Cell-type selective immunoprotection of cells

Abstract

This disclosure relates to formulations comprising one or more cells, wherein the cells of the formulation are modified to conditionally express: (i) increased levels of one or more immune checkpoint proteins compared to corresponding wild-type cells; (ii) decreased levels of one or more HLA-I proteins compared to corresponding wild-type cells; or a combination of (i) and (ii). This disclosure further relates to methods and constructs for producing said cell formulations, and methods for administering said cell formulations to subjects in need.

Description

[0001] This application claims priority to U.S. Provisional Patent Application No. 62 / 875,883, filed July 18, 2019, which is hereby incorporated by reference in its entirety. Technical Field

[0002] This disclosure relates to a method for selectively inducing immunoprotection in terminally differentiated cells, and cell preparations that can be selectively immunoprotected. Background Technology

[0003] The acute phase of transplant rejection can occur within approximately 1–3 weeks and typically involves the action of host T cells on donor tissue, resulting from recipient sensitization of the host system to donor human leukocyte antigen class I (HLA-I) and human leukocyte antigen class II (HLA-II) molecules. In most cases, the triggering antigen is the HLA-I protein. For optimal success, non-autologous donor cells are HLA-typed and matched to the transplant recipient as perfectly as possible. However, even among family members who can share a high percentage of HLA identity, allogeneic donation often fails. To prevent rejection, allogeneic transplant recipients are often subject to arduous immunosuppressive therapy, which can lead to complications and serious conditions due to opportunistic infections. Therefore, the recognition of non-autologous HLA-I and non-autologous HLA-II proteins is a major obstacle to allogeneic cell transplantation and cell replacement therapy.

[0004] Surface expression of HLA-I or HLA-II genes can be regulated by tumor cells and viral pathogens. For example, downregulation of β2-microglobulin (B2M), which forms a heterodimer with the HLA-I α chain, is a widespread mechanism used by tumor cells to evade antitumor-mediated immune responses (Nomura et al., “β2-Microglobulin-mediated Signaling as a Target for Cancer Therapy”, Anticancer Agents Med Chem. 14(3):343-352 (2014), which is hereby incorporated by full citation). In another instance, infection of certain cell types with α-herpesviruses or β-herpesviruses such as HSV and HCMV resulted in a reduction in the surface expression of the HLA-I and HLA-II complexes through proteasomal degradation of the HLA-I heavy chain and HLA-IIα chains (HLA-DRα and HLA-DMα) (Wiertz et al., “Herpesvirus Interference with Major Histocompatibility Complex Class II-Restricted T-Cell Activation”, J. Virology 81(9): 4389-4386 (2007).

[0005] Importantly, in the case of non-autologous cell transplantation, downregulation or absence of HLA-I and HLA-II molecules on the surface of donor cells may make such cells susceptible to clearance by the innate immune system. For example, natural killer (NK) cells monitor host infection by recognizing cells that do not express HLA-I molecules and inducing their apoptosis. Similarly, macrophages residing in the spleen and liver target autologous cells that fail to present “self” proteins for clearance via programmed cytophagy (Krysoko et al., “Macrophages Regulate the Clearance of Living Cells by Calreticulin”, Nature Communications 9, Article No. 4644 (2018)).

[0006] Another consideration for cell transplantation and cell replacement therapy is the use of undifferentiated cells, such as pluripotent stem cells (e.g., embryonic stem cells and induced pluripotent stem cells) or multipotent stem cells. These cells can be transplanted in the form of allogeneic (donor-derived) stem cells or autologous (self-derived) stem cells. Because undifferentiated stem cells are characterized by rapid growth and low spontaneous differentiation rates, there are concerns about the immediate and long-term risk of tumorigenesis after stem cell transplantation (Mousavinejad et al., “Current Biosafety Considerations in Stem Cell Therapy”, Cell J. 18(2): 281-287 (2016)).

[0007] This disclosure relates to overcoming deficiencies in the art. Summary of the Invention

[0008] One aspect of this disclosure relates to a recombinant gene construct comprising: a first gene sequence expressed in a cell type-specific manner; one or more nucleotide sequences encoding immune checkpoint proteins located at the 3' position of the first gene sequence; and a second gene sequence expressed in a cell type-specific manner, wherein the second gene sequence is located at the 3' position of the one or more nucleotide sequences encoding immune checkpoint proteins.

[0009] Another aspect of this disclosure relates to a recombinant gene construct comprising: a first gene sequence expressed in a cell type-specific manner; a nucleotide sequence encoding one or more agents that reduce the expression of one or more HLA-I molecules, the nucleotide sequence being located at the 3' position of the first gene sequence; and a second gene sequence expressed in a cell type-specific manner, wherein the second gene sequence is located at the 3' position of the nucleotide sequence encoding the one or more agents that reduce the expression of one or more HLA-I molecules.

[0010] Another aspect of this disclosure relates to a recombinant gene construct comprising: a first gene sequence expressed in a cell type-specific manner; one or more nucleotide sequences encoding immune checkpoint proteins; and nucleotide sequences encoding one or more agents that reduce the expression of one or more HLA-I molecules, wherein the nucleotide sequences encoding the immune checkpoint proteins and the nucleotide sequences encoding the one or more agents that reduce the expression of one or more HLA-I molecules are located at the 3' position of the first gene sequence. The recombinant gene construct further comprises a second gene sequence expressed in a cell type-specific manner, wherein the second gene sequence is located at the 3' position of the one or more nucleotide sequences encoding immune checkpoint proteins and the nucleotide sequences encoding the one or more agents that reduce the expression of one or more HLA-I molecules.

[0011] Another aspect of this disclosure relates to a formulation comprising one or more cells, said one or more cells containing the recombinant gene construct of this disclosure.

[0012] Another aspect relates to a method for administering to a desired subject an agent a formulation consisting of one or more cells including a recombinant gene construct of the present disclosure.

[0013] Another aspect of this disclosure relates to a method for treating a subject suffering from a condition mediated by myelin loss or oligodendrocyte loss or dysfunction. This method involves administering to the subject a formulation comprising one or more cells including the recombinant gene construct described herein, in a manner that effectively treats the condition.

[0014] Another aspect relates to a method for treating a subject suffering from a condition mediated by astrocyte loss or dysfunction. This method involves administering to the subject a formulation comprising one or more cells, including the recombinant gene construct described herein, under conditions that effectively treat the condition.

[0015] Another aspect relates to a method for treating a subject suffering from symptoms mediated by neuronal loss or dysfunction. This method involves administering to the subject a formulation comprising one or more cells, including the recombinant gene construct described herein, under conditions that effectively treat the symptoms.

[0016] Another aspect relates to a formulation comprising one or more cells, wherein the cells of the formulation are modified to: conditionally express increased levels of one or more immune checkpoint proteins compared to corresponding wild-type cells; conditionally express decreased levels of one or more endogenous HLA-I proteins compared to corresponding wild-type cells; or conditionally express increased levels of one or more immune checkpoint proteins and conditionally express decreased levels of one or more endogenous HLA-I proteins compared to corresponding wild-type cells.

[0017] Another embodiment relates to a method for generating cells with conditional immune protection. This method involves: modifying cells to conditionally express increased levels of one or more immune checkpoint proteins; modifying said cells to conditionally express one or more agents that reduce the expression of one or more endogenous HLA-proteins; or modifying cells to conditionally express increased levels of one or more immune checkpoint proteins and conditionally express one or more agents that reduce the expression of one or more endogenous HLA-proteins. Attached Figure Description

[0018] Figure 1 This is a schematic diagram of a recombinant gene construct disclosed herein, the recombinant gene construct comprising (i) a first gene sequence and a second gene sequence expressed in a cell type-specific manner, (ii) one or more nucleotide sequences encoding an immune checkpoint protein, and (iii) a nucleotide sequence encoding one or more agents for reducing the expression of one or more HLA-I molecules. As shown in the schematic diagram, an exemplary recombinant gene construct from 5'→3' may include: a first gene sequence expressed in a cell type-specific manner (i.e., a 5' homologous arm); a nucleotide sequence encoding a self-cleaved peptide (e.g., P2a); a nucleotide sequence encoding an immune checkpoint protein; a stop codon; a nucleotide sequence encoding an agent for reducing the expression of one or more HLA-I molecules (i.e., shRNA); a selection marker; and a second gene sequence expressed in the same cell type-specific manner as the first gene sequence (i.e., a 3' homologous arm).

[0019] Figure 2This is a schematic diagram of a recombinant gene construct expressed in a cell type-specific manner, wherein the construct includes an HLA-E / syB2M knock-in vector and shRNAs targeting B2M and CIITA. This exemplary recombinant gene construct, from 5'→3', includes: a first gene sequence expressed in a cell type-specific manner (i.e., the 5' homologous arm); a nucleotide sequence encoding a self-cleaved peptide (e.g., P2a); a nucleotide sequence encoding an immune checkpoint protein (e.g., HLA-E / syB2M); a stop codon; a nucleotide sequence encoding an agent that reduces the expression of one or more HLA-I molecules (i.e., anti-B2M shRNA); a nucleotide sequence encoding one or more agents that reduce the expression of one or more HLA-II molecules (i.e., anti-CIITA shRNA); a selection marker (puromycin); and a second gene sequence expressed in the same cell type-specific manner as the first gene sequence (i.e., the 3' homologous arm). The selection markers shown in this example include the EF1a promoter and polyadenylation signal (PA).

[0020] Figure 3 This is a schematic diagram of a recombinant gene construct expressed in a cell type-specific manner, comprising a CD47 knock-in vector and shRNAs targeting B2M and CIITA. The recombinant gene construct, from 5' to 3', includes: a first gene sequence expressed in a cell type-specific manner (i.e., the 5' homologous arm); a nucleotide sequence encoding a self-cleaving peptide (e.g., P2a); a nucleotide sequence encoding an immune checkpoint protein (i.e., CD47); a stop codon; a nucleotide sequence encoding one or more agents that reduce the expression of one or more HLA-I molecules (i.e., anti-B2M shRNA); a nucleotide sequence encoding one or more agents that reduce the expression of one or more HLA-II molecules (i.e., anti-CIITA shRNA); a selection marker (puromycin); and a second gene sequence expressed in the same cell type-specific manner as the first gene sequence (i.e., the 3' homologous arm). The selection markers shown in this example include the EF1a promoter and polyadenylation signal (PA).

[0021] Figure 4This is a schematic diagram of a recombinant gene construct expressed in a cell type-specific manner, comprising a PD-L1 knock-in vector and shRNAs targeting B2M and CIITA. The recombinant gene construct, from 5' to 3', includes: a first gene sequence expressed in a cell type-specific manner (i.e., the 5' homologous arm); a nucleotide sequence encoding a self-cleaving peptide (e.g., P2a); a nucleotide sequence encoding an immune checkpoint protein (i.e., PD-L1); a stop codon; a nucleotide sequence encoding one or more agents that reduce the expression of one or more endogenous HLA-I molecules (i.e., anti-B2M shRNA); a nucleotide sequence encoding one or more agents that reduce the expression of one or more endogenous HLA-II molecules (i.e., anti-CIITA shRNA); a selection marker (puromycin); and a second gene sequence expressed in the same cell type-specific manner as the first gene sequence (i.e., the 3' homologous arm). The selection markers shown in this example include the EF1a promoter and polyadenylation signal (PA).

[0022] Figure 5 This is a matrix illustrating combinations of target cells and protective signals (i.e., immune checkpoint proteins). Suitable cellular targets include oligodendrocyte progenitor cells (MYRF locus), neurons (SYN1 locus), and astrocytes (GFAP locus). Immune checkpoint proteins, also referred to herein as “protective signals” or “don’t eat me” signals, include the HLA-E / syB2M single-stranded trimer, PD-L1, and CD47. In each permutation shown in the matrix, the knock-in cassette further includes nucleotide sequences encoding anti-B2M shRNA (to deplete the expression of the endogenous HLA-I / B2M complex) and / or anti-CIITA shRNA (to deplete the expression of the HLA-II complex).

[0023] Figure 6 This is a schematic diagram of an exemplary recombinant gene construct comprising an HLA-E / syB2M knock-in vector targeting the synaptophysin (SYN1) gene locus, which is restricted to expression in neurons. The recombinant gene construct includes, from 5'→3': a 5' homologous arm (the first nucleotide sequence of the synaptophysin 1 gene); a nucleotide sequence encoding a self-cleaving peptide (e.g., P2a); a nucleotide sequence encoding HLA-E / syB2M; a stop codon; a polyadenylation signal (PA); a nucleotide sequence encoding anti-B2M shRNA; a nucleotide sequence encoding anti-CIITA shRNA; a puromycin selection marker; and a 3' homologous arm (the second nucleotide sequence of the synaptophysin 1 gene). The selection markers in this exemplary construct include the EF1a promoter and the polyadenylation signal (PA).

[0024] Figure 7This is a schematic diagram of an exemplary recombinant gene construct comprising a CD47 knock-in vector targeting the synaptophysin (SYN1) gene locus, which is restricted to expression in neurons. The recombinant gene construct includes, from 5' to 3': a 5' homologous arm (the first nucleotide sequence of the synaptophysin 1 gene); a nucleotide sequence encoding a self-cleaving peptide (e.g., P2a); a nucleotide sequence encoding CD47; a stop codon; a polyadenylation signal (PA); a nucleotide sequence encoding anti-B2M shRNA; a nucleotide sequence encoding anti-CIITAshRNA; a puromycin selection marker; and a 3' homologous arm (the second nucleotide sequence of the synaptophysin 1 gene). The selection markers in this exemplary construct include the EF1a promoter and the polyadenylation signal (PA).

[0025] Figure 8 This is a schematic diagram of an exemplary recombinant gene construct comprising a PD-L1 knock-in vector targeting the synaptophysin (SYN1) gene locus expressed in neurons. The recombinant gene construct includes, from 5' to 3': a 5' homologous arm (the first nucleotide sequence of the synaptophysin 1 gene); a nucleotide sequence encoding a self-cleaving peptide (e.g., P2a); a nucleotide sequence encoding PD-L1; a stop codon; a polyadenylation signal (PA); a nucleotide sequence encoding anti-B2M shRNA; a nucleotide sequence encoding anti-CIITA shRNA; a puromycin selection marker; and a 3' homologous arm (the second nucleotide sequence of the synaptophysin 1 gene). The selection markers in this exemplary construct include the EF1a promoter and the polyadenylation signal (PA).

[0026] Figure 9 This is a schematic diagram of a recombinant gene construct comprising an HLA-E / syB2M knock-in vector targeting the myelin regulatory factor (MYRF) gene locus expressed in oligodendrocyte progenitor cells and oligodendrocytes. The recombinant gene construct includes: a 5' homologous arm (the first nucleotide sequence of the myelin regulatory factor gene); a nucleotide sequence encoding a self-cleaved peptide (e.g., P2a); a nucleotide sequence encoding HLA-E / syB2M; a stop codon; a polyadenylation signal (PA); a nucleotide sequence encoding anti-B2M shRNA; a nucleotide sequence encoding anti-CIITA shRNA; a puromycin selection marker; and a 3' homologous arm (the second nucleotide sequence of the myelin regulatory factor gene). The selection markers in this exemplary construct include the EF1a promoter and the polyadenylation signal (PA).

[0027] Figure 10This is a schematic diagram of an exemplary recombinant gene construct comprising a CD47 knock-in vector targeting the myelin regulatory factor (MYRF) gene locus, which is restricted to expression in oligodendrocyte progenitor cells and oligodendrocytes. The recombinant gene construct includes, from 5'→3': a 5' homologous arm (the first nucleotide sequence of the myelin regulatory factor gene); a nucleotide sequence encoding a self-cleaved peptide (e.g., P2a); a nucleotide sequence encoding CD47; a stop codon; a polyadenylation signal (PA); a nucleotide sequence encoding anti-B2M shRNA; a nucleotide sequence encoding anti-CIITA shRNA; a puromycin selection marker; and a 3' homologous arm (the second nucleotide sequence of the myelin regulatory factor gene). The selection markers in this exemplary construct include an EF1a promoter and a polyadenylation signal (PA) for constitutive expression in mammalian cells.

[0028] Figure 11 This is a schematic diagram of an exemplary recombinant gene construct comprising a PD-L1 knock-in vector targeting a myelin regulatory factor (MYRF) gene locus restricted in oligodendrocyte progenitor cells and oligodendrocytes. The recombinant gene construct includes, from 5'→3': a 5' homologous arm (the first nucleotide sequence of the myelin regulatory factor gene); a nucleotide sequence encoding a self-cleaved peptide (e.g., P2a); a nucleotide sequence encoding PD-L1; a stop codon; a polyadenylation signal (PA); a nucleotide sequence encoding anti-B2M shRNA; a nucleotide sequence encoding anti-CIITA shRNA; a puromycin selection marker; and a 3' homologous arm (the second nucleotide sequence of the myelin regulatory factor gene). The selection markers in this exemplary construct include an EF1a promoter and a polyadenylation signal (PA) for constitutive expression in mammalian cells.

[0029] Figure 12 This is a schematic diagram of an exemplary recombinant gene construct comprising an HLA-E / syB2M knock-in vector targeting the glial fibrillary acidic protein (GFAP) gene locus, which is restricted to expression in astrocytes. The recombinant gene construct includes, from 5'→3': a 5' homologous arm (the first nucleotide sequence of the glial fibrillary acidic protein gene); a nucleotide sequence encoding a self-cleaved peptide (e.g., P2a); a nucleotide sequence encoding HLA-E / syB2M; a stop codon; a polyadenylation signal (PA); a nucleotide sequence encoding anti-B2M shRNA; a nucleotide sequence encoding anti-CIITA shRNA; a puromycin selection marker; and a 3' homologous arm (the second nucleotide sequence of the glial fibrillary acidic protein gene). The selection markers in this exemplary construct include an EF1a promoter and a polyadenylation signal (PA) for constitutive expression in mammalian cells.

[0030] Figure 13 This is a schematic diagram of an exemplary recombinant gene construct comprising a CD47 knock-in vector targeting the glial fibrillary acidic protein (GFAP) gene locus, which is restricted to expression in astrocytes. The recombinant gene construct includes, from 5'→3': a 5' homologous arm (the first nucleotide sequence of the glial fibrillary acidic protein gene); a nucleotide sequence encoding a self-cleaved peptide (e.g., P2a); a nucleotide sequence encoding CD47; a stop codon; a polyadenylation signal (PA); a nucleotide sequence encoding anti-B2M shRNA; a nucleotide sequence encoding anti-CIITA shRNA; a puromycin selection marker; and a 3' homologous arm (the second nucleotide sequence of the glial fibrillary acidic protein gene). The selection markers in this exemplary construct include an EF1a promoter and a polyadenylation signal (PA) for constitutive expression in mammalian cells.

[0031] Figure 14 This is a schematic diagram of an exemplary recombinant gene construct comprising a PD-L1 knock-in vector targeting the glial fibrillary acidic protein (GFAP) gene locus, which is restricted to expression in astrocytes. The recombinant gene construct includes, from 5'→3': a 5' homologous arm (the first nucleotide sequence of the glial fibrillary acidic protein gene); a nucleotide sequence encoding a self-cleaved peptide (e.g., P2a); a nucleotide sequence encoding PD-L1; a stop codon; a polyadenylation signal (PA); a nucleotide sequence encoding anti-B2M shRNA; a nucleotide sequence encoding anti-CIITA shRNA; a puromycin selection marker; and a 3' homologous arm (the second nucleotide sequence of the glial fibrillary acidic protein gene). The selection markers in this exemplary construct include an EF1a promoter and a polyadenylation signal (PA) for constitutive expression in mammalian cells.

[0032] Figure 15 This is a schematic diagram of an exemplary recombinant gene construct comprising a CD47 knock-in vector targeting the myelin regulatory factor (MYRF) locus expressed in oligodendrocyte progenitor cells and oligodendrocytes. The recombinant gene construct includes a 5' homologous arm (HAL); a nucleotide sequence encoding a self-cleaving peptide (P2A); a nucleotide sequence encoding CD47; a nucleotide sequence encoding anti-B2M shRNA; a nucleotide sequence encoding anti-CIITA shRNA; nucleotide sequences encoding copGFP, the self-cleaving peptide (T2A), and a puromycin resistance gene operatively linked to the EF1a promoter; and a 3' homologous arm (HAR).

[0033] Figure 16A-1 6D illustrates the design and validation of a recombinant gene construct targeting the platelet-derived growth factor receptor α (PDGFRA) locus. Figure 16AThis diagram illustrates the strategies and designs for PD-L1 or CD47 knock-in vectors (top gene construct) and control vectors (bottom construct) targeting the PDGFRA gene locus. The PD-L2 or CD47 knock-in vector, from 5' to 3', includes: a 5' homologous arm (the first nucleotide sequence of the platelet-derived growth factor α gene); a stop codon; an internal ribosome entry site (IRES); a nucleotide sequence encoding CD47 or PD-L1; a nucleotide sequence encoding anti-B2M shRNA; a nucleotide sequence encoding anti-CIITA shRNA; a puromycin selection marker; and a 3' homologous arm (the second nucleotide sequence of the platelet-derived growth factor α gene). The control vector, from 5' to 3', includes: a 5' homologous arm (the first nucleotide sequence of the platelet-derived growth factor α gene); a stop codon; an IRES; a nucleotide sequence encoding enhanced green fluorescent protein (EGFP); a stop codon; a puromycin selection marker; and a 3' homologous arm (the second nucleotide sequence of the platelet-derived growth factor α gene). The puromycin selection markers in these constructs include the phosphoglycerate kinase (PGK) promoter and polyadenylation signal (PA) for constitutive expression in mammalian cells. Figure 16B-16D Is using Figure 16A Fluorescence microscopy images of clones generated from recombinant gene constructs targeting the PDGFRA locus and using CRISPR-mediated knock-in of PD-L1 (Fig. 16B), CD47 (Fig. 16C), and EGFP (Fig. 16D). PD-L1 or CD47, red; DAPI, blue.

[0034] Figures 17A-17B This demonstrated that human U251 glioma cells expressing CD47 or PD-L1 preferentially expanded and persisted in immune-humanized hosts. Figure 17A shows human peripheral blood mononuclear cell chimeric immunodeficient NOG mice (huPBMC-NOG mice) subcutaneously injected into the flank with PD-L1, CD47, or EGFP expressed at the PDGFRA locus (i.e., using...). Figure 16A Bioluminescence images of U251 knock-in (KI) cells after gene editing (achieved via an expression vector) at days 1, 5, and 9. Figure 17B shows tumor bioluminescence at days 1, 5, and 9. Figure 17B shows that by day 9, the expansion and persistence of CD47-expressing U251 cells were significantly higher than those of EGFP-expressing control cells, consistent with their avoidance of transplant rejection by the humanized host immune system. Treatment effects were assessed by two-way ANOVA (F[2, 12] = 9.16; p < 0.001, n = 3 mice / group. Difference between CD47 knock-in and EGFP control, **p < 0.01, by post-hoc comparison using Sidak; mean ± SEM. Detailed Implementation

[0035] This disclosure relates to a recombinant gene construct, a formulation comprising one or more cells including the recombinant gene construct described herein, and a method of treating a subject using the disclosed cell formulation.

[0036] One aspect of this disclosure relates to a recombinant gene construct designed to provide cell type-selective immune protection to cells expressing the construct.

[0037] In one embodiment, the recombinant gene construct includes: a first gene sequence expressed in a cell type-specific manner; one or more nucleotide sequences encoding immune checkpoint proteins located at the 3' position of the first cell type-specific gene sequence; and a second gene sequence expressed in a cell type-specific manner, wherein the second gene sequence is located at the 3' position of the nucleotide sequence encoding the immune checkpoint protein.

[0038] In another embodiment, the recombinant gene construct includes: a first gene sequence expressed in a cell type-specific manner; a nucleotide sequence encoding one or more agents that reduce the expression of one or more HLA-I molecules, wherein the nucleotide sequence is located at the 3' position of the first cell type-specific gene sequence; and a second gene sequence expressed in a cell type-specific manner, wherein the second gene sequence is located at the 3' position of the nucleotide sequence encoding one or more agents that reduce the expression of one or more HLA-I molecules.

[0039] In another embodiment, the recombinant gene construct includes a first gene sequence expressed in a cell type-specific manner. The recombinant gene construct further includes one or more nucleotide sequences encoding immune checkpoint proteins, said one or more nucleotide sequences encoding immune checkpoint proteins being coupled to nucleotide sequences encoding one or more agents that reduce the expression of one or more HLA-I molecules, wherein said nucleotide sequences encoding immune checkpoint proteins and said nucleotide sequences encoding one or more agents that reduce the expression of one or more HLA-I molecules are located at the 3' position of the first gene sequence. This construct further includes a second gene sequence expressed in a cell type-specific manner, wherein said second gene sequence is located at the 3' position of said nucleotide sequence encoding immune checkpoint proteins and said nucleotide sequences encoding one or more agents that reduce the expression of one or more HLA-I molecules.

[0040] As described in more detail below, any of the recombinant gene constructs described above may also contain an additional nucleotide sequence encoding one or more agents that reduce the expression of one or more HLA-II molecules. This additional nucleotide sequence may be coupled to the one or more nucleotide sequences encoding immune checkpoint proteins, the nucleotide sequences encoding one or more agents that reduce the expression of one or more HLA-I molecules, or both.

[0041] As used herein, a “recombinant gene construct” refers to a nucleic acid molecule containing a combination of two or more non-naturally occurring gene elements. Recombinant gene constructs include non-naturally occurring nucleotide sequences, which may be in the form of linear DNA or circular DNA, i.e., placed within a vector (e.g., a bacterial vector, a viral vector) or integrated into the genome.

[0042] As described in more detail below, a recombinant gene construct is introduced into the genome of the cell of interest to achieve the expression of one or more agents that reduce the expression of one or more immune checkpoint proteins or peptides and / or reduce the expression of one or more HLA-I proteins. In some embodiments, the one or more agents that reduce the expression of one or more HLA-I proteins act to reduce the surface expression of one or more HLA-I proteins.

[0043] As used herein, the terms “nucleotide sequence” and “nucleic acid sequence” are used interchangeably to refer to a polymeric form of nucleotides, ribonucleotides, or deoxyribonucleotides of any length. Thus, this term includes, but is not limited to, single-stranded, double-stranded, or multi-stranded DNA or RNA, genomic DNA, cDNA, DNA / RNA hybrids, or polymers comprising purine and pyrimidine bases or other natural, chemically or biochemically modified, non-natural, or derived nucleotide bases. In the context of the recombinant gene constructs disclosed herein, if a nucleotide sequence can be transcribed and / or translated in its native state or when manipulated by methods well known to those skilled in the art to produce mRNA for a protein and / or fragments thereof, then the nucleotide sequence may be a nucleotide sequence “encoding” the protein. If the nucleotide sequence of a recombinant gene construct can be transcribed in its native state or when manipulated by methods well known to those skilled in the art to produce a drug with a desired effector function (e.g., shRNA, siRNA, microRNA, guide RNA, etc.), then the nucleotide sequence may also “encode” the drug with the effector function.

[0044] The immune checkpoint protein encoded by the nucleotide sequence of the recombinant gene construct of this disclosure can be any protein or peptide thereof involved in the downregulation of the immune system and / or the promotion of immune self-tolerance. In one embodiment, the immune checkpoint protein or peptide thereof is an immune checkpoint protein or peptide thereof that inhibits the activity of the acquired immune response. In another embodiment, the immune checkpoint protein or peptide thereof is an immune checkpoint protein or peptide thereof that inhibits the activity of the innate immune response.

[0045] In one embodiment, the immune checkpoint protein encoded by the recombinant gene construct is programmed death ligand 1 (PD-L1), programmed death ligand 2 (PD-L2), or their functionally active peptides, which bind to inhibitory programmed cell death protein 1 (PD-1). PD-1 is primarily expressed on mature T cells in peripheral tissues and the tumor microenvironment. It is also expressed on other non-T cell subsets, including B cells, professional APCs, and natural killer (NK) cells. PD-1 signaling is mediated through interactions with its ligands PD-L1 (also known as B7-H1 and CD274) and PD-L2 (also known as B7-DC and CD273). The interaction of PD-1 with its ligands, namely either PD-L1 or PD-L2, transmits an inhibitory signal that reduces CD8+ at lymph nodes. + The proliferation of T cells suppresses the immune response.

[0046] Suitable nucleotide sequences encoding human PD-L1 and PD-L2 for inclusion in the recombinant gene constructs described herein are set forth in Table 1 below. Suitable nucleotide sequences also include nucleotide sequences having approximately 70%, 75%, 80%, 85%, 90%, 95%, 98%, 99%, or 100% sequence identity with the PD-L1 and PD-L2 coding sequences (i.e., SEQ ID NO. 1-4) provided in Table 1 below.

[0047] Table 1: Suitable PD-L1 and PD-L2 coding sequences

[0048]

[0049]

[0050] Other suitable human nucleotide sequences encoding PD-L1 that may be incorporated into the recombinant gene constructs described herein are known in the art, see, for example, gene bank accession numbers BC113734.1, BC113736.1, BC074984.2 and BC069381.1, which are hereby incorporated by reference in their entirety.

[0051] Other suitable human nucleotide sequences encoding PD-L2 that may be incorporated into the recombinant gene constructs described herein are known in the art, see, for example, BC113680.1, BC113678.1 and BC074766.2, which are hereby incorporated by reference in their entirety.

[0052] In another embodiment, the immune checkpoint protein or peptide encoded by the recombinant gene construct of this disclosure is cell surface antigen differentiation cluster 47 (CD47; integrin-associated protein (IAP)). Macrophage phagocytic activity is regulated by activating (“eating”) and inhibitory (“non-eating”) signals. Under normal physiological conditions, universally expressed CD47 inhibits phagocytosis by binding to signal regulatory protein α (SIRPα) on macrophages. SIRPα, also known as protein tyrosine phosphatase substrate 1 containing the Src homology 2 domain / brain Ig-like molecule with a tyrosine-based activation motif / differentiation cluster antigen-like family member A (SHPS-1 / BIT / CD172a), is another immunoglobulin superfamily membrane protein particularly abundant in myeloid hematopoietic cells such as macrophages and dendritic cells. The binding of SIRPα on phagocytes to CD47 expressed on adjacent cells causes phosphorylation of the SIRPα tyrosine-based inhibitory (ITIM) motif of the tyrosine-based immune receptor, leading to the recruitment of SHP-1 and SHP-2 phosphatases. One resulting downstream effect is the prevention of myosin-IIA accumulation at phagocytic synapses and thus inhibition of phagocytosis. Therefore, the CD47-SIRPα interaction acts as a negative immune checkpoint to send a “don’t eat me” signal, ensuring that healthy autologous cells are not improperly phagocytosed (Lui et al., “Is CD47 an Innate Immune Checkpoint for Tumor Evasion?” J. Hematol. Oncol. 10:12 (2017), which is hereby incorporated by full citation).

[0053] Suitable nucleotide sequences encoding human CD47 for inclusion in the recombinant gene constructs described herein are set forth in Table 2 below. Suitable nucleotide sequences also include nucleotide sequences having approximately 70%, 75%, 80%, 85%, 90%, 95%, 98%, 99%, or 100% sequence identity with the CD47 coding sequences (i.e., SEQ ID NO. 5-8) provided in Table 2 below.

[0054] Table 2: Exemplary CD47 Encoded Sequences

[0055]

[0056]

[0057] In another embodiment, the immune checkpoint protein encoded by the recombinant gene construct is CD200. CD200 (also known as OX-2 membrane glycoprotein) is a 45 kDa transmembrane immune checkpoint protein. The CD200 receptor (CD200R) is expressed on monocyte / macrophage cell lines and subsets of B cells and T cells. Signaling by CD200 prevents normal activation of bone marrow cells carrying CD200R, ultimately resulting in an immunosuppressive cascade that includes regulatory T cells (T cells). regs The induction of T cells by CD200 (Gaiser et al., “Merke Cell Carcinoma Expresses the Immunoregulatory Ligand CD200 and Induces Immunosuppressive Macrophages and Regulatory T Cells”, Oncoimmunology 7(5): e1426517 (2018), which is hereby incorporated by full citation). For example, CD200 signaling inhibits classical macrophage activation (M1 polarization) and supports an immunosuppressive M2 polarized state that secretes high levels of IL-10, thereby inducing T cells. regs Therefore, cellular expression of CD200 achieved through the recombinant gene construct described in this article will protect cells from macrophage and T cell-mediated responses.

[0058] Suitable nucleotide sequences encoding human CD200 for inclusion in the recombinant gene constructs described herein are set forth in Table 3 below. Suitable nucleotide sequences also include nucleotide sequences having approximately 70%, 75%, 80%, 85%, 90%, 95%, 98%, 99%, or 100% sequence identity with the CD200 coding sequences (i.e., SEQ ID NO. 9-12) provided in Table 3 below.

[0059] Table 3: Exemplary CD200 Encoded Sequences

[0060]

[0061]

[0062] In another embodiment, the immune checkpoint protein encoded by the recombinant gene construct is CTLA-4. During immune recognition, the expansion and differentiation of T lymphocytes require two signals: the T cell receptor (TCR) which binds to the HLA molecule-peptide complex; and an antigen-independent co-stimulatory signal provided by the B7 (CD80 and Cd86) / CD28 interaction. The cytotoxic T lymphocyte antigen (CTLA-4) is a homolog of CD28, which acts as a competitive antagonist to B7. Compared to CD28, CTLA-4 has a higher affinity and binding affinity for B7, and upon T cell activation, it translocates to the cell surface, causing B7 sequestration and transduction of negative signals responsible for T cell inactivation (Pérez-García et al., “CTLA-4 Polymorphisms and Clinical Outcome after Allogeneic Stem Cell Transplantation from HLA-Identical Sibling Donors”, Blood 110(1):461-7 (2007), which is hereby incorporated by full citation). Therefore, cellular expression of CTLA-4 achieved through the recombinant gene construct described herein will protect cells from cytotoxic T cell-mediated lysis.

[0063] The CTLA-4 gene is translated into two isoforms: the full-length protein (flCTLA-4) and a soluble counterpart (sCTLA-4), the latter lacking exon 3 (encoding the transmembrane domain) due to alternative splicing. flCTLA-4 downregulates T cell responses by inducing cell cycle arrest and blocking cytokine production. Therefore, in some embodiments, the immune checkpoint protein encoded by the recombinant gene construct is the full-length CTLA-4 (flCTLA-4).

[0064] Suitable nucleotide sequences encoding human CTLA-4 for inclusion in the recombinant gene constructs described herein are set forth in Table 4 below. Suitable nucleotide sequences also include nucleotide sequences having approximately 70%, 75%, 80%, 85%, 90%, 95%, 98%, 99%, or 100% sequence identity with the CTLA-4 coding sequences (i.e., SEQ ID NOs. 13-14 and 44) ​​provided in Table 4 below.

[0065] Table 4: Exemplary CTLA-4 coding sequences

[0066]

[0067]

[0068] In another embodiment, the immune checkpoint protein encoded by the recombinant gene construct is HLA-E (major histocompatibility complex, class I, class E). Natural killer (NK) cells detect infected cells (primarily virus-infected), foreign cells, or malignant tumor cells in which the expression of MHC molecules is reduced, altered, eliminated, or absent. NK cells distinguish normal host cells by recognizing MHC class I killer cell immunoglobulin-like receptors (KIRs) and the CD94-NKG2A inhibitory receptor expressed on the surface of normal host cells. Specifically, CD94-NKG2A recognizes NK cells and CD8+. + HLA-E receptors are present on the surface of T cells. Binding to these receptors inhibits lysis by NK cells and the secretion of NK cell cytokines. KIR also exists on CD8. + HLA-E is expressed on T cells and APCs. Therefore, cellular expression of HLA-E achieved through the recombinant gene construct described herein will protect cells from NK cell lysis.

[0069] Like other HLA class I proteins, HLA-E is a heterodimer composed of a heavy chain (α chain) and a light chain (β2 microglobulin). In one embodiment, the recombinant gene construct may include a nucleotide sequence encoding HLA-E (α chain E) and a nucleotide sequence encoding the β2 microglobulin chain. Alternatively, the recombinant gene construct may include a fusion construct, i.e., a nucleotide sequence encoding a single-chain fusion protein comprising at least a portion of β2 microglobulin covalently linked to at least a portion of HLA-E. In other embodiments, the HLA-E / β2M fusion protein is syβ2M-HLA-E, wherein syB2M (synthetic B2M) is expressed as a complex with HLA-E. syB2M contains several silent mutations at the target sequence of shRNA targeting endogenous B2M. Thus, syB2M encodes a protein identical to wild-type B2M, but resistant to shRNAs that target only endogenous B2M.

[0070] Exemplary nucleotide sequences encoding human HLA-E (α chain) are provided in Table 5 below. Suitable nucleotide sequences also include those having approximately 70%, 75%, 80%, 85%, 90%, 95%, 98%, 99%, or 100% sequence identity with the HLA-E coding sequences (i.e., SEQ ID NO. 15-17) provided in Table 5 below.

[0071] Table 5: Exemplary HLA-E coding sequences

[0072]

[0073]

[0074]

[0075] Exemplary nucleotide sequences encoding human β2M are provided in Table 6 below. Suitable nucleotide sequences also include those having approximately 70%, 75%, 80%, 85%, 90%, 95%, 98%, 99%, or 100% sequence identity with the β2M coding sequences (i.e., SEQ ID NO. 18-21) provided in Table 6 below.

[0076] Table 6: Suitable β2M coding sequences

[0077]

[0078]

[0079] Single-chain HLA-E / β2M fusion proteins may include an HLA-E heavy chain covalently fused to β2M via a flexible linker. In some embodiments, the flexible linker is a glycine-serine linker, such as the G4S4 linker (Gornalusse et al., “HLA-E-Expressing Pluripotent StemCells Escape Allogenic Responses and Lysis by NK Cells”, Nature Biotechnol. 35(8):765-772 (2017), which is hereby incorporated by full reference).

[0080] The HLA-G signaling sequence includes a peptide sequence typically presented by HLA-E, which inhibits NK cell-dependent lysis by binding to CD94 / NGK2A (Lee et al., “HLA-E is a major ligand for the Natural Killer Inhibitory Receptor CD94 / NKG2A”, Proceedings of the National Academy of Sciences of the United States of America 95:5199-5204 (1998), which is hereby incorporated by full reference). Therefore, in some embodiments, the single-chain HLA-E / β2M fusion protein further includes an additional glycine-serine linker fused to a non-polymorphic peptide derived from the HLA-G signal sequence (Gornalusse et al., “HLA-E-Expressing Pluripotent Stem Cells Escape Allogenic Responses and Lysisby NK Cells”, Nature Biotechnology 35(8):765-772 (2017), which is hereby incorporated by full reference).

[0081] As described above, the recombinant gene constructs disclosed herein may alternatively or additionally include a nucleotide sequence encoding one or more agents that reduce the expression of one or more major histocompatibility class I molecules, specifically one or more HLA-I molecules. In one embodiment, this nucleotide sequence is present alone in the recombinant gene construct, located between a first gene sequence and a second gene sequence. In another embodiment, this nucleotide sequence is present in combination with one or more nucleotide sequences encoding immune checkpoint proteins in the recombinant gene construct. In this embodiment, the combination of the above-described nucleotide sequences is located between the first gene sequence and the second gene sequence. The nucleotide sequence encoding one or more agents that reduce the expression of HLA-I molecules may be located at the 5' or 3' position of one or more nucleotide sequences encoding immune checkpoint proteins.

[0082] The recombinant gene constructs disclosed herein may include additional nucleotide sequences encoding one or more agents that reduce the expression of one or more HLA-II molecules. In some embodiments, the nucleotide sequences encoding one or more agents that reduce the expression of one or more HLA-II molecules are coupled to one or more nucleotide sequences encoding immune checkpoint proteins and / or to nucleotide sequences encoding one or more agents that reduce the expression of one or more HLA-I molecules.

[0083] Suitable agents for reducing the expression of one or more HLA-I and / or HLA-II molecules are described in detail below, including but not limited to repressive oligonucleotide molecules such as small hairpin RNA (shRNA), microRNA (miRNA), small interfering RNA (siRNA), and / or antisense oligonucleotides.

[0084] The human leukocyte antigen (HLA) system is the major histocompatibility complex (MHC) in humans. Therefore, for the purposes of this disclosure, the terms HLA and MHC are used interchangeably to refer to human genes and proteins of the major histocompatibility complex. In other embodiments, the recombinant gene construct may include a nucleotide sequence encoding one or more agents that reduce the expression of one or more non-human, mammalian MHC class I or II molecules, such as mouse, rat, pig, horse, or monkey MHC class I or II molecules.

[0085] MHC class I proteins (e.g., HLA-I proteins) are heterodimers of two proteins: an α-chain, a transmembrane protein encoded by an MHC class I gene (human chromosome 6; mouse chromosome 17); and a β2-microglobulin (β2M) chain (human chromosome 15; mouse chromosome 2). The α-chain folds into three globular domains—α1, α2, and α3. The α1 domain is located on the β2M unit. The α3 domain is transmembrane, anchoring MHC class I molecules to the cell membrane. The MHC class I complex presents foreign peptides / molecules to cells of the immune system. The presented peptides / molecules are contained in peptide-binding grooves located in the central region of the α1 / α2 heterodimer of the MHC. Typical MHC class I molecules are highly polymorphic and CD8-bound. + T cells present epitopes of T cell receptors (TCRs), unlike typical MHC class I molecules which exhibit polymorphisms, expression patterns, and limited antigen presentation.

[0086] Human HLA class I gene clusters encode heavy chains of typical (HLA-A, HLA-B, and HLA-C) and atypical (HLA-E, HLA-F, HLA-G) class I molecules. Therefore, in one embodiment, the recombinant gene construct disclosed herein includes a nucleotide sequence encoding one or more agents that reduce the expression of one or more endogenous HLA-I molecules, namely HLA-A, HLA-B, HLA-C, HLA-E, HLA-F, HLA-G, or combinations thereof, in cells expressing the recombinant gene construct. In another embodiment, the recombinant gene construct disclosed herein includes a nucleotide sequence encoding an agent that reduces β2M expression, thereby reducing the expression of all class I HLAs in the cell.

[0087] Class II HLA molecules, or human forms of class II MHC proteins, are heterodimers of two transmembrane protein α and β chains encoded by class II genes (the HLA-II gene on human chromosome 6; the MHC-II gene on mouse chromosome 17). Each of the α and β chains includes two domains—α1 and α2, and β1 and β2, respectively. The α2 and β2 domains are the transmembrane domains of the α and β chains that anchor the MHC / HLA II molecule to the membrane. Typical MHC / HLA class II molecules are expressed on the surface of dendritic cells, monocytes, and B lymphocytes and express onto CD4+. + T cells deliver peptides, while atypical MHC / HLA class II molecules are not exposed on the cell membrane but on the inner membrane of the lysosome. MHC / HLA class II expression is induced by IFN-γ through the production of MHC class II transactivator (CIITA). Therefore, in one embodiment, the nucleotide sequence of the recombinant gene construct encodes an agent that inhibits CIITA expression, thereby reducing the expression of all class II HLAs in the cell.

[0088] In humans, HLA corresponding to MHC class II comprises three gene families, each encoding the α and β chains of class II molecules. The DR gene family consists of a single DRA gene and up to nine DRB genes (DRB1 to DRB9). The DRA gene encodes the invariant α chain and binds to the various β chains encoded by the DRB genes. The DP and DQ families each have one expressed gene for the α and β chains and additional unexpressed pseudogenes. The products of the DQA1 and DQB1 genes associate to form the DQ molecule, and the products of DPA1 and DPB1 form the DP molecule.

[0089] As described above, repressive oligonucleotide molecules are suitable agents encoded by recombinant gene constructs for reducing the expression of one or more HLA-I or HLA-II molecules. Exemplary repressive oligonucleotide molecules include, but are not limited to, small hairpin RNA (shRNA), small interfering RNA (siRNA), microRNA (miRNA), and / or antisense oligonucleotides.

[0090] siRNA is a synthetic double-stranded RNA molecule approximately 20-25 nucleotides in length, with short 3′ overhangs of 2-3 nucleotides at both ends. A double-stranded siRNA molecule represents the sense and antisense strands of a portion of a target mRNA molecule, in this case, said portion being a portion of any of HLA-I and / or HLA-II mRNA, β2M mRNA (e.g., SEQ ID No: 18-21), and / or CIITA mRNA (SEQ ID NO: 22-23). ​​The sequences of various HLA-I (HLA-A, HLA-B, HLA-C) mRNAs and HLA-II (HLA-E, HLA-F, HLA-G) mRNAs are readily known in the art, and those skilled in the art can use these sequences to design siRNA and shRNA oligonucleotides. siRNA molecules are typically designed to target mRNA target regions approximately 50-100 nucleotides downstream of the start codon. Methods and online tools for designing suitable siRNA sequences based on target mRNA sequences are readily available in the field (see, for example, Reynolds et al., "Rational siRNA Design for RNA Interference", *Nature Biotech* 2:326-330 (2004); Chalk et al., "Improved and Automated Prediction of Effective siRNA", *Biochem. Biophys. Res. Comm.* 319(1): 264-274 (2004); Zhang et al., "Weak Base Pairing in Both Seed and 3' Regions Reduces RNAi Off-targets and Enhances si / shRNA Designs", *Nucleic Acids*). Res., 42(19):12169-76 (2014), which is hereby incorporated by full reference. After being introduced into the cell, the siRNA complex triggers the endogenous RNA interference (RNAi) pathway, thereby causing the cleavage and degradation of the target mRNA molecule.Various modifications to siRNA compositions have been described, such as incorporating modified nucleosides or motifs into one or both strands of the siRNA molecule to enhance stability, specificity, and efficacy, and these modifications are applicable to use according to this aspect of the invention (see, for example, WO2004 / 015107 by Giese et al.; WO2003 / 070918 by McSwiggen et al.; WO1998 / 39352 by Imanshi et al.; U.S. Patent Application Publication No. 2002 / 0068708 by Jesper et al.; U.S. Patent Application Publication No. 2002 / 0147332 by Kaneko et al.; U.S. Patent Application Publication No. 2008 / 0119427 by Bhat et al., which are hereby incorporated by reference in their entirety). Methods for constructing DNA vectors for expressing siRNA in mammalian cells are known in the art, see, for example, Sui et al., “A DNA Vector-Based RNAi Technology to Suppress Gene Expression in Mammalian Cells”, Proceedings of the National Academy of Sciences of the United States of America (Proc. Nat'l Acad. Sci. USA) 99(8):5515-5520 (2002), which is hereby incorporated by reference.

[0091] Table 7: Human CIITA mRNA sequence

[0092]

[0093]

[0094]

[0095]

[0096]

[0097] Short or small hairpin RNA (shRNA) molecules are functionally similar to siRNA molecules, but include longer RNA sequences that form tight hairpin bends. shRNA is cleaved into siRNA by cellular machinery, and gene expression is silenced through the cellular RNA interference pathway. Methods and tools for designing suitable shRNA sequences based on target mRNA sequences (e.g., β2M, CIITA, and other HLA-I and HLA-II mRNA sequences) are readily available in the art (see, for example, Taxman et al., “Criteria for Effective Design, Constructions, and Gene Knockdown shRNA Vectors”, BMC Biotech 6:7 (2006) and Taxman et al., “Short Hairpin RNA (shRNA): Design, Delivery, and Assessment of Gene Knockdown”, Meth. Mol. Biol. 629: 139-156 (2010), which are hereby incorporated by reference in their entirety). This article describes a method for constructing DNA vectors for shRNA expression and gene silencing in mammalian cells, and the method is known in the art, see, for example, Cheng and Chang, “Construction of Simple and Efficient DNA Vector-based Short Hairpin RNA Expression Systems for Specific GeneSilencing in Mammalian Cells”, Methods Mol. Biol. 408:223-41 (2007), which is hereby incorporated by reference in its entirety.

[0098] Other suitable agents that can be encoded by the recombinant constructs disclosed herein for inhibiting HLA-I or HLA-II molecules include microRNAs (miRNAs). miRNAs are small, regulatory, non-coding RNA molecules that primarily control the expression of their target mRNAs by binding to the 3' untranslated region (UTR). A single UTR can have binding sites for many miRNAs or multiple sites for a single miRNA, suggesting that these regulatory RNAs have complex posttranscriptional control over gene expression (Shulka et al., “MicroRNAs: Processing, Maturation, Target Recognition and Regulatory Functions”, Molecular and Cellular Pharmacology 3(3):83-92 (2011), which is hereby incorporated by full reference). Mature miRNAs are initially expressed as primary transcripts called primary miRNAs (pri-miRNAs), which are processed in the cell nucleus by a microprocessor complex into a 70-nucleotide stem-loop structure called premiRNA. The dsRNA portion of the premiRNA is bound and cleaved by Dicer to produce a mature 22 bp double-stranded miRNA molecule that can be integrated into the RISC complex; thus, miRNAs and siRNAs share the same cellular machinery downstream of their initial processing.

[0099] MicroRNAs that can inhibit the expression of MHC class I molecules are known in the art and are suitable for inclusion in the recombinant gene constructs described herein. For example, miR-148a is known to regulate HLA-C expression (O'Huigin et al., "The Molecular Origin and Consequences of Escape from miRNA Regulation by HLA-C Alleles", *Am. J. Hum. Genet.* 89(3):424-431 (2011), which is hereby incorporated by full citation); miR-148 and miR-152 downregulate HLA-G expression (Manaster et al., "miRNA-mediated Control of HLA-G Expression and Function", *PLoS One* 7(3): e33395). (2012), the reference is hereby incorporated in full; miR-9 regulates the expression of β2-microglobulin, HLA-B and other class I MHC molecules (Gao et al., “MiR-9 Modulates the Expression of Interferon-Regulated Genes and MHC Class I Molecules in Human Nasopharyngeal Carcinoma Cells”, Biochem.Biophys. Res. Commun. 4313:610-616 (2013), the reference is hereby incorporated in full; miR-181a regulates the expression of HLA-A (Liu et al., “Altered Expression Profiles of microRNAs in a Stable Hepatitis B Virus-Expressing Cell Line”). The reference mentioned in the Chinese Medical Journal (Chin. Med J.) 1221:10-14 (2009) is hereby incorporated in full.Methods for constructing DNA vectors for miRNA expression and gene silencing in mammalian cells are known in the art, see, for example, Yang N., “An Overview of Viral and Non-Viral Delivery Systems for microRNA”, Int. J. Pharm. Investig. 5(4):179-181 (2015).

[0100] Other suitable agents for inhibiting HLA-I or HLA-II molecules that can be encoded by the recombinant constructs disclosed herein include antisense nucleotides. The use of antisense methods to inhibit gene translation in vivo and subsequent protein expression is well known in the art (e.g., U.S. Patent No. 7,425,544 to Dobie et al.; U.S. Patent No. 7,307,069 to Karras et al.; U.S. Patent No. 7,288,530 to Bennett et al.; U.S. Patent No. 7,179,796 to Cowsert et al., all of which are hereby incorporated by reference in their entirety). Antisense nucleic acids are nucleic acid molecules (e.g., molecules containing DNA nucleotides, RNA nucleotides, or modifications (e.g., modifications that increase molecular stability, such as nucleotides substituted with 2'-O-alkyl (e.g., methyl) groups) or combinations thereof) that are complementary to or hybridize with at least a portion of a specific nucleic acid molecule, such as mRNA (see, for example, Weintraub, HM, “Antisense DNA and RNA”, Scientific American 262:40-46 (1990), which is hereby incorporated by reference in its entirety). Antisense nucleic acid molecules hybridize with their corresponding target nucleic acid molecules, such as any of HLA-I or HLA-II mRNA, β2M mRNA, or CIITA mRNA, to form a double-stranded molecule that interferes with the translation of mRNA because cells do not translate double-stranded mRNA. The antisense nucleic acid used in the method of this invention is typically at least 10-15 nucleotides in length, for example, at least 10, 11, 12, 13, 14, 15, 16, 17, 18, 19, 20, 25, 30, 35, 40, 45, 50, 55, 60, 65, 70, 75, or greater than 75 nucleotides. The antisense nucleic acid may also be as long as the target nucleic acid with which it is intended to form an inhibitory double strand.

[0101] In some embodiments, the nucleotide sequence encoding one or more agents that reduce the expression of one or more HLA-I or HLA-II molecules encodes multiple (e.g., at least 2, 3, 4, 5, 6, 7, 8, 9, 10, 11, 12, 13, 14, 15 or more) RNA molecules.

[0102] In some embodiments, one or more agents encoded by the recombinant gene constructs disclosed herein that inhibit one or more HLA-I and / or HLA-II molecules include a CRISPR / Cas9 system or a zinc finger nuclease.

[0103] CRISPR / CRISPR-related (Cas) systems use a single guide RNA to target and cleave DNA elements in a sequence-specific manner. CRISPR / Cas systems are well-known in the art and include, for example, the type II CRISPR system from *Streptococcus pyogenes* (Qi et al., “Repurposing CRISPR as an RNA-Guided Platform for Sequence-Specific Control of Gene Expression”, *Cell* 152(5):1173-1183 (2013), which is hereby incorporated by full reference). The *Streptococcus pyogenes* type II CRISPR system comprises a single gene encoding the Cas9 protein and two RNAs: mature CRISPR RNA (crRNA) and a partially complementary trans-acting RNA (tracrRNA). Maturation of crRNA requires both tracrRNA and RNase II. However, this requirement can be circumvented by using engineered small guide RNAs (sgRNAs) containing a designed hairpin mimicking the tracrRNA-crRNA complex. Due to the endonuclease activity of Cas9, base pairing between the sgRNA and the target DNA causes a double-strand break (DSB). Binding specificity is determined by both the sgRNA-DNA base pairing and the short DNA motif juxtaposed with the complementary region of the DNA (pre-intermediate sequence adjacent motif (PAM) sequence: NGG).

[0104] In some embodiments, the CRISPR / Cas9 system encoded by the recombinant gene construct includes the Cas9 protein and sgRNA.

[0105] Cas9 proteins can include wild-type Cas9 proteins or nuclease-deficient Cas9 proteins. Wild-type Cas9 binds to sgRNA to form a protein-RNA complex, which mediates the cleavage of target DNA by the Cas9 nuclease. Nuclease-deficient Cas9 binds to sgRNA to form a protein-RNA complex, which mediates the transcriptional regulation of target DNA by nuclease-deficient Cas9 (Qi et al., “Repurposing CRISPR as an RNA-Guided Platform for Sequence-Specific Control of Gene Expression”, Cell 152(5):1173-1183 (2013); Maeder et al., “CRISPR RNA-Guided Activation of Endogenous Human Genes”, Nature Methods 10(10):977-999 (2013); and Gilbert et al., “CRISPR-Mediated Modular RNA-Guided Regulation of Transcription in Eukaryotes”, Cell). 154(2):442-451 (2013), the reference of which is hereby incorporated by full citation.

[0106] sgRNAs include regions complementary to specific DNA sequences (e.g., regions of HLA-I or HLA-II genes), hairpins for Cas9 binding, and / or transcription terminators (Qi et al., “Repurposing CRISPR as an RNA-Guided Platform for Sequence-Specific Control of Gene Expression”, Cell 152(5):1173-1183 (2013), which are hereby incorporated by reference in their entirety). Methods for designing sgRNAs to target specific gene sequences are well known in the art and are described in more detail, for example, in WO2015 / 089364, WO2014 / 191521, and WO2015 / 065964, which are hereby incorporated by reference in their entirety.

[0107] In some embodiments, one or more agents encoded by the recombinant gene constructs disclosed herein for inhibiting HLA-I or HLA-II molecules are zinc finger nucleases. Zinc finger nucleases (ZFNs) are synthetic enzymes comprising three (or more) zinc finger domains linked together to produce an artificial DNA-binding protein ≥9 bp that binds to DNA. To cleave DNA, the zinc finger domains are fused with half of a FokI nuclease domain such that when two ZFNs bind to two distinct 9 bp sites separated by a suitable spacer, the ZFNs can cleave within the spacer to form a DSB. Methods for designing zinc finger nucleases to identify desired targets are well known in the art and are described in more detail in, for example, U.S. Patent No. 7,163,824 to Cox III; U.S. Patent Application Publication No. 2017 / 0327795 to Kim et al.; and Harrison et al., “A Beginner's Guide to Gene Editing”, Exp. Physiol. 103(4):439-448 (2018), which are hereby incorporated by reference in their entirety.

[0108] In some embodiments, one or more agents that reduce the expression of one or more endogenous HLA-I and / or HLA-II molecules reduce the expression of all HLA-I and / or HLA-II molecules. In some embodiments, the one or more agents are capable of reducing the expression of one or more HLA-I and / or HLA-II molecules on the cell surface by 5%, 6%, 7%, 8%, 9%, 10%, 20%, 30%, 40%, 50%, 60%, 70%, 80%, 90%, 95%, 99%, 99.5%, 99.9%, or 100% relative to wild-type expression levels.

[0109] The recombinant gene construct described herein further includes first and second “gene sequences,” also referred to herein as “homologous arms.” These gene sequences, expressed in a cell type-specific manner, are used to insert the recombinant construct directly into the gene of interest (i.e., the target gene) in a cell population via, for example, homologous recombination. Therefore, the recombinant gene construct comprises: a first gene sequence expressed in a cell type-specific manner, located at the 5' of one or more nucleotide sequences encoding an immune checkpoint protein and / or one or more nucleotide sequences encoding an agent for reducing the expression of HLA-I and / or HLA-II molecules; and a second gene sequence expressed in the same cell type-specific manner as the first gene sequence. The second gene sequence is located at the 3' of one or more nucleotide sequences encoding an immune checkpoint protein and / or one or more nucleotide sequences encoding an agent for reducing the expression of HLA-I and / or HLA-II molecules.

[0110] The first and second gene sequences of the recombinant gene construct described herein are nucleotide sequences that are identical or closely homologous (i.e., share significant sequence identity) to a specific region of the target gene (i.e., the gene into which the recombinant gene construct will be inserted). Preferably, the first and second gene sequences of the recombinant construct are identical or similar to the target gene sequences immediately upstream and downstream of the insertion cleavage site (e.g., identical to the sense strand of the target gene).

[0111] In some embodiments, the percentage of identity between the first gene sequence (i.e., the 5' homologous arm) located at the 5' end of the recombinant construct and the corresponding sequence of the target gene (e.g., the sense strand) is at least about 70%, 75%, 80%, 85%, 90%, 95%, 98%, 99%, or 100%. In some embodiments, the percentage of identity between the second gene sequence (i.e., the 3' homologous arm) located at the 3' end of the recombinant construct and the corresponding sequence of the target gene (e.g., the sense strand) is at least about 70%, 75%, 80%, 85%, 90%, 95%, 98%, 99%, or 100%.

[0112] In some embodiments, the length of the first gene sequence and the second gene sequence (e.g., the 5' homologous arm and the 3' homologous arm) exceeds about 30 nucleotide residues, such as any one of more than about 50 nucleotide residues, more than about 100 nucleotide residues, more than about 200 nucleotide residues, more than about 300 nucleotide residues, more than about 500 nucleotide residues, more than about 800 nucleotide residues, more than about 1,000 nucleotide residues, more than about 1,500 nucleotide residues, more than about 2,000 nucleotide residues, and more than about 5,000 nucleotide residues.

[0113] The recombinant gene constructs disclosed herein can be circular or linear. When the recombinant gene construct is linear, the first gene sequence and the second gene sequence (e.g., the 5' homologous arm and the 3' homologous arm) are located close to the 5' end and the 3' end of the linear nucleic acid, respectively, i.e., approximately 200 bp from the 5' end and the 3' end of the linear nucleic acid. In some embodiments, the first gene sequence (e.g., the 5' homologous arm) is located approximately 1, 2, 5, 10, 15, 20, 25, 30, 35, 40, 45, 50, 55, 60, 70, 80, 90, 100, 120, 140, 160, 180, or 200 nucleotide residues from the 5' end of the linear DNA. In some embodiments, the second gene sequence (e.g., the 3' homologous arm) is located approximately 1, 2, 5, 10, 15, 20, 25, 30, 35, 40, 45, 50, 55, 60, 70, 80, 90, 100, 120, 140, 160, 180, or 200 nucleotide residues from the 3' end of the linear DNA.

[0114] The first and second gene sequences of the recombinant gene construct are designed to mimic the sequences of a “target gene” to facilitate insertion of the construct into the target gene. According to various aspects of this disclosure, a “target gene” is a gene expressed in a cell type-specific manner. In some embodiments, a “target gene” is a gene selectively and / or restrictively expressed in terminally differentiated cells. A “terminally differentiated cell” refers to a specialized cell that has acquired and is fixed in a specific function and has irreversibly lost the ability to divide and proliferate.

[0115] In some embodiments, the target genes are genes expressed in terminally differentiated cells of the central nervous system. Exemplary terminally differentiated brain cells include, but are not limited to, oligodendrocytes, astrocytes, and neurons, including cholinergic neurons, intermediate-spinous neurons, interneurons, and dopaminergic neurons. Exemplary terminally differentiated brain cells and gene targets selectively expressed in these cells are identified in Table 8, and the terminally differentiated brain cells and gene targets are discussed in more detail below.

[0116] Table 8: Exemplary CNS cells and gene targets selectively expressed therein

[0117]

[0118] In some embodiments, the target gene is a gene that is restricted to expression in oligodendrocytes. Oligodendrocytes are terminally differentiated myelinated cells of the vertebrate central nervous system (CNS) responsible for encapsulating the axons of receptive neurons, which is crucial for the rapid propagation of nerve impulses. The differentiation of oligodendrocyte progenitor cells (OPCs) into oligodendrocytes and their subsequent axonal myelination are highly regulated processes. Genes selectively or restrictedly expressed in oligodendrocytes include, but are not limited to, the transcription factor SRY-box 10 (SOX10) (Stolt et al., “Terminal differentiation of myelin-forming oligodendrocytes depends on the transcription factor Sox10”, Genes and Development 16:165-170 (2002), which is hereby incorporated in full); membrane-associated transcription factors; and myelin regulatory factor (MYRF) (Bujalka et al., “MYRF is a membrane-associated transcription factor that autoproteolytically cleaves to directly activate myelin genes”, PLoS Biol.). 11(8):e1001625 (2013), the reference of which is hereby incorporated by full reference); myelin-associated glycoprotein (MAG); and myelin basic protein (MBP).

[0119] In one embodiment, the recombinant gene construct described herein is designed for insertion into any one of the SOX10, MYRF, MAG, or MBP genes, such that the expression of the recombinant construct is coupled to the expression of the gene in oligodendrocytes. According to this embodiment, the first and second gene sequences are derived from the SOX10, MYRF, MAG, or MBP genes.

[0120] In one embodiment, the recombinant gene construct is designed to be inserted at or around the 3' untranslated region of any of the aforementioned genes, wherein the first and second gene sequences of the recombinant gene construct are homologous to regions of the selected gene located at the 5' and 3' of the selected insertion site, respectively. The specific location of the insertion site can vary, and therefore the specific sequences of the first and second gene sequences of the recombinant construct will also vary. However, the selection of these parameters using known sequences and structures of each of these genes, readily available in the art, for example through the NCBI gene database and gene ID numbers, is entirely within the skill of those skilled in the art.

[0121] In another embodiment, the target gene is a gene that is restricted to expression in astrocytes. Astrocytes are the most abundant terminally differentiated cell type in the CNS and perform a variety of tasks, from axonal guidance and synaptic support to controlling the blood-brain barrier and blood flow.

[0122] Terminally differentiated astrocytes can be identified by the presence of various cell surface markers, including, for example, glial fibrillary acidic protein (GFAP) and aquaporin-4 (AQP4). Therefore, the recombinant construct can insert genes selectively expressed in astrocytes, including but not limited to GFAP and AQP4. According to this embodiment, the first and second gene sequences are derived from GFAP and AQP4.

[0123] In one embodiment, the recombinant gene construct described herein is inserted into GFAP or AQP4 such that the expression of the recombinant construct is coupled to the expression of GFAP or AQP4. In one embodiment, the recombinant gene construct is inserted at or around the 3' untranslated region of GFAP or AQP4, wherein the first and second gene sequences of the recombinant gene construct are homologous to the regions of GFAP or AQP4 at the 5' and 3' positions, respectively, at the selected insertion site. The specific location of the insertion site can vary, and therefore the specific sequences of the first and second cell-specific gene sequences of the recombinant construct will also vary. However, the selection of these parameters using the known sequences and structures of each of these genes readily available in the art is entirely within the skill of those skilled in the art.

[0124] In another embodiment, the target gene is a gene whose expression is restricted in neurons. Neurons are electrically excitable cells in the central and peripheral nervous systems that function to process and transmit information. Terminally differentiated neurons can be identified by the presence of various cell surface markers, including, for example, synaptophysin 1 (SYN1), microtubule-associated protein 2 (MAP2), and ELAV-like RNA-binding protein 4 (ELAV4). Therefore, in one embodiment, the recombinant gene construct described herein is inserted into any one of SYN1, MAP2, or ELAV4 such that the expression of the recombinant construct is coupled to the expression of any one of the SYN1, MAP2, or ELAV4 genes in the neuron. According to this embodiment, the first gene sequence and the second gene sequence are derived from the SYN1, MAP2, or ELAV4 genes.

[0125] In embodiments where it is desired to restrict the expression of a recombinant gene construct to a specific type of neuron, such as a dopaminergic neuron, the recombinant gene construct is inserted into a gene that is selectively expressed in the desired neuronal population. Thus, in one embodiment, the recombinant gene construct described herein is designed for insertion into a tyrosine hydroxylase gene (TH) or a dopa decarboxylase gene (DDC), which are genes selectively expressed in dopaminergic neurons. In another embodiment, the recombinant gene construct is designed for insertion into a gene encoding glutamate decarboxylase 2 (GAD2, also known as GAD65) or a gene encoding glutamate decarboxylase 1 (GAD1, also known as GAD67), which are genes selectively expressed in intermediate-spinous neurons and cortical interneurons. In yet another embodiment, the recombinant gene construct described herein is inserted into a choline O-acetyltransferase gene (CHAT) selectively expressed in cholinergic neurons.

[0126] In one embodiment, the recombinant gene construct is inserted at or around the 3' untranslated region of any of the aforementioned neuron-specific genes (i.e., SYN1, MAP2, ELAV4, TH, DDC, GAD65, GAD67, or CHAT), wherein the first and second gene sequences of the recombinant gene construct are homologous to regions located at the 5' and 3' of the selected insertion site, respectively. The specific location of the insertion site can vary, and therefore the specific sequences of the first and second gene sequences of the recombinant construct will also vary. However, the selection of these parameters using the known sequences and structures of each of these genes readily available in the art is entirely within the skill of those skilled in the art.

[0127] In another embodiment, the target gene is a gene expressed in terminally differentiated cells outside the central nervous system (CNS). Exemplary terminally differentiated non-CNS cells include, but are not limited to, adipocytes, chondrocytes, endothelial cells, epithelial cells (keratinized cells, melanocytes), osteoblasts (osteoblasts, osteoclasts), hepatocytes (choledochocytes, hepatocytes), muscle cells (cardiomyocytes, skeletal muscle cells, smooth muscle cells), retinal cells (ganglionic cells, Müller cells, photoreceptor cells), retinal pigment epithelial cells, kidney cells (podocytes, proximal tubule cells, collecting duct cells, distal tubule cells), adrenal cells (cortical adrenal cells, medullary adrenal cells), pancreatic cells (α cells, β cells, δ cells, ε cells, pancreatic polypeptide-producing cells, exocrine cells); lung cells, bone marrow cells (early B cell development, early T cell development, macrophages, monocytes), urothelial cells, fibroblasts, parathyroid cells, thyroid cells, hypothalamic cells, pituitary cells, salivary gland cells, ovarian cells, and testicular cells. Table 9 below identifies exemplary terminally differentiated non-CNS cells and gene targets selectively expressed in these cells.

[0128] Table 9: Exemplary non-CNS cells and gene targets selectively expressed therein

[0129]

[0130]

[0131]

[0132]

[0133]

[0134]

[0135] In one embodiment, the recombinant gene construct described herein is designed for insertion into any of the genes provided in Table 9, such that the expression of the recombinant construct is coupled to the expression of a specific gene in a desired cell. In one embodiment, the recombinant gene construct is inserted at or around the 3' untranslated region of any of the aforementioned genes, wherein the first and second gene sequences of the recombinant gene construct are homologous to regions of the selected gene at the 5' and 3' positions of the selected insertion site, respectively. The specific location of the insertion site can vary, and therefore the specific sequences of the first and second cell-specific gene sequences of the recombinant construct will also vary. However, the selection of these parameters using the known sequences and structures of each of these genes, readily available in the art, for example through the NCBI gene database and the provided gene IDs, is entirely within the skill of those skilled in the art.

[0136] In some embodiments, the recombinant gene construct further includes one or more nucleotide sequences encoding self-cleaving peptides, wherein the nucleotide sequences encoding the self-cleaving peptides are located within the construct in a manner that effectively mediates the in vivo translation of one or more immune checkpoint proteins. A “self-cleaving peptide” is a viral oligopeptide sequence of 18-22 amino acids that mediates ribosome skipping during translation in eukaryotic cells (Liu et al., “Systemic Comparison of 2A peptides for Cloning Multi-Genes in a Polycistronic Vector”, Scientific Reports 7: Article 2193 (2017), which is hereby incorporated by reference in its entirety). A non-limiting example of such self-cleaving peptides is peptide 2A, a short protein sequence first discovered in parvoviruses. Peptide 2A functions by causing ribosomes to skip the synthesis of peptide bonds at the C-terminus of the 2A element, thereby creating a space between the end of the 2A sequence and its downstream peptide. This “cut” occurs between a glycine residue and a proline residue at the C-terminus. Therefore, a successful ribosome jump and restart of translation results in a separate “cut” protein, in which the protein upstream of the 2A element is linked to the intact 2A peptide, except for the C-terminal proline, and the protein downstream of the 2A element is linked to a proline residue at the N-terminus (Liu et al., “Systemic Comparison of 2A peptides for Cloning Multi-Genes in a Polycistronic Vector”, Scientific Reports 7: Article 2193 (2017), which is hereby incorporated by full citation).

[0137] Exemplary self-cleaving peptides that can be incorporated into recombinant gene constructs include, but are not limited to, porcine swine cirrhosis virus-1 2A (P2A), foot-and-mouth disease virus 2A (F2A), thosea asigna virus 2A (T2A), equine rhinitis virus 2A (E2A), cytoplasmic polyhedrosis virus (BmCPV 2A), and blistering disease virus (BmIFV 2A). The nucleotide sequences encoding these self-cleaving peptides suitable for inclusion in the recombinant gene constructs described herein are provided in Table 10 below.

[0138] Table 10: Suitable nucleotide sequences encoding self-cleaving peptides

[0139]

[0140] *See Wang et al., “2A Self-Cleaving Peptide-Based Multi-Gene Expression System in the Silkworm Bombyx mori”, Sci. Rep. 5:16273 (2015) and U.S. Patent Application Publication No. 2018 / 0369280, Schmitt et al., which are hereby incorporated in their entirety.

[0141] In some embodiments, the recombinant gene construct further includes an induced cell death gene located within the construct in a manner that effectively enables induced cell suicide. An induced cell death gene refers to a gene-encoded element that allows for the selective destruction of expressing cells by administration of an activating agent in the face of unacceptable toxicity.

[0142] Some cell death-inducing genes are well known in the art and are suitable for inclusion in the recombinant gene constructs described herein (see Stavrou et al., “ARapamycin-Activated Caspase 9-Based Suicide Gene”, Molecular Therapy 26(5):1266-1276 (2018), which is hereby incorporated by full reference). Exemplary suicide genes include, but are not limited to: RQR8 and huEGFRt, surface proteins recognized by therapeutic monoclonal antibodies (mAbs); herpes simplex virus thymidine kinase (HSV-TK), a cell death-inducing gene activated by the small molecule ganciclovir; inducible caspase 9 (iCasp9), a fusion of mutant FKBP12 with the catalytic domain of caspase 9, which allows docking of a dimerizing small molecule chemical inducer (CID, AP1903 / AP20187); and rapamycin-activated caspase 9 (rapaCasp9), a cell death-inducing gene activated by rapamycin (Stavrou et al., “A Rapamycin-Activated Caspase 9-Based Suicide Gene”, Molecular Therapy 26(5):1266-1276). (2018), which is hereby incorporated by full reference); and inducible caspase-3 (iCasp3), which is a fusion of a mutant FK506 binding domain with caspase-3, which allows docking of CID (AP20187) (Ono et al., “Exposure to Sequestered Self-Antigens invivo is not Sufficient for the Induction of Autoimmune Diabetes”, PLOS ONE 12(3): e0173176 (2017) and MacCorkle et al., “Synthetic Activation of Caspases: Artificial Death Switches”, PNAS 95(7):3655-3660 (1998), which is hereby incorporated by full reference).In another embodiment, the recombinant gene construct contains an induced cell death gene associated with the expression of cell division genes such as the cell division gene (CDK1) (Liang et al., “Linking a Cell-Division Gene and a Suicide Gene to Define and Improve Cell Therapy Safety”, Nature 563:701-704 (2018), which is hereby incorporated by reference in its entirety).

[0143] In some embodiments, the recombinant gene construct further includes a selection marker. Suitable selection markers for mammalian cells are known in the art and include, for example, thymidine kinase, dihydrofolate reductase (as a DHFR amplifying agent together with methotrexate), aminoglycoside phosphotransferase, hygromycin B phosphotransferase, asparagine synthase, adenosine deaminase, metallothionein, and antibiotic resistance genes, such as puromycin resistance genes or neomycin resistance genes. Exemplary antibiotic resistance gene sequences that can be used as selection markers in the recombinant gene constructs described herein are provided in Table 11 below.

[0144] Table 11: Suitable selection biomarker gene sequences

[0145]

[0146]

[0147] When a recombinant gene construct includes a mammalian selection marker, the selection marker can be operatively linked to a constitutive mammalian promoter.

[0148] Exemplary constitutive mammalian promoters suitable for inclusion in the recombinant constructs described herein are well known in the art and are shown in Table 12 below (Qin et al., “Systematic Comparison of Constitutive Promoters and the Doxycycline-Inducible Promoter”, PLOS ONE 5(5): e10611 (2010), which is hereby incorporated by reference in its entirety).

[0149] Table 12: Suitable promoter sequences

[0150]

[0151]

[0152]

[0153] *See Qin et al., “Systematic Comparison of Constitutive Promoters and the Doxycycline-Inducible Promoter”, PLOS ONE 5(5): e10611 (2010), which is hereby incorporated in full.

[0154] In some embodiments, the recombinant gene construct further encodes at least one biomarker domain. Non-limiting examples of biomarker domains include fluorescent proteins, purification tags, and epitope tags.

[0155] In some respects, the marker domain can be a fluorescent protein. Non-limiting examples of suitable fluorescent proteins include green fluorescent proteins (e.g., GFP, GFP-2, tagGFP, turboGFP, EGFP, Emerald, Azami Green, monomeric Azami Green, CopGFP, AceGFP, ZsGreenl), yellow fluorescent proteins (e.g., YFP, EYFP, Citrine, Venus, YPet, PhiYFP, ZsYellowl), blue fluorescent proteins (e.g., EBFP, EBFP2, Azurite, mKalamal, GFPuv, Sapphire, T-Sky Blue), and cyan fluorescent proteins (e.g., ECFP, Cerulean, CyPet, AmCyanl, Midoriishi-Cyan). (e.g., red fluorescent proteins (mKate, mKate2, mPlum, DsRed monomer, mCherry, mRFP1, DsRed-express, DsRed2, DsRed monomer, HcRed-Tandem, HcRedl, AsRed2, mRasberry, mStrawberry, Jred) and orange fluorescent proteins (e.g., mOrange, mKO, Kusabira-Orange, monomer Kusabira-Orange, mTangerine, tdTomato) or any other suitable fluorescent protein.

[0156] In other respects, the biomarker domain can be a purification tag and / or an epitope tag. Exemplary tags include, but are not limited to, glutathione S-transferase (GST), chitin-binding protein (CBP), maltose-binding protein, thioredoxin (TRX), poly(NANP), tandem affinity purification (TAP) tag, myc, AcV5, AU1, AU5, E, ECS, E2, FLAG, HA, nus, Softag 1, Softag 3, Strep, SBP, Glu-Glu, HSV, KT3, S, S1, T7, V5, VSV-G, 6xHis, biotinylate carboxyl carrier protein (BCCP), and calmodulin.

[0157] The marker domain can be operatively coupled to a constitutive mammalian promoter. For example, in some embodiments, the constitutive mammalian promoter is EF1a, and the marker domain is operatively coupled to EF1a. According to this embodiment, the marker domain may be CopGFP. Exemplary nucleotide sequences encoding suitable marker domain sequences are shown in Table 13 below.

[0158] Table 13: Suitable biomarker domain sequences

[0159]

[0160]

[0161] In some embodiments, the recombinant gene constructs of this disclosure are incorporated into a delivery vector. Suitable delivery vectors include, but are not limited to, plasmid vectors, viral vectors, including but not limited to vaccinia vectors, lentiviral vectors (with strong integration capacity or integration-deficient lentiviral vectors), adenovirus vectors, adeno-associated virus vectors, vectors for baculovirus expression, transposon-based vectors, or any other vector suitable for introducing the recombinant gene constructs described herein into cells by any means to promote gene / cell-selective expression of the recombinant constructs.

[0162] Another aspect of this disclosure relates to a formulation comprising one or more cells including the recombinant gene construct described herein. The formulation may be a cell formulation derived from any organism. In some embodiments, the formulation is a mammalian cell formulation, such as a formulation of rodent cells (i.e., mouse or rat cells), rabbit cells, guinea pig cells, cat cells, canine cells, pig cells, horse cells, bovine cells, sheep cells, monkey cells, or human cells. In one embodiment, the formulation is a human cell formulation.

[0163] In some embodiments, the formulation is a pluripotent stem cell formulation. Pluripotent stem cells can generate any cells from the three germ layers (i.e., endoderm, mesoderm, and ectoderm). In one embodiment, the cell formulation comprising a recombinant gene construct is an induced pluripotent stem cell (iPSC) formulation.

[0164] In another embodiment, the formulation comprising one or more cells may be a pluripotent stem cell formulation. Pluripotent stem cells can develop into a limited number of cells within a specific lineage. Examples of pluripotent stem cells include progenitor cells, such as neural progenitor cells, which generate cells of the central nervous system, such as neurons, astrocytes, and oligodendrocytes. Progenitor cells are immature or undifferentiated cell populations with the potential to mature and differentiate into more specialized differentiated cell types. Progenitor cells can also proliferate to generate more similarly immature or undifferentiated progenitor cells. Suitable formulations comprising progenitor cells of recombinant gene constructs include, but are not limited to, formulations of neural progenitor cells, neuronal progenitor cells, glial progenitor cells, oligodendrocyte-biased progenitor cells, and astrocyte-biased progenitor cells. Other suitable progenitor cell populations include, but are not limited to, bone marrow progenitor cells, cardiac progenitor cells, endothelial progenitor cells, epithelial progenitor cells, hematopoietic progenitor cells, liver progenitor cells, bone progenitor cells, muscle progenitor cells, pancreatic progenitor cells, lung progenitor cells, kidney progenitor cells, vascular progenitor cells, and retinal progenitor cells.

[0165] Cellular formulations including the recombinant gene constructs described herein can also be terminally differentiated cell formulations. In one embodiment, a formulation consisting of one or more cells can be a formulation of terminally differentiated neurons, oligodendrocytes, or astrocytes. In another embodiment, the formulation comprising one or more cells including the recombinant gene construct is a formulation comprising: adipocytes, chondrocytes, endothelial cells, epithelial cells (keratinized cells, melanocytes), osteoblasts (osteoblasts, osteoclasts), hepatocytes (choledochocytes, hepatocytes), muscle cells (cardiomyocytes, skeletal muscle cells, smooth muscle cells), retinal cells (ganglionic cells, Müller cells, photoreceptor cells), retinal pigment epithelial cells, kidney cells (podocytes, proximal tubule cells, collecting duct cells, distal tubule cells), adrenal cells (cortical adrenal cells, medullary adrenal cells), pancreatic cells (α cells, β cells, δ cells, ε cells, pancreatic polypeptide-producing cells, exocrine cells); lung cells, bone marrow cells (early B cell development, early T cell development, macrophages, monocytes), urothelial cells, fibroblasts, parathyroid cells, thyroid cells, hypothalamic cells, pituitary cells, salivary gland cells, ovarian cells, and testicular cells.

[0166] Other exemplary cell types that may include the recombinant gene constructs described herein include, but are not limited to, placental cells, keratinized cells, basal epithelial cells, urothelial cells, salivary gland cells, mucus cells, serous cells, von Ebner's gland cells, mammary gland cells, lacrimal gland cells, exocrine sweat gland cells, apocrine gland cells, MpH gland cells, sebaceous gland cells, Bowman's gland cells, Brunner's gland cells, seminal vesicle cells, prostate cells, bulbourethral gland cells, Bartholin's gland cells, Littre gland cells, endometrial cells, goblet cells of the respiratory or digestive tract, gastric mucus cells, zymogen cells of gastric glands, acid-secreting cells of gastric glands, insulin-producing P cells, glucagon-producing α cells, somatostatin-producing δ cells, pancreatic polypeptide-producing cells, pancreatic duct cells, and Paneth cells of the small intestine. Type II lung cells, Clara cells, anterior pituitary cells, middle pituitary cells, posterior pituitary cells, hormone-secreting cells of the intestine or respiratory tract, gonadal cells, glomerular cells of the kidney, dendritic cells of the kidney, peripolar cells of the kidney, mesangial cells, brush border cells of the intestine, ruffled duct cells of exocrine glands, gallbladder epithelial cells, brush border cells of the proximal tubules of the kidney, distal tubule cells of the kidney, conciliated cells of the ductulus efferens, chief cells of the epididymis, basal cells of the epididymis, hepatocytes, adipocytes, type I lung cells, pancreatic duct cells, non-ruffled cells of sweat glands, non-ruffled cells of salivary glands, non-ruffled cells of mammary glands, glomerular wall cells, glomerular podocytes, loops of Henry. Thin-segment cells of Henle, collecting duct cells, seminal vesicle duct cells, prostatic duct cells, vascular endothelial cells, synovial cells, serous membrane cells, squamous cells lining the external lymphatic space of the ear, cells lining the internal lymphatic space of the ear, choroid plexus cells, squamous cells of the pia mater arachnoid membrane, ciliary body epithelial cells of the eye, corneal endothelial cells, propulsive ciliary cells, ameloblasts, semilunar cells of the vestibular organ of the ear, interdental cells of the organ of Corti, fibroblasts, perivascular cells, nucleus pulposus cells of the intervertebral disc, cementoblasts, cementum cells, odontoblasts, odontocytes, chondrocytes, osteoblasts, osteoprogenitor cells, clear cells of the vitreous body of the eye, stellate cells of the external lymphatic space of the ear, skeletal muscle cells, cardiomyocytes, smooth muscle cells, myoepithelial cells, platelets, megakaryocytes, monocytes, connective tissue macrophages, Langerhans cells.Cells, osteoclasts, dendritic cells, microglia, neutrophils, eosinophils, basophils, mast cells, plasma cells, helper T cells, inhibitory T cells, cytotoxic T cells, cytotoxic cells, rod cells, cone cells, inner hair cells of the organ of Corti, outer hair cells of the organ of Corti, type I hair cells, vestibular organ cells, type II vestibular organ cells, type II taste bud cells, olfactory neurons, basal cells of the olfactory epithelium, type I carotid body cells, type II carotid body cells, Merkel cells, primary sensory neurons, cholinergic neurons of the autonomic nervous system, adrenergic neurons of the autonomic nervous system, peptidergic neurons of the autonomic nervous system, inner column cells of the organ of Corti, outer column cells of the organ of Corti, inner finger cells of the organ of Corti, outer finger cells of the organ of Corti, limbic cells, Hensen cells, supporting cells of the vestibular organ, supporting cells of the taste buds, supporting cells of the olfactory epithelium, Schwann cells. Cells, satellite cells, enteric glial cells, neurons of the central nervous system, astrocytes of the central nervous system, oligodendrocytes of the central nervous system, anterior lens epithelial cells, lens fiber cells, melanocytes, retinal pigment epithelial cells, iris pigment epithelial cells, oogonia, oocytes, spermatocytes, spermatogonia, ovarian cells, Sertoli cells, and thymic epithelial cells.

[0167] According to this aspect of the disclosure, a recombinant gene construct is integrated into the chromosome of one or more cells in the formulation. When used in the context of recombinant gene constructs of the present disclosure, the term "integration" means that the recombinant gene construct is inserted into the genome or genomic sequence of one or more cells in the formulation. When integrated, the integrated recombinant gene construct is replicated and delivered to daughter cells of the dividing cell in the same manner as the original genome of the cell.

[0168] According to the design of the recombinant gene construct, the genome integration of the construct targets a desired gene of interest to achieve cell-selective expression of one or more nucleotide sequences encoding immune checkpoint proteins and / or nucleotide sequences encoding one or more agents that reduce the expression of one or more HLA-I and / or HLA-II molecules. In some embodiments, the gene of interest is a gene that is restricted in expression in terminally differentiated cells. In some embodiments, the recombinant gene construct is integrated into genes selectively expressed in oligodendrocytes, such as SOX10, MYRF, MAG, or MBP. In some embodiments, the recombinant gene construct is integrated into genes selectively expressed in astrocytes, such as GFAP or AQP4. In some embodiments, the recombinant gene construct is integrated into genes selectively expressed in neurons, such as SYN1, MAP2, and ELAV4; genes selectively expressed in dopaminergic neurons, such as TH or DDC; genes selectively expressed in intermediate spinous and interneurons, such as GAD65 or GAD67; or genes selectively expressed in cholinergic neurons, such as CHAT. According to these embodiments, one or more nucleotide sequences encoding immune checkpoint proteins and / or nucleotide sequences encoding one or more agents that reduce the expression of one or more HLA-I and HLA-II molecules are conditionally expressed (i.e., transcribed and / or translated) in terminally differentiated cells. Expression of the recombinant gene construct described herein in a formulation of terminally differentiated cells makes these cells less susceptible to attack by immune cells in the in vivo environment. Therefore, when cells comprising the recombinant gene construct are transplanted into a host subject, as described in more detail below, the cells are protected from attack by the host immune system in their differentiated state because they express one or more immune checkpoint proteins and / or express one or more agents that inhibit one or more HLA-I / HLA-II proteins.

[0169] Another aspect of this disclosure relates to a method for administering a cell preparation comprising the recombinant gene construct described herein to a subject in need.

[0170] As used herein, the term "subject" or "patient" suitable for administering a cell preparation comprising the recombinant gene construct described herein encompasses any animal, preferably a mammal. Suitable subjects include, but are not limited to, domesticated and non-domesticated animals such as rodents (mice or rats), cats, dogs, rabbits, horses, sheep, pigs, and monkeys. In one embodiment, the subject is a human subject. Suitable human subjects include, but are not limited to, infants, children, adults, and elderly subjects.

[0171] In one embodiment, the subject requires a terminally differentiated cell type. For example, the subject suffers from symptoms mediated by loss or dysfunction of a differentiated cell population. Therefore, a cell preparation comprising a recombinant gene construct is administered to the subject in an amount sufficient to restore normal levels and / or function of the differentiated cell population in the selected subject, thereby treating the symptoms. In some embodiments, the cell preparation comprising a recombinant gene construct administered to the subject is a preparation of a differentiated cell population that has been lost or is dysfunctional in the subject. In another embodiment, the cell preparation comprising a recombinant gene construct administered to the subject is a preparation of precursor cells or progenitor cells of a differentiated cell population. According to this embodiment, the precursor cells or progenitor cells comprising the recombinant gene construct mature or differentiate into the desired differentiated cell population after administration to the subject in need.

[0172] When performing the methods of this disclosure, "treating" includes suppressing, preventing, improving, or delaying the onset of a particular symptom. Treatment also covers any improvement in one or more symptoms of the symptom or condition. Treatment encompasses any alteration in the progression of the symptom or condition compared to the symptom or condition in the absence of therapeutic intervention.

[0173] In some embodiments, the administration effectively reduces at least one symptom of a disease or condition associated with loss or dysfunction of differentiated cell types. In another embodiment, the administration effectively mediates improvement in a disease or condition associated with loss or dysfunction of differentiated cell types. In yet another embodiment, the administration effectively prolongs the survival of the subject compared to the expected survival without administration.

[0174] According to this aspect of the disclosure, a formulation comprising one or more cells including a recombinant gene construct may be autologous / autogenetic (“autologous”) for the recipient subject. In another embodiment, a cell formulation comprising a recombinant gene construct may be non-autologous (“non-autologous”), such as allogeneic, syngeneic, or allogeneic, for the recipient subject.

[0175] When performing the methods of this disclosure, the administration can be performed in the absence of immunosuppression or an improved course of immunosuppressive therapy. For example, in one embodiment, the administration can be performed after an initial course of immunosuppressive therapy, but long-term immunosuppressive therapy is not required.

[0176] In one embodiment, a method of treating a subject requiring the cell preparation described herein involves treating a subject suffering from a condition mediated by oligodendrocyte loss or dysfunction or myelin loss or dysfunction, wherein myelin is produced by oligodendrocytes. This method involves administering to the subject a cell preparation comprising the recombinant gene construct described herein, wherein the cell preparation is a preparation of glial progenitor cells or oligodendrocyte-biased progenitor cells. According to this method, the cells are administered in an amount sufficient to treat the condition, effectively treating the condition mediated by oligodendrocyte loss or dysfunction or myelin loss or dysfunction.

[0177] Oligodendrocytes produce myelin, which is the insulating sheath required for the hopping conduction of electrical impulses along axons (Goldman et al., “How to Make an Oligodendrocyte”, Development 142(23):3983-3985 (2015), which is hereby incorporated by reference in its entirety). As described herein, the loss of oligodendrocytes leads to demyelination, resulting in neurological impairment in a wide range of diseases, from childhood leukodystrophy and cerebral palsy to multiple sclerosis and leukoencephalopathy.

[0178] Conditions mediated by myelin loss or oligodendrocyte loss or dysfunction, treatable according to the methods described herein and cell preparations including the recombinant gene constructs described herein, include hypomyelinization and demyelinization conditions. In one embodiment, the condition is an autoimmune demyelinization condition, such as multiple sclerosis, Schilder's disease, neuromyelitis optica, transverse myelitis, and optic neuritis. In another embodiment, the myelin-related condition is a vascular leukoencephalopathy, such as subcortical stroke, diabetic leukoencephalopathy, hypertensive leukoencephalopathy, age-related white matter disorders, and spinal cord injury. In yet another embodiment, the myelin-related condition is radiation-induced demyelinization. In another embodiment, myelin-related disorders are pediatric leukodystrophy, such as Pelizaeus-Merzbacher disease, Tay-Sach disease, Sandhoff's gangliosidoses, Krabbe's disease, metachromatic leukodystrophy, mucopolysaccharidosis (e.g., Sly's disease), Niemann-Pick A disease, adrenoleukodystrophy, Canavan's disease, leukopenia, and Alexander disease. In yet another embodiment, myelin-related symptoms are periventricular leukomalacia or cerebral palsy.

[0179] Methods for generating glial progenitor cells or oligodendrocyte-biased progenitor cells suitable for treating subjects with conditions mediated by loss or dysfunction of oligodendrocytes or myelin are known in the art, see, for example, U.S. Patent No. 9,790,553, No. 10,190,095, and U.S. Patent Publication No. 2015 / 0352154, all of which are hereby incorporated by reference in their entirety. These cells may be modified according to this disclosure at any point prior to transplantation to include a recombinant gene vector. For example, in one embodiment, the recombinant gene construct is introduced into glial progenitor cells or oligodendrocyte-biased progenitor cells just prior to transplantation. In another embodiment, the recombinant gene construct is introduced into precursor cells of glial progenitor cells or oligodendrocyte-biased progenitor cells, such as neural progenitor cells or pluripotent stem cells.

[0180] In another embodiment, a method for treating a subject requiring the cell preparation described herein involves treating a condition mediated by astrocyte loss or dysfunction. This method involves administering to the subject a cell preparation comprising the recombinant gene construct described herein, wherein the cell preparation is a preparation of glial progenitor cells or astrocyte-biased progenitor cells. The cells are administered in an amount sufficient to treat the condition, in a manner effective in treating the condition mediated by astrocyte loss or dysfunction.

[0181] As mentioned above, astrocytes are the largest and most prevalent type of glial cell in the central nervous system. Astrocytes contribute to the formation of the blood-brain barrier, participate in maintaining extracellular ion and chemical homeostasis, participate in the response to injury, and influence neuronal development and plasticity.

[0182] Therefore, in some embodiments, the symptoms mediated by astrocyte loss or dysfunction are neurodegenerative conditions. Neurodegenerative diseases associated with astrocyte loss that can be treated according to the methods and cell preparations disclosed herein include, but are not limited to, Parkinson's disease (PD), Alzheimer's disease (AD) and other dementias, degenerative neurological diseases, encephalitis, epilepsy, hereditary brain disorders, head and brain malformations, hydrocephalus, multiple sclerosis, amyotrophic lateral sclerosis (ALS or Lou Gehrig's disease), Huntington's disease (HD), prions, frontotemporal dementia, Lewy body dementia, progressive supranuclear palsy, corticobasal degeneration, multiple system atrophy, hereditary spastic paraplegia, spinocerebellar atrophy, amyloidosis, motor neuron disease (MND), spinocerebellar ataxia (SCA), stroke, and spinal muscular atrophy (SMA).

[0183] Methods for generating glial progenitor cells or astrocyte-biased progenitor cells suitable for treating subjects with conditions mediated by astrocyte loss or dysfunction are known in the art, see, for example, U.S. Patent Application Publication No. 2015 / 0352154 by Goldman et al., which is hereby incorporated by reference in its entirety. These cells may be modified according to this disclosure to include a recombinant gene vector at any point prior to transplantation into the subject in need. For example, in one embodiment, the recombinant gene construct is introduced into glial progenitor cells or astrocyte-biased progenitor cells just prior to transplantation. In another embodiment, the recombinant gene construct is introduced into precursor cells of glial progenitor cells or astrocyte-biased progenitor cells, such as neural progenitor cells or pluripotent stem cells.

[0184] In another embodiment, a method for treating a subject requiring the cellular preparation described herein involves treating a condition mediated by neuronal loss or dysfunction. This method involves administering to the subject a cellular preparation comprising the recombinant gene construct described herein, wherein the cellular preparation is a preparation of neuronal progenitor cells. The cells are administered in an amount sufficient to treat the condition, in a manner effective in treating the neuronal loss or dysfunction.

[0185] According to this embodiment, the symptom to be treated can be a symptom mediated by the loss or dysfunction of a specific type of neuron. For example, in one embodiment, the symptom to be treated is a symptom mediated by the loss or dysfunction of cholinergic neurons. Exemplary symptom mediated by the loss or dysfunction of cholinergic neurons include Alzheimer's disease, corticobasal degeneration, Lewy body dementia, frontotemporal dementia, multiple system atrophy, Parkinson's disease, Parkinson's dementia, and progressive supranuclear palsy (Roy et al., "Cholinergic Imaging in Dementia Spectrum Disorders", Eur. J. Nucl. Med. Mol. Imaging. 43:1376-1386 (2016), which is hereby incorporated by reference in its entirety).

[0186] In another embodiment, the condition to be treated is a condition mediated by the loss or dysfunction of dopaminergic neurons. Exemplary conditions mediated by the loss or dysfunction of dopaminergic neurons include Parkinson's disease, Parkinson's-like conditions (e.g., juvenile Parkinson's disease, Ramsey-Hunt paralysis syndrome), and mental illnesses (e.g., schizophrenia, depression, substance addiction).

[0187] In another embodiment, the symptom to be treated is a symptom mediated by the loss or dysfunction of intermediate spinous neurons and / or cortical interneurons. Exemplary symptom mediated by the loss or dysfunction of intermediate spinous neurons and / or cortical interneurons include Huntington's disease, epilepsy, anxiety disorders, and depression (Powell et al., "Genetic Disruption of Cortical Interneuron Development Causes Region- and GABA CellType-Specific Deficits, Epilepsy, and Behavioral Dysfunction", J. Neurosci. 23(2):622-631 (2003), which is hereby incorporated by reference in its entirety).

[0188] Methods for generating neuronal progenitor cells suitable for treating subjects with symptoms mediated by neuronal loss or dysfunction are known in the art; see, for example, Goldman, SA1., “Transplanted Neural Progenitors Bridge Gaps to Benefit Cord-Injured Monkeys”, *Nature Medicine* 24(4):388-390 (2018); Roy et al., “Functional Engraftment of Human ES Cell-Derived Dopaminergic Neurons Enriched by Coculture with Telomerase-Immortalized Midbrain Astrocytes”, *Nature Medicine* 12(11):1259-1268 (2006); Nunes et al., "Identification and Isolation of Multipotential Neural Progenitor Cells from the Subcortical White Matter of the Adult Human Brain", *Nature Medicine* 9(4):439-447 (2003), U.S. Patent Nos. 6,812,027, 7,150,989, 7,468,277, 7,785,882, 8,263,406, 8,642,332, and 8,945,921, hereinafter referred to in its entirety. These cells may be modified, according to this disclosure, at any point prior to transplantation into a recipient. For example, in one embodiment, the recombinant gene construct is introduced into neuronal progenitor cells just before transplantation. In another embodiment, the recombinant gene construct is introduced into precursor cells of neuronal progenitor cells, such as neural progenitor cells or pluripotent stem cells.

[0189] In carrying out the methods of the present invention involving cell replacement in the central nervous system, the cell preparations described herein may be administered systemically into circulation or directly to one or more sites of the brain, brainstem, spinal cord, or combinations thereof.

[0190] When a cell preparation is injected systemically into the circulation, it can be placed in a syringe, cannula, or other injection device for precise placement at a pre-selected site. The term "injectable" means that the cell preparation can be dispensed from a syringe under normal conditions and at atmospheric pressure.

[0191] Methods for directly administering (i.e., transplanting) various neural tissues / cells into the host brain are well known in the art. In some embodiments, the preparation is administered intraventricularly, intracalcaneally, or intraparenchymalally.

[0192] Intraparenchymal administration, i.e., administration within the host brain (as opposed to extracerebral or extraparenchymal transplantation), is achieved by injecting or depositing cells within the brain parenchyma at the time of administration. Intraparenchymal transplantation can be performed using two methods: (i) injecting the cell preparation into the host brain parenchyma; or (ii) surgically creating a cavity to expose the host brain parenchyma and then depositing the cell preparation into the cavity. Both methods provide parenchymal deposition of the cell preparation between the cell preparation and the host brain tissue at the time of administration and both promote anatomical integration between the graft (i.e., the cell preparation) and the host brain tissue.

[0193] Alternatively, the cell graft can be placed in a ventricle, such as within the ventricle or subdurally, i.e., on the surface of the host brain, where it is separated from the host brain parenchyma by an intermediate pia mater or arachnoid mater. Transplantation into the ventricle can be accomplished by injecting donor cells or by allowing the cells to grow in a matrix such as 3% collagen to form a solid tissue plug, which can then be implanted into the ventricle to prevent graft dislocation. For subdural transplantation, cells can be injected around the surface of the brain after an incision is made in the dura mater.

[0194] To create a graft cavity (which may be preferred for spinal cord transplantation), tissue is removed from an area near the outer surface of the CNS by removing the bone covering the brain and using a material such as gelatin sponge to achieve hemostasis. Aspiration can be used to create the cavity. The cell preparation is then placed in the cavity. More than one cell preparation may be placed in the same cavity. In some embodiments, the implantation site is determined by the CNS condition being treated.

[0195] Injections can be administered to selected areas of the host brain by drilling and puncturing the dura mater to allow insertion of a microinjector needle. The microinjector is preferably mounted in a stereotactic frame, and three-dimensional stereotactic coordinates are selected to position the needle at the desired location in the brain or spinal cord. The cells can also be introduced into the putamen, basal ganglia, hippocampal cortex, striatum, substantia nigra, or caudate region of the brain, as well as the spinal cord.

[0196] The number of cells in a given volume can be determined using well-known routine procedures and instruments. The percentage of cells in a given volume of cell mixture can be determined using almost the same procedures. Cells can be counted easily, either manually or using an automated cell counter. Specific cells in a given volume can be determined using specific staining and visual inspection, as well as automated methods using specific binding reagents (typically antibodies, fluorescent tags) and fluorescence-activated cell sorters.

[0197] Taking into account factors such as the patient's age, sex, weight, and condition, as well as the formulation to be administered, cell preparations can be administered in doses and using techniques well known to those skilled in the medical and veterinary fields. The appropriate doses for use according to the various embodiments described herein will depend on many factors. The doses may vary considerably depending on the specific circumstances. Parameters for determining the optimal doses for primary and adjuvant therapy administration will generally include some or all of the following: the disease being treated and its stage; the subject's species, health status, sex, age, and weight; the subject's immune capacity; other therapies being administered; and potential complications anticipated based on the subject's medical history or genotype. These parameters may also include: whether the cells are syngeneic, autologous, allogeneic, or allogeneic; the cell potency (specific activity); the sites and / or distribution that must be targeted for cell / culture medium effectiveness; and characteristics of said sites such as cell / culture medium accessibility and / or cell implantation. Additional parameters include co-administration with other factors such as growth factors and cytokines. The optimal dose under given conditions will also take into account the preparation method of the cells / culture medium, the method of application of the cells / culture medium, and the extent to which the cells / culture medium are localized at the target site after application. Finally, the determination of the optimal dose will necessarily provide an effective dose that is neither below the threshold of maximum beneficial effect nor above the threshold of adverse effects associated with the dose exceeding the increased benefit.

[0198] For fairly pure cell preparations, the optimal dosage range in the various examples is approximately 10 mg per application. 4 To about 10 9 Cells. In some embodiments, the optimal dose per application will be between approximately 10 5 To about 10 7 Between cells. In many embodiments, the optimal dose per application will be approximately 5 × 10⁻⁶ cells.5 To approximately 5 × 10 6 Each cell.

[0199] It should be understood that a single dose can be delivered once, in multiple doses, or continuously over a period of time. Alternatively, the entire dose can be delivered to a single location or distributed in multiple doses at several locations.

[0200] Treatment duration in human subjects is typically longer than in laboratory animals; however, treatment duration is generally proportional to the duration of the disease course and the effectiveness of the treatment. This will be taken into account by those skilled in the art when determining appropriate human dosages using the results of other procedures performed in humans and / or in animals such as rats, mice, and non-human primates. Based on these considerations and taking into account the guidance provided by this disclosure and the prior art, such determinations will enable those skilled in the art to do so without excessive experimentation.

[0201] Suitable regimens for initial administration and subsequent dose or sequence administration may be identical or may be variable. Those skilled in the art can determine suitable regimens based on this disclosure, the documents referenced herein, and their knowledge in the art.

[0202] In some embodiments, the cell preparation is administered to the subject at a single dose. In other embodiments, the cell preparation is administered to the subject in a series of two or more consecutive doses. In some other embodiments where the cell preparation is administered at a single dose, at two doses, and / or more than two doses, the doses may be the same or different, and the doses may be administered at equal or unequal intervals.

[0203] Cellular preparations can be administered at various frequencies over a wide timeframe. In some embodiments, the cellular preparation is administered over a period of less than one day. In other embodiments, the cellular preparation is administered over two, three, four, five, or six days. In some embodiments, the cellular preparation is administered once or more weekly over a period of several weeks. In other embodiments, the cellular preparation is administered over a period of several weeks, lasting from one month to several months. In various embodiments, the cellular preparation can be administered over a period of several months. In other embodiments, the cellular preparation can be administered over a period of one year or more. Generally, the duration of treatment will be proportional to the duration of the disease course, the effectiveness of the therapy applied, and the condition and response of the treated subject.

[0204] The selection of a formulation for a given application will depend on a number of factors. Prominent factors will include the species of the subject, the nature of the condition being treated, the dysfunction or disease and its status and distribution in the subject, the nature of other therapies and agents being administered, the optimal route of administration, survival via said route, the dosing regimen, and other factors that will be apparent to those skilled in the art. Specifically, for example, the selection of a suitable carrier and other additives will depend on the exact route of administration and the nature of the specific dosage form.

[0205] For example, cell survival can be a crucial determinant of the efficacy of cell-based therapies. This is true for both primary and adjuvant therapies. Another problem arises when the target site is unsuitable for cell inoculation and growth. This can hinder the entry of therapeutic cells into and / or implantation at the site. Therefore, measures can be taken to improve cell survival and / or overcome problems caused by inoculation and / or growth barriers.

[0206] The final formulation may include an aqueous suspension of cells / culture medium and optionally proteins and / or small molecules, and will typically involve adjusting the ionic strength of the suspension to isotonicity (i.e., about 0.1 to 0.2) and physiological pH (i.e., about pH 6.8 to 7.5). The final formulation will also typically contain a fluid lubricant, such as maltose, which must be tolerable to the body. Exemplary lubricant components include glycerol, glycogen, maltose, etc. Organic polymer base materials such as polyethylene glycol and hyaluronic acid, as well as non-fibrous collagens such as succinylated collagen, can also act as lubricants. Such lubricants are typically used to improve the injectability, invasiveness, and dispersibility of injectable materials at the injection site and to reduce incorporation by altering the viscosity of the composition. By definition, this final formulation is the cells described herein in a pharmaceutically acceptable carrier.

[0207] Multiple cell preparations can be administered simultaneously at different sites, such as a combination of intrathecal and intravenous administration, to maximize the chance of targeting the affected area.

[0208] Another aspect relates to a formulation comprising one or more cells, wherein the cells of the formulation are modified to conditionally express increased levels of one or more immune checkpoint proteins compared to corresponding wild-type cells. In one embodiment, the cells of the formulation are further modified to conditionally express decreased levels of one or more endogenous HLA-I proteins compared to corresponding wild-type cells. In some embodiments, the cells of the formulation are further modified to conditionally express decreased levels of one or more HLA-II proteins compared to corresponding wild-type cells.

[0209] Another aspect relates to a formulation comprising one or more cells, wherein the cells of the formulation are modified to conditionally express reduced levels of one or more endogenous HLA-I proteins compared to corresponding wild-type cells. In some embodiments, the cells of the formulation are further modified to conditionally express reduced levels of one or more HLA-II proteins compared to corresponding wild-type cells.

[0210] Exemplary immune checkpoint proteins conditionally expressed in the modified cells of the formulation have been described in detail above and include, for example, programmed death-ligand 1 (PD-L1), programmed death-ligand 2 (PD-L2), CD47, HLA-E, CD200, and CTLA-4.

[0211] Similarly, exemplary HLA-I proteins with conditionally reduced expression in modified cells of the formulation, as described above, include one or more of, for example, HLA-A, HLA-B, HLA-C, HLA-E, HLA-F, HLA-G, and combinations thereof. Exemplary HLA-II proteins with conditionally reduced expression in modified cells of the formulation include any one or more of, HLA-DM, HLA-DO, HLA-DP, HLA-DQ, and HLA-DR.

[0212] Another aspect of this disclosure relates to a method for generating cells with conditional immune protection. This method involves modifying cells to: (i) conditionally express increased levels of one or more immune checkpoint proteins; or (ii) conditionally express one or more agents that reduce the surface expression of one or more endogenous HLA-proteins. In another embodiment, the method involves modifying cells to: (i) conditionally express increased levels of one or more immune checkpoint proteins; and (ii) conditionally express one or more agents that reduce the surface expression of one or more endogenous HLA-proteins.

[0213] According to this aspect of the disclosure, conditional expression of one or more immune checkpoint proteins and / or conditional expression of one or more agents that reduce the expression of one or more endogenous HLA proteins are operatively linked to the expression of a gene restricted in terminally differentiated cells. Suitable terminally differentiated cells and genes selectively expressed therein have been described in detail above.

[0214] Cells modified according to this aspect of the disclosure may include cells from any organism. In some embodiments, the formulation is a mammalian cell formulation, such as a formulation of rodent cells (i.e., mouse or rat cells), rabbit cells, guinea pig cells, cat cells, canine cells, pig cells, horse cells, bovine cells, sheep cells, monkey cells, or human cells.

[0215] In some embodiments, modifying the cell of interest involves introducing a sequence-specific nuclease into the cell that cleaves the gene at or within the 3' UTR of the target gene or just upstream of the 3' UTR. As described in detail above, a suitable target gene is a gene that is selectively or restrictively expressed in a cell-specific manner. Once the target gene is cleaved by the sequence-specific nuclease, the method further involves introducing, for example, any of the recombinant gene constructs described herein into the target gene via homologous recombination.

[0216] Suitable sequence-specific nucleases for cleaving target genes to introduce recombinant gene constructs include, but are not limited to, zinc finger nucleases (ZFNs), transcription activator-like effector nucleases (TALENs), and RNA-guided nucleases. In some embodiments, the sequence-specific nuclease is introduced into the cell in the form of a protein, mRNA, or cDNA.

[0217] Zinc finger nucleases (ZFNs) are engineered DNA-binding proteins that facilitate targeted DNA editing by introducing double-strand DNA breaks in a sequence-specific manner. Each ZFN comprises two functional domains: a DNA-binding domain consisting of strands of bifingered modules that each recognize a unique DNA hexameric sequence, and a DNA-cutting domain consisting of the nuclease domain of Fok I. ZFNs suitable for targeting and cleaving the target genes described herein to facilitate the insertion of recombinant gene constructs are known in the art, see, for example, U.S. Patent No. 8,106,255 to Carroll et al., U.S. Patent No. 9,428,756 to Cai et al., U.S. Patent Publication No. 20110281306 to Soo and Joo; and U.S. Patent Publication No. 20050130304 to Cox et al., all of which are hereby incorporated by reference in their entirety.

[0218] In another embodiment, DNA editing mediated by a transcription activator effector nuclease (TALEN) is used to introduce the recombinant gene construct described herein into a target gene of interest. The functional TALEN consists of a DNA-binding domain derived from a transcription activator effector (TALE) protein and a nuclease catalytic domain derived from the DNA nuclease FokI. The DNA-binding domain of the TALE is characterized by an array of 33-34 amino acid repeat sequences. Each repeat sequence is conserved except for repeat sequence variable two residues (RVDs) at amino acid positions 12 and 13 that determine which nucleotide of the target DNA sequence each repeat sequence recognizes. Methods for customizing TALE proteins to bind to target sites using typical or atypical RVDs within repeat sequence units are known in the art and suitable for use according to this disclosure (see, for example, U.S. Patent Nos. 8,586,526 and 9,458,205 to Philip et al., which are hereby incorporated by reference in their entirety). Similarly, methods for using TALEN for gene editing according to this disclosure are also known in the art, see, for example, U.S. Patent No. 9,393,257 to Osborn et al., which is hereby incorporated by reference in its entirety.

[0219] In another embodiment, the sequence-specific nuclease used to introduce the recombinant gene construct described herein into the target gene of interest is an RNA-guided nuclease in the form of Cas9. Cas9 is a CRISPR-associated protein containing two nuclease domains that, when complexed with CRISPR RNA (cRNA) and transactivating rRNA, enable site-specific DNA recognition and double-strand cleavage. CRISPR-Cas9 systems and methods suitable for use in gene editing according to this disclosure are well known in the art; see, for example, Jinek, M. et al., “Programmable Dual-RNA-Guided DNA Endonuclease in Adaptive Bacterial Immunity”, Science 337:816-821 (2012); Doench et al., “Rational Design of Highly Active sgRNA for CRISPR-mediated Gene Inactivation”, Nature Biotechnol. 32(12): 1262-7 U.S. Patent No. 9,970,001 to Miller (2014); U.S. Patent Publication No. 20180282762 to Gori et al.; and U.S. Patent Publication No. 20160201089 to Gersbach et al., all of which are hereby incorporated by reference in their entirety.

[0220] Example

[0221] The following examples are provided to illustrate embodiments of the invention, but these examples are in no way intended to limit the scope of the invention.

[0222] Example 1 - Recombinant gene knock-in construct for targeted expression in terminally differentiated cells

[0223] The design of various recombinant gene constructs, including immunosuppressive protein knock-in vectors targeting cell-specific genes (e.g., MYRF, SYN1, or GFAP), is underway. Figure 1-14 As shown in the image.

[0224] Figure 1A general design for a recombinant gene construct is shown, the recombinant gene construct comprising: a first gene sequence expressed in a cell type-specific manner (i.e., a 5' homologous arm); a nucleotide sequence encoding a self-cleaving peptide (e.g., P2a); a first nucleotide sequence encoding one or more immunosuppressive proteins (e.g., HLA-E / syB2M, CD47, or PD-L1); a stop codon; a second nucleotide sequence (i.e., shRNA) encoding one or more agents that reduce the surface expression of one or more endogenous HLA-I molecules; a selection marker; and a second gene sequence expressed in a cell type-specific manner (i.e., a 3' homologous arm).

[0225] Figure 2-4 A general design of a knock-in vector including a 5' homologous arm and a 3' homologous arm is shown. The knock-in vector encodes an immunosuppressive protein, HLA-E / syB2M (…). Figure 2 CD47 Figure 3 ) or PD-L1 ( Figure 4 ); self-cleaving peptide (P2a); HLA-E / syB2M; anti-B2M shRNA; anti-CIITA shRNA; and puromycin. Expression of puromycin was operatively linked to the EF1a promoter for constitutive expression in mammalian cells.

[0226] Figure 5 It is a matrix that shows combinations of various target cells and protective signals (i.e., immunosuppressive proteins or their peptides).

[0227] Figure 6-8 This illustrates a general exemplary design of a knock-in vector targeting the SYN1 locus to achieve neuron-specific expression. Each SYN1-targeting knock-in vector includes a 5' homologous arm and a 3' homologous arm and encodes an immunosuppressive protein, namely HLA-E / syB2M. Figure 6 CD47 Figure 7 ) or PD-L1 (Figure 8); self-cleaving peptide (P2a); HLA-E / syB2M; anti-B2M shRNA; anti-CIITA shRNA; and puromycin. The expression of puromycin was operatively linked to the EF1a promoter for constitutive expression in mammalian cells.

[0228] Figure 9-11 This illustrates the general design of knock-in vectors targeting the MYRF locus to achieve oligodendrocyte-specific expression. Each MYRF-targeting knock-in vector comprises a 5' homologous arm and a 3' homologous arm and encodes an immunosuppressive protein, HLA-E / syB2M. Figure 9 CD47 Figure 10 ) or PD-L1 ( Figure 11); self-cleaving peptide (P2a); HLA-E / syB2M; anti-B2M shRNA; anti-CIITA shRNA; and puromycin. Expression of puromycin was operatively linked to the EF1a promoter for constitutive expression in mammalian cells.

[0229] Figure 12-14 The general design of a knock-in vector targeting the GFAP locus to achieve astrocyte-specific expression is shown. Each GFAP-targeting knock-in vector includes a 5' homologous arm and a 3' homologous arm and encodes an immunosuppressive protein, namely HLA-E / syB2M. Figure 12 CD47 Figure 13 ) or PD-L1 ( Figure 14 ); self-cleaving peptide (P2a); HLA-E / syB2M; anti-B2M shRNA; anti-CIITA shRNA; and puromycin. Expression of puromycin was operatively linked to the EF1a promoter for constitutive expression in mammalian cells.

[0230] Predictive Example 2 - Generating a recombinant gene knock-in construct expressing CD47 cDNA with a target sequence targeting the MYRF locus.

[0231] A schematic diagram of the recombinant gene construct, including a CD47 knock-in vector targeting the MYRF locus, is shown in [the diagram]. Figure 15 As shown in the figure. The recombinant gene construct includes: a 5' homologous arm (HAL); a nucleotide sequence encoding a self-cleaving peptide (P2A); a first nucleotide sequence encoding CD47; a second nucleotide sequence encoding anti-β2M shRNA; a third nucleotide sequence encoding anti-CIITA shRNA; a nucleotide sequence encoding GFP operatively linked to the EF1a promoter; and a 3' homologous arm (HAR). Figure 15 The recombinant gene construct will be generated in the following manner.

[0232] β2-microglobulin and CIITA knockdown

[0233] shRNAs for β2M and CIITA will be generated using an online tool, such as the iRNA designer from Thermo Fisher Scientific. The shRNAs will be inserted downstream of the puromycin gene in the lentiviral vector pTANK-EF1a-copGFP-Puro-WPRE. Viral particles pseudotyped with the vesicular stomatitis virus G glycoprotein will be generated, concentrated by ultracentrifugation, and titrated on 293 HEK cells.

[0234] HAD100-derived hGPCs will be transduced with lentiviruses carrying shRNAs for β2M or CIITA (MOI = 1). Knockdown efficiency will be assessed by qPCR. shRNAs with knockdown efficiency >80% will be further validated by expression of the corresponding proteins and by immunostaining and Western blotting.

[0235] sgRNA design and CRSPR / Cas9 vector construct

[0236] The CRISPR / Cas9 design tool developed by Zhang's lab at MIT (crispr.mit.edu) will be used to design single guide RNAs to allow for double cleavage. The sgRNA will be selected from the coding sequence just before the codon termination (e.g., TCAGGCCAACTGCAGTTCAGAGG (SEQ ID NO: 45)). The sgRNA will be validated by transfecting HEK-29 cells using the Surveyor Mutation Detection Kit (IDT Inc.).

[0237] Cloning of homologous arms

[0238] Genomic DNA will be extracted from cells using the DNeasy Blood and Tissue Kit (QIAGEN) according to the manufacturer's instructions. Homologous arms (primers TBD) will be amplified from the genomic DNA of the HAD100 cell line using an AmpliTaq Gold 360 (Thermo Fisher Scientific). Both homologous arms will be subcloned into pCR2.1-TOPO and sequence verified. The left homologous arm (HAL) will include the last exon of the target gene.

[0239] hESC transfection and selection

[0240] The endotoxin-free Maxi-prep kit (Qiagen) will be used to amplify the knock-in and sgRNA-CRIPR / Cas9 plasmids. Both plasmids (3 µg each) will be transfected into hESCs (800,000 cells) using an Amaxa 4D-Nucleofector (Lonza; procedure CA-137 according to manufacturer's instructions). Twenty-four hours after electroporation, cells will be grown in medium containing puromycin (1 μg / mL).

[0241] Individual colonies will be isolated and amplified. Transgenic clones will be verified by PCR to confirm the correct integration of the knock-in cassette and the deletion of the sgRNA-CRISPR / Cas9 plasmid.

[0242] Suitable sequences for generating recombinant gene knock-in constructs with target sequences targeting the MYRF locus that express CD47 cDNA are shown in Table 14 below.

[0243] Table 14: Exemplary sequences of recombinant gene knock-in constructs with target sequences targeting the MYRF locus for expressing CD47 cDNA

[0244]

[0245]

[0246]

[0247] Example 3 - Human U251 glioma cells expressing PD-L1 and CD47 preferentially expand and persist in immune-humanized hosts.

[0248] Materials and Methods:

[0249] Construction of targeting plasmids: Targeting vectors were generated using PCR-produced inserts and basic molecular cloning techniques. The coding sequences for human PD-L1 (NCBI reference sequence: NM_014143.4, hereby incorporated in full), human CD47 (NCBI reference sequence: NM_001777.3, hereby incorporated in full), or EGFP were cloned immediately downstream of the internal ribosome entry site (IRES) in pIRES-hPGK-Puro-WPRE-BGHpa. Two shRNAs targeting CIITA and B2M were also cloned immediately following PDL1 or CD47 (Table 15).

[0250] Table 15: shRNA sequences

[0251]

[0252] The homologous arms overlapping the last coding exon were cloned from HEK293 cell genomic DNA. The left homologous arm consists of 842 bp (NCBI reference sequence: NC_000004.12 (spanning 54294436 - 54295277), which is hereby incorporated in full), while the right homologous arm consists of 875 bp (NCBI reference sequence: NC_000004.12 (spanning 54295286 - 54296160), which is hereby incorporated in full).

[0253] The sgRNA (5'-CTG TAA CTG GCG GAT TCG AGG-3'; SEQ ID NO: 56) was cloned downstream of the U6 promoter of pU6-PDGFRA2-CBh-Cas9-T2A-mCherry (Addgene plasmid #64324) and validated in HEK293 cells using the Surveyor nuclease assay (Surveyor Mutation Detection Kit, IDT).

[0254] Cell transfection and selection. U251 human glioblastoma cells were maintained at 37°C and 5% CO2 in Durbecco's modified Eagle's medium (DMEM; Invitrogen, Carlsbad, CA, USA) supplemented with 10% heat-inactivated fetal bovine serum (FBS) and 1% penicillin-streptomycin (100 units / mL penicillin and 100 μg / mL streptomycin).

[0255] Using 4D Nucleofector TM (Lonza) Using the SE cell line 4D-Nucleofector™ X transfection kit, following the DS-126 protocol and the manufacturer's instructions, U251 cells (5 × 10⁶ cells) were transfected with a 2 µg DNA mixture (1:1 ratio) of targeting plasmid and sgRNA / Cas9 plasmid. 5 Three days after transfection, cells were passaged and cultured in medium containing puromycin (1.5 µg / ml; Sigma) for selection. Individual clones were amplified and genotyped to ensure proper integration, transgene integrity, and the absence of donor bacterial plasmids.

[0256] Selected clones were transduced using a lentivirus expressing luciferase (pTANK-CMV-luciferase-IRES-mCherry-WPRE; MOI = 5). For transplantation, cells were collected by trypsin digestion and concentrated to 1 × 10⁻⁶ in Hanks' balanced salt solution. 7 Cells / ml

[0257] Animals, cell transplantation, and imaging. Female huPBMC-NOG mice (NOD.Cg-Prkdc scid Il2rg tm1SugThe mice (JicTac) were purchased from Taconic. Mice were housed in a sterile environment (3-4 mice per cage). Transplantation was performed under 2.5% isoflurane anesthesia. A total of 1 × 10⁻⁶ mice were transferred from 100 µl of HBSS. 6 One cell was subcutaneously injected into the lateral abdomen of a mouse.

[0258] In vivo bioluminescence imaging. Bioluminescence imaging was performed on an IVIS® Spectrum imaging station (PerkinElmer) under 2.5% isoflurane anesthesia. D-fluorescein (150 mg / kg body weight, intraperitoneal; Sigma) was injected into mice 10 minutes prior to imaging. Luminescence was calculated using IVIS® Spectrum software.

[0259] result:

[0260] Recombinant gene knock-in constructs expressing PD-L1, CD47, and EGFP cDNA with target sequences targeting the PDGFRA locus are generated. A schematic diagram of a recombinant gene construct including a PD-L1 or CD47 knock-in vector targeting the PDGFRA locus is shown in [the diagram]. Figure 16A As shown in the diagram. The PD-L2 and CD47 knock-in vectors from 5'→3' include: a 5' homologous arm; a stop codon; an internal ribosome entry site (IRES); a nucleotide sequence encoding CD47 or PD-L1; a nucleotide sequence encoding anti-B2M shRNA; a nucleotide sequence encoding anti-CIITA shRNA; a puromycin selection marker; and a 3' homologous arm. The EGFP vector (control vector) from 5'→3' includes: a 5' homologous arm; a stop codon; an IRES; a nucleotide sequence encoding enhanced green fluorescent protein (EGFP); a stop codon; a puromycin selection marker; and a 3' homologous arm. The puromycin selection markers in these constructs include a phosphoglycerate kinase (PGK) promoter and a polyadenylation signal (PA) for constitutive expression in mammalian cells. The CD47 and PD-L1 knock-in vectors can knock down class I and II major histocompatibility complexes (MHCs) via shRNAi inhibition of β2-microglobulin and class II transactivator CIITA. Figure 16A The top construct). The EGFP knock-in vector (control vector) expresses only EGFP instead of CD47 or PDL1 and does not express any shRNA. Figure 16A (bottom building block). Figure 16B-16D This demonstrates how CRISPR-mediated [the process] can [be used to] [transform / initiate] [the process]. Figure 16A The clones generated by knocking in the PDGFRA locus with the recombinant gene construct were verified by immunostaining after purine enzyme selection and clonal amplification.

[0261] Human U251 glioma cells expressing PD-L1 and CD47 preferentially proliferate and persist in immune-humanized hosts. U251 cells express PDGFRA, similar to their associated glial progenitor cells. Based on this, gene-edited U251 knock-in (KI) cells expressing PD-L1, CD47, or EGFP (control) at the PDGFRA locus were subcutaneously injected into the flanks of huPBMC-NOG mice (human peripheral blood mononuclear cell chimeric immunodeficient NOG mice). Tumor growth was monitored in vivo by bioluminescence imaging at 1, 5, or 9 days post-transplantation (Fig. 17A). By day 9 post-transplantation, the expansion and persistence of CD47-expressing U251 cells were significantly higher than that of EGFP-expressing control cells (Fig. 17B), consistent with their avoidance of transplant rejection by the humanized host immune system.

[0262] Although preferred embodiments have been described and illustrated in detail herein, it will be apparent to those skilled in the art that various modifications, additions, substitutions, etc., may be made without departing from the spirit of the invention, and therefore these are considered to be within the scope of the invention as defined in the following claims.

Claims

1. A recombinant gene construct, comprising: The first gene sequence expressed in a cell type-specific manner; One or more nucleotide sequences encoding immune checkpoint proteins located at the 3' position of the first gene sequence, and a nucleotide sequence encoding one or more agents that reduce the expression of one or more HLA-I molecules, wherein the nucleotide sequence encoding the one or more agents that reduce the expression of one or more HLA-I molecules is located at the 3' position of the first gene sequence; and A second gene sequence expressed in a cell type-specific manner, the second gene sequence being located at the 3' of the nucleotide sequence encoding the immune checkpoint protein and the nucleotide sequence encoding one or more agents for reducing the expression of one or more HLA-I molecules, wherein the first gene sequence and the second gene sequence of the recombinant gene construct are derived from genes restricted to expression in one or more terminally differentiated cells, wherein the terminally differentiated cells are oligodendrocytes, and the first and second gene sequences are derived from genes selected from the group consisting of: SOX10, MYRF, MAG, and MBP.

2. The recombinant gene construct according to claim 1, wherein: (i) The one or more immune checkpoint proteins are selected from CD47, programmed death-ligand 1 (PD-L1), programmed death-ligand 2 (PD-L2), CD200, CTLA-4, HLE-1 and any combination thereof; (ii) The one or more agents that reduce the expression of the one or more HLA-I molecules are (a) selected from the group consisting of shRNA, miRNA, and siRNA, (b) nuclease-deficient Cas9 or zinc finger nucleases, and / or (c) agents that reduce the expression of β2M; and / or (iii) The one or more HLA-I molecules are selected from the group consisting of HLA-A, HLA-B, HLA-C, HLA-E, HLA-F, HLA-G and combinations thereof.

3. The recombinant gene construct according to claim 1 or 2, further comprising: An additional nucleotide sequence encoding one or more agents that reduce the expression of one or more HLA-II molecules, wherein the additional nucleotide sequence of the construct is coupled to the one or more nucleotide sequences encoding immune checkpoint proteins and / or the nucleotide sequences encoding one or more agents that reduce the expression of one or more HLA-I molecules, wherein: (i) The one or more agents that reduce the expression of one or more HLA-II molecules are selected from the group consisting of shRNA, miRNA and siRNA; (ii) The one or more agents that reduce the expression of one or more HLA-II molecules are nuclease-deficient Cas9 proteins or zinc finger nucleases; and / or (iii) The one or more agents that reduce the expression of the one or more HLA-II molecules are agents that reduce the expression of the major histocompatibility complex trans activator (CIITA).

4. The recombinant gene construct according to claim 1 or 2, further comprising: One or more nucleotide sequences encoding self-cleaving peptides, wherein the nucleotide sequences encoding self-cleaving peptides are located in the construct in a manner that effectively mediates the translation of one or more immune checkpoint proteins, wherein the self-cleaving peptides are selected from the group consisting of: porcine swine cirrhosis virus-1 2A (P2A), varicella-zoster virus 2A (T2A), equine rhinitis virus 2A (E2A), cytoplasmic polyhedrosis virus (BmCPV 2A), and malformation virus (BmIFV 2A).

5. The recombinant gene construct according to claim 1 or 2, further comprising: A cell death-inducible gene is located in the construct in a manner that effectively induces cell suicide, wherein the cell death-inducible gene is selected from the group consisting of caspase-3, caspase-9, and thymidine kinase.

6. A formulation comprising one or more cells, wherein the cells of the formulation comprise a recombinant gene construct according to any one of claims 1 to 5, wherein, The cells in the formulation are oligodendrocytes.

7. A formulation comprising cells, wherein when the cells of the formulation have terminally differentiated, the cells express: (i) Increased levels of one or more immune checkpoint proteins compared to the corresponding wild-type cells, wherein the one or more immune checkpoint proteins are selected from the group consisting of: programmed death-ligand 1 (PD-L1), programmed death-ligand 2 (PD-L2), CD47, CD200, CTLA-4, HLE-1, and any combination thereof. (ii) Reduced levels of one or more HLA-I proteins compared to the corresponding wild-type cells. The one or more HLA-I proteins mentioned herein are selected from the group consisting of: HLA-A, HLA-B, HLA-C, HLA-E, HLA-F, HLA-G and combinations thereof, or (iii) Combinations of (i) and (ii), The cells thereon are derived from the cells defined in claim 6.

8. The formulation according to claim 7, wherein the modified cells of the formulation are terminally differentiated cells.

9. The formulation of claim 7, wherein the modified cells of the formulation conditionally express reduced levels of one or more HLA-II proteins compared to the corresponding wild-type cells, wherein the one or more HLA-II proteins are selected from the group consisting of HLA-DM, HLA-DO, HLA-DP, HLA-DQ, HLA-DR, and combinations thereof.

10. A method for preparing a formulation of one or more cells according to claim 7, comprising: Cells are modified to conditionally express (i) one or more immune checkpoint proteins at increased levels; (ii) one or more agents that reduce the expression of one or more HLA-I molecules; or (iii) both (i) and (ii), wherein the conditional expression of the one or more immune checkpoint proteins and the conditional expression of the one or more agents that reduce the expression of one or more HLA-I molecules are operatively coupled to a gene that is restricted to expression in terminally differentiated cells.

11. The method of claim 10, wherein: (i) The one or more immune checkpoint proteins are selected from the group consisting of: CD47, programmed death-ligand 1 (PD-L1), programmed death-ligand 2 (PD-L2), CD200, CTLA4, HLE-A and any combination thereof; (ii) The one or more agents that reduce the expression of said one or more HLA-I proteins are (a) selected from the group consisting of shRNA, miRNA, and siRNA, (b) nuclease-deficient CRISPR-Cas9 proteins or zinc finger nucleases, and / or (c) agents that reduce the expression of β2M; and / or (iii) The one or more HLA-I molecules are selected from the group consisting of HLA-A, HLA-B, HLA-C, HLA-E, HLA-F, HLA-G and combinations thereof.

12. The method according to claim 10 or 11, further comprising: The cells are modified to conditionally express one or more agents that reduce the expression of one or more HLA-II molecules, wherein: (i) The one or more agents that reduce the expression of one or more HLA-II molecules are selected from the group consisting of shRNA, miRNA and siRNA; (ii) The one or more agents that reduce the expression of one or more HLA-II proteins are nuclease-deficient CRISPR-Cas9 proteins or zinc finger nucleases; and / or (iii) The one or more agents that reduce the expression of the one or more HLA-II molecules are agents that reduce the expression of the major histocompatibility complex trans activator (CIITA).

13. The method of claim 10, wherein the modification comprises: (i) Introducing a sequence-specific nuclease into the cell, the sequence-specific nuclease cleaving the target gene upstream of its 3' untranslated region (UTR), wherein the target gene is a gene expressed in a cell-specific manner, and (ii) Introducing a recombinant gene construct into the cell, the recombinant gene construct comprising: (a) One or more nucleotide sequences encoding immune checkpoint proteins; (b) A nucleotide sequence encoding one or more agents that reduce the expression of one or more HLA-I molecules; or (c) Both (a) and (b) The recombinant gene construct is inserted into the target gene via homologous recombination at the nuclease cleavage site.

14. The method according to claim 13, wherein the sequence-specific nuclease is: (1) Select from the following groups: zinc finger nucleases (ZFN), transcription activator effector nucleases (TALEN), and RNA-guided nucleases; (2) RNA-guided nucleases in the form of Cas9; or (3) Introduced into the cells in the form of protein, mRNA or cDNA.

Images