 18-76, 20-76, 22-76, 24-76, 26-76, 28-76, 30-76, 6-72, 8-72, 10-72, 12-72, 14-72, 16-72, 18-72, 20-72, 22-76 72, 24-72, 26-72, 28-72, 30-72, 6-68, 8-68, 10-68, 12-68, 14-68, 16-68, 18-68, 20-68, 22-68, 24-68, 26-68, 28-68, 30-68, 6-64, 8-64, 10-64, 12-64, 14-64, 16-64, 18-64, 20-64, 22-64, 24-64, 26-64, 28-64, 30-64, 6-60, 8-60, 10-60, 12-56, 14-56, 16-56, 18-56, 20-56, 22-56, 24-56, 2 6-56, 28-56, 30-56, 6-52, 8-52, 10-52, 12-52, 14-52, 16-52, 18-52, 20-52, 22-52, 24-52, 26-52, 28-52, 30-52, 6-48, 8-48, 10-48, 12-48, 14-48, 16-48, 18-48, 20-48, 22-48, 24-48, 26-48, 28-48, 30-48, 6-44, 8-44, 10-44, 12-44, 14-44, 16-44, 18-44, 20-44, 22-44, 24-44, 26-44, 28-44 32, 8-32, 10-32, 12-32, 14-32, 16-32, 18-32, 20-32, 22-32, 24-32, 26-32, 28-32, or 30-32 ECN.

[0227] II.A.1 Cholesterol and other sterols

[0228] In some aspects, the anchoring moiety comprises a sterol, a steroid, a hopane, a hydroxysteroid, a ring-opened steroid, or an analog thereof with a lipophilic property. In some aspects, the anchoring moiety comprises a sterol, such as a plant sterol, a mycosterol, or an animal sterol. Exemplary animal sterols include cholesterol and 24S-hydroxycholesterol; Exemplary plant sterols include ergosterol (mycosterol), campesterol, sitosterol, and stigmasterol. In some aspects, the sterol is selected from ergosterol, 7-dehydrocholesterol, cholesterol, 24S-hydroxycholesterol, lanosterol, cycloartenol, fucosterol, saringosterol, campesterol, β-sitosterol, sitostanol, fecal sterol, avenasterol, or stigmasterol. Sterols may exist as free sterols, acylated (sterol esters), alkylated (sterol alkyl ethers), sulfated (sterol sulfates), or linked to a glycosidic moiety (sterol glycosides), which may themselves be acylated (acylated sterol glycosides).

[0229] In some aspects, the anchoring moiety comprises a steroid. In some aspects, the steroid is selected from dihydrotestosterone, ursutol, agave sapogenin, diosgenin, progesterone or cortisol.

[0230] For example, sterols can be conjugated to BAM at an available —OH group of the sterol directly or through a linker combination. Exemplary sterols have a general backbone as shown below:

[0231]

[0232] As another example, ergosterol has the following structure:

[0233]

[0234] Cholesterol has the following structure:

[0235]

[0236] Thus, in some aspects, the free -OH group of the sterol or steroid is used to conjugate the ASO to the sterol (eg, cholesterol) or steroid directly or through a linker combination.

[0237] II.A.2. Fatty acids

[0238] In some aspects, the anchoring moiety is a fatty acid. In some aspects, the fatty acid is a short chain, medium chain or long chain fatty acid. In some aspects, the fatty acid is a saturated fatty acid. In some aspects, the fatty acid is an unsaturated fatty acid. In some aspects, the fatty acid is a monounsaturated fatty acid. In some aspects, the fatty acid is a polyunsaturated fatty acid, such as ω-3 (ω-3) or ω-6 (ω-6) fatty acid.

[0239] In some aspects, the lipid (eg, fatty acid) has a C 2 -C 60 In some aspects, the lipid (eg, fatty acid) has a C 2 -C 28 In some aspects, the fatty acid has C 2 -C 40 In some aspects, the fatty acid has C 2 -C 12 or C 4 -C 12 In some aspects, the fatty acid has C 4 -C 40 In some aspects, the fatty acid has C 4 -C 40 , C 2 -C 38 , C 2 -C 36 , C 2 -C 34 , C 2 -C 32 , C 2 -C 30 , C 4 -C 30 , C 2 -C 28 , C 4 -C 28 , C 2 -C 26 , C 4 -C 26 , C 2 -C 24 , C 4 -C 24 , C 6 -C 24 , C 8 -C 24 , C 10 -C 24 , C 2 -C 22 , C 4 -C 22 , C 6 -C 22 , C 8 -C 22 , C 10 -C 22 , C 2 -C 20 , C 4 -C 20 , C 6 -C20 、C 8 -C 20 、C 10 -C 20 、C 2 -C 18 、C 4 -C 18 、C 6 -C 18 、C 8 -C 18 、C 10 -C 18 、C 12 -C 18 、C 14 -C 18 、C 16 -C 18 、C 2 -C 16 、C 4 -C 16 、C 6 -C 16 、C 8 -C 16 、C 10 -C 16 、C 12 -C 16 、C 14 -C 16 、C 2 -C 15 、C 4 -C 15 、C 6 -C 15 、C 8 -C 15 、C 9 -C 15 、C 10 -C 15 、C 11 -C 15 、C 12 -C 15 、C 13 -C 15 、C 2 -C 14 、C 4 -C 14 、C 6 -C 14 、C 8 -C 14 、C 9 -C 14 、C 10 -C 14 、C 11 -C 14, C 12 -C 14 , C 2 -C 13 , C 4 -C 13 , C 6 -C 13 , C 7 -C 13 , C 8 -C 13 , C 9 -C 13 , C 10 -C 13 , C 10 -C 13 , C 11 -C 13 , C 2 -C 12 , C 4 -C 12 , C 6 -C 12 , C 7 -C 12 , C 8 -C 12 , C 9 -C 12 , C 10 -C 12 , C 2 -C 11 , C 4 -C 11 , C 6 -C 11 , C 7 -C 11 , C 8 -C 11 , C 9 -C 11 , C 2 -C 10 , C 4 -C 10 , C 2 -C 9 , C 4 -C 9 , C 2 -C 8 , C 2 -C 7 , C 4 -C 7 , C 2 -C 6 or C 4 -C 6 In some aspects, the fatty acid has C 2 , C 3, C 4 , C 5 , C 6 , C 7 , C 8 , C 9 , C 10 , C 11 , C 12 , C 13 , C 14 , C 15 , C 16 , C 17 , C 18 , C 19 , C 20 , C 21 , C 22 , C 23 , C 24 , C 25 , C 26 , C 27 , C 28 , C 29 , C 30 , C 31 , C 32 , C 33 , C 34 , C 35 , C 36 , C 37 , C 38 , C 39 , C 40 , C 41 , C 42 , C 43 , C 44 , C 45 , C 46 , C 47 , C 48 , C 49 , C 50 , C 51 , C 52 , C 53 , C 54 , C 55 , C 56 , C 57 , C 58 , C 59 or C 60 chain.

[0240] In some aspects, the anchoring moiety comprises two fatty acids, each of which is independently selected from fatty acids having a chain having any of the aforementioned carbon atom ranges or carbon atom numbers. In some aspects, one fatty acid is independently a fatty acid having a C6-C21 chain, and one fatty acid is independently a fatty acid having a C12-C36 chain. In some aspects, each fatty acid independently has a chain of 11, 12, 13, 14, 15, 16, or 17 carbon atoms.

[0241] Suitable fatty acids include saturated straight chain fatty acids, saturated branched chain fatty acids, unsaturated fatty acids, hydroxy fatty acids and polycarboxylic acids. In some aspects, such fatty acids have up to 32 carbon atoms.

[0242] Examples of useful saturated straight-chain fatty acids include those having an even number of carbon atoms, butyric acid, caproic acid, caprylic acid, capric acid, lauric acid, myristic acid, palmitic acid, stearic acid, arachidic acid, behenic acid, tetracosanoic acid, hexacosanoic acid, octacosanoic acid, triacontanoic acid and n-dotriacontanoic acid, and those having an odd number of carbon atoms, such as propionic acid, n-pentanoic acid, heptanoic acid, nonanoic acid, undecanoic acid, tridecanoic acid, pentadecanoic acid, heptadecanoic acid, nonadecanoic acid, heneicosanoic acid, tricosanoic acid, pentacosanoic acid and heptacosanoic acid.

[0243] Examples of suitable saturated branched fatty acids include isobutyric acid, isohexanoic acid, isooctanoic acid, isodecanoic acid, isolauric acid, 11-methyldodecanoic acid, isomyristic acid, 13-methyl-tetradecanoic acid, isopalmitic acid, 15-methyl-hexadecanoic acid, isostearic acid, 17-methyloctadecanoic acid, isoarachidic acid, 19-methyl-eicosanoic acid, α-ethyl-hexanoic acid, α-hexyldecanoic acid, α-heptylundecanoic acid, 2-decyltetradecanoic acid, 2-undecyltetradecanoic acid, 2-decylpentadecanoic acid, 2-undecylpentadecanoic acid and Fine oxocol 1800 acid (product of Nissan Chemical Industries, Ltd.). Suitable saturated odd-numbered branched fatty acids include isobutyl terminated anteiso fatty acids such as 6-methyl-octanoic acid, 8-methyl-decanoic acid, 10-methyl-dodecanoic acid, 12-methyl-tetradecanoic acid, 14-methyl-hexadecanoic acid, 16-methyl-octadecanoic acid, 18-methyl-eicosanoic acid, 20-methyl-docosanoic acid, 22-methyl-tetracosanoic acid, 24-methyl-hexacosanoic acid and 26-methyloctacosanoic acid.

[0244] Examples of suitable unsaturated fatty acids include 4-decenoic acid, decenoic acid, 4-dodecenoic acid, 5-dodecenoic acid, laureic acid, 4-tetradecenoic acid, 5-tetradecenoic acid, 9-tetradecenoic acid, palmitoleic acid, 6-octadecenoic acid, oleic acid, 9-octadecenoic acid, 11-octadecenoic acid, 9-eicosenoic acid, cis-11-eicosenoic acid, cetoleic acid, 13-docosenoic acid, 15-tetradecenoic acid, 17- Hexacosenoic acid, 6,9,12,15-hexadecatetraenoic acid, linoleic acid, linolenic acid, α-eleostearic acid, β-eleostearic acid, punicic acid, 6,9,12,15-octadecatetraenoic acid, euphorbic acid, 5,8,11,14-eicosatetraenoic acid, 5,8,11,14,17-eicosapentaenoic acid, 7,10,13,16,19-docosapentaenoic acid, 4,7,10,13,16,19-docosahexaenoic acid, etc.

[0245] Examples of suitable hydroxy fatty acids include α-hydroxylauric acid, α-hydroxymyristic acid, α-hydroxypalmitic acid, α-hydroxystearic acid, ω-hydroxylauric acid, α-hydroxyarachidic acid, 9-hydroxy-12-octadecenoic acid, ricinoleic acid, α-hydroxybehenic acid, 9-hydroxy-trans-10,12-octadecadienoic acid, styryl acid, saffron acid, 9,10-dihydroxystearic acid, 12-hydroxystearic acid, and the like.

[0246] Examples of suitable polycarboxylic acids include oxalic acid, malonic acid, succinic acid, glutaric acid, adipic acid, pimelic acid, suberic acid, azelaic acid, sebacic acid, D,L-malic acid, and the like.

[0247] In some aspects, each fatty acid is independently selected from propionic acid, butyric acid, valeric acid, caproic acid, heptanoic acid, caprylic acid, nonanoic acid, decanoic acid, undecanoic acid, lauric acid, tridecanoic acid, myristic acid, pentadecanoic acid, palmitic acid, heptadecanoic acid, stearic acid, nonadecanoic acid, arachidic acid, heneicosanoic acid, behenic acid, tricosanoic acid, lignoceric acid, pentacosanoic acid, cerotic acid, heptacosanoic acid, montanic acid, nonacosanoic acid, melissic acid, untertriacontadecanoic acid, lacceric acid, cerotic acid, lignic acid, hexatricoic acid, hexatricodecanoic acid, heptatriacontadecanoic acid, and octatricodecanoic acid.

[0248] In some aspects, each fatty acid is independently selected from alpha-linolenic acid, stearidonic acid, eicosapentaenoic acid, docosahexaenoic acid, linoleic acid, gamma-linoleic acid, dihomo-gamma-linoleic acid, arachidonic acid, docosatetraenoic acid, palmitoleic acid, vaccenic acid, paullinic acid, oleic acid, elaidic acid, gondoic acid, erucic acid, nervonic acid, mead acid, adrenic acid, bosseopentaenoic acid, ozubondo acid, sardine acid, herring acid, docosahexaenoic acid, or tetracopentaenoic acid, or another monounsaturated or polyunsaturated fatty acid.

[0249] In some aspects, one or both of the fatty acids are essential fatty acids. In view of the beneficial health effects of some essential fatty acids, the therapeutic benefits of the exosomes of the disclosed loaded therapeutic agent can be increased by including such fatty acids in the therapeutic agent. In some aspects, the essential fatty acids are n-6 or n-3 essential fatty acids selected from the group consisting of: linolenic acid, γ-linolenic acid, dihomo-γ-linolenic acid, arachidonic acid, adrenal acid, docosapentaenoic acid, α-linolenic acid, octadecatetraenoic acid, 20:4n-3 acid, eicosapentaenoic acid, docosapentaenoic acid, or docosahexaenoic acid.

[0250] In some aspects, each fatty acid is independently selected from all-cis-7,10,13-hexadecatrienoic acid, α-linolenic acid, octadecatetraenoic acid, eicosatrienoic acid, eicosatetraenoic acid, eicosapentaenoic acid (EPA), docosapentaenoic acid, docosahexaenoic acid (DHA), tetracosapentaenoic acid, tetracosahexaenoic acid or lipoic acid. In other aspects, the fatty acid is selected from eicosapentaenoic acid, docosahexaenoic acid or lipoic acid. Other examples of fatty acids include all-cis-7,10,13-hexadecatrienoic acid, α-linolenic acid (ALA or all-cis-9,12,15-octadecatrienoic acid), stearidonic acid (STD or all-cis-6,9,12,15-octadecatrienoic acid), eicosatrienoic acid (ETE or all-cis-11,14,17-eicosatrienoic acid), eicosatetraenoic acid (ETA or all-cis-8,11,14,17-eicosatrienoic acid), and alpha-linolenic acid (ALA or all-cis-9,12,15-octadecatrienoic acid). In some aspects, the fatty acid is a medium chain fatty acid, such as lipoic acid.

[0251] Fatty acid chains vary greatly in their chain length, and can be classified according to chain length, for example, short to very long. Short-chain fatty acids (SCFA) are fatty acids (e.g., butyric acid) with about five or less carbon chains. In some aspects, fatty acids are SCFA. Medium-chain fatty acids (MCFA) include fatty acids with a chain of about 6-12 carbons, which can form medium-chain triglycerides. In some aspects, fatty acids are MCFA. Long-chain fatty acids (LCFA) include fatty acids with a chain of 13-21 carbons. In some aspects, fatty acids are LCFA. In some aspects, fatty acids are LCFA. Very long-chain fatty acids (VLCFA) include fatty acids with a chain of 22 or more carbons, such as 22-60, 22-50, or 22-40 carbons. In some aspects, fatty acids are VLCFA.

[0252] II.A.3. Phospholipids

[0253] In some aspects, the anchoring moiety comprises a phospholipid. Phospholipids are a class of lipids that are a major component of all cell membranes. Due to their amphiphilic nature, they can form lipid bilayers. The structure of a phospholipid molecule generally consists of two hydrophobic fatty acid "tails" and a hydrophilic "head" consisting of phosphate groups. For example, a phospholipid can be a lipid according to the formula:

[0254]

[0255] Where R p represents the phospholipid part, and R 1 and R 2 represents fatty acid moieties which may be the same or different and may or may not have unsaturation.

[0256] The phospholipid moiety may be selected, for example, from the non-limiting group consisting of phosphatidylcholine, phosphatidylethanolamine, phosphatidylglycerol, phosphatidylserine, phosphatidic acid, 2-lysophosphatidylcholine, and sphingomyelin.

[0257] Specific phospholipids can promote fusion with a lipid bilayer, such as a lipid bilayer of an exosome membrane. For example, a cationic phospholipid can interact with one or more negatively charged phospholipids of the membrane. Fusion of a phospholipid with a membrane can allow one or more elements of a lipid-containing composition to bind to or pass through the membrane.

[0258] The fatty acid moiety can be selected, for example, from the non-limiting group consisting of lauric acid, myristic acid, myristoleic acid, palmitic acid, palmitoleic acid, stearic acid, oleic acid, linoleic acid, α-linolenic acid, erucic acid, phytanic acid, arachidic acid, arachidonic acid, eicosapentaenoic acid, behenic acid, docosapentaenoic acid, and docosahexaenoic acid.

[0259] The phospholipids used as anchoring moieties in the present disclosure can be natural or non-natural phospholipids. Non-natural phospholipid materials are also contemplated, including natural materials with modifications and substitutions (including branching, oxidation, cyclization, and alkynes). For example, phospholipids can be cross-linked with one or more alkynes (e.g., alkenyl groups in which one or more double bonds are replaced by triple bonds) by functionalization with one or more alkynes. Under appropriate reaction conditions, alkyne groups can undergo copper-catalyzed cycloaddition reactions when exposed to azides.

[0260] Phospholipids include, but are not limited to, glycerophospholipids such as phosphatidylcholine, phosphatidylethanolamine, phosphatidylserine, phosphatidylinositol, phosphatidylglycerol, and phosphatidic acid. Examples of phospholipids that can be used in the anchoring moiety disclosed herein include phosphatidylethanolamine (e.g., dilauroylphosphatidylethanolamine, dimyristoylphosphatidylethanolamine, dipalmitoylphosphatidylethanolamine, distearoylphosphatidylethanolamine, dioleoylphosphatidylethanolamine, 1-palmitoyl-2-oleylphosphatidylethanolamine, 1-oleyl-2-palmitoylphosphatidylethanolamine, and dierucylphosphatidylethanolamine), phosphatidylglycerol. phosphatidylglycerol (e.g., dilauroylphosphatidylglycerol, dimyristoylphosphatidylglycerol, dipalmitoylphosphatidylglycerol, distearoylphosphatidylglycerol, dioleoylphosphatidylglycerol, 1-palmitoyl-2-oleyl-phosphatidylglycerol, 1-oleyl-2-palmitoyl-phosphatidylglycerol and dierucylphosphatidylglycerol); phosphatidylserine (e.g., dilauroylphosphatidylglycerol, dimyristoylphosphatidylglycerol, dipalmitoylphosphatidylglycerol, distearoylphosphatidylglycerol, dioleoylphosphatidylglycerol, 1-palmitoyl-2-oleyl-phosphatidylglycerol, 1-oleyl-2-palmitoyl-phosphatidylglycerol and dierucylphosphatidylglycerol); phosphatidylserine, palmitoylphosphatidylserine, distearoylphosphatidylserine, dioleoylphosphatidylserine, 1-palmitoyl-2-oleyl-phosphatidylserine, 1-oleyl-2-palmitoyl-phosphatidylserine and dierucoylphosphatidylserine); phosphatidic acids (e.g., dilauroylphosphatidic acid, dimyristoylphosphatidic acid, dipalmitoylphosphatidic acid, distearoylphosphatidic acid, dioleoylphosphatidic acid ... oleylphosphatidic acid, 1-oleyl-2-palmitoyl-phosphatidic acid and dieruoylphosphatidic acid); and phosphatidylinositols (e.g., dilauroylphosphatidylinositol, dimyristoylphosphatidylinositol, dipalmitoylphosphatidylinositol, distearoylphosphatidylinositol, dioleoylphosphatidylinositol, 1-palmitoyl-2-oleyl-phosphatidylinositol, 1-oleyl-2-palmitoyl-phosphatidylinositol and dieruoylphosphatidylinositol).

[0261] Phospholipids can be symmetrical or asymmetrical types. As used herein, the term "symmetrical phospholipids" includes glycerophospholipids with a fatty acid moiety and a sphingolipid that is matched, wherein the hydrocarbon chain of the variable fatty acid moiety and the sphingosine main chain includes a considerable number of carbon atoms. As used herein, the term "asymmetric phospholipids" includes lysolipids, glycerophospholipids with different fatty acid moieties (e.g., fatty acid moieties with different carbon atoms and / or unsaturation (e.g., double bonds), and sphingolipids (e.g., variable fatty acid moieties include at least two carbon atoms more than the hydrocarbon chain or at least two carbon atoms less than the hydrocarbon chain) with different numbers of carbon atoms of the hydrocarbon chain of the variable fatty acid moiety and the sphingosine main chain.

[0262] In some aspects, the anchoring moiety comprises at least one symmetric phospholipid. The symmetric phospholipid can be selected from the non-limiting group consisting of: 1,2 dipropionyl sn-glycero3 phosphocholine (03:0PC), 1,2 dibutyryl sn-glycero3 phosphocholine (04:0PC), 1,2 divaleranoyl sn-glycero3 phosphocholine (05:0PC), 1,2 dihexanoyl sn-glycero3 phosphocholine (06:0PC), 1,2 diheptanoyl sn-glycero3 phosphocholine (07:0PC), 1,2 dioctanoyl sn-glycero3 phosphocholine (08:0PC), 1,2 dinonanoyl sn-glycero3 phosphocholine (09:0PC), 1,2 didecanoyl sn-glycero3 phosphocholine (10:0PC), 1,2 diundecanoyl sn-glycero3 phosphocholine (11:0PC), 1,2 diundecanoyl sn-glycero3 phosphocholine (12:0PC), 1,2 diundecanoyl sn-glycero3 phosphocholine (13:0PC), 1,2 diundecanoyl sn-glycero3 phosphocholine (14:0PC), 1,2 diundecanoyl sn-glycero3 phosphocholine (15:0PC), 1,2 diundecanoyl sn-glycero3 phosphocholine (16:0PC), 1,2 diundecanoyl sn-glycero3 phosphocholine (17:0PC), 1,2 diundecanoyl sn-glycero3 phosphocholine (18:0PC), 1,2 diundecanoyl sn-glycero3 phosphocholine (19:0PC), 1,2 diundecanoyl sn- Glyceryl 3 phosphocholine (11:0PC, DUPC), 1,2 dilauroyl sn glyceryl 3 phosphocholine (12:0PC), 1,2 ditridecanoyl sn glyceryl 3 phosphocholine (13:0PC), 1,2 dimyristoyl sn glyceryl 3 phosphocholine (14:0PC, DMPC), 1,2 dipentadecanoyl sn glyceryl 3 phosphocholine (15:0PC), 1,2 dipalmitoyl sn glyceryl 3 phosphocholine (16:0PC, DPPC), 1,2 diphytanoyl sn glyceryl 3 phosphocholine (4ME16:0PC), 1,2 diheptadecanoyl sn glyceryl 3 phosphocholine (17:0PC), 1,2 distearoyl sn glycerol sn glyceryl 3 phosphocholine (18:0PC, DSPC), 1,2-dinonadecanoyl sn glyceryl 3 phosphocholine (19:0PC), 1,2-diicosanoyl sn glyceryl 3 phosphocholine (20:0PC), 1,2-diheonedecanoyl sn glyceryl 3 phosphocholine (21:0PC), 1,2-dibehenoyl sn glyceryl 3 phosphocholine (22:0PC), 1,2-ditricosanoyl sn glyceryl 3 phosphocholine (23:0PC), 1,2-ditetracosanoyl sn glyceryl 3 phosphocholine (24:0PC), 1,2-dimyristoyl sn glyceryl 3 phosphocholine (14:1(Δ9-cis)PC), 1,2-ditransmyristoyl sn Glyceryl 3 phosphocholine (14:1 (Δ9-trans) PC), 1,2-dipalmitoleoyl sn glyceryl 3 phosphocholine (16:1 (Δ9-cis) PC), 1,2-ditrans-palmitoleoyl sn glyceryl 3 phosphocholine (16:1 (Δ9-trans) PC), 1,2-diisophysalisyl sn glyceryl 3 phosphocholine (18:1 (Δ6-cis) PC), 1,2-dioleoyl sn glyceryl 3 phosphocholine (18:1 (Δ9-cis) PC, DOPC), 1,2-ditrans-oleoyl sn glyceryl 3 phosphocholine (18:1 (Δ9-trans) PC), 1,2-dilinoleoyl sn glyceryl 3 phosphocholine (18:2 (cis) PC, DLPC), 1,1,2-Dilinolenoyl sn-glyceryl-3-phosphocholine (18:3 (cis) PC, DLnPC), 1,2-Di-eicosenoyl sn-glyceryl-3-phosphocholine (20:1 (cis) PC), 1,2-Diarachidonoyl sn-glyceryl-3-phosphocholine (20:4 (cis) PC, DAPC), 1,2-Di-Euphrasianoyl sn-glyceryl-3-phosphocholine (22:1 (cis) PC), 1,2-Di-Docosahexaenoyl sn-glyceryl-3-phosphocholine (22:6 (cis) PC, DHAPC), 1,2-Di-Neuryl sn-glyceryl-3-phosphocholine (24:1 (cis) PC, DHAPC), 1,2-Di-Di-Euranoyl sn-glyceryl-3-phosphocholine (24:1 (cis) PC, DHAPC), 1,2-Di ... 1,2-Dicaprylyl sn-glyceryl-3-phosphoethanolamine (06:0PE), 1,2-Dicaprylyl sn-glyceryl-3-phosphoethanolamine (08:0PE), 1,2-Didecanoyl sn-glyceryl-3-phosphoethanolamine (10:0PE), 1,2-Dilauroyl sn-glyceryl-3-phosphoethanolamine (12:0PE), 1,2-Dimyristoyl sn-glyceryl-3-phosphoethanolamine (14:0PE), 1,2-Dipentadecanoyl sn-glyceryl-3-phosphoethanolamine (15:0PE), 1,2-Dipalmitoyl sn-glyceryl-3-phosphoethanolamine (16:0PE), 1, 2-diphytanoyl sn glyceryl 3 phosphoethanolamine (4ME16:0PE), 1,2-diheptadecanoyl sn glyceryl 3 phosphoethanolamine (17:0PE), 1,2-distearoyl sn glyceryl 3 phosphoethanolamine (18:0PE, DSPE), 1,2-dipalmitoleoyl sn glyceryl 3 phosphoethanolamine (16:1PE), 1,2-dioleoyl sn glyceryl 3 phosphoethanolamine (18:1(Δ9-cis)PE, DOPE), 1,2-di-recidoyl sn glyceryl 3 phosphoethanolamine (18:1(Δ9-trans)PE), 1,2-di-linoleoyl sn n-glyceryl 3-phosphoethanolamine (18:2PE, DLPE), 1,2-dilinolenoyl sn-glyceryl 3-phosphoethanolamine (18:3PE, DLnPE), 1,2-arachidonoyl sn-glyceryl 3-phosphoethanolamine (20:4PE, DAPE), 1,2-didocosahexaenoyl sn-glyceryl 3-phosphoethanolamine (22:6PE, DHAPE), 1,2-dioctadecenyl sn-glyceryl 3-phosphocholine (18:0 diether PC), 1,2-dioleoyl sn-glyceryl 3-phosphocholine (1 glycerol) sodium salt (DOPG), and any combination thereof.

[0263] In some aspects, the anchoring moiety comprises at least one symmetric phospholipid selected from the non-limiting group consisting of DLPC, DMPC, DOPC, DPPC, DSPC, DUPC, 18:0 diether PC, DLnPC, DAPC, DHAPC, DOPE, 4ME 16:0PE, DSPE, DLPE, DLnPE, DAPE, DHAPE, DOPG, and any combination thereof.

[0264] In some aspects, the anchoring moiety comprises at least one asymmetric phospholipid. The asymmetric phospholipid can be selected from the non-limiting group consisting of: 1 myristoyl 2 palmitoyl sn glyceryl 3 phosphocholine (14:0-16:0PC, MPPC), 1 myristoyl 2 stearoyl sn glyceryl 3 phosphocholine (14:0-18:0PC, MSPC), 1 palmitoyl 2 acetyl sn glyceryl 3 phosphocholine (16:0-02:0PC), 1 palmitoyl 2 myristoyl sn glyceryl 3 phosphocholine (16:0-14:0PC, PMPC), 1 palmitoyl 2 stearoyl s n glyceryl tri-phosphocholine (16:0-18:0PC, PSPC), 1 palmitoyl 2 oleoyl sn glyceryl tri-phosphocholine (16:0-18:1PC, POPC), 1 palmitoyl 2 linoleoyl sn glyceryl tri-phosphocholine (16:0-18:2PC, PLPC), 1 palmitoyl 2 arachidonoyl sn glyceryl tri-phosphocholine (16:0-20:4PC), 1 palmitoyl 2 docosahexaenoyl sn glyceryl tri-phosphocholine (14:0-22:6PC), 1 stearoyl 2 myristoyl sn glyceryl 3 phosphocholine (18:0-14:0PC, SMPC), 1 stearoyl 2 palmitoyl sn glyceryl 3 phosphocholine (18:0-16:0PC, SPPC), 1 stearoyl 2 oleoyl sn glyceryl 3 phosphocholine (18:0-18:1PC, SOPC), 1 stearoyl 2 linoleoyl sn glyceryl 3 phosphocholine (18:0-18:2PC), 1 stearoyl 2 arachidonoyl sn glyceryl 3 phosphocholine (18:0-20:4PC), 1 stearoyl Fatty acyl 2 docosahexaenoyl sn glyceryl 3 phosphocholine (18:0-22:6PC), 1 oleoyl 2 myristoyl sn glyceryl 3 phosphocholine (18:1-14:0PC, OMPC), 1 oleoyl 2 palmitoyl sn glyceryl 3 phosphocholine (18:1-16:0PC, OPPC), 1 oleoyl 2 stearoyl sn glyceryl 3 phosphocholine (18:1-18:0PC, OSPC), 1 palmitoyl 2 oleoyl sn glyceryl 3 phosphoethanolamine (16:0-18:1PE,POPE), 1 palmitoyl 2 linoleoyl sn glyceryl 3 phosphoethanolamine (16:0-18:2PE), 1 palmitoyl 2 arachidonoyl sn glyceryl 3 phosphoethanolamine (16:0-20:4PE), 1 palmitoyl 2 docosahexenoyl sn glyceryl 3 phosphoethanolamine (16:0-22:6PE), 1 stearoyl 2 oleoyl sn glyceryl 3 phosphoethanolamine (18:0-18:1PE), 1 stearyl Fatty acyl 2 linoleyl sn glyceryl 3 phosphoethanolamine (18:0-18:2PE), 1 stearoyl 2 arachidonoyl sn glyceryl 3 phosphoethanolamine (18:0-20:4PE), 1 stearoyl 2 docosahexaenoyl sn glyceryl 3 phosphoethanolamine (18:0-22:6PE), 1 oleoyl 2 cholesteryl hemisuccinyl sn glyceryl 3 phosphocholine (OChemsPC) and any combination thereof.

[0265] In order to provide more significant nuclease resistance, cellular uptake efficiency and more significant RNA interference effect, phosphatidylethanolamine can be used as an anchoring part, such as dimyristoylphosphatidylethanolamine, dipalmitoylphosphatidylethanolamine, 1-palmitoyl-2-oleyl-phosphatidylethanolamine and dioleoylphosphatidylethanolamine.

[0266] The binding site of lipid (e.g., phospholipid) and joint combination or BAM (e.g., ASO) can be appropriately selected according to the type of lipid and joint or BAM. Any position except the hydrophobic group of lipid can be connected to joint or BAM by chemical bond. For example, when using phosphatidylethanolamine, it can be connected by forming amide bond etc. between the amino group of phosphatidylethanolamine and joint or BAM. When using phosphatidylglycerol, it can be connected by forming ester bond, ether bond etc. between the hydroxyl group of glycerol residue and joint or BAM. When using phosphatidylserine, it can be connected by forming amide bond or ester bond etc. between the amino group or carboxyl group of serine residue and joint or BAM. When using phosphatidic acid, it can be connected by forming phosphate bond etc. between phosphate residue and joint or BAM. When using phosphatidylinositol, it can be connected by forming ester bond, ether bond etc. between the hydroxyl group of inositol residue and joint or BAM.

[0267] II.A.4. Lysolipids (e.g., lysophospholipids)

[0268] In some aspects, the anchoring moiety comprises a lysolipid, such as a lysophospholipid. A lysolipid is a derivative of a lipid in which one or two fatty acyl chains have been removed (usually by hydrolysis). A lysophospholipid is a derivative of a phospholipid in which one or two fatty acyl chains have been removed by hydrolysis.

[0269] In some aspects, the anchoring moiety comprises any of the phospholipids disclosed above, wherein one or both acyl chains have been removed by hydrolysis, and the resulting lysophospholipid thus comprises one or no fatty acid acyl chains.

[0270] In some aspects, the anchoring moiety comprises a lysoglycerophospholipid, a lysoglycosphingolipid, a lysophosphatidylcholine, a lysophosphatidylethanolamine, a lysophosphatidylinositol, or a lysophosphatidylserine.

[0271] In some aspects, the anchoring moiety comprises a lysophospholipid selected from the non-limiting group consisting of: 1 hexanoyl 2 hydroxy sn glyceryl 3 phosphocholine (06:0 Lyso PC), 1 heptanoyl 2 hydroxy sn glyceryl 3 phosphocholine (07:0 Lyso PC), 1 octanoyl 2 hydroxy sn glyceryl 3 phosphocholine (08:0 Lyso PC), 1 nonanoyl 2 hydroxy sn glyceryl 3 phosphocholine (09:0 Lyso PC), 1 decanoyl 2 hydroxy sn glyceryl 3 phosphocholine (10:0 Lyso PC), 1 undecanoyl 2 hydroxy sn glyceryl 3 phosphocholine (11:0 Lyso PC), 1 lauroyl 2 hydroxy sn glyceryl 3 phosphocholine (12:0 Lyso PC), 1 tridecanoyl 2 hydroxy sn glyceryl 3 phosphocholine (13:0 Lyso PC), 1 myristoyl 2 hydroxy sn glyceryl 3 phosphocholine (14:0 Lyso PC). PC), 1-pentadecanoyl-2-hydroxy-sn-glyceryl-3-phosphocholine (15:0 Lyso PC), 1-palmitoyl-2-hydroxy-sn-glyceryl-3-phosphocholine (16:0 Lyso PC), 1-heptadecanoyl-2-hydroxy-sn-glyceryl-3-phosphocholine (17:0 Lyso PC), 1-stearoyl-2-hydroxy-sn-glyceryl-3-phosphocholine (18:0 Lyso PC), 1-oleoyl-2-hydroxy-sn-glyceryl-3-phosphocholine (18:1 Lyso PC), 1-nonadecanoyl-2-hydroxy-sn-glyceryl-3-phosphocholine (19:0 Lyso PC), 1-eicosanoyl-2-hydroxy-sn-glyceryl-3-phosphocholine (20:0 Lyso PC), 1-behenoyl-2-hydroxy-sn-glyceryl-3-phosphocholine (22:0 Lyso PC), 1-tetracosanoyl-2-hydroxy-sn-glyceryl-3-phosphocholine (24:0 Lyso PC), 1-hexacosanoyl-2-hydroxy-sn-glyceryl-3-phosphocholine (26:0 Lyso PC), 1 myristoyl 2 hydroxy sn glyceryl 3 phosphoethanolamine (14:0 Lyso PE), 1 palmitoyl 2 hydroxy sn glyceryl 3 phosphoethanolamine (16:0 Lyso PE), 1 stearoyl 2 hydroxy sn glyceryl 3 phosphoethanolamine (18:0 Lyso PE), 1 oleoyl 2 hydroxy sn glyceryl 3 phosphoethanolamine (18:1 Lyso PE), 1 hexadecyl sn glyceryl 3 phosphocholine (C16 Lyso PC), and any combination thereof.

[0272] II.A.5 Vitamins

[0273] In some aspects, the anchoring portion comprises a lipophilic vitamin, such as folic acid, vitamin A, vitamin E, or vitamin K. In some aspects, the anchoring portion comprises vitamin A. Vitamin A is a group of unsaturated nutritional organic compounds that include retinol, retinal, retinoic acid, and several provitamin A carotenoids (most notably beta-carotene). In some aspects, the anchoring portion comprises retinol. In some aspects, the anchoring portion comprises a retinoid. Retinoids are a class of vitamin A equivalents or chemical compounds chemically related to them. In some aspects, the anchoring portion comprises a first generation retinoid (e.g., retinol, tretinoin, isotretinoin, or alitretinoin), a second generation retinoid (e.g., etretinate or acitretin), a third generation retinoid (e.g., adapalene, bexarotene, or tazarotene), or any combination thereof.

[0274]

[0275] In some aspects, the anchoring moiety comprises vitamin E. Tocopherols are a class of methylated phenols, many of which have vitamin E activity. Thus, in some aspects, the anchoring moiety comprises alpha-tocopherol, beta-tocopherol, gamma-tocopherol, delta-tocopherol, or a combination thereof.

[0276] α-Tocopherol

[0277] Beta-tocopherol

[0278] Gamma Tocopherol

[0279] Delta Tocopherol

[0280] Tocotrienols also have vitamin E activity. The key chemical structural difference between tocotrienols and tocopherol is that tocotrienols have unsaturated isoprenoid side chains with three carbon-carbon double bonds, compared to the saturated side chains of tocopherol. In some aspects, the anchoring moiety comprises α-tocotrienol, β-tocotrienol, γ-tocotrienol, δ-tocotrienol, or a combination thereof. Tocotrienols can be represented by the formula

[0281]

[0282] α(α)-Tocotrienol: R1=Me, R2=Me, R3=Me;

[0283] β(β)-tocotrienol: R1=Me, R2=H, R3=Me;

[0284] γ(γ)-tocotrienol: R1=H, R2=Me, R3=Me;

[0285] δ(δ)-Tocotrienol: R1=H, R2=H, R3=Me.

[0286] In some aspects, the anchoring moiety comprises vitamin K. Chemically, the vitamin K family comprises 2-methyl-1,4-naphthoquinone (3-) derivatives. Vitamin K comprises two naturally occurring vitamin equivalents: vitamin K 1 and vitamin K 2 Vitamin K 1 The structure of vitamin K (also called phytomenaquinone, phylloquinone or (E)-phytomenaquinone) is characterized by the presence of a phytyl group. 2 The structure of (methyl menaquinone) is characterized by the presence of polyisoprene side chains in the molecule, which can contain 6 to 13 isoprenyl units. 2 It consists of many related chemical isoforms with carbon side chains of varying lengths consisting of isoprenoid atoms. MK-4 is vitamin K 2 The most common form of vitamin K. Long-chain forms such as MK-7, MK-8, and MK-9 predominate in fermented foods. Longer-chain forms of vitamin K 2 , such as MK-10 to MK-13, are synthesized by bacteria, but they are not well absorbed and have little biological function. In addition to the natural forms of vitamin K, there are many synthetic forms of vitamin K, such as vitamin K 3 (Menadione; 2-methylnaphthalene-1,4-dione), Vitamin K 4 and vitamin K 5 .

[0287] Thus, in some aspects, the anchoring moiety comprises vitamin K 1 , K 2 (For example, MK-4, MK-5, MK-6, MK-7, MK-8, MK-9, MK-10, MK-11, MK-12, or MK-13), K 3 , K 4 , K 5 or any combination thereof.

[0288]

[0289] II.B. Connector Assembly

[0290] In some aspects, the BAM is connected to the hydrophobic membrane anchoring moiety disclosed herein by a linker combination, which may include any combination of cleavable linkers and / or non-cleavable linkers. The main function of the linker combination is to provide optimal spacing between one or more anchoring moieties and the BAM target. For example, in the case of an ASO, the linker combination should reduce steric hindrance and position the ASO so that it can interact with the target nucleic acid (e.g., mRNA or miRNA).

[0291] The linker can be easily cleaved ("cleavable linker"), thereby promoting the release of the bioactive molecule. Therefore, in some aspects, the linker combination disclosed herein may include a cleavable linker. Under conditions where the bioactive molecule remains active, such cleavable linkers may, for example, be susceptible to acid-induced cleavage, light-induced cleavage, peptidase-induced cleavage, esterase-induced cleavage, and disulfide bond cleavage. Alternatively, the linker can be substantially resistant to cleavage ("non-cleavable linker"). In some aspects, the cleavable linker includes a spacer. In some aspects, the spacer is PEG.

[0292] In some aspects, the linker combination comprises at least 2, at least 3, at least 4, at least 5, or at least 6 or more different linkers disclosed herein. In some aspects, the linkers in the linker combination can be connected by an ester linkage (e.g., phosphodiester or phosphorothioate).

[0293] In some aspects, the linker is a direct bond between the anchoring moiety and the BAM (eg, ASO).

[0294] II.B.1 Non-cleavable linker

[0295] In some aspects, the linker combination comprises a "non-cleavable linker". A non-cleavable linker is any chemical moiety that is capable of connecting two or more components of the modified bioactive molecule of the present disclosure (e.g., a bioactive molecule and an anchoring moiety; a bioactive molecule and a cleavable linker; an anchoring moiety and a cleavable linker) in a stable covalent manner and does not belong to the categories listed above for cleavable linkers. Therefore, a non-cleavable linker is substantially resistant to acid-induced cleavage, light-induced cleavage, peptidase-induced cleavage, esterase-induced cleavage, and disulfide bond-induced cleavage.

[0296] In addition, non-cleavable refers to the ability of a chemical bond in or adjacent to a joint to undergo cleavage induced by an acid, a photolabile cleavage agent, a peptidase, an esterase, or a chemical or physiological compound that cleaves disulfide bonds without the cyclic dinucleotide and / or antibody losing its activity. In some aspects, the bioactive molecule is connected to the joint by another joint (e.g., a self-degradable joint).

[0297] In some aspects, the linker combination comprises a non-cleavable linker comprising, for example, tetraethylene glycol (TEG), hexaethylene glycol (HEG), polyethylene glycol (PEG), succinimide, or any combination thereof. In some aspects, the non-cleavable linker comprises a spacer unit to connect the biologically active molecule to the non-cleavable linker.

[0298] In some aspects, one or more non-cleavable linkers comprise smaller units linked together (e.g., HEG, TEG, glycerol, C2 to C12 alkyl, etc.). In one aspect, the linkage is an ester linkage (e.g., phosphodiester or phosphorothioate) or other linkage.

[0299] II.B.1.a. Ethylene glycol (HEG, TEG, PEG)

[0300] In some aspects, the linker combination comprises a non-cleavable linker, wherein the non-cleavable linker comprises a 3 -(O-CH 2 -CH 2 ) n - or R 3 -(0-CH 2 -CH 2 ) n -O-polyethylene glycol (PEG), where R 3 is hydrogen, methyl or ethyl, and n has a value from 2 to 200. In some aspects, the linker comprises a spacer, wherein the spacer is PEG.

[0301] In some aspects, the PEG linker is an oligoethylene glycol, such as a diethylene glycol, triethylene glycol, tetraethylene glycol (TEG), pentaethylene glycol, or hexaethylene glycol (HEG) linker.

[0302] In some aspects, n has 2, 3, 4, 5, 6, 7, 8, 9, 10, 11, 12, 13, 14, 15, 16, 17, 18, 19, 20, 21, 22, 23, 24, 25, 26, 27, 28, 29, 30, 31, 32, 33, 34, 35, 36, 37, 38, 39, 40, 41, 42, 43, 44, 45, 46, 47, 48, 49, 50, 51, 52, 53, 54, 55, 56, 57, 58, 59 , 60, 61, 62, 63, 64, 65, 66, 67, 68, 69, 70, 71, 72, 73, 74, 75, 76, 77, 78, 79, 80, 81, 82, 83, 84, 85, 86, 87, 88, 89, 90, 91, 92, 93, 94, 95, 96, 97, 98, 99, 100, 101, 102, 103, 104, 105, 106, 107, 108, 109, 110, 111, 112, 113 , 114, 115, 116, 117, 118, 119, 120, 121, 122, 123, 124, 125, 126, 127, 128, 129, 130, 131, 132, 133, 134, 135, 136, 137, 138, 139, 140, 141, 142, 143, 144, 145, 146, 147, 148, 149, 150, 151, 152, 153, 154, 155, 156, 157 7, 158, 159, 160, 161, 162, 163, 164, 165, 166, 167, 168, 169, 170, 171, 172, 173, 174, 175, 176, 177, 178, 179, 189, 181, 182, 183, 184, 185, 186, 187, 188, 189, 190, 191, 192, 193, 194, 195, 196, 197, 198, 199, or 200. In some aspects, n is between 2 and 10, between 10 and 20, between 20 and 30, between 30 and 40, between 40 and 50, between 50 and 60, between 60 and 70, between 70 and 80, between 80 and 90, between 90 and 100, between 100 and 110, between 110 and 120, between 120 and 130, between 130 and 140, between 140 and 150, between 150 and 160, between 160 and 170, between 170 and 180, between 180 and 190, or between 190 and 200. In some specific aspects, n has a value of 3 to 200, 3 to 20, 10 to 30, or 9 to 45. In some aspects, the PEG is a branched chain PEG.Branched chain PEGs have 3 to 10 PEG chains deriving from a central core group.

[0303] In some aspects, the PEG moiety is a monodisperse polyethylene glycol. In the context of the present disclosure, monodisperse polyethylene glycol (mdPEG) is a PEG with a single, limited chain length and molecular weight. MdPEG is usually produced by separation from a polymerization mixture by chromatography. In some formulas, the monodisperse PEG moiety is designated as abbreviation mdPEG.

[0304] In some aspects, PEG is a star PEG. A star PEG has 10 to 100 PEG chains derived from a central core group. In some aspects, PEG is a comb PEG. A comb PEG has multiple PEG chains that are typically grafted onto a polymer backbone.

[0305] In some aspects, PEG has a molar mass between 100 g / mol and 3000 g / mol, particularly between 100 g / mol and 2500 g / mol, more particularly about 100 g / mol to 2000 g / mol. In some aspects, PEG has a molar mass between 200 g / mol and 3000 g / mol, particularly between 300 g / mol and 2500 g / mol, more particularly about 400 g / mol to 2000 g / mol.

[0306] In some aspects, PEG is PEG 100 PEG 200 PEG 300 PEG 400 PEG 500 PEG 600 PEG 700 PEG 800 PEG 900 PEG 1000 PEG 1100 PEG 1200 PEG 1300 PEG 1400 PEG 1500 PEG 1600 PEG 1700 PEG 1800 PEG 1900 PEG 2000 PEG 2100 PEG 2200 PEG 2300 PEG 2400 PEG 2500 PEG 1600 PEG 1700 PEG 1800PEG 1900 PEG 2000 PEG 2100 PEG 2200 PEG 2300 PEG 2400 PEG 2500 PEG 2600 PEG 2700 PEG 2800 PEG 2900或 PEG 3000 In one specific aspect, PEG is PEG 400 In another specific aspect, PEG is PEG 2000 .

[0307] In some aspects, the present disclosure may include several PEG linkers, such as cleavable linkers flanking PEG, HEG or TEG linkers. In some aspects, the linker combination includes (HEG)n and / or (TEG)n, wherein n is an integer between 1 and 50, and each unit is connected, for example, by a phosphate linker, a phosphorothioate linkage, or a combination thereof.

[0308] II.B.1.b. Glycerol and polyglycerol (PG)

[0309] In some aspects, the linker combination comprises a non-cleavable linker comprising a non-cleavable linker having the formula (R 3 —O—(CH 2 —CHOH—CH 2 O) n —) described glycerol units or polyglycerols (PG), wherein R3 is hydrogen, methyl or ethyl, and n has a value from 3 to 200. In some aspects, n has a value from 3 to 20. In some aspects, n has a value from 10 to 30.

[0310] In some aspects, the PG linker is a diglycerol, triglycerol, tetraglycerol (TG), pentaglycerol, or hexaglycerol (HG) linker. In some aspects, n has 2, 3, 4, 5, 6, 7, 8, 9, 10, 11, 12, 13, 14, 15, 16, 17, 18, 19, 20, 21, 22, 23, 24, 25, 26, 27, 28, 29, 30, 31, 32, 33, 34, 35, 36, 37, 38, 39, 40, 41, 42, 43, 44, 45, 46, 47, 48, 49, 50, 51, 52, 53, 54, 55, 56, 57, 58, 59 , 60, 61, 62, 63, 64, 65, 66, 67, 68, 69, 70, 71, 72, 73, 74, 75, 76, 77, 78, 79, 80, 81, 82, 83, 84, 85, 86, 87, 88, 89, 90, 91, 92, 93, 94, 95, 96, 97, 98, 99, 100, 101, 102, 103, 104, 105, 106, 107, 108, 109, 110, 111, 112, 113 , 114, 115, 116, 117, 118, 119, 120, 121, 122, 123, 124, 125, 126, 127, 128, 129, 130, 131, 132, 133, 134, 135, 136, 137, 138, 139, 140, 141, 142, 143, 144, 145, 146, 147, 148, 149, 150, 151, 152, 153, 154, 155, 156, 157 7, 158, 159, 160, 161, 162, 163, 164, 165, 166, 167, 168, 169, 170, 171, 172, 173, 174, 175, 176, 177, 178, 179, 189, 181, 182, 183, 184, 185, 186, 187, 188, 189, 190, 191, 192, 193, 194, 195, 196, 197, 198, 199, or 200. In some aspects, n is between 2 and 10, between 10 and 20, between 20 and 30, between 30 and 40, between 40 and 50, between 50 and 60, between 60 and 70, between 70 and 80, between 80 and 90, between 90 and 100, between 100 and 110, between 110 and 120, between 120 and 130, between 130 and 140, between 140 and 150, between 150 and 160, between 160 and 170, between 170 and 180, between 180 and 190, or between 190 and 200.

[0311] In some alternatives of these aspects, n has a value of 9 to 45. In some aspects, the heterologous moiety is of the formula (R 3 —O—(CH 2 —CHOR 5 —CH 2 —O) n —) described branched polyglycerol, wherein R 5 is hydrogen; or 3 —O—(CH 2 —CHOH—CH 2 —O) n —) described as a straight glycerol chain, and R 3 is hydrogen, methyl or ethyl. In some aspects, the heterologous moiety is of formula (R 3 —O—(CH 2 —CHOR 5 —CH 2 —O) n —) described hyperbranched polyglycerol, wherein R 5 is hydrogen; or 3 —O—(CH 2 —CHOR 6 —CH 2 —O) n —) describes a glycerol chain, wherein R 6 is hydrogen; or 3 —O—(CH 2 —CHOR 7 —CH 2 —O) n —) describes a glycerol chain, wherein R 7 is hydrogen; or 3 —O—(CH 2 —CHOH—CH 2 —O) n —) described as a straight glycerol chain, and R 3 is hydrogen, methyl or ethyl. Hyperbranched glycerols and methods for their synthesis are described in Oudshorn et al. (2006) Biomaterials 27:5471-5479; Wilms et al. (20100 Acc. Chem. Res. 43, 129-41 and references cited therein.

[0312] In some aspects, PG has a molar mass between 100 g / mol and 3000 g / mol, particularly between 100 g / mol and 2500 g / mol, more particularly about 100 g / mol to 2000 g / mol. In some aspects, PG has a molar mass between 200 g / mol and 3000 g / mol, particularly between 300 g / mol and 2500 g / mol, more particularly about 400 g / mol to 2000 g / mol.

[0313] In some aspects, PG is PG 100 PG 200 PG 300 PG 400 PG 500 PG 600 PG 700 PG 800 PG 900 PG 1000 PG 1100 PG 1200 PG 1300 PG 1400 PG 1500 PG 1600 PG 1700 PG 1800 PG 1900 PG 2000 PG 2100 PG 2200 PG 2300 PG 2400 PG 2500 PG 1600 PG 1700 PG 1800 PG 1900 PG 2000 PG 2100 PG 2200 PG 2300 PG 2400 PG 2500 PG 2600 PG 2700 PG 2800 PG 2900 or PG 3000 In one particular aspect, PG is PG 400 In another specific aspect, PG is PG 2000 .

[0314] In some aspects, the linker combination comprises (glycerol)n, and / or (HG)n and / or (TG)n, wherein n is an integer between 1 and 50, and each unit is connected, for example, by a phosphate linker, a phosphorothioate linkage, or a combination thereof.

[0315] II.B.1.c. Aliphatic (alkyl) linkers

[0316] In some aspects, the linker combination comprises at least one aliphatic (alkyl) linker, for example propyl, butyl, hexyl, or C2-C12 alkyl, such as C2-C10 alkyl or C2-C6 alkyl.

[0317] In some aspects, the linker combination comprises an alkyl chain, such as an unsubstituted alkyl. In some aspects, the linker combination comprises a substituted or unsubstituted alkenyl, a substituted or unsubstituted alkynyl, an arylalkyl, an arylalkenyl, an arylalkynyl, a heteroarylalkyl, a heteroarylalkenyl, a heteroarylalkynyl, a heterocyclylalkyl, a heterocyclylalkenyl, a heterocyclylalkynyl, an aryl, a heteroaryl, a heterocyclyl, a cycloalkyl, a cycloalkenyl, an alkylarylalkyl, an alkylarylalkenyl, an alkylarylalkynyl, an alkenylarylalkyl, an alkenylReylalkenyl, an alkenylarylalkynyl, Alkynylarylalkyl, alkynylarylalkenyl, alkynylarylalkynyl, alkylheteroarylalkyl, alkylheteroarylalkyl, alkylheteroarylalkenyl, alkylheteroarylalkynyl, alkenylheteroarylalkyl, alkenylheteroarylalkenyl, alkenylheteroarylalkynyl, alkynylheteroarylalkyl, alkynylheteroarylalkenyl, alkynylheteroarylalkynyl, alkylheterocyclylalkyl, alkylheterocyclylalkenyl, alkylheterocyclylalkynyl, alkenylheterocyclylalkyl, alkenylheterocyclylalkenyl or alkenylheterocyclylalkynyl.

[0318] Optionally, these components are substituted. Substituents include alcohols, alkoxy groups (such as methoxy, ethoxy and propoxy), straight or branched alkyl groups (such as C1-C12 alkyl groups), amines, aminoalkyl groups (such as amino C1-C12 alkyl groups), phosphoramidites, phosphates, phosphoramidates, phosphorodithioates, phosphorothioates, hydrazides, hydrazines, halogens (such as F, Cl, Br or I), amides, alkylamides (such as amide C1-C12 alkyl groups), carboxylic acids, carboxylates, carboxylic anhydrides, carboxylic acid halides, ethers, sulfonyl halides, imidoesters, isocyanates, isothiocyanates, haloformates, carbodiimide adducts, aldehydes, ketones, sulfhydryl groups, haloacetyl groups, alkyl halides, alkyl sulfonates, C(═O)CH═CHC(═O) (maleimide), thioethers, cyano groups, sugars (such as mannose, galactose and glucose), α,β-unsaturated carbonyl groups, alkylmercury groups or α,β-unsaturated sulfones.

[0319] The term "alkyl," by itself or as part of another substituent, means, unless otherwise stated, a straight or branched chain hydrocarbon radical (e.g., C 1 -C 10The term "alkyl" refers to alkyl radicals having 1 to 24 carbon atoms, such as 1 to 10 carbon atoms, 1 to 8 carbon atoms, or 1 to 6 carbon atoms. "Lower alkyl" refers to alkyl radicals having 1 to 4 carbon atoms. The term "alkyl" includes divalent and polyvalent radicals. For example, where appropriate, for example, when the formula indicates that the alkyl radical is divalent or when the substituents are linked together to form a ring, the term "alkyl" includes "alkylene". Examples of alkyl radicals include, but are not limited to, methyl, ethyl, n-propyl, isopropyl, n-butyl, tert-butyl, isobutyl, sec-butyl, and homologs and isomers of, for example, n-pentyl, n-hexyl, n-heptyl, and n-octyl.

[0320] The term "alkylene", by itself or as part of another substituent, means a divalent (diradical) alkyl group, wherein alkyl is defined herein. "Alkylene" is exemplified by, but not limited to, -CH 2 CH 2 CH 2 CH 2 -. Typically, an "alkylene" group will have from 1 to 24 carbon atoms, for example, 10 or fewer carbon atoms (e.g., 1 to 8 or 1 to 6 carbon atoms). A "lower alkylene" group is an alkylene group having from 1 to 4 carbon atoms.

[0321] The term "alkenyl", by itself or as part of another substituent, refers to a straight or branched hydrocarbon radical having 2 to 24 carbon atoms and at least one double bond. Typical alkenyls have 2 to 10 carbon atoms and at least one double bond. In one aspect, alkenyls have 2 to 8 carbon atoms or 2 to 6 carbon atoms and 1 to 3 double bonds. Exemplary alkenyls include vinyl, 2-propenyl, 1-but-3-enyl, crotyl, 2-(butadienyl), 2,4-pentadienyl, 3-(1,4-pentadienyl), 2-isopentenyl, 1-pent-3-enyl, 1-hex-5-enyl, etc.

[0322] The term "alkynyl", by itself or as part of another substituent, refers to a straight or branched, unsaturated or polyunsaturated hydrocarbon radical having 2 to 24 carbon atoms and at least one triple bond. Typical "alkynyl" has 2 to 10 carbon atoms and at least one triple bond. In one aspect of the invention, alkynyl has 2 to 6 carbon atoms and at least one triple bond. Exemplary alkynyls include prop-1-ynyl, prop-2-ynyl (i.e., propargyl), ethynyl, and 3-butynyl.

[0323] The terms "alkoxy," "alkylamino," and "alkylthio" (or thioalkoxy) are used in their conventional sense and refer to an alkyl group attached to the remainder of the molecule through an oxygen atom, an amino group, or a sulfur atom, respectively.

[0324] The term "heteroalkyl", by itself or in combination with another term, means a group consisting of the specified number of carbon atoms (e.g., C2 -C 10 or C 2 -C 8 ) and at least one heteroatom selected from, for example, N, O, S, Si, B and P (in one aspect, N, O and S), wherein the nitrogen, sulfur and phosphorus atoms are optionally oxidized, and one or more nitrogen atoms are optionally quaternized. One or more heteroatoms are placed at any interior position of the heteroalkyl group. Examples of heteroalkyl groups include, but are not limited to, -CH 2 -CH 2 -O-CH 3 、-CH 2 -CH 2 -NH-CH 3 、-CH 2 -CH 2 -N(CH 3 )-CH 3 、-CH 2 -S-CH 2 -CH 3 、-CH 2 -CH 2 -S(O)-CH 3 、-CH 2 -CH 2 -S(O) 2 -CH 3 、-CH=CH-O-CH 3 、-CH 2 -Si(CH 3 ) 3 、-CH 2 -CH=N-OCH 3 and -CH=CH-N(CH 3 )-CH 3 Up to two heteroatoms may be consecutive, such as, for example, -CH 2 -NH-OCH 3 and –CH 2 -O-Si(CH 3 ) 3 .

[0325] Similarly, the term "heteroalkylene", by itself or as part of another substituent, refers to a divalent radical derived from heteroalkyl, such as, but not limited to, -CH 2 -CH 2 -S-CH 2 -CH 2 -and-CH 2 -S-CH 2 -CH 2 -NH-CH 2-. Typically, a heteroalkyl group will have from 3 to 24 atoms (carbon and heteroatoms, excluding hydrogen) (3 to 24-membered heteroalkyl). In another example, a heteroalkyl group has a total of from 3 to 10 atoms (3 to 10-membered heteroalkyl) or from 3 to 8 atoms (3 to 8-membered heteroalkyl). Where appropriate, for example, when the formula indicates that the heteroalkyl group is divalent or when substituents are linked together to form a ring, the term "heteroalkyl" includes "heteroalkylene".

[0326] The term "cycloalkyl", by itself or in combination with other terms, means a saturated or unsaturated non-aromatic carbocyclic group having from 3 to 24 carbon atoms, for example having from 3 to 12 carbon atoms (e.g., C 3 -C 8 Cycloalkyl or C 3 -C 6 Cycloalkyl). Examples of cycloalkyl include, but are not limited to, cyclopropyl, cyclobutyl, cyclopentyl, cyclohexyl, cycloheptyl, 1-cyclohexenyl, 3-cyclohexenyl, cycloheptyl, etc. The term "cycloalkyl" also includes bridged polycyclic (e.g., bicyclic) structures such as norbornyl, adamantyl, and bicyclo[2.2.1]heptyl. "Cycloalkyl" may be fused to at least one (e.g., 1 to 3) other ring selected from aryl (e.g., phenyl), heteroaryl (e.g., pyridyl), and non-aromatic (e.g., carbocyclic or heterocyclic) rings. When "cycloalkyl" includes fused aryl, heteroaryl, or heterocyclic rings, then "cycloalkyl" is connected to the rest of the molecule via a carbocyclic ring.

[0327] The terms "heterocycloalkyl", "heterocyclic", "heterocycle" or "heterocyclyl", by themselves or in combination with other terms, mean a carbocyclic non-aromatic ring (e.g., 3 to 8 membered rings and, e.g., 4, 5, 6 or 7 membered rings) containing at least one and up to 5 heteroatoms selected from, e.g., N, O, S, Si, B and P (e.g., N, O and S), wherein the nitrogen, sulfur and phosphorus atoms are optionally oxidized and one or more nitrogen atoms are optionally quaternized (e.g., 1 to 4 heteroatoms selected from nitrogen, oxygen and sulfur), or a fused ring system of 4 to 8 membered rings containing at least one and up to 10 heteroatoms (e.g., 1 to 5 heteroatoms selected from N, O and S), known to those skilled in the art for stable combinations. Exemplary heterocycloalkyls include fused benzene rings. When the "heterocycle" group includes a fused aryl, heteroaryl or cycloalkyl ring, then the "heterocycle" group is attached to the rest of the molecule through the heterocycle. Heteroatoms may occupy the position at which the heterocycle is attached to the rest of the molecule.

[0328] Exemplary heterocycloalkyl or heterocyclic groups of the present disclosure include morpholinyl, thiomorpholinyl, thiomorpholinyl S-oxide, thiomorpholinyl S,S-dioxide, piperazinyl, homopiperazinyl, pyrrolidinyl, pyrrolinyl, imidazolidinyl, tetrahydropyranyl, piperidinyl, tetrahydrofuranyl, tetrahydrothiophenyl, piperidinyl, homopiperidinyl, homomorpholinyl, homothiomorpholinyl, homothiomorpholinyl S,S-dioxide, oxazolidinone, dihydropyrazolyl ... 1-(1,2,5,6-tetrahydropyridinyl), 1-piperidinyl, 2-piperidinyl, 3-piperidinyl, 4-morpholinyl, 3-morpholinyl, tetrahydrofuran-2-yl, tetrahydrofuran-3-yl, tetrahydrothiophene-2-yl, tetrahydrothiophene-3-yl, 1-piperazinyl, 2-piperazinyl, etc.

[0329] "Aryl" means a 5, 6 or 7-membered aromatic carbocyclic group with a monocyclic ring (e.g., phenyl) or fused to other aromatic or non-aromatic rings (e.g., 1 to 3 other rings). When "aryl" includes a non-aromatic ring (such as in 1,2,3,4-tetrahydronaphthyl) or a heteroaryl, "aryl" is connected to the rest of the molecule by an aromatic ring (e.g., a phenyl ring). Aryl is optionally substituted (e.g., with 1 to 5 substituents as described herein). In one example, aryl has 6 to 10 carbon atoms. Non-limiting examples of aryl include phenyl, 1-naphthyl, 2-naphthyl, quinoline, indanyl, indenyl, dihydronaphthyl, fluorenyl, tetrahydronaphthyl (tetralinyl), benzo [d] [1,3] dioxolyl or 6,7,8,9-tetrahydro-5H-benzo [a] cycloheptenyl. In one aspect, aryl is selected from phenyl, benzo[d][1,3]dioxolyl, and naphthyl. In another aspect, aryl is phenyl.

[0330] The term "arylalkyl" or "aralkyl" is intended to include those groups in which an aryl or heteroaryl group is attached to an alkyl group to form the groups -alkyl-aryl and -alkyl-heteroaryl (where alkyl, aryl and heteroaryl are defined herein). Exemplary "arylalkyl" or "aralkyl" groups include benzyl, phenethyl, pyridylmethyl, and the like.

[0331] "Aryloxy" means the group -O-aryl, wherein aryl is as defined herein. In one example, the aryl portion of the aryloxy is phenyl or naphthyl. In one aspect, the aryl portion of the aryloxy is phenyl.

[0332] The term "heteroaryl" or "heteroaromatic" refers to a polyunsaturated 5, 6 or 7-membered aromatic moiety containing at least one heteroatom (e.g., 1 to 5 heteroatoms, such as 1-3 heteroatoms) selected from N, O, S, Si and B (e.g., N, O and S), wherein nitrogen and sulfur atoms are optionally oxidized, and one or more nitrogen atoms are optionally quaternized. "Heteroaryl" can be a monocyclic ring or fused with other aryl, heteroaryl, cycloalkyl or heterocycloalkyl rings (e.g., 1 to 3 other rings). When "heteroaryl" includes fused aryl, cycloalkyl or heterocycloalkyl rings, then "heteroaryl" is connected to the rest of the molecule by a heteroaromatic ring. Heteroaryl can be connected to the rest of the molecule by carbon or heteroatoms.

[0333] In one example, the heteroaryl group has 4 to 10 carbon atoms and 1 to 5 heteroatoms selected from O, S and N. Non-limiting examples of heteroaryl groups include pyridyl, pyrimidinyl, quinolyl, benzothiophenyl, indolyl, indolyl, pyridazinyl, pyrazinyl, isoindolyl, isoquinolyl, quinazolinyl, quinoxalinyl, phthalazinyl, imidazolyl, isoxazolyl, pyrazolyl, oxazolyl, thiazolyl, indolizinyl, indazolyl, benzothiazolyl, benzimidazolyl, benzofuranyl, furanyl, thienyl, pyrrolyl, oxadiazolyl, thiadiazolyl, triazolyl, tetrazolyl, isothiazolyl, naphthyridinyl, isochromanyl, chromanyl, tetrahydroisoquinolyl, isoindolyl, isobenzotetrahydrofuranyl, isobenzotetrahydrothiazinyl phenyl, isobenzothienyl, benzoxazolyl, pyridopyridyl, benzotetrahydrofuranyl, benzotetrahydrothienyl, purinyl, benzodioxolyl, triazinyl, pteridinyl, benzothiazolyl, imidazopyridyl, imidazothiazolyl, dihydrobenzisoxazinyl, benzisoxazinyl, benzoxazinyl, dihydrobenzisothiazinyl, benzopyranyl , benzothiopyranyl, chromonyl, chromanonyl, pyridyl-N-oxide, tetrahydroquinolinyl, dihydroquinolinyl, dihydroquinolinonyl, dihydroisoquinolinonyl, dihydrocoumarinyl, dihydroisocoumarinyl, isoindolinonyl, benzodioxanyl, benzoxazolinonyl, pyrrolyl N-oxide, pyrimidinyl N-oxide, pyridazinyl N-oxide, pyrazinyl-N-oxide, quinolyl-N-oxide, indolyl N-oxide, indole N-oxide, benzothiazolyl N-oxide, benzoimidazolyl N-oxide, pyrrolyl N-oxide, oxadiazolyl N-oxide, thiadiazolyl N-oxide, triazolyl N-oxide, tetrazolyl N-oxide, benzothiopyranyl S-oxide, benzothiopyranyl S, S-dioxide. Exemplary heteroaryl groups include imidazolyl, pyrazolyl, thiadiazolyl, triazolyl, isoxazolyl, isothiazolyl, imidazolyl, thiazolyl, oxadiazolyl and pyridyl.Other exemplary heteroaryl groups include 1-pyrrolyl, 2-pyrrolyl, 3-pyrrolyl, 3-pyrazolyl, 2-imidazolyl, 4-imidazolyl, pyrazinyl, 2-oxazolyl, 4-oxazolyl, 2-phenyl-4-oxazolyl, 5-oxazolyl, 3-isoxazolyl, 4-isoxazolyl, 5-isoxazolyl, 2-thiazolyl, 4-thiazolyl, 5-thiazolyl, 2-furyl, 3-furyl, 2-thienyl, 3-thienyl, 2-pyridyl, 3-pyridyl, pyridin-4-yl, 2-pyrimidinyl, 4-pyrimidinyl, 5-benzothiazolyl, purinyl, 2-benzimidazolyl, 5-indolyl, 1-isoquinolyl, 5-isoquinolyl, 2-quinoxalinyl, 5-quinoxalinyl, 3-quinolyl, 6-quinolyl. Substituents for each of the above noted aryl and heteroaryl ring systems are selected from the group consisting of acceptable substituents for aryl groups described below.

[0334] Examples of aliphatic linkers include the following structures: —O—CO—O—; —NH—CO—O—; —NH—CO—NH—; —NH—(CH 2 ) n1 —;—S—(CH 2 ) n1 —;—CO—(CH 2 ) n1 —CO—; —CO—(CH 2 ) n1 —NH—; —NH—(CH 2 ) n1 —NH—; —CO—NH—(CH 2 ) n1 —NH—CO—;—C(═S)—NH—(CH 2 ) n1 —NH—CO—;—C(═S)—NH—(CH 2 ) n1 —NH—C—(═S)—;—CO—O—(CH 2 ) n1 —O—CO—;—C(═S)—O—(CH 2 ) n1 —O—CO—;—C(═S)—O—(CH 2 ) n1 —O—C—(═S)—;—CO—NH—(CH 2 ) n1 —O—CO—;—C(═S)—NH—(CH 2 ) n1 —O—CO—;—C(═S)—NH—(CH 2 ) n1 —O—C—(═S)—;—CO—NH—(CH 2 )n1 —O—CO—;—C(═S)—NH—(CH 2 ) n1 —CO—;—C(═S)—O—(CH 2 ) n1 —NH—CO—;—C(═S)—NH—(CH 2 ) n1 —O—C—(═S)—;—NH—(CH 2 CH 2 O) n2 —CH(CH 2 OH)—;—NH—(CH 2 CH 2 O) n2 —CH 2 —;—NH—(CH 2 CH 2 O) n2 —CH 2 —CO—;—O—(CH 2 ) n3 —S—S—(CH 2 ) n4 —O—P(═O) 2 —;—CO—(CH 2 ) n3 —O—CO—NH—(CH 2 ) n4 —;—CO—(CH 2 ) n3 —CO—NH—(CH 2 ) n4 —;—(CH2) n1 NH—;—C(O)(CH2) n1 NH—;—C(O)—(CH2) n1 -C(O)—;—C(O)—(CH2) n1 -C(O)O—;—C(O)—O—;—C(O)—(CH2) n1 -NH—C(O)—;—C(O)—(CH2) n1 —;—C(O)—NH—;—C(O)—;—(CH2) n1 -C(O)—;—(CH2) n1 -C(O)O—;—(CH2) n1 —;—(CH2) n1-NH—C(O)—; wherein n1 is an integer between 1 and 40 (e.g., 2 to 20 or 2 to 12); n2 is an integer between 1 and 20 (e.g., 1 to 10 or 1 to 6); n3 and n4 may be the same or different and are integers between 1 and 20 (e.g., 1 to 10 or 1 to 6).

[0335] In some aspects, the linker combination comprises (C3)n, (C4)n, (C5)n, (C6)n, (C7)n, or (C8)n, or a combination thereof, wherein n is an integer between 1 and 50, and each unit is connected, for example, by a phosphate linker, a phosphorothioate linkage, or a combination thereof.

[0336] II.B.2. Cleavable Linkers

[0337] In some aspects, the different components of the ASO disclosed herein can be linkers of cleavable linkers. The term cleavable linker refers to a linker comprising at least one linkage or chemical bond that can be broken or cleaved. As used herein, the term cleavage refers to the breaking of one or more chemical bonds in a relatively large molecule in a manner that produces two or more relatively smaller molecules. Cleavage can be mediated, for example, by nucleases, peptidases, proteases, phosphatases, oxidases, or reductases, or by specific physicochemical conditions, such as redox environments, pH, the presence of reactive oxygen species, or light of a specific wavelength.

[0338] In some aspects, the term "cleavable" as used herein refers to, for example, rapidly degradable linkers such as, for example, phosphodiesters and disulfides, while the term "non-cleavable" refers to, for example, more stable linkages such as, for example, nuclease-resistant phosphorothioates.

[0339] In some aspects, the cleavable linker is a dinucleotide or trinucleotide linker, a disulfide, an imine, a thioketal, a val-cit dipeptide, or any combination thereof.

[0340] In some aspects, the cleavable linker comprises valine-alanine-p-aminobenzyl carbamate or valine-citrulline-p-aminobenzyl carbamate.

[0341] II.B.2.a. Redox-cleavable linkers

[0342] In some aspects, the linker combination comprises a redox cleavable linker. As a non-limiting example, one type of cleavable linker is a redox cleavable linker that cleaves upon reduction or upon oxidation. In some aspects, the redox cleavable linker contains a disulfide bond, i.e., it is a disulfide cleavable linker. The redox cleavable linker can be reduced, for example, by intracellular thiols, oxidases, or reductases.

[0343] II.B.2.b. Reactive Oxygen Species (ROS) Cleavable Linkers

[0344] In some aspects, the linker combination may include a cleavable linker that can be cleaved by reactive oxygen species (ROS), such as, for example, superoxide (O) or hydrogen peroxide (HO) produced by inflammatory processes such as activated neutrophils. In some aspects, the ROS cleavable linker is a thioketal cleavable linker. See, for example, U.S. Patent No. 8,354,455B2, which is incorporated herein by reference in its entirety.

[0345] II.B.2.c. pH-dependent cleavable linkers

[0346] In some aspects, the linker is an "acid-labile linker" comprising an acid-cleavable linking group, which is a linking group that is selectively cleaved under acidic conditions (pH < 7).

[0347] As a non-limiting example, the acid-cleavable linking group is cracked in an acidic environment, such as about 6.0, 5.5, 5.0 or lower. In some aspects, the pH is about 6.5 or lower. In some aspects, the joint is by such as an enzyme that can serve as a broad acid, such as a peptidase (which can be substrate-specific) or a phosphatase cleavage. In cells, some low pH organelles (such as endosomes and lysosomes) can provide a cracking environment for the acid-cleavable linking group. Although the pH of human serum is 7.4, the average pH in the cell is slightly lower, within the range of about 7.1-7.3. Endosomes also have an acidic pH, within the range of 5.5 to 6.0, and lysosomes are about 5.0 under even more acidic pH. Therefore, pH-dependent cleavable joints are sometimes referred to as endosome unstable joints in the art.

[0348] The acid cleavable group may have the general formula -C=NN-, C(O)O or -OC(O). In another non-limiting example, for example, when the carbon attached to the ester oxygen (alkoxy) is attached to an aryl, substituted alkyl or tertiary alkyl such as dimethylpentyl or tert-butyl. Examples of acid cleavable linking groups include, but are not limited to, amines, imines, aminoesters, benzoic acid imides, diorthoesters, polyphosphates, polyphosphazenes, acetals, vinyl ethers, hydrazones, cis-aconitates, hydrazides, thiocarbamoyls, imizines, azidomethyl-methylmaleic anhydride, thiopropionates, masked endosomolytic agents, citraconyls or any combination thereof. Disulfide linkages are also sensitive to pH.

[0349] In some aspects, the linker comprises a low pH labile hydrazone bond. Such acid labile bonds have been widely used in the field of conjugates, such as antibody-drug conjugates. See, for example, Zhou et al. (2011) Biomacromolecules 12: 1460-7; Yuan et al. (2008) Acta Biomater. 4: 1024-37; Zhang et al. (2007) Acta Biomater. 6: 838-50; Yang et al. (2007) J. Pharmacol. Exp. Ther. 321: 462-8; Reddy et al. (2006) Cancer Chemother. Pharmacol. 58: 229-36; Doronina et al. (2003) Nature Biotechnol. 21: 778-84.

[0350] In certain aspects, the linker comprises a low pH labile bond selected from: ketals that are labile in acidic environments (e.g., pH less than 7, greater than about 4) to form diols and ketones; acetals that are labile in acidic environments (e.g., pH less than 7, greater than about 4) to form diols and aldehydes; imines or iminiums that are labile in acidic environments (e.g., pH less than 7, greater than about 4) to form amines and aldehydes or ketones; silicon-oxygen-carbon linkages that are labile under acidic conditions; silicon-nitrogen (silazane) linkages; silicon-carbon linkages (e.g., arylsilanes, vinylsilanes, and allylsilanes); maleamates (amide bonds synthesized from maleic anhydride derivatives and amines); orthoesters; hydrazones; activated carboxylic acid derivatives (e.g., esters, amides) designed to undergo acid-catalyzed hydrolysis; or vinyl ethers.

[0351] Other examples can be found in US Pat. Nos. 9,790,494 B2 and 8,137,695 B2, the contents of which are incorporated herein by reference in their entirety.

[0352] II.B.2.d. Enzyme-cleavable linkers

[0353] In some aspects, the joint combination may include a joint that can be cleaved by intracellular or extracellular enzymes, such as proteases, esterases, nucleases, and amidases. The range of enzymes that can cleave a particular joint in the joint combination depends on the specific bond and chemical structure of the joint. Thus, a peptide joint can be cleaved, for example, by a peptidase, a joint containing an ester bond can be cleaved, for example, by an esterase; a joint containing an amide bond can be cleaved, for example, by an amidase; and the like.

[0354] II.B.2.e. Protease-cleavable linkers

[0355] In some aspects, the joint combination comprises a protease cleavable joint, i.e. a joint that can be cleaved by an endogenous protease. Only certain peptides are easily cleaved intracellularly or extracellularly. See, for example, Trout et al., 79 Proc. Natl. Acad. Sci. USA, 626-629 (1982) and Umemoto et al. 43 Int. J. Cancer, 677-684 (1989). A cleavable joint may contain a cleavable site consisting of an α-amino acid unit and a peptide bond, which is chemically an amide bond between the carboxylate of an amino acid and the amino group of a second amino acid. Other amide bonds, such as the bond between the α-amino group of a carboxylate and lysine, are not understood to be peptide bonds and are considered to be non-cleavable.

[0356] In some aspects, the protease-cleavable linker comprises a cleavage site for a protease,The proteases are, for example, enkephalinase (CALLA or CDIO), phorate oligopeptidase (TOP), leukotriene A4 hydrolase, endothelin converting enzyme, ste24 protease, neurolysin, mitochondrial intermediate peptidase, interstitial collagenase, collagenase, stromelysin, macrophage elastase, matrix lytic factor, gelatinase, meprins, procollagen C-endopeptidase, procollagen N-endopeptidase, ADAM and ADAMT metalloproteinases, myelin-associated metalloproteinases, enamelysin, tumor necrosis factor α-converting enzyme, insulysin, nardilysin, mitochondrial processing peptidase , magnolysin, dactylysin-like metalloproteinase, neutrophil collagenase, matrix metalloproteinase, membrane-type matrix metalloproteinase, SP2 endopeptidase, prostate-specific antigen (PSA), plasmin, urokinase, human fibroblast activation protein (FAPα), trypsin, chymotrypsin, caldecrin, pancreatic elastase, pancreatic endopeptidase, enteropeptidase, leukocyte elastase, myeloblast, chymase, tryptase, granzyme, stratum corneum chymotrypsin, acrosomal protease, kallikrein, complement components and factors, alternative complement pathway c3 / c5 convertase, mannose binding protein-related serine protein leukemia, coagulation factors, thrombin, protein C, U and T plasminogen activator, cathepsin G, serine transmembrane protease (hepsin), prostasin, hepatocyte growth factor activated endopeptidase, subtilisin / kexin type proprotein convertase, furin, proprotein convertase, prolyl peptidase, acylaminoacyl peptidase, peptidyl-glycaminase, signal peptidase, N-terminal nucleophile amidohydrolase, 20S proteasome, gamma-glutamyl transpeptidase, mitochondrial endopeptidase, mitochondrial endopeptidase Ia, htra2 peptidase, protein cleavage enzyme (matriptase), site 1 protease, asparagine endopeptidase (legumai n), cathepsins, cysteine ​​cathepsins, calpains, ubiquitin isopeptidase T, caspases, glycosylphosphatidylinositol protein transamidase, cancer procoagulants, prohormone thiol proteases, gamma-glutamyl hydrolases, bleomycin hydrolases, fibroblast activation protein (seprase), cathepsin B, cathepsin D, cathepsin L, cathepsin M, proteinase K, pepsin, chymosyn, gastricsin, renin, yeast asparagine (yapsin) and / or mapin, prostate specific antigen (PSA) or generally any Asp-N, Glu-C, Lys-C or Arg-C protease. See, for example,Cancer Res. 77(24):7027-7037(2017), which is incorporated herein by reference in its entirety.

[0357] In some aspects, the cleavable linker component comprises a peptide comprising one to ten amino acid residues. In these aspects, the peptide allows protease cleavage of the linker, thereby facilitating release of the bioactive molecule when exposed to intracellular proteases (such as lysosomal enzymes) (Doronina et al. (2003) Nat. Biotechnol. 21: 778-784). Exemplary peptides include, but are not limited to, dipeptides, tripeptides, tetrapeptides, pentapeptides and hexapeptides.

[0358] The peptide may comprise naturally occurring and / or non-natural amino acid residues. The term "naturally occurring amino acid" refers to Ala, Asp, Cys, Glu, Phe, Gly, His, He, Lys, Leu, Met, Asn, Pro, Gin, Arg, Ser, Thr, Val, Trp and Tyr. "Non-natural amino acids" (i.e., amino acids that are not naturally occurring) include, as non-limiting examples, homoserine, homoarginine, citrulline, phenylglycine, taurine, iodotyrosine, selenocysteine, norleucine ("Nle"), norvaline ("Nva"), β-alanine, L- or D-naphthylalanine, ornithine ("Orn"), etc. The peptide may be designed and optimized to be enzymatically cleaved by a specific enzyme, such as a tumor-associated protease, cathepsin B, C and D or plasmin protease.

[0359] Amino acids also include the D- forms of natural and non-natural amino acids. "D-" means an amino acid with a "D" (dextrorotatory) configuration, which is opposite to the configuration in naturally occurring ("L-") amino acids. Natural or non-natural amino acids can be commercially purchased (Sigma Chemical Co., AdvancedChemtech) or synthesized using methods known in the art. Exemplary dipeptides include but are not limited to valine-alanine, valine-citrulline, phenylalanine-lysine, N-methyl-valine-citrulline, cyclohexylalanine-lysine and beta-alanine-lysine. Exemplary tripeptides include but are not limited to glycine-valine-citrulline (gly-val-cit) and glycine-glycine-glycine (gly-gly-gly).

[0360] II.B.2.f. Esterase-cleavable linkers

[0361] Some linkers are cleaved by esterases ("esterase cleavable linkers"). Only certain esters can be cleaved by esterases and amidases present inside or outside the cell. Esters are formed by condensation between carboxylic acids and alcohols. Simple esters are esters produced with simple alcohols, such as aliphatic alcohols and small cyclic alcohols and small aromatic alcohols. Examples of ester-based cleavable linking groups include, but are not limited to, esters of alkylene, alkenylene and alkynylene. Ester cleavable linking groups have the general formula -C(O)O- or -OC(O)-.

[0362] II.B.2.g. Phosphatase-cleavable linkers

[0363] In some aspects, the linker combination may include a phosphate-based cleavable linking group that is cleaved by an agent that degrades or hydrolyzes the phosphate group. An example of an agent that cleaves an intracellular phosphate group is an enzyme, such as an intracellular phosphatase. An example of a phosphate-based linking group is —O—P(O)(OR k )—O—、—O—P(S)(OR k )—O—、—O—P(S)(SR k )—O-、-SP(O)(OR k )-O-、-OP(O)(OR k )-S-、-SP(O)(OR k )-S-、-OP(S)(OR k )-S-、-SP(S)(OR k )-O-、-OP(O)(R k )-O-、-OP(S)(R k )-O-、-SP(O)(R k )-O-、-SP(S)(R k )-O-、-SP(O)(R k )-S-or-OP(S)(R k )-S-. In all aspects, R k Any of the following: NH 2 , BH 3 , CH 3 , C 1-6 Alkyl, C 6-10 Aryl, C 1-6 Alkoxy and C 6-10 In some aspects, C 1-6 Alkyl and C 6-10Aryl is unsubstituted. Other non-limiting examples are -OP(O)(OH)-O-, -OP(S)(OH)-O-, -OP(S)(SH)-O-, -SP(O)(OH)-O-, OP(O)(OH)-S-, -SP(O)(OH)-S-, -OP(S)(OH)-S-, -SP(S)(OH)-O-, -OP(O)(H)-O-, -OP(S)(H)-O-, -SP(O)(H)-O-, -SP(S)(H)-O-, -SP(O)(H)-S-, -OP(S)(H)-S- or -OP(O)(OH)-O-.

[0364] II.B.2.h. Photoactivatable cleavable linkers

[0365] In some aspects, the combined linker comprises a photoactivatable cleavable linker, such as a nitrobenzyl linker or a linker comprising a nitrobenzyl reactive group.

[0366] II.B.2.i. Self-degrading joints

[0367] In some aspects, the linker combination comprises a self-degradable linker. In some aspects, the self-degradable linker in the EV (e.g., exosome) of the present disclosure undergoes 1,4 elimination after enzymatic cleavage of a protease-cleavable linker. In some aspects, the self-degradable linker in the EV (e.g., exosome) of the present disclosure undergoes 1,6 elimination after enzymatic cleavage of a protease-cleavable linker. In some aspects, the self-degradable linker is, for example, a p-aminobenzyl (pAB) derivative, such as p-aminobenzyl carbamate (pABC), p-aminobenzyl ether (PABE), p-aminobenzyl carbonate, or a combination thereof. In certain aspects, the self-degradable linker comprises an aromatic group. In some aspects, the aromatic group is selected from the group consisting of: benzyl, cinnamyl, naphthyl, and biphenyl. In some aspects, the aromatic group is heterocyclic. In other aspects, the aromatic group comprises at least one substituent. In some aspects, at least one substituent is selected from the group consisting of: F, Cl, I, Br, OH, methyl, methoxy, NO 2 NH 2 、NO 3+ NHCOCH 3 、N(CH 3 ) 2 NHCOCF 3 , alkyl, halogenated alkyl, C 1 -C 8 In other aspects, at least one C in the aromatic group is substituted with N, O or CR*, wherein R* is independently selected from H, F, Cl, I, Br, OH, methyl, methoxy, NO2 NH 2 、NO 3+ NHCOCH 3 、N(CH 3 ) 2 NHCOCF 3 , alkyl, halogenated alkyl, C 1 -C 8 Alkyl halides, carboxylates, sulfates, sulfamates and sulfonates.

[0368] In some aspects, the self-immolative linker comprises an aminobenzyl carbamate group (e.g., p-aminobenzyl carbamate), an aminobenzyl ether group, or an aminobenzyl carbonate group. In one aspect, the self-immolative linker is p-aminobenzyl carbamate (pABC). pABC is the most effective and widespread linker linkage for self-immolative site-specific prodrug activation (see, e.g., Carl et al. J. Med. Chem. 24: 479-480 (1981); WO 1981 / 001145; Rautio et al., Nature Rev. Drug Disc. 7: 255-270 (2008); Simplicio et al., Molecules 13: 519-547 (2008)).

[0369] In some aspects, the self-immolative linker connects the bioactive molecule (e.g., ASO) to a protease cleavable substrate (e.g., Val-Cit). In specific aspects, the carbamate group of the pABC self-immolative linker is connected to the amino group of the bioactive molecule (e.g., ASO), and the amino group of the pABC self-immolative linker is connected to the protease cleavable substrate.

[0370] The aromatic ring of the aminobenzyl group may be optionally replaced by one or more aromatic rings (e.g., R 1 and / or R 2 ) substituent that replaces a hydrogen that is otherwise attached to one of the four unsubstituted carbons forming the ring. As used herein, the symbol "R x ”(For example, R 1 , R 2 , R 3 , R 4 ) is a general abbreviation for a substituent as described herein. The substituent may enhance the autolysis ability of the p-aminobenzyl group (Hay et al., J. Chem Soc., Perkin Trans. 1:2759-2770 (1999); see also Sykes et al., J. Chem. Soc., Perkin Trans. 1:1601-1608 (2000)).

[0371] Autolytic elimination can occur, for example, by 1,4 elimination, 1,6-elimination (e.g., pABC), 1,8 elimination (e.g., p-aminocinnamyl alcohol), β-elimination, cyclization elimination (e.g., 4-aminobutanol ester and ethylenediamine), cyclization / lactonization, cyclization / lactonization, etc. See, e.g., Singh et al. Curr. Med. Chem. 15: 1802-1826 (2008); Greenwald et al. J. Med. Chem. 43: 475-487 (2000).

[0372] In some aspects, the self-immolative spacer can include, for example, cinnamyl, naphthyl, or biphenyl (see, e.g., Blencowe et al. Polym. Chem. 2:773-790 (2011)). In some aspects, the self-immolative linker includes a heterocycle (see, e.g., U.S. Pat. Nos. 7,375,078; 7,754,681). Many homologous aromatics (see, e.g., Carl et al. J. Med. Chem. 24:479 (1981); Senter et al. J. Org. Chem. 55:2975 (1990); Taylor et al. J. Org. Chem. 43:1197 (1978); Andrianomenjanahary et al. Bioorg. Med. Chem. Lett. 2:1903 (1992)) and coumarin-based self-immolatives under aqueous and physiological conditions (see, e.g., Weinstein et al. Chem. Heteroaromatic groups of compounds such as thiophene, thiazole, oxazole, isoxazole, pyrrole, pyrazole (see, e.g., Hay et al. J. Med. Chem. 46:553 (2010)), pyridine (see, e.g., Perry-Feigenbaum et al. Org. Biomol. Chem. 7:4825 (2009)), imidazolide (see, e.g., Nailor et al. Bioorg. Med. Chem. Lett. Z:1267 (1999); Hay and Denny, Tetrahedron Lett. 38:8425 (1997)), and triazole (see, e.g., Bertrand and Gesson, J. Org. Chem. 72:3596 (2007)) are known in the art. See also U.S. Patent Nos. 7,691,962; 7,091,186; U.S. Patent Publication Nos. US2006 / 0269480; US2010 / 0092496; US2010 / 0145036; US2003 / 0130189; US2005 / 0256030).

[0373] In some aspects, the joint combinations disclosed herein include more than one self-degrading joints in series, such as two or more pABC units. See, for example, de Groot et al. J. Org. Chem. 66: 8815-8830 (2001). In some aspects, the joint combinations disclosed herein may include a self-degrading joint (e.g., a hemithioaminal derivative of p-aminobenzyl alcohol or p-carboxybenzaldehyde or glyoxylic acid) connected to a fluorescent probe (see, for example, Meyer et al. Org. Biomol. Chem. 8: 1777-1780 (2010)).

[0374] When substituents in a self-immolative linker are specified by their conventional chemical formula written from left to right, they also include chemically identical substituents that would result from writing the structure from right to left. For example, "-CH 2 O-" also means "-OCH 2 -".

[0375] Self-immolative, for example, R in the p-aminobenzyl self-immolative linker as described above 1 and / or R 2 Substituents in the substituent group may include, for example, alkyl, alkylene, alkenyl, alkynyl, alkoxy, alkylamino, alkylthio, heteroalkyl, cycloalkyl, heterocycloalkyl, aryl, arylalkyl, aryloxy, heteroaryl, etc. When a compound of the present disclosure contains more than one substituent, each substituent is independently selected.

[0376] In some specific aspects, the self-immolative linker is attached to a cleavable peptide linker having the formula:

[0377] -A a -Y y -

[0378] wherein each -A- is independently an amino acid unit, a is independently an integer from 1 to 12; and -Y- is a self-immolative spacer, and y is 1 or 2. In some aspects, -A a - is a dipeptide, tripeptide, tetrapeptide, pentapeptide or hexapeptide. In some aspects, -A a - is selected from the group consisting of: valine-alanine, valine-citrulline, phenylalanine-lysine, N-methylvaline-citrulline, cyclohexylalanine-lysine and β-alanine-lysine. In some aspects, -A a - is valine-alanine or valine-citrulline.

[0379] In some aspects, the self-immolative linker -Y y - has the following formula:

[0380]

[0381] Each R 2 Independently C 1-8 Alkyl, -O-(C 1-8 In some aspects, m is 0, 1 or 2. In some aspects, m is 0.

[0382] In some aspects, the cleavable linker is valine-alanine-p-aminobenzyl carbamate or valine-citrulline-p-aminobenzyl carbamate.

[0383] II.B.3. Reactive moiety (RM)

[0384] The ASOs of the present disclosure are produced by chemical synthesis or by chemical reactions between their components. For example, in some aspects, an anchoring moiety comprising a reactive group (e.g., maleimide) can be reacted with a BAM comprising a maleimide reactive group to produce a modified BAM of the present disclosure, wherein the anchoring moiety can be inserted into the lipid bilayer of the membrane of the exosome, thereby connecting the BAM to the surface of the exosome.

[0385] Any component or group of components of the modified BAM of the present disclosure may contain at least RG and / or RM, which will allow the components to be linked by one reaction or a series of reactions to produce the modified BAM of the present disclosure. Exemplary synthetic schemes for producing modified BAMs include:

[0386] [AM]- / RG / + / RM / -[BAM]→[AM]-[BAM]

[0387] [AM]- / RM / + / RG / -[BAM]→[AM]-[BAM]

[0388] [AM]-[L]- / RM / + / RG / -[BAM]→[AM]-[L]-[BAM]

[0389] [AM]-[L]- / RG / + / RM / -[BAM]→[AM]-[L]-[BAM]

[0390] [AM]- / RM / + / RG / -[L]-[BAM]→[AM]-[L]-[BAM]

[0391] [AM]- / RG / + / RM / -[L]-[BAM]→[AM]-[L]-[BAM]

[0392] [AM]-[L]- / RM / + / RG / -[L]-[BAM]→[AM]-[L]-[L]-[BAM]

[0393] [AM]-[L]- / RG / + / RM / -[L]-[BAM]→[AM]-[L]-[L]-[BAM]

[0394] Wherein [AM] is an anchoring moiety, [BAM] is a biologically active molecule, [L] is a linker or a combination of linkers, / RM / is a reactive moiety, and / RG / is a reactive group. In any of the schematics provided, BAM can be attached, for example, via its 5' end or 3' end.

[0395] Exemplary synthetic schemes for generating intermediates in the synthesis of BAM include:

[0396] [AM]- / RM / + / RG / -[L]→[AM]-[L]

[0397] [AM]- / RG / + / RM / -[L]→[AM]-[L]

[0398] [L]- / RM / + / RG / -[L]→[L]-[L]

[0399] [L]- / RG / + / RM / -[L]→[L]-[L]

[0400] [L]- / RM / + / RG / -[BAM]→[L]-[BAM]

[0401] [L]- / RG / + / RM / -[BAM]→[L]-[BAM]

[0402] Wherein [AM] is an anchoring moiety, [BAM] is a biologically active molecule, [L] is a linker or a combination of linkers, / RM / is a reactive moiety, and / RG / is a reactive group. In any of the schematics provided, BAM can be attached, for example, via its 5' end or 3' end.

[0403] In some aspects, the reactive group " / RG / " can be, for example, an amino group, a thiol group, a hydroxyl group, a carboxylic acid group, or an azide group. Specific reactive moieties " / RM / " that can react with these reactive groups are described in more detail below.

[0404] [AM]-( / RM / )n+( / RG / -[L]-[BAM])n→[AM]-[L]-[BAM]

[0405] Any anchoring moiety, linker or combination of linkers, or BAM disclosed herein can be conjugated to a reactive moiety, such as an amino-reactive moiety (e.g., NHS-ester, p-nitrophenol, isothiocyanate, isocyanate, or aldehyde), a thiol-reactive moiety (e.g., acrylate, maleimide, or pyridyl disulfide), a hydroxyl-reactive moiety (e.g., isothiocyanate or isocyanate), a carboxylic acid-reactive moiety (e.g., epoxide), or an azide-reactive moiety (e.g., alkyne).

[0406] Exemplary reactive moieties that can be used to covalently bind two components disclosed herein (e.g., an anchor moiety and BAM, or an anchor moiety and a linker, or an anchor moiety and a linker, or two linkers, or a linker and BAM, or two anchor moieties) include, for example, N-succinimidyl-3-(2-pyridyldithio) propionate, N-4-maleimidobutyric acid, S-(2-pyridyldithio) cysteamine, iodoacetoxysuccinimide, N-(4-maleimidobutyryloxy) succinimide, N-[5-(3'-maleimidopropylamide)-1-carboxypentyl] iminodiacetic acid, N-(5-aminopentyl) iminodiacetic acid, and 1'-[(2-cyanoethyl)-(N,N-diisopropyl)]-phosphoramidite). Bifunctional linkers (linkers containing two functional groups) are also useful.

[0407] In some aspects, the anchoring moiety, linker or BAM may comprise a terminal oxyamino group, such as —ONH 2 , hydrazine, -NHNH 2 , sulfhydryl (ie, SH or thiol) or olefin (eg, CH═CH 2 ). In some aspects, the anchoring moiety, linker or BAM may, for example, comprise an electrophilic moiety at a terminal position, such as an aldehyde, an alkyl halide, a mesylate, a tosylate, a m-nitrobenzenesulfonic acid or p-bromobenzenesulfonate, or an activated carboxylate, such as an NHS ester, a phosphoramidite or a pentafluorophenyl ester. In some aspects, a covalent bond may be formed by coupling a nucleophilic group (e.g., a hydroxyl, a thiol or an amino group) of a ligand to an electrophilic group. The present invention is applicable to all manner of reactive groups and reactive moieties, including but not limited to those known in the art.

[0408] As used herein, the term "blocking group" refers to an unstable chemical moiety known in the art to protect reactive groups (including but not limited to hydroxyl, amino and thiol groups) from unwanted reactions during a synthetic procedure. Blocking groups are typically used selectively and / or orthogonally to protect sites during reactions at other reactive sites, and can then be removed to leave unprotected groups or can be used for further reactions. Blocking groups as known in the art are typically described in Greene and Wuts, Protective Groups in Organic Synthesis, 3rd edition, John Wiley & Sons, New York (1999).

[0409] In addition, various synthesis steps can be performed in alternating order or sequence to obtain the desired compound. Synthetic chemical transformations and protecting group methodology (protection and deprotection) that can be used for synthesizing the compounds described herein are known in the art, and include, for example, those described in the following documents: R. Larock, Comprehensive Organic Transformations, VCH Publishers (1989); T. W. Greene and PGM Wuts, Protective Groups in Organic Synthesis, 2nd Edition, John Wiley and Sons (1991); L. Fieser and M. Fieser, Fieser and Fieser's Reagents for Organic Synthesis, John Wiley and Sons (1994); and L. Paquette, editor, Encyclopedia of Reagents for Organic Synthesis, John Wiley and Sons (1995), and subsequent versions thereof.

[0410] Solid phase synthesis known in the art may be used additionally or alternatively. Suitable solid phase techniques (including automated synthesis techniques) are described in F. Eckstein (ed.), Oligonucleotides and Analogues, a Practical Approach, Oxford University Press, New York (1991) and Toy, PH; Lam, Y (ed.), Solid-Phase Organic synthesis, concepts, Strategies, and Applications, John Wiley & Sons, Inc. New Jersey (2012).

[0411] In some aspects, a reactive group can alternatively react with more than one of the reactive moieties described below.

[0412] II.B.3.a. Amine-Reactive Moieties

[0413] In some aspects, the reactive moiety is an amine reactive moiety. As used herein, the term "amine reactive moiety" refers to a chemical group that can react with a reactive group having an amino moiety (e.g., a primary amine). Exemplary amine reactive moieties are N-hydroxysuccinimide esters (NHS-esters), p-nitrophenol, isothiocyanates, isocyanates, and aldehydes. Alternative reactive moieties that react with primary amines are also well known in the art. In some aspects, the amine reactive moiety can be connected to the terminal position of an anchoring moiety, a joint combination, or a BAM disclosed herein.

[0414] In some aspects, the amine reactive moiety is an NHS-ester. Typically, the NHS-ester reactive moiety reacts with the primary amine of the reactive group to produce a stable amide bond and N-hydroxysuccinimide (NHS).

[0415] In some aspects, the amine reactive moiety is a p-nitrophenol group. Typically, the p-nitrophenol reactive moiety is an activated carbamate that reacts with a primary amine of the reactive group to produce a stable carbamate moiety and p-nitrophenol.

[0416] In some aspects, the amine reactive moiety is an isothiocyanate. Typically, the isothiocyanate reacts with the primary amine of the reactive group to produce a stable thiourea moiety.

[0417] In some aspects, the amine reactive moiety is an isocyanate. Typically, the isocyanate reacts with the primary amine of the reactive group to produce a stable urea moiety.

[0418] In some aspects, the amine-reactive moiety is an aldehyde. Typically, aldehydes react with primary amines to form Schiff bases, which can be further reduced by reductive amination to form covalent bonds.

[0419] II.B.3.b. Thiol-Reactive Moieties

[0420] In some aspects, the reactive moiety is a thiol reactive moiety. As used herein, the term "thiol reactive moiety" refers to a chemical group that can react with a reactive group having a thiol moiety (or sulfhydryl). Exemplary thiol reactive moieties are acrylates, maleimides, and pyridyl disulfides. Alternative reactive moieties that react with thiols are also well known in the art. In some aspects, the thiol reactive moiety can be connected to the terminal position of an anchoring moiety, a linker combination, or a BAM disclosed herein.

[0421] In some aspects, the thiol reactive moiety is an acrylate. Typically, acrylate reacts with thiol at the β carbon of thiol with the carbonyl of acrylate to form a stable sulfide bond. In some aspects, the thiol reactive moiety is maleimide. Typically, maleimide reacts with thiol at the β carbon of thiol with the carbonyl to form a stable sulfide bond. In some aspects, the thiol reactive moiety is a pyridyl disulfide. Typically, pyridyl disulfide reacts with thiol at the β sulfur atom of thiol with pyridyl to form a stable disulfide bond and pyridine-2-thione.

[0422] II.B.3.c. Hydroxyl Reactive Moieties

[0423] In some aspects, the reactive moiety is a hydroxyl reactive moiety. As used herein, the term "hydroxyl reactive moiety" refers to a chemical group that can react with a reactive group having a hydroxyl moiety. Exemplary hydroxyl reactive moieties are isothiocyanates and isocyanates. Alternative reactive moieties that react with hydroxyl moieties are also well known in the art. In some aspects, the hydroxyl reactive moiety can be connected to the terminal position of an anchoring moiety, a joint combination, or a BAM of the present disclosure.

[0424] In some aspects, the hydroxyl reactive moiety is an isothiocyanate. Typically, an isothiocyanate reacts with the hydroxyl of the reactive group to produce a stable thiocarbamate moiety. In some aspects, the amine reactive moiety is an isocyanate. Typically, an isocyanate reacts with the hydroxyl of the reactive group to produce a stable carbamate moiety.

[0425] II.B.3.d. Carboxylic acid reactive moieties

[0426] In some respects, the reactive moiety is a carboxylic acid reactive moiety. As used herein, the term "carboxylic acid reactive moiety" refers to a chemical group that can react with a reactive group with a carboxylic acid moiety. An exemplary carboxylic acid reactive moiety is an epoxide. Alternative reactive moieties that react with carboxylic acid moieties are also well known in the art. In some respects, the carboxylic acid reactive moiety can be connected to the terminal position of an anchoring moiety, a joint combination or a BAM disclosed herein.

[0427] In some aspects, the carboxylic acid reactive moiety is an epoxide. Typically, the epoxide reacts with the carboxylic acid of the reactive group at any carbon atom of the epoxide to form a 2-hydroxyethyl acetate moiety.

[0428] II.B.3.e. Azide-Reactive Moieties

[0429] In some aspects, the reactive moiety is an azide reactive moiety. As used herein, the term "azide reactive moiety" refers to a chemical group that can react with a reactive group having an azide moiety. An exemplary azide reactive moiety is an alkyne. Alternative reactive moieties that react with the azide moiety are also well known in the art. In some aspects, the carboxylic acid reactive moiety can be connected to the terminal position of the anchor moiety, linker combination or BAM of the present disclosure.

[0430] In some aspects, the azide reactive moiety is an alkyne. Typically, the alkyne reacts with the azide of the reactive group to form a 1,2,3-triazole moiety via a 1,3-dipolar cycloaddition reaction (also known as "click chemistry").

[0431] II.B.4. Specific Examples and Topologies

[0432] In a specific aspect of the present disclosure, the linker combination consists of a linker of the formula:

[0433] [Alkyl linker]m-[PEG1]n-[PEG2]o

[0434] wherein m, n and o are 0 or 1, and at least one of m, n or o is not zero. Exemplary linker combinations according to such formula are C6-TEG-HEG, C6-HEG, C6-TEG, C6, TEG-HEG, TEG, C8-TEG-HEG, C8-HEG, C8-TEG, and C8.

[0435] In some aspects, the linker combination comprises a non-cleavable linker (eg, TEG or HEG) combined with one or more cleavable linkers (eg, an enzyme-cleavable linker and a self-immolative linker).

[0436] In a specific aspect, the linker combination includes the linker combination TEG (non-cleavable linker)-Val-Cit (cleavable linker)-pAB (self-degradable linker), as shown below:

[0437] [Cholesterol]-[TEG]-[Val-Cit]-[pAB]

[0438]

[0439] Specific combinations of anchoring moieties and linker combinations are described in the table below.

[0440] Table 1.

[0441]

[0442]

[0443] Table 2.

[0444]

[0445] In some aspects, the linker combination has a general structure [AM]-[Linker 1]-[Linker 2]-[BAM], wherein the anchoring moiety [AM] is selected from cholesterol, palmitate and tocopherol, the first linker [Linker 1] is a hydrophobic linker, and the second linker [Linker 2] is a hydrophilic linker.

[0446] In other aspects, the linker combination has the general structure [AM]-[Linker 1]-[Linker 2]-[BAM], wherein the anchoring moiety [AM] is selected from cholesterol, palmitate and tocopherol, the first linker [Linker 1] is a hydrophilic linker, and the second linker [Linker 2] is a hydrophilic linker.

[0447] In other aspects, in some aspects, the linker combination has a general structure [AM]-[Linker 1]-[Linker 2]-[ASO], wherein the anchoring portion [AM] is selected from cholesterol, palmitate and tocopherol, the first linker [Linker 1] is selected from a C6 linker, a C8 linker, a TEG linker and a HEG linker, and the second linker [Linker 2] is a hydrophilic linker selected from TEG and HEG.

[0448] In some aspects, the linker combination has a general structure [AM]-[Linker 1]-[Linker 2]-[Linker 3]-[ASO], wherein the anchoring portion [AM] is a lipid (e.g., a phospholipid), the first linker [Linker 1] is selected from the group consisting of: HEG, TEG, TEG-HEG and C6, or the first linker is not present, the second linker [Linker 2] is selected from the group consisting of: disulfide, imine, thioketal, tri / dinucleotide and Val-Cit, and the third linker [Linker 3] is selected from the group consisting of: HEG, TEG, TEG-HEG and C6, or the third linker is not present.

[0449] The following examples illustrate specific connector combinations disclosed in the present invention.

[0450] [Cholesterol]-[TEG]-[HEG]-[BAM]

[0451]

[0452] [Cholesterol]-[SMal]-[Val-Cit]-[pAB]-[BAM]

[0453]

[0454] [Cholesterol]-[TEG]-[Val-Cit]-[C6]-[BAM]

[0455]

[0456] [Cholesterol]-[TEG]-[SS]-[C6]-[BAM]

[0457]

[0458] Wherein [cholesterol] is a cholesterol anchoring moiety, [TEG] is a TEG non-cleavable linker, [HEG] is a HEG non-cleavable linker, [SS] is a disulfide redox cleavable linker, [C6] is an alkyl non-cleavable linker, [SMal] is S-maleimide, [Val-Cit] is a valine-citrulline cleavable linker, and [pAB] is a pAB self-cleavable linker. In some aspects, the ASOs of the present disclosure have structures according to the exemplary structures provided above, wherein one or more components have been replaced by components of the same class as those depicted in the examples. For example, the [cholesterol] anchoring moiety can be replaced by another anchoring moiety disclosed herein, [TEG] can be replaced by another polymeric non-cleavable linker disclosed herein (e.g., HEG, PEG, PG), [Val-Cit] can be replaced by another peptidase cleavable linker, or [pAB] can be replaced by another self-cleavable linker.

[0459] The following examples illustrate other specific connector combinations of the present disclosure.

[0460] [Saturated phospholipids; ethanolamine; DLPE]-[TEG]-[BAM]

[0461]

[0462] [Unsaturated phospholipids; ethanolamine; DOPE]-[BAM]

[0463]

[0464] [Saturated fatty acid; lauric acid]-[TEG]-[C6]-[BAM]

[0465]

[0466] [Unsaturated fatty acid; linoleate]-[TEG]-[C6]-[BAM]

[0467]

[0468] [Stearate]-[TEG]-[HEG]-[BAM]

[0469]

[0470] II.C. Bioactive molecules

[0471] In some aspects, the EVs (e.g., exosomes) disclosed herein are capable of delivering a payload (connected to the EV via an anchoring moiety, such as a bioactive molecule of the exosome) to a target. The payload is an agent that acts on a target (e.g., a target cell) in contact with the EV (e.g., exosome). The contact may occur in vitro or in the subject. Non-limiting examples of payloads that may be connected to the EV (e.g., exosome) via a maleimide moiety include agents such as nucleotides (e.g., nucleotides containing a detectable moiety or a toxin or disrupting transcription), nucleic acids (e.g., DNA or mRNA molecules encoding polypeptides such as enzymes, or RNA molecules with regulatory functions such as miRNA, dsDNA, lncRNA, or siRNA), amino acids (e.g., amino acids containing a detectable moiety or a toxin that disrupts translation), polypeptides (e.g., enzymes), lipids, carbohydrates, and small molecules (e.g., small molecule drugs and toxins). In some aspects, the payload is in the cavity of the EV (e.g., exosome). In some aspects, an EV (e.g., exosome) may contain more than one payload, for example, a first payload in solution in the lumen of the EV (e.g., exosome) and a second payload attached to the outer surface of the EV (e.g., exosome), for example via an anchoring moiety.

[0472] In some aspects, the bioactive molecule (payload, BAM) does not naturally occur in EVs (e.g., exosomes). In some aspects, the payload (BAM) is non-naturally occurring. In some aspects, the EV comprising the BAM is non-naturally occurring.

[0473] In some aspects, the payload targets a tumor antigen. Non-limiting examples of tumor antigens include: alpha-fetoprotein (AFP), carcinoembryonic antigen (CEA), epithelial tumor antigen (ETA), mucin 1 (MUC1), Tn-MUC1, mucin 16 (MUC16), tyrosinase, melanoma-associated antigen (MAGE), tumor protein p53 (p53), CD4, CD8, CD45, CD80, CD86, programmed death ligand 1 (PD-L1), programmed death ligand 2 (PD-L2), NY-ESO-1, PSMA, TAG-72, HER2, GD2, cMET, EGFR, mesothelin, VEGFR, alpha-folate receptor, CE7R, IL-3, cancer-testis antigen (CTA), MART-1gp100, TNF-related apoptosis-inducing ligand, or a combination thereof.

[0474] In some aspects, the payload is a small molecule. In some aspects, the small molecule is a proteolysis targeting chimera (PROTAC).

[0475] In some aspects, the payload comprises a nucleotide, wherein the nucleotide is a stimulator of interferon genes (STING) agonist. STING is a cytoplasmic sensor of cyclic dinucleotides typically produced by bacteria. Upon activation, it leads to the production of type I interferons and triggers an immune response.

[0476] In some aspects, the EVs (e.g., exosomes) of the present disclosure comprise one or more STING agonists covalently linked to the EVs (e.g., exosomes) via an anchoring moiety. In some aspects, the STING agonist comprises a cyclic dinucleotide STING agonist or a non-cyclic dinucleotide STING agonist.

[0477] It is known that cyclic purine dinucleotides, such as but not limited to cGMP, cyclic di-GMP (c-di-GMP), cAMP, cyclic di-AMP (c-di-AMP), cyclic-di-GMP-AMP (cGAMP), cyclic di-IMP (c-di-IMP), cyclic AMP-IMP (cAIMP) and any analogs thereof, can stimulate or enhance the immune or inflammatory response of a patient. The CDN can have 2'2', 2'3', 2'5', 3'3' or 3'5' bonds connecting the cyclic dinucleotides, or any combination thereof.

[0478] Cyclic purine dinucleotides can be modified by standard organic chemistry techniques to produce analogs of purine dinucleotides. Suitable purine dinucleotides include, but are not limited to, adenine, guanine, inosine, hypoxanthine, xanthine, isoguanine, or any other suitable purine dinucleotides known in the art. Cyclic dinucleotides can be modified analogs. Any suitable modification known in the art can be used, including but not limited to phosphorothioate, biphosphorothioate, fluorination, and difluorination modifications.

[0479] Acyclic dinucleotide agonists may also be used, such as 5,6-dimethylxanthone-4-acetic acid (DMXAA), or any other acyclic dinucleotide agonist known in the art.

[0480] It is contemplated that any STING agonist can be used. Among the STING agonists are DMXAA, STING agonist-1, ML RR-S2CDA, ML RR-S2c-di-GMP, ML-RR-S2 cGAMP, 2'3'-c-di-AM(PS)2, 2'3'-cGAMP, 2'3'-cGAMPdFHS, 3'3'-cGAMP, 3'3'-cGAMPdFSH, cAIMP, cAIM(PS)2, 3'3'-cAIMP, 3'3'-cAIMPdFSH, 2'2'-cGAMP, 2'3'-cGAM(PS)2, 3'3'-cGAMP, c-di-AMP, 2'3'-c-di-AMP, 2'3'-c-di-AM(PS)2, c-di-GMP, 2'3'-c-di-GMP, c-di-IMP, c-di-UMP, or any combination thereof. In specific aspects, the STING agonist is 3'3'-cAIMPdFSH, alternatively designated 3-3cAIMPdFSH. Additional STING agonists known in the art may also be used.

[0481] In some aspects, the bioactive molecule is an antibody or its antigen binding fragment. In some aspects, the bioactive molecule is an ADC. In some aspects, the bioactive molecule is a synthetic anti-tumor agent (e.g., monomethyl auristatin E (MMAE) (vedotin (vedotin))), a cytokine release inhibitor (e.g., MCC950), an mTOR inhibitor (e.g., rapamycin and its analogs (rapamycin analogs (Rapalog))), an autotaxin inhibitor (e.g., PAT409 or PAT505), a lysophosphatidic acid receptor antagonist (e.g., BMS-986020), a STING antagonist (e.g., CL656) or any combination thereof. In some aspects, the bioactive molecule is a fusion peptide.

[0482] In some aspects, bioactive molecules include antisense oligonucleotides (ASO). In some aspects, ASO targets various genes (transcripts) expressed in vivo. In some aspects, bioactive molecules of the present disclosure are included in the morpholino backbone structure disclosed in U.S. Patent No. 5,034,506, and the patent is incorporated herein by reference as a whole. In some aspects, bioactive molecules of the present disclosure include diaminophosphorothioate morpholino oligomers (PMO), wherein the deoxyribose moiety is replaced by a morpholine ring, and the charged phosphodiester intersubunit linkage is replaced by uncharged diaminophosphorothioate linkage, such as Summerton, et al., Antisense Nucleic Acid Drug Dev.1997, 7: described in 63-70. Therefore, in some aspects, bioactive molecules are antisense oligonucleotides, diaminophosphorothioate morpholino oligomers (PMO) or peptide-conjugated diaminophosphorothioate morpholino oligomers (PPMO).

[0483] In some aspects, bioactive molecules target macrophages. In other aspects, bioactive molecules induce macrophage polarization. Macrophage polarization is a method by which macrophages adopt different functional programs in response to signals from the macrophage microenvironment. This ability is related to the multiple roles of macrophages in organisms: macrophages are powerful effector cells of the innate immune system and are also crucial in cell debris removal, embryonic development, and tissue repair.

[0484] By simplifying the classification, macrophage phenotypes are divided into 2 groups: M1 (classically activated macrophages) and M2 (alternatively activated macrophages). This rough classification is based on in vitro studies in which cultured macrophages are treated with molecules that stimulate their phenotype to be converted into a specific state. In addition to chemical stimulation, it has been shown that the rigidity of the underlying substrate on which macrophages grow can guide polarization states, functional roles, and migration patterns. M1 macrophages are described as proinflammatory types and play an important role in direct host defense against pathogens (such as phagocytosis and secretion of proinflammatory cytokines and microbicidal molecules). M2 macrophages are described as having completely opposite functions: regulating the resolution phase of inflammation and repairing damaged tissues. Later, more extensive in vitro and ex vivo studies showed that macrophage phenotypes are more diverse, overlapping in gene expression and function, thereby revealing that these multiple mixed states form a series of activation states that depend on the microenvironment. In addition, in vivo, there is a high diversity in the gene expression profiles between macrophage populations in different tissues. Therefore, the macrophage activation spectrum is considered to be wider, involving complex regulatory pathways to respond to a large number of different signals from the environment. The diversity of macrophage phenotypes remains to be fully characterized in vivo.

[0485] Imbalance of macrophage types is associated with many immune-related diseases. For example, an increased M1 / M2 ratio in mice may be associated with the development of inflammatory bowel disease as well as obesity. On the other hand, in vitro experiments have shown that M2 macrophages are the main mediators of tissue fibrosis. Several studies have linked the fibrotic profile of M2 macrophages to the pathogenesis of systemic sclerosis. Non-limiting examples of bioactive molecules targeting macrophages are: PI3Kγ (phosphatidylinositol-4,5-bisphosphate 3-kinase catalytic subunit γ), RIP1 (receptor interacting protein (RIP) kinase 1, RIPK1), HIF-1α (hypoxia-inducible factor 1-α), AHR1 (adhesion and hyphal regulatory factor 1), miR146a, miR155, IRF4 (interferon regulatory factor 4), PPARγ (peroxisome proliferator-activated receptor γ), IL-4RA (interleukin-4 receptor subunit α), TLR8 (Toll-like receptor 8), and TGF-β1 (transforming growth factor β-1 proprotein).

[0486] In some aspects, the biologically active molecule targets PI3Kγ protein or transcript (PI3Kγ antagonist). In some aspects, the PI3Kγ antagonist is an antisense oligonucleotide. In other aspects, the PI3Kγ antagonist is a small molecule. In some aspects, the ASO targets a transcript encoding PI3Kγ, such as mRNA. The sequence of the PI3Kγ gene can be found at chromosome position 7q22.3 and publicly available GenBank accession number NC_000007.14 (106865282..106908980), which is incorporated by reference in its entirety. The sequence of human PI3Kγ protein can be found under publicly available UniProt accession number P48736, which is incorporated by reference in its entirety herein.

[0487] In some aspects, the bioactive molecule targets the RIP1 protein or transcript (RIP1 antagonist). In some aspects, the RIP1 antagonist is an antisense oligonucleotide. In other aspects, the RIP1 antagonist is a small molecule. In some aspects, the ASO targets a transcript encoding RIP1, such as an mRNA. The sequence of the RIP1 gene can be found at chromosome location 6p25.2 and publicly available GenBank accession number NC_000006.12 (3063967..3115187), which is incorporated by reference in its entirety. The sequence of the human RIP1 protein can be found under publicly available UniProt accession number Q13546, which is incorporated by reference in its entirety.

[0488] In some aspects, the bioactive molecule targets HIF-1α protein or transcript (HIF-1α antagonist). In some aspects, the HIF-1α antagonist is an antisense oligonucleotide. In other aspects, the HIF-1α antagonist is a small molecule. In some aspects, the ASO targets the transcript encoding HIF-1α, such as mRNA. The sequence of the HIF-1α gene can be found under chromosome position 14q23.2 and publicly available GenBank accession number NC_000014.9 (61695513..61748259), which is incorporated by reference in its entirety. The sequence of human HIF-1α protein can be found under publicly available UniProt accession number Q16665, which is incorporated by reference in its entirety herein. In some aspects, the ASO targets the mRNA encoding HIF-2α. The sequence of the HIF-2α gene can be found at chromosome location 2p21 and publicly available GenBank accession number NC_000002.12 (46297407..46386697), which is incorporated by reference in its entirety. The sequence of the human HIF-2α protein can be found under publicly available UniProt accession number Q99814, which is incorporated by reference in its entirety herein.

[0489] In some aspects, the biologically active molecule targets AHR1 protein or transcript (AHR1 antagonist). In other aspects, the AHR1 antagonist is a small molecule.

[0490] In some aspects, the bioactive molecule targets miR146a (miR146a antagomir). In some aspects, the miR146a antagomir is an antisense oligonucleotide. In some aspects, the ASO binds to miR146a-5p (ugagaacugaauuccauggguu) (SEQ ID NO: 54).

[0491] In some aspects, the ASO binds to miR146a-3p (ccucugaaauucaguucuucag) (SEQ ID NO: 55).

[0492] In some aspects, the bioactive molecule mimics miR155 (miR155 mimics). In some aspects, the miR155 mimics are RNA or DNA. In some aspects, the miR155 mimics include the nucleotide sequence (uuaaugcuaaucgugauaggggu) (SEQ ID NO: 56) of miR155-5p. In some aspects, the miR155 mimics include the nucleotide sequence (cuccuacauauuagcauuaaca) (SEQ ID NO: 57) of miR155-3p.

[0493] In some aspects, the bioactive molecule targets IRF-4 protein or transcript (IRF4 antagonist). In some aspects, the IRF4 antagonist is an antisense oligonucleotide. In some aspects, the ASO targets the transcript encoding IRF-4, such as mRNA. The sequence of the IRF-4 gene can be found under chromosome position 6p25.3 and publicly available GenBank accession number NC_000006.12 (391739..411443), which is incorporated by reference in its entirety. The sequence of human IRF-4 protein can be found under publicly available UniProt accession number Q15306, which is incorporated by reference in its entirety herein.

[0494] In some aspects, the biologically active molecule targets PPARγ protein or transcript (PPARγ antagonist). In some aspects, the PPARγ antagonist is an antisense oligonucleotide. In other aspects, the PPARγ antagonist is a small molecule. In some aspects, the ASO targets a transcript encoding PPARγ, such as mRNA. The sequence of the PPARγ gene can be found at chromosome position 3p25.2 and publicly available GenBank accession number NC_000003.12 (12287485..12434356), which is incorporated by reference in its entirety. The sequence of the human PPARγ protein can be found under the publicly available UniProt accession number P37231, which is incorporated by reference in its entirety.

[0495] In some aspects, the biologically active molecule targets an IL-4RA protein or transcript (IL-4RA antagonist). In some aspects, the IL-4RA antagonist is an antisense oligonucleotide. In some aspects, the ASO targets a transcript encoding IL-4RA, such as an mRNA. The sequence of the IL-4RA gene can be found at chromosome location 16p12.1 and publicly available GenBank accession number NC_000016.10 (27313668..27364778), which is incorporated by reference in its entirety. The sequence of the human IL-4RA protein can be found at publicly available UniProt accession number P24394, which is incorporated by reference in its entirety.

[0496] In some aspects, the bioactive molecule is an agonist of Toll-like receptor 8 (TLR8). TLR8 is also referred to as CD288. TLR8 is a key component of innate and adaptive immunity. TLR (Toll-like receptor) controls the host immune response to pathogens by recognizing molecular patterns unique to microorganisms. It works through MYD88 and TRAF6, resulting in NF-κ-B activation, cytokine secretion and inflammatory response. The sequence of human TLR8 protein can be found under publicly available UniProt accession number Q9NR97, which is incorporated herein by reference in its entirety.

[0497] In some aspects, the bioactive molecule targets TGF-β1 protein or transcript (TGF-β1 antagonist). In some aspects, the TGF-β1 antagonist is an antisense oligonucleotide. In some aspects, the ASO targets a transcript encoding TGF-β1, such as mRNA. The sequence of the TGF-β1 gene can be found at chromosome position 19q13.2 and publicly available GenBank accession number NC_000019.10 (41330323..41353922, complementary sequence), which is incorporated by reference in its entirety. The sequence of the human TGF-β1 protein can be found under the publicly available UniProt accession number P01137, which is incorporated by reference in its entirety herein.

[0498] In some aspects, the ASO is a gapmer, a mixmer, or a totalmer. The ASOs of the present disclosure may comprise one or more nucleosides having a modified sugar moiety (i.e., a modification of the sugar moiety when compared to the ribose moiety found in DNA and RNA). Many nucleosides having modifications of the ribose moiety have been prepared, primarily for the purpose of improving certain properties of the oligonucleotide, such as affinity and / or nuclease resistance.

[0499] Such modifications include those modifications in which the ribose ring structure is for example substituted with a hexose ring (HNA) or a bicyclic (LNA) having a diradical bridge between C2' and C4' carbon on the ribose ring or a non-connected ribose ring (e.g., UNA) lacking a key between C2' and C3' carbon. Other sugar-modified nucleosides include for example bicyclohexose nucleic acids (WO2011 / 017521) or tricyclic nucleic acids (WO2013 / 154798). Modified nucleosides also include nucleosides in which the sugar moiety is replaced by a non-sugar moiety, for example, in the case of peptide nucleic acids (PNA) or morpholino nucleic acids.

[0500] Sugar modification also includes modification by changing the substituent on the ribose ring to a group other than hydrogen or changing the naturally occurring 2'-OH group in the RNA nucleoside. Substituents can be introduced, for example, at the 2', 3', 4' or 5' position. Nucleosides with modified sugar moieties also include 2' modified nucleosides, such as 2' substituted nucleosides. In fact, much emphasis has been placed on developing 2' substituted nucleosides, and it has been found that many 2' substituted nucleosides have beneficial properties when incorporated into oligonucleotides, such as enhanced nucleoside resistance and enhanced affinity.

[0501] 2' sugar modified nucleosides are nucleosides having a substituent other than H or -OH at the 2' position (2' substituted nucleosides) or containing a 2' linked diradical, and include 2' substituted nucleosides and LNA (2'-4' diradical bridged) nucleosides. For example, the 2' modified sugar can provide enhanced binding affinity (e.g., affinity enhanced 2' sugar modified nucleosides) and / or increased nuclease resistance to oligonucleotides. Examples of 2' substituted modified nucleosides are 2'-O-alkyl-RNA, 2'-O-methyl-RNA, 2'-alkoxy-RNA, 2'-O-methoxyethyl-RNA (MOE), 2'-amino-DNA, 2'-fluoro-RNA, 2'-fluoro-DNA, arabinoic acid (ANA), and 2'-fluoro-ANA nucleosides. For other examples, see, eg, Freier and Altmann; Nucl. Acid Res., 1997, 25, 4429-4443; Uhlmann, Curr. Opinion in Drug Development, 2000, 3(2), 293-213; and Deleavey and Damha, Chemistry and Biology 2012, 19, 937. Below is a description of some 2' substituted modified nucleosides.

[0502]

[0503] LNA nucleosides are modified nucleosides that contain a linker group (called a diradical or bridge) between C2' and C4' of the ribose ring of the nucleoside (i.e., a 2'-4' bridge) that restricts or locks the conformation of the ribose ring. These nucleosides are also referred to in the literature as bridged nucleic acids or bicyclic nucleic acids (BNA). When LNA is incorporated into an oligonucleotide complementary to an RNA or DNA molecule, the locking of the ribose conformation is associated with enhanced hybridization affinity (duplex stabilization). This can be routinely determined by measuring the melting temperature of the oligonucleotide / complement duplex.

[0504] Non-limiting exemplary LNA nucleosides are disclosed in WO 99 / 014226, WO 00 / 66604, WO 98 / 039352, WO 2004 / 046160, WO 00 / 047599, WO 2007 / 134181, WO 2010 / 077578, WO 2010 / 036698, WO 2007 / 090071, WO 2009 / 006478, WO 2011 / 156202, WO 2008 / 154401, WO 2009 / 067647, WO2008 / 150729; Morita et al., Bioorganic & Med. Chem. Lett. 12, 73-76; Seth et al., J. Org. Chem. 2010, Vol. 75(5), pp. 1569-81; and Mitsuoka et al., Nucleic Acids Research 2009, 37(4), 1225-1238. In some aspects, the modified nucleosides or LNA nucleosides of the ASOs disclosed herein have the general structure of Formula I or II:

[0505]

[0506] in

[0507] W is selected from -O-, -S-, -N(R a )-、-C(R a R b )-, especially –O-;

[0508] B is a nucleobase or a modified nucleobase moiety;

[0509] Z is an internucleoside linkage to an adjacent nucleoside or a 5'-terminal group;

[0510] Z* is an internucleoside linkage to an adjacent nucleoside or a 3′-terminal group;

[0511] R 1 , R 2 , R 3 , R 5 and R 5* are independently selected from hydrogen, halogen, alkyl, alkenyl, alkynyl, hydroxy, alkoxy, alkoxyalkyl, alkenyloxy, carboxyl, alkoxycarbonyl, alkylcarbonyl, formyl, azide, heterocycle, and aryl; and

[0512] X, Y, R a and R b Defined in this article.

[0513] II.C.1. ASOs targeting NLRP3

[0514] NLRP3 (NLRP3) is also known as NLR family pyrin domain-containing 3. Unless otherwise specified, the term "NLRP3" as used herein may refer to NLRP3 from one or more species (e.g., humans, non-human primates, dogs, cats, guinea pigs, rabbits, rats, mice, horses, cattle, and bears). Synonyms for NLRP3 / NLRP3 are known and include NLRP3; C1orf7; CIAS1; NALP3; PYPAF1; nucleotide binding oligomerization domain, leucine-rich repeats, and pyrin domain-containing 3; cold-induced autoinflammatory syndrome 1 protein; cryopyin; protein 3 containing NACHT, LRR, and PYD domains; angiotensin / vasopressin receptor AII / AVP-like; caterpillar protein 1.1; CLR1.1; cold-induced autoinflammatory syndrome 1 protein; and APAF1-like protein 1 containing PYRIN. The sequence of the human NLRP3 gene can be found under the publicly available GenBank accession number NC_000001.11:247416156-247449108. The human NLRP3 gene is located at chromosome position 1q44 at 247,416,156-247,449,108.

[0515] The sequence of the human NLRP3 pre-mRNA transcript (SEQ ID NO: 1) corresponds to the reverse complement of residues 247,416,156-247,449,108 of chromosome 1q44. The NLRP3 mRNA sequence (GenBank Accession No. NM_001079821.2) is provided in SEQ ID NO: 3, except that the nucleotide "t" in SEQ ID NO: 3 is shown as "u" in the mRNA. The sequence of the human NLRP3 protein can be found under the publicly available accession numbers: Q96P20 (canonical sequence, SEQ ID NO: 2), Q96P20-2 (SEQ ID NO: 4), Q96P20-3 (SEQ ID NO: 5), Q96P20-4 (SEQ ID NO: 6), Q96P20-5 (SEQ ID NO: 7), and Q96P20-6 (SEQ ID NO: 8), each of which is incorporated herein by reference in its entirety.

[0516] Natural variants of human NLRP3 gene products are known. For example, natural variants of human NLRP3 proteins may contain one or more amino acid substitutions selected from the group consisting of D21H, I174T, V200M, R262L, 4262P, R262W, L266H, D305G, D305N, L307P, Q308K, F311S, T350M, A354V, L355P, E356D, H360R, T407P, T438I, T438N, A441T, A441V, R490K, F525C, F525L, G571R, Y572C, F575S, E629G, L634F, M664T, Q705K, Y861C, and R920Q, and any combination thereof. Additional variants of human NLRP3 proteins produced by alternative splicing are also known in the art. NLRP3 isoform 1 (UniProt identifier: Q96P20-2) differs from the canonical sequence (SEQ ID NO: 3) as follows: deletion of residues 721-777 and 836-892 relative to SEQ ID NO: 3. The sequence of NLRP3 isoform 3 (identifier: Q96P20-3) differs from the canonical sequence (SEQ ID NO: 3) as follows: deletion of residues 720-1036 relative to SEQ ID NO: 3. The sequence of NLRP3 isoform 4 (identifier: Q96P20-4) differs from the canonical sequence (SEQ ID NO: 3) as follows: deletion of residues 721-777 relative to SEQ ID NO: 3. The sequence of NLRP3 isoform 5 (identifier: Q96P20-5) differs from the canonical sequence (SEQ ID NO: 3) as follows: Deletion of residues 836-892 relative to SEQ ID NO: 3. The sequence of NLRP3 isoform 6 (identifier: Q96P20-6) differs from the canonical sequence (SEQ ID NO: 3) as follows: Deletion of residues 776-796 relative to SEQ ID NO: 3. Thus, the ASOs of the present disclosure can be designed to reduce or inhibit the expression of natural variants of NLRP3 proteins.

[0517] An example of a target nucleic acid sequence for an ASO is NLRP3 pre-mRNA. SEQ ID NO: 1 represents the human NLRP3 genomic sequence (i.e., the reverse complementary sequence of nucleotides 247,416,156-247,449,108 of chromosome 1q44). SEQ ID NO: 1 is identical to the NLRP3 pre-mRNA sequence, except that the nucleotide "t" in SEQ ID NO: 1 is shown as "u" in the pre-mRNA. In certain aspects, the "target nucleic acid" comprises an intron of a nucleic acid encoding a NLRP3 protein or a naturally occurring variant thereof and an RNA nucleic acid (e.g., a pre-mRNA) derived therefrom. In other aspects, the target nucleic acid comprises an exon region of a nucleic acid encoding a NLRP3 protein or a naturally occurring variant thereof and an RNA nucleic acid (e.g., a pre-mRNA) derived therefrom. In other aspects, the target nucleic acid comprises an exon-intron junction of a nucleic acid encoding a NLRP3 protein or a naturally occurring variant thereof and an RNA nucleic acid (e.g., a pre-mRNA) derived therefrom. In some aspects, for example, when used for research or diagnosis, a "target nucleic acid" can be a cDNA or synthetic oligonucleotide derived from the above-mentioned DNA or RNA nucleic acid targets. The human NLRP3 protein sequence encoded by the NLRP3 pre-mRNA is shown as SEQ ID NO: 3. In other aspects, the target nucleic acid comprises an untranslated region of a nucleic acid encoding a NLRP3 protein or a naturally occurring variant thereof, such as a 5'UTR, a 3'UTR, or both.

[0518] In some aspects, the ASOs of the present disclosure hybridize to regions within introns of NLRP3 transcripts (e.g., SEQ ID NO: 1). In certain aspects, the ASOs of the present disclosure hybridize to regions within exons of NLRP3 transcripts (e.g., SEQ ID NO: 1). In other aspects, the ASOs of the present disclosure hybridize to regions within exon-intron junctions of NLRP3 transcripts (e.g., SEQ ID NO: 1). In some aspects, the ASOs of the present disclosure hybridize to regions within NLRP3 transcripts (e.g., introns, exons, or exon-intron junctions), such as SEQ ID NO: 1, wherein the ASOs have a design according to the following formula: 5'ABC 3' as described elsewhere herein.

[0519] In some aspects, the ASO targets mRNA encoding a specific isoform of the NLRP3 protein (e.g., isoform 1). In some aspects, the ASO targets all isoforms of the NLRP3 protein. In other aspects, the ASO targets two isoforms of the NLRP3 protein (e.g., isoform 1 and isoform 2, isoform 3 and isoform 4, and isoform 5 and isoform 6).

[0520] In some aspects, the nucleotide sequence or contiguous nucleotide sequence of the ASO of the present disclosure is the same as a sequence selected from SEQ ID NOs: 101 to 200 (ie, Figure 1A 80% sequence identity, such as at least about 80%, at least about 85%, at least about 90%, at least about 91%, at least about 92%, at least about 93%, at least about 94%, at least about 95%, at least about 96% sequence identity, at least about 97% sequence identity, at least about 98% sequence identity, at least about 99% sequence identity, such as about 100% sequence identity (homologous). In some aspects, the ASO has a design described elsewhere herein or a chemical structure shown elsewhere herein (e.g., Figure 1A ).

[0521] In some aspects, the ASO (or a contiguous nucleotide portion thereof) is selected from or comprises one of the sequences selected from the group consisting of: SEQ ID NO: 101 to 200 or a region of at least 10 contiguous nucleotides thereof, wherein the ASO (or a contiguous nucleotide portion thereof) may optionally comprise 1, 2, 3 or 4 mismatches when compared to the corresponding NLRP3 transcript.

[0522] In some aspects, the ASO comprises a sequence selected from the group consisting of: SEQ ID NO:101, SEQ ID NO:102, SEQ ID NO:103, SEQ ID NO:104, SEQ ID NO:105, SEQ ID NO:106, SEQ ID NO:107, SEQ ID NO:108, SEQ ID NO:109, SEQ ID NO:110, SEQ ID NO:111, SEQ ID NO:112, SEQ ID NO:113, SEQ ID NO:114, SEQ ID NO:115, SEQ ID NO:116, SEQ ID NO:117, SEQ ID NO:118, SEQ ID NO:119, SEQ ID NO:120, SEQ ID NO:121, SEQ ID NO:122, SEQ ID NO:123, SEQ ID NO:124, SEQ ID NO:125, SEQ ID NO:126, SEQ ID NO:127, SEQ ID NO:128, SEQ ID NO:129, SEQ ID NO:130, SEQ ID NO:131, SEQ ID NO:132, SEQ ID NO:133, SEQ ID NO:134, SEQ ID NO:135, SEQ ID NO:136, SEQ ID NO:137, SEQ ID NO:138, SEQ ID NO:139, SEQ ID NO:140, SEQ ID NO:141, SEQ ID NO:142, SEQ ID NO:143, SEQ ID NO:144, SEQ ID NO:145, SEQ ID NO:146, SEQ ID NO:147, SEQ ID NO:148, SEQ ID NO:149, SEQ ID NO:150, SEQ ID NO:151, SEQ ID NO:152, SEQ ID NO:153, SEQ ID NO:154, SEQ ID NO:155, SEQ ID NO:156, SEQ ID NO:157, SEQ ID NO:158, SEQ ID NO:159, SEQ ID NO:160, SEQ ID NO:161, SEQ ID NO:162, SEQ ID NO:163, SEQ ID NO:164, SEQ ID NO:165, SEQ ID NO:166, SEQ ID NO:167, SEQ ID NO:168, SEQ ID NO:169, SEQ IDNO: 170, SEQ ID NO: 171, SEQ ID NO: 172, SEQ ID NO: 173, SEQ ID NO: 174, SEQ ID NO: 175, SEQ ID NO: 176, SEQ ID NO: 177, SEQ ID NO: 178, SEQ ID NO: 179, SEQ ID NO: 180, SEQ ID NO: 181, SEQ ID NO: 182, SEQ ID NO: 183, SEQ ID NO: 184, SEQ ID NO: 185, SEQ ID NO: 186, SEQ ID NO: 187, SEQ ID NO: 188, SEQ ID NO: 189, SEQ ID NO: 190, SEQ ID NO: 191, SEQ ID NO: 192, SEQ ID NO: 193, SEQ ID NO: 194, SEQ ID NO: 195, SEQ ID NO: 196, SEQ ID NO: 197, SEQ ID NO: 198, SEQ ID NO: 199 or SEQ ID NO: 200.

[0523] In some aspects, the ASO comprises a sequence as set forth in SEQ ID NO: 101. In some aspects, the ASO comprises a sequence as set forth in SEQ ID NO: 102. In some aspects, the ASO comprises a sequence as set forth in SEQ ID NO: 103. In some aspects, the ASO comprises a sequence as set forth in SEQ ID NO: 104. In some aspects, the ASO comprises a sequence as set forth in SEQ ID NO: 105. In some aspects, the ASO comprises a sequence as set forth in SEQ ID NO: 106. In some aspects, the ASO comprises a sequence as set forth in SEQ ID NO: 107. In some aspects, the ASO comprises a sequence as set forth in SEQ ID NO: 108. In some aspects, the ASO comprises a sequence as set forth in SEQ ID NO: 109. In some aspects, the ASO comprises a sequence as set forth in SEQ ID NO: 110. In some aspects, the ASO comprises a sequence as set forth in SEQ ID NO: 111. In some aspects, the ASO comprises a sequence as set forth in SEQ ID NO: 112. In some aspects, the ASO comprises a sequence as set forth in SEQ ID NO: 113. In some aspects, the ASO comprises a sequence as set forth in SEQ ID NO: 114. In some aspects, the ASO comprises a sequence as set forth in SEQ ID NO: 115. In some aspects, the ASO comprises a sequence as set forth in SEQ ID NO: 116. In some aspects, the ASO comprises a sequence as set forth in SEQ ID NO: 117. In some aspects, the ASO comprises a sequence as set forth in SEQ ID NO: 118. In some aspects, the ASO comprises a sequence as set forth in SEQ ID NO: 119. In some aspects, the ASO comprises a sequence as set forth in SEQ ID NO: 120. In some aspects, the ASO comprises a sequence as set forth in SEQ ID NO: 121. In some aspects, the ASO comprises a sequence as set forth in SEQ ID NO: 122. In some aspects, the ASO comprises a sequence as set forth in SEQ ID NO: 123. In some aspects, the ASO comprises a sequence as set forth in SEQ ID NO: 124. In some aspects, the ASO comprises a sequence as set forth in SEQ ID NO: 125. In some aspects, the ASO comprises a sequence as set forth in SEQ ID NO: 126. In some aspects, the ASO comprises a sequence as set forth in SEQ ID NO: 127. In some aspects, the ASO comprises a sequence as set forth in SEQ ID NO: 128. In some aspects, the ASO comprises a sequence as set forth in SEQ ID NO: 129. In some aspects, the ASO comprises a sequence as set forth in SEQ ID NO: 130.In some aspects, the ASO comprises a sequence as set forth in SEQ ID NO: 131. In some aspects, the ASO comprises a sequence as set forth in SEQ ID NO: 132. In some aspects, the ASO comprises a sequence as set forth in SEQ ID NO: 133. In some aspects, the ASO comprises a sequence as set forth in SEQ ID NO: 134. In some aspects, the ASO comprises a sequence as set forth in SEQ ID NO: 135. In some aspects, the ASO comprises a sequence as set forth in SEQ ID NO: 136. In some aspects, the ASO comprises a sequence as set forth in SEQ ID NO: 137. In some aspects, the ASO comprises a sequence as set forth in SEQ ID NO: 138. In some aspects, the ASO comprises a sequence as set forth in SEQ ID NO: 139. In some aspects, the ASO comprises a sequence as set forth in SEQ ID NO: 140. In some aspects, the ASO comprises a sequence as set forth in SEQ ID NO: 141. In some aspects, the ASO comprises a sequence as set forth in SEQ ID NO: 142. In some aspects, the ASO comprises a sequence as set forth in SEQ ID NO: 143. In some aspects, the ASO comprises a sequence as set forth in SEQ ID NO: 144. In some aspects, the ASO comprises a sequence as set forth in SEQ ID NO: 145. In some aspects, the ASO comprises a sequence as set forth in SEQ ID NO: 146. In some aspects, the ASO comprises a sequence as set forth in SEQ ID NO: 147. In some aspects, the ASO comprises a sequence as set forth in SEQ ID NO: 148. In some aspects, the ASO comprises a sequence as set forth in SEQ ID NO: 149. In some aspects, the ASO comprises a sequence as set forth in SEQ ID NO: 150. In some aspects, the ASO comprises a sequence as set forth in SEQ ID NO: 151. In some aspects, the ASO comprises a sequence as set forth in SEQ ID NO: 152. In some aspects, the ASO comprises a sequence as set forth in SEQ ID NO: 153. In some aspects, the ASO comprises a sequence as set forth in SEQ ID NO: 154. In some aspects, the ASO comprises a sequence as set forth in SEQ ID NO: 155. In some aspects, the ASO comprises a sequence as set forth in SEQ ID NO: 156. In some aspects, the ASO comprises a sequence as set forth in SEQ ID NO: 157. In some aspects, the ASO comprises a sequence as set forth in SEQ ID NO: 158. In some aspects, the ASO comprises a sequence as set forth in SEQ ID NO: 159. In some aspects, the ASO comprises a sequence as set forth in SEQ ID NO: 160.In some aspects, the ASO comprises a sequence as set forth in SEQ ID NO: 161. In some aspects, the ASO comprises a sequence as set forth in SEQ ID NO: 162. In some aspects, the ASO comprises a sequence as set forth in SEQ ID NO: 163. In some aspects, the ASO comprises a sequence as set forth in SEQ ID NO: 164. In some aspects, the ASO comprises a sequence as set forth in SEQ ID NO: 165. In some aspects, the ASO comprises a sequence as set forth in SEQ ID NO: 166. In some aspects, the ASO comprises a sequence as set forth in SEQ ID NO: 167. In some aspects, the ASO comprises a sequence as set forth in SEQ ID NO: 168. In some aspects, the ASO comprises a sequence as set forth in SEQ ID NO: 169. In some aspects, the ASO comprises a sequence as set forth in SEQ ID NO: 170. In some aspects, the ASO comprises a sequence as set forth in SEQ ID NO: 171. In some aspects, the ASO comprises a sequence as set forth in SEQ ID NO: 172. In some aspects, the ASO comprises a sequence as set forth in SEQ ID NO: 173. In some aspects, the ASO comprises a sequence as set forth in SEQ ID NO: 174. In some aspects, the ASO comprises a sequence as set forth in SEQ ID NO: 175. In some aspects, the ASO comprises a sequence as set forth in SEQ ID NO: 176. In some aspects, the ASO comprises a sequence as set forth in SEQ ID NO: 177. In some aspects, the ASO comprises a sequence as set forth in SEQ ID NO: 178. In some aspects, the ASO comprises a sequence as set forth in SEQ ID NO: 179. In some aspects, the ASO comprises a sequence as set forth in SEQ ID NO: 180. In some aspects, the ASO comprises a sequence as set forth in SEQ ID NO: 181. In some aspects, the ASO comprises a sequence as set forth in SEQ ID NO: 182. In some aspects, the ASO comprises a sequence as set forth in SEQ ID NO: 183. In some aspects, the ASO comprises a sequence as set forth in SEQ ID NO: 184. In some aspects, the ASO comprises a sequence as set forth in SEQ ID NO: 185. In some aspects, the ASO comprises a sequence as set forth in SEQ ID NO: 186. In some aspects, the ASO comprises a sequence as set forth in SEQ ID NO: 187. In some aspects, the ASO comprises a sequence as set forth in SEQ ID NO: 188. In some aspects, the ASO comprises a sequence as set forth in SEQ ID NO: 189. In some aspects, the ASO comprises a sequence as set forth in SEQ ID NO: 190.In some aspects, the ASO comprises a sequence as set forth in SEQ ID NO: 191. In some aspects, the ASO comprises a sequence as set forth in SEQ ID NO: 192. In some aspects, the ASO comprises a sequence as set forth in SEQ ID NO: 193. In some aspects, the ASO comprises a sequence as set forth in SEQ ID NO: 194. In some aspects, the ASO comprises a sequence as set forth in SEQ ID NO: 195. In some aspects, the ASO comprises a sequence as set forth in SEQ ID NO: 196. In some aspects, the ASO comprises a sequence as set forth in SEQ ID NO: 197. In some aspects, the ASO comprises a sequence as set forth in SEQ ID NO: 198. In some aspects, the ASO comprises a sequence as set forth in SEQ ID NO: 199. In some aspects, the ASO comprises a sequence as set forth in SEQ ID NO: 200.

[0524] In some aspects, the ASO comprises or consists of a sequence that is at least about 60%, at least about 65%, at least about 70%, at least about 75%, at least about 80%, at least about 85%, at least about 90%, at least about 95%, at least about 96%, at least about 97%, at least about 98%, at least about 99%, or about 100% identical to the sequence set forth in SEQ ID NOs: 101 to 200. In some aspects, the ASO (or a contiguous nucleotide portion thereof) is selected from or comprises one of the sequences selected from the group consisting of SEQ ID NOs: 101 to 200, or a region of at least 8, 9, 10, 11, 12, 13, 14, 15, 16, 17, 18, 19, or 20 contiguous nucleotides thereof. In some aspects, the ASO (or a contiguous nucleotide portion thereof) is selected from or comprises one of the sequences selected from the group consisting of: SEQ ID NO: 101 to 200 or a region of at least 8, 9, 10, 11, 12, 13, 14, 15, 16, 17, 18, 19 or 20 contiguous nucleotides thereof, wherein the ASO (or a contiguous nucleotide portion thereof) may optionally comprise 1, 2, 3 or 4 mismatches when compared to the corresponding NLRP3 transcript. In some aspects, the ASO (or a contiguous nucleotide portion thereof) is selected from or comprises one of the sequences selected from the group consisting of: SEQ ID NO: 101 to 200, except for 1, 2, 3, 4, 5, 6, 7, 8, 9 or 10 substitutions, wherein the substituted ASO can bind to the NLRP3 transcript. In some aspects, the ASO (or a contiguous nucleotide portion thereof) is selected from or comprises one of the sequences selected from the group consisting of: SEQ ID NO: 101 to 200, or a region of at least 8, 9, 10, 11, 12, 13, 14, 15, 16, 17, 18, 19, or 20 contiguous nucleotides thereof, wherein the ASO (or a contiguous nucleotide portion thereof) may optionally comprise 1, 2, 3, or 4 additional 5' and / or 3' nucleotides that are complementary to the corresponding NLRP3 transcript.

[0525] In some aspects, binding of an ASO targeting an NLRP3 transcript disclosed herein to an mRNA transcript encoding NLRP3 can reduce the expression level and / or activity level of NLRP3.

[0526] II.C.2. ASOs targeting STAT6

[0527] STAT6 (STAT6) is also known as signal transducer and transcription activator 6. Synonyms for STAT6 / STAT6 are known and include IL-4STAT; STAT, interleukin 4-induced; transcription factor IL-4STAT; STAT6B; STAT6C; and D12S1644. The sequence of the human STAT6 gene can be found under the publicly available GenBank accession number NC_000012.12:c57111413-57095404. The human STAT6 gene is located at 57111413-57095404 at chromosome position 12q13.3, complementary sequence. Unless otherwise indicated, the term "STAT6" as used herein may refer to STAT6 from one or more species (e.g., humans, non-human primates, dogs, cats, guinea pigs, rabbits, rats, mice, horses, cattle, and bears).

[0528] The sequence of the human STAT6 pre-mRNA transcript (SEQ ID NO: 11) corresponds to residues 57111413-57095404 of chromosome 12q13.3, the reverse complement of the complementary sequence. The STAT6 mRNA sequence (GenBank accession number NM_001178078.1) is provided in SEQ ID NO: 13, except that the nucleotide "t" in SEQ ID NO: 13 is shown as "u" in the mRNA. The sequence of the human STAT6 protein can be found under the publicly available accession numbers: P42226-1 (canonical sequence, SEQ ID NO: 12), P42226-2 (SEQ ID NO: 14) and P42226-3 (SEQ ID NO: 15), each of which is incorporated herein by reference in its entirety.

[0529] Natural variants of human STAT6 gene products are known. For example, natural variants of human STAT6 protein may contain one or more amino acid substitutions selected from the group consisting of: M118R, D419N, and any combination thereof. Additional variants of human STAT6 protein produced by alternative splicing are also known in the art. STAT6 isoform 2 (UniProt identifier: P42226-2) differs from the canonical sequence (SEQ ID NO: 13) as follows: a deletion of residues 1-174 relative to SEQ ID NO: 13 and 175 PSE 177 quilt 175 MEQ 177Substitutions. The sequence of STAT6 isoform 3 (identifier: P42226-3) differs from the canonical sequence (SEQ ID NO: 13) as follows: Deletion of residues 1-110 relative to SEQ ID NO: 13. Thus, the ASOs of the present disclosure can be designed to reduce or inhibit the expression of natural variants of STAT6 protein.

[0530] An example of the target nucleic acid sequence of ASO is STAT6 precursor mRNA. SEQ ID NO: 11 represents the human STAT6 genomic sequence (i.e., nucleotides 57111413-57095404 of chromosome 12q13.3, the reverse complementary sequence of the complementary sequence). SEQID NO: 11 is identical to the STAT6 precursor mRNA sequence, except that the nucleotide "t" in SEQ ID NO: 11 is shown as "u" in the precursor mRNA. In certain aspects, "target nucleic acid" includes introns of nucleic acids encoding STAT6 protein or its naturally occurring variants and RNA nucleic acids (e.g., precursor mRNA) derived therefrom. In other aspects, the target nucleic acid includes exon regions of nucleic acids encoding STAT6 protein or its naturally occurring variants and RNA nucleic acids (e.g., precursor mRNA) derived therefrom. In other aspects, the target nucleic acid includes exon-intron junctions of nucleic acids encoding STAT6 protein or its naturally occurring variants and RNA nucleic acids (e.g., precursor mRNA) derived therefrom. In some aspects, for example, when used for research or diagnosis, a "target nucleic acid" can be a cDNA or synthetic oligonucleotide derived from the above-mentioned DNA or RNA nucleic acid target. The human STAT6 protein sequence encoded by STAT6 precursor mRNA is shown as SEQ ID NO: 13. In other aspects, the target nucleic acid comprises an untranslated region of a nucleic acid encoding a STAT6 protein or a naturally occurring variant thereof, such as a 5'UTR, a 3'UTR, or both.

[0531] In some aspects, the ASO of the present disclosure hybridizes with a region within an intron of a STAT6 transcript (e.g., SEQ ID NO: 11). In certain aspects, the ASO of the present disclosure hybridizes with a region within an exon of a STAT6 transcript (e.g., SEQ ID NO: 11). In other aspects, the ASO of the present disclosure hybridizes with a region within an exon-intron junction of a STAT6 transcript (e.g., SEQ ID NO: 11). In some aspects, the ASO of the present disclosure hybridizes with a region within a STAT6 transcript (e.g., an intron, an exon, or an exon-intron junction), such as SEQ ID NO: 11, wherein the ASO has a design according to the following formula: 5'ABC 3' as described elsewhere herein.

[0532] In some aspects, ASO targets the mRNA of a specific isoform (e.g., isoform 1) encoding STAT6 protein. In some aspects, ASO targets all isoforms of STAT6 protein. In other aspects, ASO targets two isoforms of STAT6 protein (e.g., isoform 1 and isoform 2, isoform 1 and isoform 3, or isoform 2 and isoform 3).

[0533] In some aspects, the nucleotide sequence or contiguous nucleotide sequence of the ASO of the present disclosure is the same as a sequence selected from SEQ ID NOs: 601 to 703 (ie, Figure 1B 80% sequence identity, such as at least about 80%, at least about 85%, at least about 90%, at least about 91%, at least about 92%, at least about 93%, at least about 94%, at least about 95%, at least about 96% sequence identity, at least about 97% sequence identity, at least about 98% sequence identity, at least about 99% sequence identity, such as about 100% sequence identity (homologous). In some aspects, the ASO has a design described elsewhere herein or a chemical structure shown elsewhere herein (e.g., Figure 1B ).

[0534] In some aspects, the ASO (or a contiguous nucleotide portion thereof) is selected from or comprises one of the sequences selected from the group consisting of: SEQ ID NO: 601 to 703 or a region of at least 10 contiguous nucleotides thereof, wherein the ASO (or a contiguous nucleotide portion thereof) may optionally comprise 1, 2, 3 or 4 mismatches when compared to the corresponding STAT6 transcript.

[0535] In some aspects, the ASO comprises a sequence as listed in SEQ ID NO:601 (e.g., ASO-STAT6-1053). In some aspects, the ASO comprises a sequence as listed in SEQ ID NO:602 (e.g., ASO-STAT6-1359). In some aspects, the ASO comprises a sequence as listed in SEQ ID NO:603 (e.g., ASO-STAT6-1890). In some aspects, the ASO comprises a sequence as listed in SEQ ID NO:604 (e.g., ASO-STAT6-1892). In some aspects, the ASO comprises a sequence as listed in SEQ ID NO:605 (e.g., ASO-STAT6-1915). In some aspects, the ASO comprises a sequence as listed in SEQ ID NO:606 (e.g., ASO-STAT6-1916). In some aspects, the ASO comprises a sequence as listed in SEQ ID NO:607 (e.g., ASO-STAT6-1917). In some aspects, the ASO comprises a sequence as listed in SEQ ID NO:608 (e.g., ASO-STAT6-1918). In some aspects, the ASO comprises a sequence as listed in SEQ ID NO:609 (e.g., ASO-STAT6-1919). In some aspects, the ASO comprises a sequence as listed in SEQ ID NO:610 (e.g., ASO-STAT6-1920). In some aspects, the ASO comprises a sequence as listed in SEQ ID NO:611 (e.g., ASO-STAT6-1937). In some aspects, the ASO comprises a sequence as listed in SEQ ID NO:612 (e.g., ASO-STAT6-1938). In some aspects, the ASO comprises a sequence as listed in SEQ ID NO:613 (e.g., ASO-STAT6-2061). In some aspects, the ASO comprises a sequence as listed in SEQ ID NO:614 (e.g., ASO-STAT6-2062). In some aspects, the ASO comprises a sequence as listed in SEQ ID NO: 615 (e.g., ASO-STAT6-2063). In some aspects, the ASO comprises a sequence as listed in SEQ ID NO: 616 (e.g., ASO-STAT6-2064). In some aspects, the ASO comprises a sequence as listed in SEQ ID NO: 617 (e.g., ASO-STAT6-2066). In some aspects, the ASO comprises a sequence as listed in SEQ ID NO: 618 (e.g., ASO-STAT6-2067). In some aspects, the ASO comprises a sequence as listed in SEQ ID NO: 619 (e.g., ASO-STAT6-2068).In some aspects, the ASO comprises a sequence as listed in SEQ ID NO:620 (e.g., ASO-STAT6-2352). In some aspects, the ASO comprises a sequence as listed in SEQ ID NO:621 (e.g., ASO-STAT6-3073). In some aspects, the ASO comprises a sequence as listed in SEQ ID NO:622 (e.g., ASO-STAT6-1053). In some aspects, the ASO comprises a sequence as listed in SEQ ID NO:623 (e.g., ASO-STAT6-1054). In some aspects, the ASO comprises a sequence as listed in SEQ ID NO:624 (e.g., ASO-STAT6-1356). In some aspects, the ASO comprises a sequence as listed in SEQ ID NO:625 (e.g., ASO-STAT6-1847). In some aspects, the ASO comprises a sequence as listed in SEQ ID NO:626 (e.g., ASO-STAT6-1886). In some aspects, the ASO comprises a sequence as listed in SEQ ID NO: 627 (e.g., ASO-STAT6-1887). In some aspects, the ASO comprises a sequence as listed in SEQ ID NO: 628 (e.g., ASO-STAT6-1888). In some aspects, the ASO comprises a sequence as listed in SEQ ID NO: 629 (e.g., ASO-STAT6-1889). In some aspects, the ASO comprises a sequence as listed in SEQ ID NO: 630 (e.g., ASO-STAT6-1890). In some aspects, the ASO comprises a sequence as listed in SEQ ID NO: 631 (e.g., ASO-STAT6-1893). In some aspects, the ASO comprises a sequence as listed in SEQ ID NO: 632 (e.g., ASO-STAT6-1917). In some aspects, the ASO comprises a sequence as listed in SEQ ID NO: 633 (e.g., ASO-STAT6-1919). In some aspects, the ASO comprises a sequence as listed in SEQ ID NO: 634 (e.g., ASO-STAT6-2056). In some aspects, the ASO comprises a sequence as listed in SEQ ID NO: 635 (e.g., ASO-STAT6-2060). In some aspects, the ASO comprises a sequence as listed in SEQ ID NO: 636 (e.g., ASO-STAT6-2066). In some aspects, the ASO comprises a sequence as listed in SEQ ID NO: 637 (e.g., ASO-STAT6-2070). In some aspects, the ASO comprises a sequence as listed in SEQ ID NO: 638 (e.g., ASO-STAT6-2351).In some aspects, the ASO comprises a sequence as listed in SEQ ID NO: 639 (e.g., ASO-STAT6-2352). In some aspects, the ASO comprises a sequence as listed in SEQ ID NO: 640 (e.g., ASO-STAT6-2359). In some aspects, the ASO comprises a sequence as listed in SEQ ID NO: 641 (e.g., ASO-STAT6-3633). In some aspects, the ASO comprises a sequence as listed in SEQ ID NO: 642 (e.g., ASO-STAT6-673). In some aspects, the ASO comprises a sequence as listed in SEQ ID NO: 643 (e.g., ASO-STAT6-1052). In some aspects, the ASO comprises a sequence as listed in SEQ ID NO: 644 (e.g., ASO-STAT6-1356). In some aspects, the ASO comprises a sequence as listed in SEQ ID NO: 645 (e.g., ASO-STAT6-1357). In some aspects, the ASO comprises a sequence as listed in SEQ ID NO:646 (e.g., ASO-STAT6-1359). In some aspects, the ASO comprises a sequence as listed in SEQ ID NO:647 (e.g., ASO-STAT6-1360). In some aspects, the ASO comprises a sequence as listed in SEQ ID NO:648 (e.g., ASO-STAT6-1839). In some aspects, the ASO comprises a sequence as listed in SEQ ID NO:649 (e.g., ASO-STAT6-1848). In some aspects, the ASO comprises a sequence as listed in SEQ ID NO:650 (e.g., ASO-STAT6-1849). In some aspects, the ASO comprises a sequence as listed in SEQ ID NO:651 (e.g., ASO-STAT6-1891). In some aspects, the ASO comprises a sequence as listed in SEQ ID NO:652 (e.g., ASO-STAT6-1915). In some aspects, the ASO comprises a sequence as listed in SEQ ID NO: 653 (e.g., ASO-STAT6-1916). In some aspects, the ASO comprises a sequence as listed in SEQ ID NO: 654 (e.g., ASO-STAT6-1917). In some aspects, the ASO comprises a sequence as listed in SEQ ID NO: 655 (e.g., ASO-STAT6-1938). In some aspects, the ASO comprises a sequence as listed in SEQ ID NO: 656 (e.g., ASO-STAT6-1939). In some aspects, the ASO comprises a sequence as listed in SEQ ID NO: 657 (e.g., ASO-STAT6-2063).In some aspects, the ASO comprises a sequence as listed in SEQ ID NO: 658 (e.g., ASO-STAT6-2064). In some aspects, the ASO comprises a sequence as listed in SEQ ID NO: 659 (e.g., ASO-STAT6-2065). In some aspects, the ASO comprises a sequence as listed in SEQ ID NO: 660 (e.g., ASO-STAT6-2066). In some aspects, the ASO comprises a sequence as listed in SEQ ID NO: 661 (e.g., ASO-STAT6-2068). In some aspects, the ASO comprises a sequence as listed in SEQ ID NO: 662 (e.g., ASO-STAT6-2187). In some aspects, the ASO comprises a sequence as listed in SEQ ID NO: 663 (e.g., ASO-STAT6-2350). In some aspects, the ASO comprises a sequence as listed in SEQ ID NO: 664 (e.g., ASO-STAT6-2351). In some aspects, the ASO comprises a sequence as listed in SEQ ID NO: 665 (e.g., ASO-STAT6-2352). In some aspects, the ASO comprises a sequence as listed in SEQ ID NO: 666 (e.g., ASO-STAT6-2357). In some aspects, the ASO comprises a sequence as listed in SEQ ID NO: 667 (e.g., ASO-STAT6-513). In some aspects, the ASO comprises a sequence as listed in SEQ ID NO: 668 (e.g., ASO-STAT6-671). In some aspects, the ASO comprises a sequence as listed in SEQ ID NO: 669 (e.g., ASO-STAT6-1131). In some aspects, the ASO comprises a sequence as listed in SEQ ID NO: 670 (e.g., ASO-STAT6-1354). In some aspects, the ASO comprises a sequence as listed in SEQ ID NO: 671 (e.g., ASO-STAT6-1355). In some aspects, the ASO comprises a sequence as listed in SEQ ID NO: 672 (e.g., ASO-STAT6-1356). In some aspects, the ASO comprises a sequence as listed in SEQ ID NO: 673 (e.g., ASO-STAT6-1432). In some aspects, the ASO comprises a sequence as listed in SEQ ID NO: 674 (e.g., ASO-STAT6-1555). In some aspects, the ASO comprises a sequence as listed in SEQ ID NO: 675 (e.g., ASO-STAT6-1556). In some aspects, the ASO comprises a sequence as listed in SEQ ID NO: 676 (e.g., ASO-STAT6-1557).In some aspects, the ASO comprises a sequence as listed in SEQ ID NO: 677 (e.g., ASO-STAT6-1558). In some aspects, the ASO comprises a sequence as listed in SEQ ID NO: 678 (e.g., ASO-STAT6-1826). In some aspects, the ASO comprises a sequence as listed in SEQ ID NO: 679 (e.g., ASO-STAT6-1827). In some aspects, the ASO comprises a sequence as listed in SEQ ID NO: 680 (e.g., ASO-STAT6-1833). In some aspects, the ASO comprises a sequence as listed in SEQ ID NO: 681 (e.g., ASO-STAT6-1843). In some aspects, the ASO comprises a sequence as listed in SEQ ID NO: 682 (e.g., ASO-STAT6-1846). In some aspects, the ASO comprises a sequence as listed in SEQ ID NO: 683 (e.g., ASO-STAT6-1847). In some aspects, the ASO comprises a sequence as listed in SEQ ID NO:684 (e.g., ASO-STAT6-1883). In some aspects, the ASO comprises a sequence as listed in SEQ ID NO:685 (e.g., ASO-STAT6-1889). In some aspects, the ASO comprises a sequence as listed in SEQ ID NO:686 (e.g., ASO-STAT6-1890). In some aspects, the ASO comprises a sequence as listed in SEQ ID NO:687 (e.g., ASO-STAT6-1891). In some aspects, the ASO comprises a sequence as listed in SEQ ID NO:688 (e.g., ASO-STAT6-1916). In some aspects, the ASO comprises a sequence as listed in SEQ ID NO:689 (e.g., ASO-STAT6-1917). In some aspects, the ASO comprises a sequence as listed in SEQ ID NO:690 (e.g., ASO-STAT6-2056). In some aspects, the ASO comprises a sequence as listed in SEQ ID NO: 691 (e.g., ASO-STAT6-2057). In some aspects, the ASO comprises a sequence as listed in SEQ ID NO: 692 (e.g., ASO-STAT6-2060). In some aspects, the ASO comprises a sequence as listed in SEQ ID NO: 693 (e.g., ASO-STAT6-2062). In some aspects, the ASO comprises a sequence as listed in SEQ ID NO: 694 (e.g., ASO-STAT6-2063). In some aspects, the ASO comprises a sequence as listed in SEQ ID NO: 695 (e.g., ASO-STAT6-2065).In some aspects, the ASO comprises a sequence as listed in SEQ ID NO:696 (e.g., ASO-STAT6-2068). In some aspects, the ASO comprises a sequence as listed in SEQ ID NO:697 (e.g., ASO-STAT6-2347). In some aspects, the ASO comprises a sequence as listed in SEQ ID NO:698 (e.g., ASO-STAT6-2348). In some aspects, the ASO comprises a sequence as listed in SEQ ID NO:699 (e.g., ASO-STAT6-2358). In some aspects, the ASO comprises a sequence as listed in SEQ ID NO:700 (e.g., ASO-STAT6-2782). In some aspects, the ASO comprises a sequence as listed in SEQ ID NO:701 (e.g., ASO-STAT6-3070). In some aspects, the ASO comprises a sequence as listed in SEQ ID NO:702 (e.g., ASO-STAT6-3071). In some aspects, the ASO comprises the sequence set forth in SEQ ID NO:703 (eg, ASO-STAT6-3431).

[0536] In some aspects, the ASO comprises or consists of a sequence that is at least about 60%, at least about 65%, at least about 70%, at least about 75%, at least about 80%, at least about 85%, at least about 90%, at least about 95%, at least about 96%, at least about 97%, at least about 98%, at least about 99%, or about 100% identical to the sequence set forth in SEQ ID NOs: 601 to 703. In some aspects, the ASO (or a contiguous nucleotide portion thereof) is selected from or comprises one of the sequences selected from the group consisting of SEQ ID NOs: 601 to 703, or a region of at least 8, 9, 10, 11, 12, 13, 14, 15, 16, 17, 18, 19, or 20 contiguous nucleotides thereof. In some aspects, the ASO (or a contiguous nucleotide portion thereof) is selected from or comprises one of the sequences selected from the group consisting of: SEQ ID NO: 601 to 703 or a region of at least 8, 9, 10, 11, 12, 13, 14, 15, 16, 17, 18, 19 or 20 contiguous nucleotides thereof, wherein the ASO (or a contiguous nucleotide portion thereof) may optionally comprise 1, 2, 3 or 4 mismatches when compared to the corresponding STAT6 transcript. In some aspects, the ASO (or a contiguous nucleotide portion thereof) is selected from or comprises one of the sequences selected from the group consisting of: SEQ ID NO: 601 to 703, except for 1, 2, 3, 4, 5, 6, 7, 8, 9 or 10 substitutions, wherein the substituted ASO can bind to the STAT6 transcript. In some aspects, the ASO (or a contiguous nucleotide portion thereof) is selected from or comprises one of the sequences selected from the group consisting of: SEQ ID NO: 601 to 703 or a region of at least 8, 9, 10, 11, 12, 13, 14, 15, 16, 17, 18, 19 or 20 contiguous nucleotides thereof, wherein the ASO (or a contiguous nucleotide portion thereof) may optionally comprise 1, 2, 3 or 4 additional 5' and / or 3' nucleotides that are complementary to the corresponding STAT6 transcript.

[0537] In some aspects, binding of an ASO targeting a STAT6 transcript disclosed herein to an mRNA transcript encoding STAT6 can reduce the expression level and / or activity level of STAT6.

[0538] II.C.3. ASOs targeting CEBP / β

[0539] Unless otherwise indicated, the term "CEBP / β" as used herein may refer to CEBP / β from one or more species (eg, human, non-human primate, dog, cat, guinea pig, rabbit, rat, mouse, horse, cow, and bear).

[0540] CEBP / β (CEBP / β) is also known as CCAAT / enhancer binding protein β. Synonyms of CEBP / β / CEBP / β are known and include C / EBPβ; liver activating factor protein; LAP; liver-enriched inhibitory protein; LIP; nuclear factor NF-IL6; transcription factor 5; TCF-5; CEBPB; CEBPb; CEBPβ; CEBP / B; and TCF5. The sequence of the human CEBP / β gene can be found under the publicly available GenBank accession number NC_000020.11 (50190583..50192690). The human CEBP / β gene is located at 50190583-50192690 at chromosome position 20q13.13.

[0541] The sequence of the human CEBP / β precursor mRNA transcript (SEQ ID NO: 21) corresponds to the reverse complement of residues 50190583-50192690 of chromosome 20q13.13. The CEBP / β mRNA sequence (GenBank Accession No. NM_001285878.1) is provided in SEQ ID NO: 23, except that the nucleotide "t" in SEQ ID NO: 23 is shown as "u" in the mRNA. The sequence of the human CEBP / β protein can be found under the publicly available accession numbers: P17676 (canonical sequence, SEQ ID NO: 22), P17676-2 (SEQ ID NO: 24), and P17676-3 (SEQ ID NO: 25), each of which is incorporated herein by reference in its entirety.

[0542] Natural variants of human CEBP / β gene products are known. For example, a natural variant of human CEBP / β protein may contain one or more amino acid substitutions selected from the group consisting of A241P, A253G, G195S, and any combination thereof. Additional variants of human CEBP / β protein produced by alternative splicing are also known in the art. CEBP / β isoform 2 (UniProt identifier: P17676-2) differs from the canonical sequence (SEQ ID NO: 23) as follows: a deletion of residues 1-23 relative to SEQ ID NO: 23. The sequence of CEBP / β isoform 3 (identifier: P17676-3) differs from the canonical sequence (SEQ ID NO: 23) as follows: a deletion of residues 1-198 relative to SEQ ID NO: 23. Therefore, the ASOs disclosed herein can be designed to reduce or inhibit the expression of natural variants of the protein.

[0543] An example of a target nucleic acid sequence for an ASO is CEBP / β precursor mRNA. SEQ ID NO: 21 represents the human CEBP / β genomic sequence (i.e., the reverse complementary sequence of nucleotides 50190583-50192690 of chromosome 20q13.13). SEQ ID NO: 21 is identical to the CEBP / β precursor mRNA sequence, except that the nucleotide "t" in SEQ ID NO: 21 is shown as "u" in the precursor mRNA. In certain aspects, the "target nucleic acid" comprises an intron of a nucleic acid encoding a CEBP / β protein or a naturally occurring variant thereof, and an RNA nucleic acid derived therefrom (e.g., a precursor mRNA). In other aspects, the target nucleic acid comprises an exon region of a nucleic acid encoding a CEBP / β protein or a naturally occurring variant thereof, and an RNA nucleic acid derived therefrom (e.g., a precursor mRNA). In other aspects, the target nucleic acid comprises an exon-intron junction of a nucleic acid encoding a CEBP / β protein or a naturally occurring variant thereof, and an RNA nucleic acid derived therefrom (e.g., a precursor mRNA). In some aspects, for example when used for research or diagnosis, a "target nucleic acid" may be a cDNA or synthetic oligonucleotide derived from the above-mentioned DNA or RNA nucleic acid targets. The sequence of the human CEBP / β protein encoded by the CEBP / β precursor mRNA is shown as SEQ ID NO: 23. In other aspects, the target nucleic acid comprises an untranslated region of a nucleic acid encoding a CEBP / β protein or a naturally occurring variant thereof, such as a 5'UTR, a 3'UTR, or both.

[0544] In some aspects, the ASOs of the present disclosure hybridize to regions within introns of CEBP / β transcripts (e.g., SEQ ID NO: 21). In certain aspects, the ASOs of the present disclosure hybridize to regions within exons of CEBP / β transcripts (e.g., SEQ ID NO: 21). In other aspects, the ASOs of the present disclosure hybridize to regions within exon-intron junctions of CEBP / β transcripts (e.g., SEQ ID NO: 21). In some aspects, the ASOs of the present disclosure hybridize to regions within CEBP / β transcripts (e.g., introns, exons, or exon-intron junctions), such as SEQ ID NO: 21, wherein the ASOs have a design according to the following formula: 5'ABC 3' as described elsewhere herein.

[0545] In some aspects, the ASO targets an mRNA encoding a specific isoform of a CEBP / β protein (e.g., isoform 1). In some aspects, the ASO targets all isoforms of a CEBP / β protein. In other aspects, the ASO targets two isoforms of a CEBP / β protein (e.g., isoform 1 and isoform 2, isoform 1 and isoform 3, or isoform 2 and isoform 3).

[0546] In some aspects, the nucleotide sequence or contiguous nucleotide sequence of the ASO of the present disclosure is the same as a sequence selected from SEQ ID NOs: 704-806 (ie, Figure 1C 80% sequence identity, such as at least about 80%, at least about 85%, at least about 90%, at least about 91%, at least about 92%, at least about 93%, at least about 94%, at least about 95%, at least about 96% sequence identity, at least about 97% sequence identity, at least about 98% sequence identity, at least about 99% sequence identity, such as about 100% sequence identity (homologous). In some aspects, the ASO has a design described elsewhere herein or a chemical structure shown elsewhere herein (e.g., Figure 1C ).

[0547] In some aspects, the ASO (or a contiguous nucleotide portion thereof) is selected from or comprises one of the sequences selected from the group consisting of: SEQ ID NO: 704-806 or a region of at least 10 contiguous nucleotides thereof, wherein the ASO (or a contiguous nucleotide portion thereof) may optionally comprise 1, 2, 3 or 4 mismatches when compared to the corresponding CEBP / Β transcript.

[0548] In some aspects, the ASO comprises a sequence as set forth in SEQ ID NO: 704 (e.g., ASO-CEBPb-540). In some aspects, the ASO comprises a sequence as set forth in SEQ ID NO: 705 (e.g., ASO-CEBPb-565). In some aspects, the ASO comprises a sequence as set forth in SEQ ID NO: 706 (e.g., ASO-CEBPb-569). In some aspects, the ASO comprises a sequence as set forth in SEQ ID NO: 707 (e.g., ASO-CEBPb-648). In some aspects, the ASO comprises a sequence as set forth in SEQ ID NO: 708 (e.g., ASO-CEBPb-816). In some aspects, the ASO comprises a sequence as set forth in SEQ ID NO: 709 (e.g., ASO-CEBPb-817). In some aspects, the ASO comprises a sequence as set forth in SEQ ID NO: 710 (e.g., ASO-CEBPb-818). In some aspects, the ASO comprises a sequence as set forth in SEQ ID NO: 711 (e.g., ASO-CEBPb-819). In some aspects, the ASO comprises a sequence as set forth in SEQ ID NO: 712 (e.g., ASO-CEBPb-820). In some aspects, the ASO comprises a sequence as set forth in SEQ ID NO: 713 (e.g., ASO-CEBPb-851). In some aspects, the ASO comprises a sequence as set forth in SEQ ID NO: 714 (e.g., ASO-CEBPb-853). In some aspects, the ASO comprises a sequence as set forth in SEQ ID NO: 715 (e.g., ASO-CEBPb-856). In some aspects, the ASO comprises a sequence as set forth in SEQ ID NO: 716 (e.g., ASO-CEBPb-858). In some aspects, the ASO comprises a sequence as set forth in SEQ ID NO: 717 (e.g., ASO-CEBPb-987). In some aspects, the ASO comprises a sequence as set forth in SEQ ID NO: 718 (e.g., ASO-CEBPb-1056). In some aspects, the ASO comprises a sequence as set forth in SEQ ID NO: 719 (e.g., ASO-CEBPb-1064). In some aspects, the ASO comprises a sequence as set forth in SEQ ID NO: 720 (e.g., ASO-CEBPb-1065). In some aspects, the ASO comprises a sequence as set forth in SEQ ID NO: 721 (e.g., ASO-CEBPb-1066). In some aspects, the ASO comprises a sequence as set forth in SEQ ID NO: 722 (e.g., ASO-CEBPb-1071).In some aspects, the ASO comprises a sequence as set forth in SEQ ID NO: 723 (e.g., ASO-CEBPb-1270). In some aspects, the ASO comprises a sequence as set forth in SEQ ID NO: 724 (e.g., ASO-CEBPb-1273). In some aspects, the ASO comprises a sequence as set forth in SEQ ID NO: 725 (e.g., ASO-CEBPb-1274). In some aspects, the ASO comprises a sequence as set forth in SEQ ID NO: 726 (e.g., ASO-CEBPb-1405). In some aspects, the ASO comprises a sequence as set forth in SEQ ID NO: 727 (e.g., ASO-CEBPb-1407). In some aspects, the ASO comprises a sequence as set forth in SEQ ID NO: 728 (e.g., ASO-CEBPb-539). In some aspects, the ASO comprises a sequence as set forth in SEQ ID NO: 729 (e.g., ASO-CEBPb-540). In some aspects, the ASO comprises a sequence as set forth in SEQ ID NO: 730 (e.g., ASO-CEBPb-563). In some aspects, the ASO comprises a sequence as set forth in SEQ ID NO: 731 (e.g., ASO-CEBPb-564). In some aspects, the ASO comprises a sequence as set forth in SEQ ID NO: 732 (e.g., ASO-CEBPb-565). In some aspects, the ASO comprises a sequence as set forth in SEQ ID NO: 733 (e.g., ASO-CEBPb-568). In some aspects, the ASO comprises a sequence as set forth in SEQ ID NO: 734 (e.g., ASO-CEBPb-644). In some aspects, the ASO comprises a sequence as set forth in SEQ ID NO: 735 (e.g., ASO-CEBPb-645). In some aspects, the ASO comprises a sequence as set forth in SEQ ID NO: 736 (e.g., ASO-CEBPb-648). In some aspects, the ASO comprises a sequence as set forth in SEQ ID NO: 737 (e.g., ASO-CEBPb-819). In some aspects, the ASO comprises a sequence as set forth in SEQ ID NO: 738 (e.g., ASO-CEBPb-855). In some aspects, the ASO comprises a sequence as set forth in SEQ ID NO: 739 (e.g., ASO-CEBPb-860). In some aspects, the ASO comprises a sequence as set forth in SEQ ID NO: 740 (e.g., ASO-CEBPb-986). In some aspects, the ASO comprises a sequence as set forth in SEQ ID NO: 741 (e.g., ASO-CEBPb-987).In some aspects, the ASO comprises a sequence as set forth in SEQ ID NO: 742 (e.g., ASO-CEBPb-996). In some aspects, the ASO comprises a sequence as set forth in SEQ ID NO: 743 (e.g., ASO-CEBPb-1049). In some aspects, the ASO comprises a sequence as set forth in SEQ ID NO: 744 (e.g., ASO-CEBPb-1050). In some aspects, the ASO comprises a sequence as set forth in SEQ ID NO: 745 (e.g., ASO-CEBPb-1064). In some aspects, the ASO comprises a sequence as set forth in SEQ ID NO: 746 (e.g., ASO-CEBPb-1065). In some aspects, the ASO comprises a sequence as set forth in SEQ ID NO: 747 (e.g., ASO-CEBPb-1066). In some aspects, the ASO comprises a sequence as set forth in SEQ ID NO: 748 (e.g., ASO-CEBPb-1083). In some aspects, the ASO comprises a sequence as set forth in SEQ ID NO: 749 (e.g., ASO-CEBPb-1088). In some aspects, the ASO comprises a sequence as set forth in SEQ ID NO: 750 (e.g., ASO-CEBPb-1253). In some aspects, the ASO comprises a sequence as set forth in SEQ ID NO: 751 (e.g., ASO-CEBPb-1269). In some aspects, the ASO comprises a sequence as set forth in SEQ ID NO: 752 (e.g., ASO-CEBPb-1272). In some aspects, the ASO comprises a sequence as set forth in SEQ ID NO: 753 (e.g., ASO-CEBPb-1274). In some aspects, the ASO comprises a sequence as set forth in SEQ ID NO: 754 (e.g., ASO-CEBPb-539). In some aspects, the ASO comprises a sequence as set forth in SEQ ID NO: 755 (e.g., ASO-CEBPb-564). In some aspects, the ASO comprises a sequence as set forth in SEQ ID NO: 756 (e.g., ASO-CEBPb-565). In some aspects, the ASO comprises a sequence as set forth in SEQ ID NO: 757 (e.g., ASO-CEBPb-567). In some aspects, the ASO comprises a sequence as set forth in SEQ ID NO: 758 (e.g., ASO-CEBPb-647). In some aspects, the ASO comprises a sequence as set forth in SEQ ID NO: 759 (e.g., ASO-CEBPb-648). In some aspects, the ASO comprises a sequence as set forth in SEQ ID NO: 760 (e.g., ASO-CEBPb-815).In some aspects, the ASO comprises a sequence as set forth in SEQ ID NO: 761 (e.g., ASO-CEBPb-818). In some aspects, the ASO comprises a sequence as set forth in SEQ ID NO: 762 (e.g., ASO-CEBPb-820). In some aspects, the ASO comprises a sequence as set forth in SEQ ID NO: 763 (e.g., ASO-CEBPb-854). In some aspects, the ASO comprises a sequence as set forth in SEQ ID NO: 764 (e.g., ASO-CEBPb-855). In some aspects, the ASO comprises a sequence as set forth in SEQ ID NO: 765 (e.g., ASO-CEBPb-859). In some aspects, the ASO comprises a sequence as set forth in SEQ ID NO: 766 (e.g., ASO-CEBPb-1050). In some aspects, the ASO comprises a sequence as set forth in SEQ ID NO: 767 (e.g., ASO-CEBPb-1053). In some aspects, the ASO comprises a sequence as set forth in SEQ ID NO: 768 (e.g., ASO-CEBPb-1062). In some aspects, the ASO comprises a sequence as set forth in SEQ ID NO: 769 (e.g., ASO-CEBPb-1063). In some aspects, the ASO comprises a sequence as set forth in SEQ ID NO: 770 (e.g., ASO-CEBPb-1064). In some aspects, the ASO comprises a sequence as set forth in SEQ ID NO: 771 (e.g., ASO-CEBPb-1065). In some aspects, the ASO comprises a sequence as set forth in SEQ ID NO: 772 (e.g., ASO-CEBPb-1265). In some aspects, the ASO comprises a sequence as set forth in SEQ ID NO: 773 (e.g., ASO-CEBPb-1270). In some aspects, the ASO comprises a sequence as set forth in SEQ ID NO: 774 (e.g., ASO-CEBPb-1271). In some aspects, the ASO comprises a sequence as set forth in SEQ ID NO: 775 (e.g., ASO-CEBPb-1272). In some aspects, the ASO comprises a sequence as set forth in SEQ ID NO: 776 (e.g., ASO-CEBPb-1274). In some aspects, the ASO comprises a sequence as set forth in SEQ ID NO: 777 (e.g., ASO-CEBPb-1277). In some aspects, the ASO comprises a sequence as set forth in SEQ ID NO: 778 (e.g., ASO-CEBPb-564). In some aspects, the ASO comprises a sequence as set forth in SEQ ID NO: 779 (e.g., ASO-CEBPb-565).In some aspects, the ASO comprises a sequence as set forth in SEQ ID NO: 780 (e.g., ASO-CEBPb-818). In some aspects, the ASO comprises a sequence as set forth in SEQ ID NO: 781 (e.g., ASO-CEBPb-1061). In some aspects, the ASO comprises a sequence as set forth in SEQ ID NO: 782 (e.g., ASO-CEBPb-1062). In some aspects, the ASO comprises a sequence as set forth in SEQ ID NO: 783 (e.g., ASO-CEBPb-1064). In some aspects, the ASO comprises a sequence as set forth in SEQ ID NO: 784 (e.g., ASO-CEBPb-1267). In some aspects, the ASO comprises a sequence as set forth in SEQ ID NO: 785 (e.g., ASO-CEBPb-1272). In some aspects, the ASO comprises a sequence as set forth in SEQ ID NO: 786 (e.g., ASO-CEBPb-645). In some aspects, the ASO comprises a sequence as set forth in SEQ ID NO: 787 (e.g., ASO-CEBPb-848). In some aspects, the ASO comprises a sequence as set forth in SEQ ID NO: 788 (e.g., ASO-CEBPb-849). In some aspects, the ASO comprises a sequence as set forth in SEQ ID NO: 789 (e.g., ASO-CEBPb-850). In some aspects, the ASO comprises a sequence as set forth in SEQ ID NO: 790 (e.g., ASO-CEBPb-1063). In some aspects, the ASO comprises a sequence as set forth in SEQ ID NO: 791 (e.g., ASO-CEBPb-1070). In some aspects, the ASO comprises a sequence as set forth in SEQ ID NO: 792 (e.g., ASO-CEBPb-1071). In some aspects, the ASO comprises a sequence as set forth in SEQ ID NO: 793 (e.g., ASO-CEBPb-1262). In some aspects, the ASO comprises a sequence as set forth in SEQ ID NO: 794 (e.g., ASO-CEBPb-1274). In some aspects, the ASO comprises a sequence as set forth in SEQ ID NO: 795 (e.g., ASO-CEBPb-1275). In some aspects, the ASO comprises a sequence as set forth in SEQ ID NO: 796 (e.g., ASO-CEBPb-644). In some aspects, the ASO comprises a sequence as set forth in SEQ ID NO: 797 (e.g., ASO-CEBPb-647). In some aspects, the ASO comprises a sequence as set forth in SEQ ID NO: 798 (e.g., ASO-CEBPb-851).In some aspects, the ASO comprises a sequence as set forth in SEQ ID NO: 799 (e.g., ASO-CEBPb-1266). In some aspects, the ASO comprises a sequence as set forth in SEQ ID NO: 800 (e.g., ASO-CEBPb-1268). In some aspects, the ASO comprises a sequence as set forth in SEQ ID NO: 801 (e.g., ASO-CEBPb-1270). In some aspects, the ASO comprises a sequence as set forth in SEQ ID NO: 802 (e.g., ASO-CEBPb-646). In some aspects, the ASO comprises a sequence as set forth in SEQ ID NO: 803 (e.g., ASO-CEBPb-1060). In some aspects, the ASO comprises a sequence as set forth in SEQ ID NO: 804 (e.g., ASO-CEBPb-1263). In some aspects, the ASO comprises a sequence as set forth in SEQ ID NO: 805 (e.g., ASO-CEBPb-1269). In some aspects, the ASO comprises the sequence set forth in SEQ ID NO:806 (eg, ASO-CEBPb-1271).

[0549] In some aspects, the ASO comprises or consists of a sequence that is at least about 60%, at least about 65%, at least about 70%, at least about 75%, at least about 80%, at least about 85%, at least about 90%, at least about 95%, at least about 96%, at least about 97%, at least about 98%, at least about 99%, or about 100% identical to the sequence set forth in SEQ ID NOs: 704 to 806. In some aspects, the ASO (or a contiguous nucleotide portion thereof) is selected from or comprises one of the sequences selected from the group consisting of SEQ ID NOs: 704 to 806, or a region of at least 8, 9, 10, 11, 12, 13, 14, 15, 16, 17, 18, 19, or 20 contiguous nucleotides thereof. In some aspects, the ASO (or a contiguous nucleotide portion thereof) is selected from or comprises one of the sequences selected from the group consisting of: SEQ ID NOs: 704 to 806 or a region of at least 8, 9, 10, 11, 12, 13, 14, 15, 16, 17, 18, 19, or 20 contiguous nucleotides thereof, wherein the ASO (or a contiguous nucleotide portion thereof) may optionally comprise 1, 2, 3, or 4 mismatches when compared to the corresponding CEBPb transcript. In some aspects, the ASO (or a contiguous nucleotide portion thereof) is selected from or comprises one of the sequences selected from the group consisting of: SEQ ID NOs: 704 to 806, except for 1, 2, 3, 4, 5, 6, 7, 8, 9, or 10 substitutions, wherein the substituted ASO can bind to the CEBPb transcript. In some aspects, the ASO (or a contiguous nucleotide portion thereof) is selected from or comprises one of the sequences selected from the group consisting of: SEQ ID NO: 704 to 806, or a region of at least 8, 9, 10, 11, 12, 13, 14, 15, 16, 17, 18, 19 or 20 contiguous nucleotides thereof, wherein the ASO (or a contiguous nucleotide portion thereof) may optionally comprise 1, 2, 3 or 4 additional 5' and / or 3' nucleotides that are complementary to the corresponding CEBPb transcript.

[0550] In some aspects, binding of an ASO targeting a CEBPb transcript disclosed herein to an mRNA transcript encoding CEBPb can reduce the expression level and / or activity level of CEBPb.

[0551] II.C.4. ASOs targeting STAT3

[0552] Signal transducer and activator of transcription 3 (STAT3) is a signal transducer and activator of transcription that transmits signals from cell surface receptors to the nucleus. STAT3 is often overactivated in many human cancers. The genomic DNA encoding STAT3 can be located at chromosome position 17q21.2 (i.e., nucleotides 5,001 to 80,171 of GenBank accession number NG_007370.1). High levels of activated STAT3 are generally found to be associated with poor prognosis of human breast cancer patients in terms of metastatic progression (Ranger et al. 2009). Therefore, STAT3 represents a promising target for preventing and treating ER positive and ER negative breast cancer and other cancers such as pancreatic cancer, head and neck cancer, prostate cancer and lung cancer. However, the current strategy of inhibiting STAT3 activity by blocking peptides, blocking translocation, destroying dimerization or regulating phosphatase activity does not fully inhibit the STAT3 activity in cancer cells. Under normal conditions, STAT3 activation is short-lived and strictly regulated. Upon cell stimulation by ligands such as growth factors or cytokines, STAT3 becomes phosphorylated on a key tyrosine residue (Tyr705), and thus induces STAT3 dimerization through two mutual phosphotyrosine (pTyr)-Src-homology 2 (SH2) interactions. STAT3 dimers then translocate to the nucleus and bind to specific DNA response elements in the promoter of target genes, thereby activating transcription. The association of abnormal STAT3 activation with many types of human malignancie...

Claims

1. An extracellular vesicle (EV) comprising a biologically active molecule (BAM) covalently linked to the EV via an anchoring moiety (AM), wherein the anchoring moiety comprises: [Cholesterol]-[C6]-[Linker]n Where n is any integer between 1 and 10.

2. The extracellular vesicle according to claim 1, wherein n is 5 and the linker is: [PO], [C3], [PS], [TEG] and [PS].

3. The extracellular vesicle according to claim 1, wherein n is 5 and the linker is: [PO], [C3], [PS], [HEG], and [PS].

4. The extracellular vesicle of claim 1, wherein the linker comprises a cleavable linker.

5. The extracellular vesicle of any one of claims 1 to 4, further comprising a scaffold portion. The extracellular vesicle of claim 5 , wherein the scaffold portion is Scaffold X.

7. The extracellular vesicle of claim 6, wherein the scaffold X is selected from the group consisting of: prostaglandin F2 receptor negative regulator (PTGFRN protein); basigin (BSG protein); immunoglobulin superfamily member 2 (IGSF2 protein); immunoglobulin superfamily member 3 (IGSF3 protein); immunoglobulin superfamily member 8 (IGSF8 protein); integrin beta-1 (ITGB1 protein); integrin alpha-4 (ITGA4 protein); 4F2 cell surface antigen heavy chain (SLC3A2 protein); a class of ATP transporters; their functional fragments; and any combination thereof.

8. The extracellular vesicle of claim 6 or 7, wherein the scaffold X is PTGFRN protein or a functional fragment thereof.

9. The extracellular vesicle of claim 6, wherein the scaffold X comprises an amino acid sequence that is at least 50%, at least 60%, at least 70%, at least 80%, at least 85%, at least 90%, at least 95%, at least 96%, at least 97%, at least 98%, at least 99% or 100% identical to SEQ ID NO:

302.

10. The extracellular vesicle of claim 5, wherein the anchoring portion and / or the scaffold portion is scaffold Y. The extracellular vesicle of claim 10 , wherein the scaffold Y is a scaffold protein capable of anchoring the bioactive molecule on the luminal surface of the extracellular vesicle and / or on the outer surface of the extracellular vesicle.

12. The extracellular vesicle of claim 10 or 11, wherein the scaffold Y is selected from the group consisting of: protein kinase C substrate rich in myristoylated alanine (MARCKS protein), protein kinase C substrate rich in myristoylated alanine-like 1 (MARCKSL1 protein), brain acid soluble protein 1 (BASP1 protein), functional fragments thereof, and any combination thereof. The extracellular vesicle according to claim 12 , wherein the scaffold Y is BASP1 protein or a functional fragment thereof.

14. The extracellular vesicle of claim 5, wherein the bioactive molecule is attached to the anchoring portion and / or the scaffold portion on the outer surface of the EV.

15. The extracellular vesicle of claim 5, wherein the bioactive molecule is linked to the anchoring portion and / or the scaffold portion on the luminal surface of the EV.

16. The extracellular vesicle of claim 14 or 15, wherein the biologically active molecule is a peptide, a polynucleotide, a chemical compound, or any combination thereof.

17. The extracellular vesicle of claim 16, wherein the biologically active molecule comprises an ASO.

18. The extracellular vesicle of claim 17, wherein the ASO targets a transcript.

19. The extracellular vesicle of claim 18, wherein the transcript is a STAT6 transcript, a CEBP / β transcript, a STAT3 transcript, a KRAS transcript, a NRAS transcript, a NLPR3 transcript, a PMP22 transcript, or any combination thereof.

20. The extracellular vesicle of claim 1, wherein the EV is an exosome.

21. A pharmaceutical composition comprising the extracellular vesicle according to any one of claims 1 to 20 and a pharmaceutically acceptable carrier.

22. A method of conjugating a biologically active molecule to an extracellular vesicle, the method comprising attaching an anchoring moiety to the extracellular vesicle of any one of claims 1 to 20.

23. A medicine kit comprising the EV according to any one of claims 1 to 20 and instructions for use.

24. A kit comprising reagents for conjugating a biologically active molecule to an EV and instructions for performing the conjugation, thereby producing the EV of any one of claims 1 to 20.

25. Use of the extracellular vesicle of any one of claims 1 to 20, the pharmaceutical composition of claim 21, or the kit of claim 23 or 24 in the preparation of a medicament for treating or preventing a disease or disorder in a subject in need thereof.

26. The use of claim 25, wherein the disease or disorder is cancer, an inflammatory disorder, a neurodegenerative disorder, a central nervous system disease or a metabolic disease.

27. The use of claim 25 or 26, wherein the EV is administered intravenously, intraperitoneally, nasally, orally, intramuscularly, subcutaneously, parenterally or intratumorally.

Images