Primer set and kit for detecting crossing breakpoint PCR combined with multiplex PCR

By combining primer sets and kits for cross-breakpoint PCR with multiplex PCR, the problem of the inability to detect large-scale insertions or deletions across exons in existing technologies has been solved, enabling rapid and accurate gene detection that is suitable for large-scale non-diagnostic gene screening.

CN114807329BActive Publication Date: 2026-03-27SHENZHEN UNI MEDICA TECH
View PDF 2 Cites 0 Cited by

Patent Information

Authority / Receiving Office
CN · China
Patent Type
Patents(China)
Current Assignee / Owner
Filing Date
2022-05-05
Publication Date
2026-03-27

AI Technical Summary

Technical Problem

Existing technologies cannot effectively detect large-scale insertions or deletions across exons, affecting the accuracy of detection results.

Method used

Using a primer set and kit for cross-breakpoint PCR combined with multiplex PCR, specific primers were designed to cross the breakpoint for amplification. Combined with multiplex PCR, a library was constructed and sequenced to detect large-scale gene deletions or insertions.

Benefits of technology

It enables rapid and accurate detection of large-scale deletions or insertions in all exons of genes, making it suitable for large-scale non-diagnostic gene screening, reducing the risk of missed detections, and improving detection speed and accuracy.

✦ Generated by Eureka AI based on patent content.

Smart Images

  • Figure CN114807329B_ABST
    Figure CN114807329B_ABST
Patent Text Reader

Abstract

The application relates to the field of sequencing technology, in particular to a primer group and a kit for gene detection by cross-breakpoint PCR combined with multiplex PCR, and provides a primer group for sequencing by cross-breakpoint PCR combined with multiplex PCR, which comprises a first primer, a second primer, a third primer, a fourth primer and a fifth primer; the first primer comprises a specific primer and a first sequencing tag from the 5' end to the 3' end in sequence; the second primer comprises a specific primer and a second sequencing tag from the 5' end to the 3' end in sequence; wherein the specific primer comprises a forward primer of an upper breakpoint and a reverse primer of the upper breakpoint, a forward primer of a lower breakpoint and a reverse primer of the lower breakpoint. The primer group can be used for rapidly analyzing whether a large-area gene deletion or insertion exists in the whole exon of a sample gene, and the speed is high and the accuracy is high.
Need to check novelty before this filing date? Find Prior Art

Description

TECHNICAL FIELD

[0001] The application belongs to the field of sequencing technology, and particularly relates to a primer set and kit for detecting large-area deletion or insertion of genes by crossing breakpoint PCR combined with multiplex PCR. BACKGROUND

[0002] Genetic metabolic disease belongs to monogenic disease. Due to gene mutation, the function of synthesized enzyme, receptor, carrier and other proteins is defective, resulting in various abnormalities in synthesis, metabolism, transport and other aspects of biochemical substances in the body, and a large class of diseases with a series of clinical symptoms. At present, a small part of this kind of disease can be treated and prevented, and the development of diet therapy and drug therapy will improve the prognosis of some patients.

[0003] The application of high-throughput sequencing technology has been more than 10 years, and its high-throughput, high-sensitivity and low-cost advantages make it have a wide clinical application scene. At present, compared with whole genome sequencing or whole exon sequencing, exon sequencing of specific disease genes ensures accurate detection of common mutation sites, which is an effective and relatively low-cost sequencing strategy. Amplicon sequencing is to sequence PCR products or captured fragments of specific length. Due to the low price and simple operation, multiplex PCR is an important means of target segment enrichment technology.

[0004] Mutiplex Ligation-dependent Probe Amplification (MLPA) was first reported by Schouten et al. in 2002, which is a new technology for qualitative and semi-quantitative analysis of DNA sequences to be detected developed in recent years. It is mainly used for the detection of copy number changes of large fragments of genome, such as deletion or duplication of gene exons, chromosomal aneuploidy, chromosomal microdeletion / microduplication, etc. It can also be used for analysis of known SNPs or single base mutations. The feature of MLPA technology lies in the design of its probe. Each MLPA probe includes a target nucleotide specific sequence, a filler sequence and a universal primer sequence. In the MLPA reaction, each pair of probes hybridizes with the target sequence of the sample to be detected after denaturation, and then through connection, universal primer amplification and capillary electrophoresis, about 50-60 target sequences are separated in one tube reaction, and then the relative copy number of the target sequence is compared and analyzed.

[0005] For the current two-step method of multiplex PCR amplification library construction, when the sample amount is large, since no sample tag is added in the first round of amplification, the subsequent operation is complicated and easy to cause cross contamination between samples. One-step amplification library construction, although simple operation, can also avoid contamination between samples, but due to the long primer, the PCR amplification efficiency is affected, thereby reducing the coverage and uniformity of the amplicon library, and the cost of primer synthesis is high.

[0006] The MLPA technology needs a kit matched with the detected gene. After the sample preparation is completed, the detection is performed on a gene analyzer. The reagent instrument is expensive and has small throughput, and cannot simultaneously detect dozens or even hundreds of genes for full exon and large fragment insertion, deletion or duplication.

[0007] The Gap-PCR technology can only design primers according to gene fragments with clear breakpoints, and determine the results by agarose gel electrophoresis. The Gap-PCR technology cannot detect full exon point mutations or small insertions and deletions of genes. There is a method for establishing a Gap-PCR combined with next-generation sequencing technology for thalassemia gene detection. The long fragment is amplified, purified and used as a starting DNA template for enzyme digestion to build a library for sequencing. The operation is complicated and time-consuming. SUMMARY

[0008] The purpose of the present application is to provide a primer set and kit for sequencing by Gap-PCR combined with multiplex PCR, aiming to solve the problem that the sequencing detection in the prior art cannot detect some large fragment insertions or deletions across exons, which affects the accuracy of the detection results.

[0009] To achieve the above application purposes, the technical solutions adopted by the present application are as follows:

[0010] In a first aspect, the present application provides a primer set for sequencing by Gap-PCR combined with multiplex PCR. The primer set includes a first primer, a second primer, a third primer, a fourth primer and a fifth primer. The first primer sequentially includes a specific primer and a first sequencing tag from 5' end to 3' end. The second primer sequentially includes a specific primer and a second sequencing tag from 5' end to 3' end. The specific primer includes a forward primer of an upper breakpoint and a reverse primer of the upper breakpoint, and a forward primer of a lower breakpoint and a reverse primer of the lower breakpoint.

[0011] In a second aspect, the present application provides a kit for sequencing by Gap-PCR combined with multiplex PCR. The kit includes the primer set for sequencing by Gap-PCR combined with multiplex PCR.

[0012] In a third aspect, the present application provides a method for detecting large area deletion or insertion of a gene by using a kit for sequencing by Gap-PCR combined with multiplex PCR. The method is for non-diagnostic purposes, and includes the following steps:

[0013] Providing a DNA template of a sample to be detected;

[0014] Performing a first round of multiplex PCR reaction on the sample DNA by using the first primer, the second primer and the third primer to obtain an amplification product;

[0015] Performing a second round of multiplex PCR reaction on the amplification product by using the fourth primer and the fifth primer to obtain a sample to be detected library;

[0016] Sequencing the sample library to be tested to analyze whether the gene of the sample to be tested has large area deletion or insertion.

[0017] The primer set for sequencing by crossing breakpoint PCR combined with multiplex PCR provided in the first aspect of the application, the first primer and the second primer provided in the primer set both contain specific primers, and the specific primers are designed according to the position of the breakpoint fragment in the sequence to be sequenced. In combination with other primers, the crossing breakpoint PCR combined with multiplex PCR can analyze whether the sample has large area deletion or large area insertion of the whole exon. When detecting the sequence of large fragment deletion crossing the exon, the wild type gene can be amplified by the forward primer of the upper breakpoint and the reverse primer of the upper breakpoint to obtain the sequence of the upper breakpoint of the breakpoint fragment, and by the forward primer of the lower breakpoint and the reverse primer of the lower breakpoint to obtain the sequence of the lower breakpoint of the breakpoint fragment, while the deletion type gene can be amplified by the forward primer of the upper breakpoint and the reverse primer of the lower breakpoint to obtain the corresponding fragment, and finally the sequence analysis can be used to detect the gene deletion crossing the exon; when detecting the sequence of large fragment insertion crossing the exon, the wild type gene can be amplified by the forward primer of the upper breakpoint and the reverse primer of the lower breakpoint to obtain the corresponding fragment, and the insertion type gene can be amplified by the forward primer of the upper breakpoint and the reverse primer of the upper breakpoint to obtain the upper breakpoint (upper insertion point) sequence of the insertion fragment, and by the forward primer of the lower breakpoint and the reverse primer of the lower breakpoint to obtain the lower breakpoint (lower insertion point) sequence of the insertion fragment, and finally the sequence analysis can be used to detect the gene insertion crossing the exon. Therefore, the primer set can be used to quickly analyze whether the sample gene has large area deletion or insertion of the whole exon, and has the advantages of fast detection speed, high detection accuracy, and is suitable for large-scale non-diagnostic in vitro sample gene screening.

[0018] The kit for sequencing by crossing breakpoint PCR combined with multiplex PCR provided in the second aspect of the application, the kit includes the primer set for sequencing by crossing breakpoint PCR combined with multiplex PCR; since the primer set is based on the action of crossing breakpoint PCR and multiplex PCR, it can analyze whether the sample gene has large area deletion or insertion of the whole exon, and therefore, the kit is suitable for non-diagnostic in vitro sample gene detection, has the advantages of fast detection speed, low cost, high detection rate, and low risk of missed detection, and is suitable for wide use.

[0019] The third aspect of the application provides a kit for detecting large-scale deletion or insertion of genes by using cross-break point PCR combined with multiplex PCR for sequencing, which is a method for non-diagnostic purposes, in which primers are designed based on cross-break point PCR and multiplex PCR, and the provided primers are used to construct a library by multiplex PCR and then sequenced, so that whether the sample has large-scale deletion or insertion of genes can be quickly detected, which is high in universality and accurate and sensitive. BRIEF DESCRIPTION OF DRAWINGS

[0020] FIG. 1 shows a schematic diagram of large-scale deletion of a sequence provided in an embodiment of the application. Figure 1

[0021] FIG. 2 shows a schematic diagram of large-scale insertion of a sequence provided in an embodiment of the application. Figure 2

[0022] FIG. 3 shows a schematic diagram of the process of constructing an amplicon library provided in an embodiment of the application. Figure 3 DETAILED DESCRIPTION

[0023] In order to make the technical problems, technical solutions and beneficial effects to be solved in the application more clear and obvious, the application will be further described in detail below in combination with embodiments. It should be understood that the specific embodiments described herein are only used to explain the application and do not limit the application.

[0024] In the application, the term "and / or" describes the association relationship of the associated objects, which means that there can be three kinds of relationships, for example, A and / or B, which can mean that A exists alone, A and B exist together, and B exists alone. Wherein A and B can be singular or plural. The character " / " generally represents an "or" relationship between the associated objects before and after it.

[0025] In the application, "at least one" means one or more, and "a plurality of" means two or more. "At least one of the following" or similar expressions means any combination of these items, including any combination of single item or multiple items. For example, "at least one of a, b, or c", or "at least one of a, b, and c", can mean a, b, c, a-b (i.e. a and b), a-c, b-c, or a-b-c, wherein a, b, and c can be single or multiple.

[0026] It should be understood that in various embodiments of the application, the size of the sequence number of the above-mentioned processes does not mean the order of execution, and part or all of the steps can be executed in parallel or in sequence, and the execution order of each process should be determined according to its function and inherent logic, and should not constitute any limitation on the implementation process of the embodiments of the application.

[0027] ​​​The terminology used in the present application embodiments is for the purpose of describing particular embodiments only and is not intended to be limiting of the present application. As used in the description of the present application embodiments and the appended claims, the singular forms "a," "an," and "the" are intended to include the plural forms as well, unless the context clearly indicates otherwise.

[0028] The weight of the related components mentioned in the present application embodiments can not only refer to the specific content of each component, but also represent the proportional relationship between the weights of each component. Therefore, as long as the content of the related components in the present application embodiments is proportionally enlarged or reduced, it is within the scope disclosed in the present application embodiments. Specifically, the mass in the present application embodiments can be μg, mg, g, kg, and other mass units commonly known in the chemical field.

[0029] The terms "first", "second", "third", etc. are used only for the purpose of description and are used to distinguish one object from another, and cannot be understood as indicating or implying relative importance or implicitly indicating the number of the technical features indicated. For example, without departing from the scope of the present application embodiments, the first XX can also be referred to as the second XX, and similarly, the second XX can also be referred to as the first XX. Therefore, the features defined with "first", "second" can explicitly or implicitly include one or more of the features.

[0030] The first aspect of the embodiment of the present application provides a primer set for sequencing by crossing breakpoint PCR combined with multiplex PCR, the primer set comprising a first primer, a second primer, a third primer, a fourth primer and a fifth primer, the first primer comprising a specific primer and a first sequencing tag from 5' end to 3' end in sequence, the second primer comprising a specific primer and a second sequencing tag from 5' end to 3' end in sequence, wherein the specific primer comprises a forward primer of an upper breakpoint and a reverse primer of the upper breakpoint, and a forward primer of a lower breakpoint and a reverse primer of the lower breakpoint. The primer set provided in the first aspect of the embodiment of the present application, wherein the first primer and the second primer both comprise a specific primer, the specific primer is designed according to the position of the breakpoint fragment in the sequence to be sequenced, and the specific primer is combined with other primers to analyze whether the whole exon of the sample has large-area deletion or large-area insertion based on the crossing breakpoint PCR combined with multiplex PCR. When detecting the sequence of large fragment deletion crossing the exon, the wild-type gene can be amplified by the forward primer of the upper breakpoint and the reverse primer of the upper breakpoint to obtain the sequence of the upper breakpoint of the breakpoint fragment, and the sequence of the lower breakpoint of the breakpoint fragment can be amplified by the forward primer of the lower breakpoint and the reverse primer of the lower breakpoint, while the deletion-type gene can be amplified by the forward primer of the upper breakpoint and the reverse primer of the lower breakpoint to obtain the corresponding fragment, and finally the gene deletion crossing the exon can be detected by sequence analysis. When detecting the sequence of large fragment insertion crossing the exon, the wild-type gene can be amplified by the forward primer of the upper breakpoint and the reverse primer of the lower breakpoint to obtain the corresponding fragment, the insertion-type gene can be amplified by the forward primer of the upper breakpoint and the reverse primer of the upper breakpoint to obtain the sequence of the upper breakpoint (upper insertion point) of the insertion fragment, and the sequence of the lower breakpoint (lower insertion point) of the insertion fragment can be amplified by the forward primer of the lower breakpoint and the reverse primer of the lower breakpoint, and finally the gene insertion crossing the exon can be detected by sequence analysis. Therefore, the primer set can be used to quickly analyze whether the whole exon of the sample gene has large-area deletion or insertion, the detection speed is fast, the detection accuracy is high, and the primer set is suitable for large-scale non-diagnostic in vitro sample gene screening. In some embodiments, the length of the fragment amplified by the forward primer of the upper breakpoint and the reverse primer of the lower breakpoint is 125-700 bp, so as to ensure that the length of the amplified original gene fragment is moderate and can be sequenced.

[0031] In some embodiments, the length of the specific primer is 17-25 bp. The length of the specific primer is controlled to be moderate, which is beneficial to further control the sequence of the amplified product.

[0032] In some embodiments, the third primer comprises a first sequencing adapter, a sample tag and a second sequencing tag.

[0033] In some embodiments, the fourth primer consists of the second sequencing adaptor, the first sequencing tag.

[0034] In some embodiments, the fifth primer is the first sequencing adaptor.

[0035] In some embodiments, the sequence of the first sequencing tag is as shown in Seq. ID No. 1, specifically: ACACTCTTTCCCTACACGACGCTCTTCCGAT.

[0036] In some embodiments, the sequence of the second sequencing tag is as shown in Seq. ID No. 2, specifically: GTGACTGGAGTTCAGACGTGTGCTCTTCCGATC.

[0037] In some embodiments, the sequence of the first sequencing adaptor is as shown in Seq. ID No. 3, specifically: CAAGCAGAAGACGGCATACGAGAT.

[0038] In some embodiments, the sequence of the second sequencing adaptor is as shown in Seq. ID No. 4, specifically: AATGATACGGCGACCACCGAGATCTACAC.

[0039] In some embodiments, the sequence of the first sequencing adaptor and the sequence of the second sequencing adaptor are the adaptor sequences of the Illumina sequencing platform.

[0040] In some embodiments, as shown in Figure 1 In some embodiments, as shown in Figure 2As shown, when analyzing whether the whole exon of the sample has a large-scale gene insertion, the specific primers use the forward primer of the upper breakpoint and the reverse primer of the upper breakpoint, the forward primer of the lower breakpoint and the reverse primer of the lower breakpoint, the wild-type gene is amplified by the forward primer of the upper breakpoint and the reverse primer of the lower breakpoint to obtain the corresponding fragment, the insertion-type gene can be amplified by the forward primer of the upper breakpoint and the reverse primer of the upper breakpoint to obtain the upper breakpoint (upper insertion point) sequence of the insertion fragment, and the lower breakpoint (lower insertion point) sequence of the insertion fragment can be amplified by the forward primer of the lower breakpoint and the reverse primer of the lower breakpoint. If the sequence of the upper breakpoint and the sequence of the lower breakpoint can be detected, it indicates that there is a large-scale gene insertion in the sample at this position.

[0041] The second aspect of the embodiment of the present application provides a kit for sequencing by cross-breakpoint PCR combined with multiplex PCR, and the kit comprises a primer group for sequencing by cross-breakpoint PCR combined with multiplex PCR.

[0042] The kit for sequencing by cross-breakpoint PCR combined with multiplex PCR provided in the second aspect of the embodiment of the present application comprises a primer group for sequencing by cross-breakpoint PCR combined with multiplex PCR. Because the provided primer group is based on the action of cross-breakpoint PCR and multiplex PCR, it can analyze whether the whole exon of the sample gene has a large-scale deletion or insertion. Therefore, the kit is suitable for being widely used in the detection of genes of non-diagnostic in vitro samples, and has the advantages of fast detection speed, low cost, high detection rate, and low risk of missed detection.

[0043] In some embodiments, the kit further comprises a PCR buffer and a DNA polymerase.

[0044] The third aspect of the embodiment of the present application provides a method for detecting a large-scale deletion or insertion of a gene by using a kit for sequencing by cross-breakpoint PCR combined with multiplex PCR. The method is for non-diagnostic purposes, such as Figure 3 As shown, the method comprises the following steps:

[0045] S01. providing a DNA template of a sample to be detected;

[0046] S02. performing a first round of multiplex PCR reaction on the sample DNA by using a first primer, a second primer and a third primer to obtain an amplification product;

[0047] S03. performing a second round of multiplex PCR reaction on the amplification product by using a fourth primer and a fifth primer to obtain a sample to be detected library;

[0048] S04. sequencing the sample to be detected library to analyze whether the sample to be detected has a large-scale deletion or insertion of a gene.

[0049] The method for detecting large-area deletion or insertion of genes by using the kit for sequencing by spanning breakpoint PCR combined with multiplex PCR provided in the third aspect of the embodiments of the present application is a method for non-diagnostic purposes, in which primers are designed based on spanning breakpoint PCR and multiplex PCR, and the provided primers are used to construct a library by the method of multiplex PCR and then sequenced, so that whether the sample has large-area deletion or insertion of genes can be quickly detected, and the method has high universality and high accuracy and sensitivity.

[0050] In step S01, a DNA template of a sample to be detected is provided; the provided DNA template is quantified by using Qubit Flurometer 3.0, and about 10-150 ng of DNA template is required for detecting one sample.

[0051] In step S02, the sample DNA is subjected to first-round multiplex PCR reaction by using the first primer, the second primer and the third primer to obtain an amplified product. In order to avoid the formation of short fragments due to the overlapping of the primers and thus affect the reaction results, the first-round multiplex PCR reaction is divided into two reaction systems for reaction, and the first primer and the second primer having overlapping sequences are divided into different reaction systems.

[0052] In the first-round multiplex PCR reaction, when the number of amplicons changes, the input amount of each component of the PCR reaction system changes, and the input amount of each component is determined according to the specific embodiments.

[0053] In some embodiments, in the step of performing the first-round multiplex PCR reaction, the first-round multiplex PCR reaction is simultaneously performed in two reaction systems, wherein the first reaction system comprises 5-75 ng of DNA template, 3-3.2 U of DNA polymerase, 15.5-16 μL of amplification buffer, 0.5-0.6 μL of part of the first primer with a concentration of 1-1.1 μM, 0.17-0.18 μL of part of the second primer with a concentration of 1-1.1 μM, 1.39-1.40 μL of the third primer with a concentration of 50-51 μM, and double-distilled water added to 25 μL; and the second reaction system comprises 5-75 ng of DNA template, 3-3.2 U of DNA polymerase, 15.5-16 μL of amplification buffer, 0.5-0.6 μL of the remaining first primer with a concentration of 1-1.1 μM, 0.17-0.18 μL of the remaining second primer with a concentration of 1-1.1 μM, 1.44-1.5 μL of the third primer with a concentration of 50-51 μM, and double-distilled water added to 25 μL.

[0054] In some embodiments, in the step of performing the first round of multiplex PCR reaction, the first round of multiplex PCR reaction is performed in two reaction systems simultaneously, wherein the first reaction system comprises 25 ng of DNA template, 3 U of DNA polymerase, 15.5 μL of amplification buffer, 0.5 μL of the first primer at a concentration of 1 μM, 0.17 μL of the second primer at a concentration of 1 μM, 1.39 μL of the third primer at a concentration of 50 μM, and double-distilled water added to 25 μL.

[0055] In some embodiments, in the step of performing the first round of multiplex PCR reaction, the first round of multiplex PCR reaction is performed in two reaction systems simultaneously, wherein the second reaction system comprises 25 ng of DNA template, 3 U of DNA polymerase, 15.5 μL of amplification buffer, 0.5 μL of the first primer at a concentration of 1 μM, 0.17 μL of the second primer at a concentration of 1 μM, 1.44 μL of the third primer at a concentration of 50 μM, and double-distilled water added to 25 μL.

[0056] In some embodiments, the reaction conditions of the first round of multiplex PCR reaction are as follows: pre-denaturation at 94-95 °C for 3-4 min; 94-95 °C for 30-35 s, 60-61 °C for 2-2.5 min, 58-59 °C for 2-2.5 min, 72-73 °C for 3-3.5 min, 20 cycles; and storage at 4 °C.

[0057] In some embodiments, the reaction conditions of the first round of multiplex PCR reaction are as follows: pre-denaturation at 95 °C for 3 min; 95 °C for 30 s, 60 °C for 2 min, 58 °C for 2 min, 72 °C for 3 min, 20 cycles; and storage at 4 °C.

[0058] In some embodiments, the amplification product obtained after the reaction is completed is purified and then subjected to the next reaction.

[0059] In step S03, the fourth primer and the fifth primer are used to perform a second round of multiplex PCR reaction on the amplification product to obtain a library of the sample to be detected.

[0060] In some embodiments, in the step of performing the second round of multiplex PCR reaction, the system of the second round of multiplex PCR reaction comprises 10-11 μL of the amplification product, 25-27 μL of 2x high-fidelity hot-start polymerase premix, 1.5-1.6 μL of the fourth primer at a concentration of 25-26 μM, and 1.5-1.6 μL of the fifth primer at a concentration of 25-26 μM, and double-distilled water added to 50 μL.

[0061] In some specific embodiments, in the step of performing the second round of multiplex PCR reaction, the system of the second round of multiplex PCR reaction is 10 μL of amplification product, 25 μL of 2x high-fidelity hot start polymerase premix, 1.5 μL of fourth primer at a concentration of 25 μM, 1.5 μL of fifth primer at a concentration of 25 μM, and adding double-distilled water to 50 μL.

[0062] In some embodiments, the reaction conditions of the second round of multiplex PCR reaction are as follows: pre-denaturation at 94-95 °C for 3-4 min; 94-95 °C for 30-35 s, 60-61 °C for 30-35 s, 72-73 °C for 40-45 s, 15 cycles; 72-73 °C for 3-3.5 min, and storage at 4 °C.

[0063] In some specific embodiments, the reaction conditions of the second round of multiplex PCR reaction are as follows: pre-denaturation at 95 °C for 3 min; 95 °C for 30 s, 60 °C for 30 s, 72 °C for 4 s, 15 cycles; 72 °C for 3 min, and storage at 4 °C.

[0064] In some embodiments, the second round of PCR product obtained after the reaction is completed is subjected to purification treatment to obtain a sample library to be tested.

[0065] In step S04, the sample library to be tested is sequenced, and whether the sample to be tested has a large-area deletion or insertion of genes is analyzed.

[0066] In some embodiments, the amplicon library after the second round of PCR is accurately quantified according to the Qubit Flurometer 3.0 instructions. After the product passes the library detection, the Illumina sequencing platform is used for PE150 on-machine sequencing, and the steps are strictly used according to the requirements of the supplier. After filtering the low-quality sequences and the adapter sequences obtained by sequencing, the alignment software BWA is used to align them to the reference genome (GRCh37 / hg19), and a large-fragment insertion-deletion variant type reference sequence is built for alignment. The performance and uniformity of the multiplex PCR library are judged by analyzing the sequencing depth (reads) of different amplicons.

[0067] The following will be described in conjunction with specific embodiments.

[0068] Embodiment 1

[0069] Detection of target genes PAH and SLC25A13 by cross-breakpoint PCR combined with multiplex PCR

[0070] The detection method comprises the following steps:

[0071] (1) providing a first primer, a second primer, a third primer, a fourth primer, and a fifth primer; wherein the first primer comprises, from 5' end to 3' end, a specific primer and a first sequencing tag in sequence, the second primer comprises, from 5' end to 3' end, a specific primer and a second sequencing tag in sequence; the specific primers in the first primer and the second primer are shown in Table 1,

[0072] The third primer comprises a first sequencing adaptor, a sample tag, and a second sequencing tag;

[0073] The fourth primer comprises a second sequencing adaptor and a first sequencing tag;

[0074] The fifth primer is a first sequencing adaptor;

[0075] The sequence of the first sequencing tag is shown in Seq. ID No. 1, specifically: ACACTCTTTCCCTACACGACGCTCTTCCGAT.

[0076] The sequence of the second sequencing tag is shown in Seq. ID No. 2, specifically: GTGACTGGAGTTCAGACGTGTGCTCTTCCGATC.

[0077] The sequence of the first sequencing adaptor is shown in Seq. ID No. 3, specifically: CAAGCAGAAGACGGCATACGAGAT.

[0078] The sequence of the second sequencing adaptor is shown in Seq. ID No. 4, specifically: AATGATACGGCGACCACCGAGATCTACAC.

[0079] Table 1

[0080]

[0081]

[0082] (2) providing a DNA template of a sample to be tested; the provided DNA template is quantified by Qubit Flurometer 3.0, and about 5-150 ng of DNA template is required for detecting one sample.

[0083] (3) performing a first round of multiplex PCR reaction on the sample DNA by using the first primer, the second primer, and the third primer to obtain an amplification product.

[0084] The multiplex PCR comprises 283 amplicons, and is performed in two tubes, wherein multiplex PCR reaction system 1 comprises 139 amplicons, and multiplex PCR reaction system 2 comprises 144 amplicons.

[0085] In the step of performing the first round of multiplex PCR reaction, the first round of multiplex PCR reaction is performed in two reaction systems at the same time, wherein the first reaction system is 75 ng of DNA template, 3 U of DNA polymerase, 15.5 μL of amplification buffer, 0.5 μL of 1 μM of partial first primer, 0.17 μL of 1 μM of partial second primer, 1.39 μL of 50 μM of third primer, and double-distilled water is added to 25 μL. The second reaction system is 75 ng of DNA template, 3 U of DNA polymerase, 15.5 μL of amplification buffer, 0.5 μL of 1 μM of residual first primer, 0.17 μL of 1 μM of residual second primer, 1.44 μL of 50 μM of third primer, and double-distilled water is added to 25 μL.

[0086] The reaction conditions of the first round of multiplex PCR reaction are as follows: 95 °C for 3 min of pre-denaturation; 95 °C for 30 s, 60 °C for 2 min, 58 °C for 2 min, 72 °C for 3 min, 20 cycles; and storage at 4 °C.

[0087] 10 μL of the amplification product is taken from each tube and combined into one tube, which is shaken and mixed, and then 500 μL is purified twice with 0.8 times the volume of AMPure XP Beads and dissolved in 50 μL of TE for purification treatment.

[0088] (4) The fourth primer and the fifth primer are used to perform the second round of multiplex PCR reaction on the amplification product to obtain the sample library to be tested.

[0089] The system of the second round of multiplex PCR reaction is 10 μL of amplification product, 25 μL of high-fidelity hot-start polymerase premix, 1.5 μL of 25 μM of fourth primer, 1.5 μL of 25 μM of fifth primer, and double-distilled water is added to 50 μL.

[0090] The reaction conditions of the second round of multiplex PCR reaction are as follows: 95 °C for 3 min of pre-denaturation; 95 °C for 30 s, 60 °C for 30 s, 72 °C for 4 s, 15 cycles; 72 °C for 3 min, and storage at 4 °C.

[0091] The second round of PCR product is purified once with 0.8 times the volume of AMPure XP Beads and dissolved in 50 μL of TE for purification treatment to obtain the sample library to be tested.

[0092] (5) Sequencing of the sample library is performed to analyze whether the gene has large-scale deletion or insertion. Refer to the Qubit Flurometer 3.0 instruction manual to accurately quantify the amplicon library after two rounds of PCR. After the product passes the library detection, use the Illumina sequencing platform for PE150 on-machine sequencing, and strictly follow the supplier's requirements. After filtering the low-quality sequences and adapter sequences obtained by sequencing, use the alignment software BWA to align them to the reference genome (GRCh37 / hg19), and build a large fragment insertion and deletion variant type reference sequence for alignment. By analyzing the sequencing depth (reads) of different amplicons, the performance and uniformity of the multiplex PCR library can be determined.

[0093] Sequencing result analysis

[0094] The sequencing analysis results are as follows: 96 samples have at least 1 measured sequence number (reads) of 283 amplicons, 98% of the amplicon sequencing depth is more than 30x, and the repeatability is 100%.

[0095] Among them, S1: PAH(c.-4173_-407del3767) carrier, S2: SLC25A13(IVS16ins3kb) carrier, and S3: negative sample results are shown in Table 2:

[0096] Table 2: Amplicon sequencing depth results of sample detection

[0097]

[0098]

[0099] The above results, S1 sample, is a PAH gene c.-4173_-407del3767 variant carrier, amplicon AmpA3 is a fusion sequence after deletion, which is aligned to the built fusion sequence reference gene with a depth of 206x, and the S2 and S3 samples without this variation are not detected. Fusion sequence, in addition to the two wild-type amplicons AmpA1 and AmpA2; S2 sample, SLC25A13 gene IVS16ins3kb variant carrier, amplicon AmpB1 and AmpB2 spanning the upper and lower insertion points, reads depth of 363 and 514x are detected, and wild-type amplicon AmpB3 is detected. AmpB3, and S1 and S3 samples without this insertion variation only detect wild-type amplicon AmpB3.

[0100] In summary, the primer set for sequencing by cross-break point PCR combined with multiplex PCR, among the provided primer sets, the first primer and the second primer both contain specific primers, and the provided specific primers are designed according to the position of the broken fragments in the sequence to be sequenced. In this way, combined with other primers, based on cross-break point PCR combined with multiplex PCR, it can be analyzed whether the sample has a large area of gene deletion or insertion. If the sequence of a large fragment deletion spanning the exon is detected, the wild-type gene can be amplified by the forward primer of the upper break point and the reverse primer of the upper break point to obtain the sequence of the upper break point of the broken fragment, and by the forward primer of the lower break point and the reverse primer of the lower break point to obtain the sequence of the lower break point of the broken fragment. The deletion type gene can be amplified by the forward primer of the upper break point and the reverse primer of the lower break point to obtain the corresponding fragment, and finally the sequence analysis can detect the gene deletion spanning the exon; if the sequence of a large fragment insertion spanning the exon is detected, the wild-type gene is amplified by the forward primer of the upper break point and the reverse primer of the lower break point to obtain the corresponding fragment, and the insertion type gene can be amplified by the forward primer of the upper break point and the reverse primer of the upper break point to obtain the upper break point (upper insertion point) sequence of the insertion fragment, and by the forward primer of the lower break point and the reverse primer of the lower break point to obtain the lower break point (lower insertion point) sequence of the insertion fragment. Finally, sequence analysis can detect the gene insertion spanning the exon. Therefore, using this primer set can quickly analyze whether the sample gene has a large area of gene deletion or insertion, with fast detection speed, high detection accuracy, and is suitable for large-scale non-diagnostic in vitro sample genetic screening.

[0101] The above only describes the preferred embodiments of the present application and is not intended to limit the present application. Any modifications, equivalent replacements, and improvements made within the spirit and principle of the present application shall be included in the protection scope of the present application. SEQUENCE LISTING <110> Shenzhen Joint Medical Technology Co., Ltd. <120> Primer set and kit for detection by cross-break point PCR combined with multiplex PCR <130> 28 April 2022 <160> 16 <170> PatentIn version 3.3 <210> 1 <211> 31 <212> DNA <213> Artificial synthesis <400> 1 acactctttc cctacacgac gctcttccga t 31 <210> 2 <211> 33 <212> DNA <213> Artificial <400> 2 gtgactggag ttcagacgtg tgctcttccg atc 33 <210> 3 <211> 24 <212> DNA <213> Artificial <400> 3 caagcagaag acggcatacg agat 24 <210> 4 <211> 29 <212> DNA <213> Artificial <400> 4 aatgatacgg cgaccaccga gatctacac 29 <210> 5 <211> 17 <212> DNA <213> Artificial <400> 5 actgagaagg gcacaga 17 <210> 6 <211> 18 <212> DNA <213> Artificial <400> 6 gttcctattg gtgggtat 18 <210> 7 <211> 19 <212> DNA <213> Artificial <400> 7 tcacgtgccc tctagctgt 19 <210> 8 <211> 18 <212> DNA <213> Artificial<213> Artificial <400> 8 taggcacttc cgggactc 18 <210> 9 <211> 17 <212> DNA <213> Artificial <400> 9 actgagaagg gcacaga 17 <210> 10 <211> 18 <212> DNA <213> Artificial <400> 10 taggcacttc cgggactc 18 <210> 11 <211> 21 <212> DNA <213> Artificial <400> 11 gagctggtgg tatggaaata a 21 <210> 12 <211> 21 <212> DNA <213> Artificial <400> 12 aagaagactg gatttggaaa g 21 <210> 13 <211> 18 <212> DNA <213> Artificial <400> 13 acggcttttt atccgccc 18 <210> 14 <211> 19 <212> DNA <213> Artificial <400> 14 gggtgaggat cgaaataca 19 <210> 15 <211> 21 <212> DNA <213> Artificial synthesis <400> 15 gagctggtgg tatggaaata a 21 <210> 16 <211> 19 <212> DNA <213> Artificial synthesis <400> 16 gggtgaggat cgaaataca 19

Claims

1. A primer set for sequencing by combining a cross- breakpoint PCR with a multiplex PCR, characterized by, The primer set is used for detecting the target genes PAH and SLC25A13, and for the target gene PAH, the primer set comprises a first primer, a second primer, a third primer, a fourth primer and a fifth primer. The first primer comprises a specific primer and a first sequencing tag from 5' end to 3' end in sequence, wherein the specific primer in the first primer for detecting the target gene PAH comprises a primer as shown in Seq.ID No. 5, Seq.ID No. 7 or Seq.ID No. 9, The second primer comprises a specific primer and a second sequencing tag from 5' end to 3' end in sequence, wherein the specific primer in the second primer for detecting the target gene PAH comprises a primer as shown in Seq.ID No. 6, Seq.ID No. 8 or Seq.ID No. 10; For the target gene SLC25A13, the primer set comprises a first primer, a second primer, a third primer, a fourth primer and a fifth primer. The first primer comprises a specific primer and a first sequencing tag from 5' end to 3' end in sequence, wherein the specific primer in the first primer for detecting the target gene SLC25A13 comprises a primer as shown in Seq.ID No. 11, Seq.ID No. 13 or Seq.ID No. 15, The second primer comprises a specific primer and a second sequencing tag from 5' end to 3' end in sequence, wherein the specific primer in the second primer for detecting the target gene SLC25A13 comprises a primer as shown in Seq.ID No. 12, Seq.ID No. 14 or Seq.ID No. 16; The third primer comprises a first sequencing adaptor, a sample tag and a second sequencing tag; The fourth primer comprises a second sequencing adaptor and a first sequencing tag; The fifth primer is a first sequencing adaptor; the sequence of the first sequencing tag is shown in Seq.ID No. 1, specifically: ACACTCTTTCCCTACACGACGCTCTTCCGAT; the sequence of the second sequencing tag is shown in Seq.ID No. 2, specifically: GTGACTGGAGTTCAGACGTGTGCTCTTCCGATC; the sequence of the first sequencing adaptor is shown in Seq.ID No. 3, specifically: CAAGCAGAAGACGGCATACGAGAT; and the sequence of the second sequencing adaptor is shown in Seq.ID No. 4, specifically: AATGATACGGCGACCACCGAGATCTACAC.

2. A kit for sequencing across a breakpoint by a combination of a PCR and a multiplex PCR, characterized in that, The kit comprises the primer set for sequencing by cross-breakpoint PCR combined with multiplex PCR according to claim 1.

3. The kit for sequencing across a breakpoint by a combination of a long-range PCR and a multiplex PCR according to claim 2, wherein, The kit further comprises a PCR buffer and a DNA polymerase.

4. A method for detecting large-scale deletion or insertion of a gene using a kit for sequencing by the combination of the bridging gap PCR of claim 2 and multiplex PCR, characterized by, The method is for non-diagnostic use, comprising the following steps: providing a DNA template of a sample to be detected; performing a first round of multiplex PCR reaction on the sample DNA by using the first primer, the second primer and the third primer to obtain an amplification product; performing a second round of multiplex PCR reaction on the amplification product by using the fourth primer and the fifth primer to obtain a second amplification product; and sequencing the second amplification product by using the first sequencing tag and the second sequencing tag. The fourth primer and the fifth primer are used to perform a second round of multiplex PCR reaction on the amplification product, so as to obtain a library of the sample to be tested; Sequencing is performed on the library of the sample to be tested, and whether the sample to be tested has a large-area deletion or insertion of genes is analyzed.

5. The method of claim 4, wherein, In the step of performing the first round of multiplex PCR reaction, the first round of multiplex PCR reaction is performed in two reaction systems at the same time, wherein the first reaction system is 5-75 ng of DNA template, 3-3.2 U of DNA polymerase, 15.5-16 μL of amplification buffer, 0.5-0.6 μL of the first primer with a concentration of 1-1.1 μM, 0.17-0.18 μL of the second primer with a concentration of 1-1.1 μM, 1.39-1.40 μL of the third primer with a concentration of 50-52 μM, and double-distilled water is added to 25 μL; the second reaction system is 5-75 ng of DNA template, 3-3.2 U of DNA polymerase, 15.5-16 μL of amplification buffer, 0.5-0.6 μL of the first primer with a concentration of 1-1.1 μM, 0.17-0.18 μL of the second primer with a concentration of 1-1.1 μM, 1.44-1.5 μL of the third primer with a concentration of 50-51 μM, and double-distilled water is added to 25 μL; The reaction conditions of the first round of multiplex PCR reaction are as follows: 94-95 ℃ for 3-4 min, pre-denaturation; 94-95 ℃ for 30-35 s, 60-61 ℃ for 2-2.5 min, 58-59 ℃ for 2-2.5 min, 72-73 ℃ for 3-3.5 min, 20 cycles; and preservation at 4 ℃.

6. The method of claim 4, wherein, In the step of performing the second round of multiplex PCR reaction, the system of the second round of multiplex PCR reaction is 10-11 μL of amplification product, 25-27 μL of 2×high-fidelity hot-start polymerase premix, 1.5-1.6 μL of the fourth primer with a concentration of 25-26 μM, and 1.5-1.6 μL of the fifth primer with a concentration of 25-26 μM, and double-distilled water is added to 50 μL; The reaction conditions of the second round of multiplex PCR reaction are as follows: 94-95 ℃ for 3-4 min, pre-denaturation; 94-95 ℃ for 30-35 s, 60-61 ℃ for 30-35 s, 72-73 ℃ for 40-45 s, 15 cycles; 72-73 ℃ for 3-3.5 min, and preservation at 4 ℃.

Citation Information

Patent Citations

  • Gene detection reagent kit for -alpha21.9 deletion-type alpha-thalassemia

    CN105861661A

  • Method and kit for identifying thalassemia alpha alpha alpha anti4.2 heterozygosis and HK alpha alpha heterozygosis

    CN114277096A