A method for electroporation of dwarf clam eggs

Abstract

The invention discloses an electroporation method for dwarf clam eggs. The specific steps of the electroporation method are as follows: S1: screening and constructing a fluorescent expression vector; S2: mixing the vector and the eggs, and selecting and combining several parameters such as voltage, pulse time, pulse number and the like in the electroporation conditions; the invention can screen out a fluorescent expression vector containing a dwarf clam gene promoter with high transcriptional activity, and conducts research on the electroporation transfection technology of dwarf clam eggs for the first time. Under the conditions of 150V, 1ms and electroporation once, the hatching rate is greater than 98%, the deformity rate is less than 10%, and the fluorescence efficiency can reach 33.66±2.71%; under the conditions of 25V, 10ms and electroporation four times, the hatching rate is greater than 70%, the deformity rate is 13%, and the fluorescence rate is 24.57±2.35%. The electroporation efficiency is high in the electroporation research of marine bivalve eggs, provides a very good tool for studying the gene function of shellfish, and has extremely high application value.

Description

Technical Field

[0001] The invention relates to an electroporation method, in particular to an electroporation method for dwarf clam eggs, and belongs to the technical field of dwarf clam egg perforation. Background Art

[0002] The introduction of exogenous genes is a key step in genetic engineering. It is an important means to verify the function of important genes and analyze related biological mechanisms. At present, it mainly includes physical, chemical and biological methods. Physical methods include electroporation, gene gun, microinjection, etc.; chemical methods include calcium phosphate, nanoparticle-mediated methods, etc.; biological methods include Agrobacterium transformation and viral transfection. Various exogenous gene introduction technologies have their own advantages and disadvantages in the application process. For example, the microinjection technology has a high success rate, but its operation is cumbersome, time-consuming and labor-intensive, and has high requirements for equipment and operation; the applicability of virus-mediated transfection is relatively limited and has certain safety hazards; liposome transfection is highly toxic to cells. As a physical method, electroporation transfection can be carried out in most cells, and has the characteristics of simple operation, high throughput, time-saving and high efficiency. It is a relatively excellent means of exogenous gene introduction. However, the current research on the use of electroporation technology to introduce exogenous genes in marine bivalve shellfish is still immature, and the relevant technical system has not yet been completed, which hinders the development of shellfish gene function verification technology and new breeding technology.

[0003] The dwarf clam is naturally distributed along the Atlantic coast of North America and the Caribbean Sea. It belongs to the phylum Mollusca, order Cercophoridae, and is a small bivalve burrowing shellfish. It has the characteristics of short development and reproduction cycle, small size, large spawning, transparent shells in early development, etc. Its potential as a model shellfish is recognized internationally. The present invention establishes an electroporation method for dwarf clam eggs, which can achieve efficient introduction of exogenous vectors and obtain the highest introduction efficiency in marine shellfish. The present invention is of great significance for the verification of shellfish gene functions. Summary of the invention

[0004] The object of the present invention is to provide a method for electroporation of dwarf clam eggs to solve the problems raised in the above background technology.

[0005] To achieve the above object, the present invention provides the following technical solution: an electroporation method for dwarf clam eggs, wherein the specific steps of the electroporation method are as follows:

[0006] S1: Screen and construct different "ef1α promoter-tdtomato" fluorescent expression vectors, and screen the fluorescent vectors with high expression activity;

[0007] S2: Mix the vector and eggs, select and combine several parameters in the electroporation conditions, such as voltage, pulse time, and pulse number, and transfer the fluorescent expression vector into the eggs of dwarf clams through an electroporator. 48 hours after fertilization, select the optimal electroporation conditions based on the embryo fluorescence efficiency.

[0008] As a preferred technical solution of the present invention, in step S1, the specific method for constructing the fluorescent carrier is as follows:

[0009] According to the transcriptome data of dwarf clam, it was determined that the ef1α gene had a high expression level in the fertilized eggs and D-type larvae stages; the full-length sequence of the ef1α gene was obtained in the genome, and the promoter position was predicted using FPROM and BDGP. The promoter sequence was divided into three segments based on the prediction results, and primers were designed using Primer Premier 5. Using dwarf clam DNA as a template, the ef1α promoter sequence was amplified and a vector containing the target sequence and the reporter gene was constructed.

[0010] As a preferred technical solution of the present invention, in step S1, HEK293T cells are used for transfection to screen fluorescent vectors with high expression activity.

[0011] As a preferred technical solution of the present invention, in step S2, the method for extracting dwarf clam eggs is as follows:

[0012] Take female and male mature dwarf clams with well-developed gonads, place them in a dry, dark place under running water to stimulate the dwarf clams to release gametes, observe the morphology and vitality of sperm and eggs under a microscope, use a 500-mesh sieve to enrich the dwarf clam eggs with round shape and uniform and plump yolk, and collect sufficient sperm with good swimming ability.

[0013] As a preferred technical solution of the present invention, in step S2, the electroporation conditions are 150V, 1ms, electroporation once, or 25V, 10ms, electroporation 4 times, the pulse interval is 1s, and after electroporation, it is allowed to stand for 10 minutes, filtered seawater and an appropriate amount of sperm are added for fertilization, and cultured in a 22°C incubator.

[0014] Compared with the prior art, the present invention has the following beneficial effects:

[0015] The invention discloses an electroporation method for dwarf clam eggs, which can screen out fluorescent expression vectors containing dwarf clam gene promoters with high transcriptional activity, and conducts research on electroporation transfection technology for dwarf clam eggs for the first time. The results show that under the conditions of 150V, 1ms and electroporation once, the hatching rate is greater than 98%, the deformity rate is less than 10%, and the fluorescence efficiency can reach 33.66±2.71%; under the conditions of 25V, 10ms and electroporation four times, the hatching rate is greater than 70%, the deformity rate is 13%, and the fluorescence rate is 24.57±2.35%. The electroporation efficiency is high in the electroporation research of marine bivalve eggs, provides a very good tool for studying the gene function of shellfish, and has extremely high application value. BRIEF DESCRIPTION OF THE DRAWINGS

[0016] Figure 1 This is a simplified diagram of the ef1α gene structure of the dwarf clam;

[0017] Figure 2 This is the gel electrophoresis of the dwarf clam genome DNA;

[0018] Figure 3 This is the gel electrophoresis diagram of the target fragment amplification of ef1α promoter;

[0019] Figure 4 This is the fluorescence intensity diagram of HEK293T cells transfected with the "ef1α promoter-tdtomato" vector;

[0020] Figure 5 This is a fluorescence image of the egg electroporated with the "EF1α2524-tdTomato" vector 48 hours after fertilization. DETAILED DESCRIPTION

[0021] The following will be combined with the drawings in the embodiments of the present invention to clearly and completely describe the technical solutions in the embodiments of the present invention. Obviously, the described embodiments are only part of the embodiments of the present invention, not all of the embodiments. Based on the embodiments of the present invention, all other embodiments obtained by ordinary technicians in this field without creative work are within the scope of protection of the present invention.

[0022] See also Figure 1-5The present invention provides a technical solution for an electroporation method of dwarf clam eggs: according to the transcriptome data of dwarf clam, it is determined that the ef1α gene has a high expression level in both fertilized eggs and D-type larvae; the full-length sequence of the ef1α gene is obtained in the genome, the promoter position is predicted using FPROM and BDGP, ​​and the promoter sequence is divided into three sections according to the prediction results; primers are designed using Primer Premier 5, and the ef1α promoter sequence is amplified using dwarf clam DNA as a template, and a vector containing a target sequence and a reporter gene is constructed; HEK293T cells are transfected to screen the optimal vector; the constructed vector is introduced into dwarf clam eggs by electroporation, and the electroporation parameters are adjusted to obtain the optimal introduction efficiency. The specific operations are as follows:

[0023] (1) Extraction of genomic DNA from dwarf clams

[0024] Take frozen samples of dwarf clam feet, gills, mantle, gonads, and muscles, grind and mix the samples with liquid nitrogen, and use the Tiangen DP304 blood / cell / tissue genomic DNA extraction kit to extract genomic DNA. Take 1 μl for 1.2% agarose gel electrophoresis detection, and store the product in a -20°C refrigerator.

[0025] (2) Amplification of the ef1α promoter sequence of the dwarf clam

[0026] Using the dwarf clam genomic DNA as a template, the promoter was amplified using the gflex high-fidelity enzyme according to the primers in Table 1, the forward primer introduced an XhoI restriction site, and the reverse primer introduced a HindIII restriction site. The reaction system and procedures are shown in Tables 2 and 3.

[0027] Table 1 Primer sequences for amplifying the ef1α promoter fragment of the dwarf clam

[0028]

[0029] Note: The underline indicates the restriction site

[0030] Table 2 PCR reaction system

[0031]

[0032]

[0033] Table 3 PCR reaction procedure

[0034]

[0035] After the reaction was completed, 1 μl was taken for agarose gel electrophoresis.

[0036] (3) Confirmation of ef1α promoter sequence

[0037] Gel recovery: The amplified promoter sequence was subjected to 1.2% agarose gel electrophoresis, and the target sequence was recovered using a gel recovery kit.

[0038] Ligation: Prepare a 10μl ligation system according to the pClone007 Blunt Simple Vector Kit: add different amounts of gel recovery product according to the fragment size (10-50ng for 300-1000bp, 50-100ng for 1000-2000bp, 100-200ng for 2000-5000bp), 1μl of pClone007 blunt vector, 1μl of 10x Topo Mix, fill to 10μl with sterile water, mix well by pipetting, and let react at room temperature for 10 min.

[0039] Transformation: Take out the E. coli DH5α competent cells from the -80℃ refrigerator and thaw them. Add the ligation product to the competent cells and mix gently. Keep it on ice for 30 minutes, heat-shock it in a 42℃ water bath for 45 seconds, and then transfer it to ice for 3 minutes.

[0040] Plate coating: After transformation, add 1 ml of LB medium to each tube, resuscitate at 37°C and 180 rpm for 1 hour, centrifuge at 3000g for 5 minutes, remove 900 μl of supernatant, gently pipette and mix the remaining liquid, aspirate and plate on an LB solid plate containing ampicillin resistance, and culture upside down at 37°C for 12 hours.

[0041] Picking single colonies: After a single colony grows on the solid culture medium, pick 8 single colonies, add 1 ml of LB culture medium containing ampicillin resistance, and culture at 37°C and 200 rpm for 6 hours. Then prepare 10 μl of reaction system according to Table 2, and perform bacterial liquid PCR according to the procedure in Table 3. Take 1 μl of the product for electrophoresis detection, and select the PCR product with the correct band size for sequencing.

[0042] (4) Linking of the promoter sequence to ptdtomato-1

[0043] Extract pClone007 plasmid. Select the E. coli clone with correct sequencing and expand the culture in 50 ml system, culture at 37℃180rpm for 18h. Use Tiangen Endotoxin-free Plasmid Extraction Kit to extract plasmid.

[0044] Double enzyme digestion: Use restriction endonucleases XhoⅠ and HindⅢ (Takara) to digest the pClone007 vector and ptdtomato-1 plasmid respectively: HindⅢ1μl, XhoⅠ1μl, plasmid 1000ng, 10x Buffer 5μl, make up to 50μl with sterile water, react at 37℃ for 20min, and separate the obtained enzyme digestion products by agarose gel electrophoresis and gel recovery and purification.

[0045] The promoter sequence was connected to the ptdtomato-1 plasmid: T4 ligase was used to prepare the ligation system according to the following components: 10× Buffer 2 μl, T4 ligase 1 μl, ptdtomato-1 linear plasmid 50 ng, promoter 10 ng, ddH 2 Make up to 20 μl with 5% CO and ligate overnight at 4°C.

[0046] Single clone screening: The connected plasmid was transferred into DH5α competent E. coli according to the above steps, and spread on LB solid medium containing kanamycin resistance, and inverted cultured at 37°C for 10 hours. Eight single colonies were selected for bacterial liquid PCR, and the bacterial liquid with the correct band size was selected for sequencing based on the electrophoresis results of the PCR product.

[0047] Plasmid extraction: The correctly sequenced strains were expanded and cultured, and the plasmids were extracted using the Tiangen Endotoxin-Free Plasmid Extraction Kit for subsequent electroporation and cell transfection experiments.

[0048] (5) Cell transfection to screen promoters with high transcriptional activity

[0049] Cell recovery: Prepare DMEM high-glucose medium (Hyclone) containing 10% fetal bovine serum in advance, take out the frozen HEK293T cells from the liquid nitrogen tank, quickly put them into a 37°C water bath for recovery, centrifuge at 300 rpm for 5 minutes, remove the supernatant, add 1 ml of culture medium, blow and mix, and divide the cell suspension evenly into two 25 cm 2 Add 3-4 ml of prepared DMEM high-glucose medium to each culture flask, mix well and place in 5% CO 2 Culture in an incubator.

[0050] Cell passaging: After the cells reach 80-90% confluence, pass them. Remove the culture medium in the bottle, add 1ml preheated PBS and gently rotate the culture dish to wash the cells. Then add 200μl 0.25% trypsin and shake gently. After the cells are detached from the wall, add 1ml DMEM culture medium containing 10% fetal bovine serum to terminate digestion. Use a gun to blow gently, centrifuge at 300rpm for 5min to collect the cells, add 1ml DMEM culture medium containing 10% fetal bovine serum and blow to mix, and evenly distribute the cell suspension to 3 25cm 2In the culture flask, add CO 2 Culture in an incubator.

[0051] Cell plating: After the cells in the culture flask are full again, use the above method to digest and suspend the cells, centrifuge to remove the supernatant and add 1ml of fresh culture medium to mix. Take two 12-well plates, add 1ml of PBS to each well to rinse, then add culture medium and dissociated cells in turn, and gently shake the 12-well plate to evenly distribute the cells. Place in CO 2 Culture in an incubator.

[0052] Using Lipofectamin TM 2000 Transfection Reagent (Invitrogen) was used for transfection. Ptdtomato-1 (without promoter) was selected as negative control, ptdtomato-N1 (with CMV promoter) was selected as positive control, ef1α3294-tdtomato, ef1α2524-tdtomato and ef1α825-tdtomato vectors (ef1α promoter fragment lengths were 3294 bp, 2524 bp and 825 bp, respectively) were selected as experimental groups, and 3 replicates were set for each group. The transfection experiment was performed at a ratio of lipo2000: plasmid = 3:1:

[0053] Before transfection, the culture medium containing fetal bovine serum was aspirated from the culture plate, and 1 ml of opti-mEm medium (Therm Fisher Scientific) without fetal bovine serum was added to each well.

[0054] Prepare solutions A and B. Solution A: 50 μl serum-free medium, 1 μl lipofectamine 2000 (incubate for 5 min); Solution B: 50 ul serum-free medium, 3 ug carrier (incubate for 5 min). Add solution B to solution A and let stand for 20 min.

[0055] Evenly add the mixture of A and B to the 12-well plate, shake evenly, remove the solution after 4-6 hours, add fresh culture medium, and incubate at 37°C and 5% CO 2 The cells were cultured for 48 to 72 h, and photographs were taken using a Nikon Ts2 inverted fluorescence microscope, and the mean fluorescence intensity was calculated using ImageJ software.

[0056] (6) Electroporation to introduce the vector into dwarf clam eggs

[0057] To induce spawning of dwarf clams: Take female and male mature dwarf clams with well-developed gonads, and place them in a dry, dark place with running water to stimulate the clams to release gametes. Observe the morphology and vitality of sperm and eggs under a microscope, and use a 500-mesh sieve to enrich the eggs of the dwarf clams with round shape and uniform and plump yolk, and collect sufficient sperm with good swimming ability.

[0058] Electroporation to introduce exogenous substances into eggs: 5000 eggs were used in each group, and endotoxin-free EF1α2524-tdTomato plasmid was added to a final concentration of 60μg / ml, and filtered seawater was used to make up to 100μl. After blowing and mixing, electroporation was performed using an electroporation cup with a diameter of 4mm. The electroporation conditions were 150V, 1ms, and electroporation was performed once, or 25V, 10ms, and electroporation was performed 4 times, with a pulse interval of 1s. After electroporation, the eggs were allowed to stand for 10min, filtered seawater and an appropriate amount of sperm were added for fertilization, and the eggs were cultured in a 22℃ incubator. After 48h, the fluorescent embryos and larvae were randomly selected in a 10x field of view under a Nikon Ts2 inverted fluorescence microscope to count and calculate the electrotransfection efficiency (number of fluorescent embryos / total number of embryos).

[0059] Under the conditions of 150V, 1ms, and electroporation once, the hatching rate was greater than 98%, the deformity rate was less than 10%, and the fluorescence efficiency 48h after electroporation could reach 33.66±2.71%. Under the conditions of 25V, 10ms, and electroporation 4 times, the hatching rate was greater than 70%, the deformity rate was 13%, and the fluorescence efficiency 48h after electroporation was 24.57±2.35%.

[0060] The invention provides a very good tool for studying the introduction of exogenous genes into dwarf clams and the study of gene functions, and has extremely high application value.

[0061] In the description of the present invention, it is necessary to understand that the indicated orientation or positional relationship is based on the orientation or positional relationship shown in the accompanying drawings, and is only for the convenience of describing the present invention and simplifying the description, rather than indicating or implying that the device or element referred to must have a specific orientation, be constructed and operated in a specific orientation, and therefore cannot be understood as a limitation on the present invention.

[0062] Although embodiments of the present invention have been shown and described, it will be appreciated by those skilled in the art that various changes, modifications, substitutions and variations may be made to the embodiments without departing from the principles and spirit of the present invention, and that the scope of the present invention is defined by the appended claims and their equivalents. Sequence Listing <110> Ocean University of China <120> A method for electroporation of dwarf clam eggs <130> 2022 <160> 4 <170> PatentIn version 3.5 <210> 1 <211> 26 <212> DNA <213> Artificial sequence <400> 1 ccctcgagga tgctacaccc cgttgg 26 <210> 2 <211> 29 <212> DNA <213> Artificial sequence <400> 2 ccctcgagga ttgatgtgtc attgataag 29 <210> 3 <211> 25 <212> DNA <213> Artificial sequence <400> 3 ccctcgaggc ggatacccaag aggca 25 <210> 4 <211> 30 <212> DNA <213> Artificial sequence <400> 4 ccaagctttg tgctgagaca ggttgaggta 30

Claims

1. A method for electroporation of dwarf clam eggs, characterized in that: The specific steps of the electroporation method are as follows: S1: Screen and construct different "ef1α promoter-tdtomato" fluorescent expression vectors, and screen the fluorescent vectors with high expression activity; S2: Mix the vector and eggs, select and combine the voltage, pulse time, and pulse number parameters in the electroporation conditions, transfer the fluorescent expression vector into the eggs of the dwarf clam through the electroporator, and select the best electroporation conditions according to the embryo fluorescence efficiency 48 hours after fertilization; In step S1, the specific method for constructing the fluorescent carrier is as follows: According to the transcriptome data of dwarf clams, it was determined that the ef1α gene had a high expression level in both the fertilized eggs and the D-type larvae. The full-length sequence of the ef1α gene was obtained from the genome, and the promoter position was predicted using FPROM and BDGP. The promoter sequence was divided into three segments based on the prediction results. Primers were designed using Primer Premier 5, and the ef1α promoter sequence was amplified using dwarf clam DNA as a template, and a vector containing the target sequence and the reporter gene was constructed. In step S1, HEK293T cells are transfected to screen fluorescent vectors with high expression activity, and finally the ef1α promoter-2425-tdtomato fluorescent vector is screened and obtained; the ef1α promoter is amplified using dwarf clam genomic DNA as a template and a primer pair of CCCTCGAGGATTGATGTGTCATTGATAAG and CCAAGCTTTGTGCTGAGACAGGTTGAGGTA; In step S2, the method for extracting dwarf clam eggs is as follows: Take mature male and female dwarf clams with well-developed gonads, place them in a dry and dark place with running water to stimulate the dwarf clams to release gametes, observe the morphology and vitality of sperm and eggs under a microscope, use a 500-mesh sieve to enrich the eggs of the dwarf clams with rounded shapes and uniform and full yolks, and collect sufficient sperm with good swimming ability; In step S2, the electroporation conditions are 150V, 1ms, electroporation once, or 25V, 10ms, electroporation 4 times, with a pulse interval of 1s. After electroporation, the mixture is allowed to stand for 10 minutes, filtered seawater and sperm are added for fertilization, and the mixture is cultured in a 22°C incubator.

Images