Snp marker of expression regulation of high temperature response gene hsp70 in crassostrea gigas and application thereof

Abstract

The application belongs to the field of genetic engineering and genetic breeding, and particularly relates to a high-temperature response gene HSP70 expression regulation SNP marker of Crassostrea gigas and application of the SNP marker in identifying high-temperature resistant oyster individuals. The SNP marker is the 251th base in the sequence shown in SEQ ID NO: 2, and the mutation type is C / G (trans-regulation site Marker13973). The application provides a SNP marker which is significantly related to the expression of the HSP70 gene, and the advantage of the application is that the genotype of parent oysters can be identified before seed breeding, and the tolerance of offspring to high-temperature environment is improved. The SNP marker obtained in the research has high reliability and stable results.

Description

TECHNICAL FIELD

[0001] The application belongs to the field of genetic engineering and genetic breeding, and relates to a high-temperature response gene HSP70 expression regulation SNP marker of Crassostrea gigas and application and a method for identifying high-temperature-resistant Crassostrea gigas individuals. BACKGROUND

[0002] Due to their wide distribution and important ecological significance, bivalve mollusks have long been considered as good biological indicators for monitoring marine habitat pollution and the impact of global warming. Oysters, as a model species of bivalves, crown animals and even marine invertebrates, are an excellent choice for studying the impact of climate change on coastal ecosystems. Oysters are the most traded farmed shellfish in the world, with annual trade exceeding 1 billion US dollars, and they are also the main farmed shellfish in China, accounting for 25% of the annual output of marine aquaculture ( Figure 3 ), with a value of over 40 billion yuan (China Fishery Statistical Yearbook 2019). However, for a long time, the periodic mass mortality of oysters in summer has caused serious economic losses in many countries. Studies have shown that many abiotic factors such as temperature, water quality and salt, or together with other biological factors such as viruses, cause mass mortality of oysters. High temperature is considered to be one of the most important abiotic factors leading to summer mortality of oysters. Therefore, understanding the high-temperature regulation mechanism of oysters and how to improve their high-temperature resistance has become a problem that needs to be solved by the industry.

[0003] Crassostrea gigas is mainly distributed in the north of the Yangtze River in China, and Crassostrea angulata is distributed in the south of the Yangtze River, which are two allopatric sister subspecies. Phylogenetic analysis shows that their differentiation time is about 2.7 Ma. The habitats of the two species differ greatly, especially the difference in annual mean sea surface temperature, which can reach 6.6℃, and the difference in annual average air temperature, which can reach 8.7℃. The difference in latitude distribution between the two species reveals the difference in temperature adaptation between them. Crassostrea angulata has a higher heat stress survival rate, Arrhenius temperature and Q 10 value, and is a high-temperature adapted species. In the previous study, the research group constructed a pseudo-backcross F2 generation family ZF2-3 of Crassostrea gigas and Crassostrea angulata, and genotyped 106 individuals of the offspring using a simplified genome, and then constructed a high-density genetic map. The upper map of the genetic map is marked with 1,694 SNPs, with a genome coverage of 98.7% and an average distance between markers of 0.8 cM.

[0004] The research shows that the genes responding to high temperature stress of organisms are mainly genes involved in cell homeostasis and energy balance. The transcriptome data shows that the heat shock protein genes are significantly differentiated in C. apiculus and C. japonica. The induced expression of HSP70 gene in C. japonica is significantly higher than that in C. apiculus under high temperature stress, which indicates that the expression of the gene is closely related to the high temperature tolerance of the oysters and can be used as an important molecular phenotype of the high temperature tolerance of the oysters. However, which phenotype is significant is currently the focus. SUMMARY

[0005] The purpose of the present application is to find SNP sites that potentially regulate the expression of high temperature response genes and provide a reference for molecular marker assisted selection of C. apiculus.

[0006] To achieve the above purpose, the technical scheme adopted by the present application is:

[0007] A SNP marker for regulating the expression of a high temperature response gene HSP70 of C. apiculus, wherein the SNP marker is the 251th base in the sequence shown in SEQ ID NO: 2, and the mutation type is C / G (trans-regulation site Marker13973).

[0008] The genotype is homozygous or heterozygous, i.e. the genotype is CC or CG.

[0009] A primer set for detecting the SNP marker, wherein the primer set is a specific peripheral amplification primer and a single base extension primer gene sequence,

[0010] the specific peripheral amplification primer is

[0011] Marker13973-F: 5'-TACATTAACTGTAAATTAATTCAACTTT-3';

[0012] Marker13973-R: 5'-TCTTAAAAAAGTAGAGAAAAATATGAA-3';

[0013] and the single base extension primer gene sequence is

[0014] Marker13973:

[0015] 5'-TTTTTTTTTTTTTTTTTTTTTTTTTTTTTTTTTTTATGCAGTACATTTCATCATTTG- 3'.

[0016] A kit for detecting the SNP marker, comprising the primer set.

[0017] Application of the SNP marker, the primer set or the kit in identifying high temperature tolerant oyster individuals.

[0018] The application discloses a method for identifying high-temperature-resistant oyster individuals, which comprises the following steps: detecting a SNP marker of a to-be-tested oyster, determining a genotype of the to-be-tested oyster, and determining an advantage individual of the high-temperature-resistant oyster according to the genotype.

[0019] Specifically, the method comprises the following steps: extracting genomic DNA of the to-be-tested oyster; using the primer group to perform PCR amplification on the genomic DNA of the to-be-tested oyster as a template, so as to amplify a fragment containing a target SNP site; and then using a single-base primer to perform SNP site typing detection, so as to identify the genotype of the to-be-tested oyster and determine the high-temperature-resistant oyster individual.

[0020] The SNP site of the to-be-tested oyster is determined and the typing detection is performed as follows: a. the extracted DNA sample is diluted to 20 ng / ul and then used as a PCR template, and specific primers are used to perform peripheral amplification; the peripheral primer sequence is as follows:

[0021] Marker13973-F: 5'-TACATTAACTGTAAATTAATTCAACTTT-3';

[0022] Marker13973-R: 5'-TCTTAAAAAAGTAGAGAAAAATATGAA-3';

[0023] The PCR reaction system is as follows:

[0024]

[0025] The reaction procedure of the PCR amplification is as follows:

[0026]

[0027] b. SNaPshot PCR: using the PCR product as a template of SNaPshot PCR, and then performing site detection after product purification, wherein the single-base-specific primer sequence is as follows:

[0028] Marker13973:

[0029] 5'-TTTTTTTTTTTTTTTTTTTTTTTTTTTTTTTTTTTATGCAGTACATTTCATCAT TTG-3';

[0030] The reaction system is as follows:

[0031]

[0032] The reaction procedure is as follows:

[0033]

[0034] c. Using the above amplification product to identify the genotype of each individual.

[0035] Advantages of the present application:

[0036] The present application can quickly and in large quantities screen oyster individuals with different expression levels of high temperature response genes by detecting the expression level of high temperature response genes of oyster individuals, identifying high temperature resistant oysters, and applying the non-destructive sampling technology to detect the genotype of the parent before breeding, and selecting individuals with target genotype combinations as parents for molecular marker assisted selection breeding, breeding high temperature resistant offspring, and also as a potential marker to predict the adaptation potential of oysters under the current global warming environment.

[0037] The present application locates an important upstream regulatory site of high temperature response HSP70: Marker13973 by performing eQTL analysis on the important high temperature response gene HSP70 of oysters, and there is a nucleosome protein gene RPL10A about 2kb downstream of Marker13973, and research reports have shown that this gene can promote the expression of HSP70 gene; and the best genotype combination is obtained, which is used for predicting individuals with different expression levels of high temperature response genes. The candidate marker of the present application is obtained by simplified genome, and is located by eQTL, and is further verified by other populations for a unit point, and the result is reliable, which can be used for screening individuals with different expression levels of HSP70 gene, identifying high temperature resistant oyster parents, breeding high temperature resistant oyster individuals, and also predicting the environmental adaptation potential of oysters;

[0038] Further, the present application can quickly and in large quantities screen oyster individuals with different expression levels, and can identify the genotype of the parent before breeding, screen high temperature resistant oyster parents, improve the high temperature resistance of offspring, and also predict the adaptation potential of oysters under the current climate change. The result of the present application is reliable, the SNP site obtained has high reliability, and the effect is stable. BRIEF DESCRIPTION OF DRAWINGS

[0039] Figure 1 is a histogram of the frequency distribution of the expression amount of HSP70 gene of 106 oyster individuals of ZF2-3 family.

[0040] Figure 2 is an eQTL positioning map of HSP70 gene.

[0041] Figure 3 is a correlation diagram of the expression level of HSP70 gene and the genotype of regulatory site Marker13973.

[0042] 1.SEQ ID NO:1 is the full sequence of HSP70 gene of Crassostrea gigas, the information sequence characteristic length is 2111bp, and the gene ID is CGI_10016162.

[0043] 2. SEQ ID NO: 2 is a SNP marker sequence for regulating HSP70 expression, information sequence feature length: 501 bp, 250 bp upstream and downstream of the scaffold 41136, 3037 locus. DETAILED DESCRIPTION

[0044] The application will be further illustrated below in conjunction with examples, but the examples do not limit the application in any form.

[0045] Using a high-density genetic map constructed in the early stage of the laboratory, the expression levels of the high-temperature response candidate gene HSP70 of 106 offspring individuals of the constructed map of the Crassostrea gigas and Fujian oyster pseudo-backcross F2 (ZF2-3) were determined, and then eQTL linkage mapping was performed. For the candidate regulatory SNP locus located, the results of the association analysis verification in another Crassostrea gigas and Fujian oyster backcross family were obtained.

[0046] The high-density genetic map described above has 1,694 markers, the average distance between markers is 0.8 cM, and the genome coverage is 98.7%.

[0047] The expression amount of HSP70 gene of each individual in the 106 offspring individuals of the Crassostrea gigas and Fujian oyster pseudo-backcross F2 generation family (ZF2-3) mapped was detected, and some trans-regulatory sites (trans-eQTLs) were located through linkage mapping analysis of genotypes and gene expression. Through association analysis verification in 95 offspring individuals of another Crassostrea gigas and Fujian oyster pseudo-backcross F2 generation family ZF95, it was found that the Marker13973 locus was significantly related to the expression of HSP70 gene (p<0.05), and could be used for screening high-temperature-resistant oyster individuals.

[0048] The SNP marker screening step related to the expression of high-temperature response genes is as follows:

[0049] Construction of experimental materials: wild individuals of Crassostrea gigas and Fujian oyster were collected to construct two Crassostrea gigas and Fujian oyster pseudo-backcross F2 generation families ZF2-3: the father is a first-generation individual of Crassostrea gigas and Fujian oyster, and the mother is a wild Crassostrea gigas collected in Qingdao.

[0050] Genotyping: the 106 offspring individuals of one pseudo-backcross family were subjected to whole genome genotyping by using reduced genome (GBS), and a high-density genetic map was constructed;

[0051] Determination of gene expression amount: the expression amount of HSP70 gene was determined by qRT-PCR method.

[0052] eQTL linkage analysis: interval mapping method and multiple QTL positioning method were used to perform linkage mapping by using MapQTL6 software, and the eQTL mapping diagram is shown in FIG. 2.Figure 2 , and a candidate trans-regulation site Marker13973 of HSP70 gene was obtained.

[0053] The high-temperature response gene of oyster, heat shock protein gene HSP70, was obtained from the above. An expression regulation site Marker13973 of HSP70 gene was identified by expression quantitative trait loci (eQTL), and the correlation between the site and the expression of HSP70 gene was further verified by association analysis in another independent population ZF. A method for rapidly detecting the genotype was developed for the SNP site. The expression amount of HSP70 gene of the advantageous genotype (CG) of Marker13973 site is 54.4% higher than that of the disadvantageous genotype (CC). Subsequently, individuals with different expression levels of HSP70 gene in response to high temperature can be screened by identifying the genotype of oyster individuals, and then oyster parents resistant to high temperature can be screened for oyster breeding. In addition, it also provides basic research for predicting the adaptation potential of marine organisms under the current severe global climate change. The present application provides a SNP marker significantly related to the expression of HSP70 gene, which has the advantage that the genotype of parent oysters can be identified before seed breeding, thereby improving the tolerance of offspring to high-temperature environment. The SNP marker obtained in the present research has high reliability and stable results.

[0054] Example 1:

[0055] The SNP marker screening step related to the expression of high-temperature response gene is:

[0056] A) Construction of experimental materials: wild individuals of Crassostrea gigas and Crassostrea hongkongensis were collected to construct two Crassostrea gigas and Crassostrea hongkongensis pseudo-backcross F2 families ZF2-3: the father is a Crassostrea gigas and Crassostrea hongkongensis F1 individual, and the mother is a wild Crassostrea gigas collected in Qingdao.

[0057] B) Genotyping: the 106 offspring individuals of the family were subjected to whole genome genotyping by using reduced genome (GBS), and a high-density genetic map was constructed. For detailed steps, please refer to the article of Wang et al. (Wang et al. 2016).

[0058] 1. Restriction enzyme double digestion 2. Design of adapter and barcode 3. Adapter annealing 4. Construction of sequencing library 5. Library quality control and sequencing 6. Use Stack software to perform SNP genotyping on original Reads 7. Use JoinMap 4.0 to construct a genetic map.

[0059] C) Determination of gene expression amount: the expression amount of HSP70 gene was determined by qRT-PCR method, and the frequency distribution histogram of HSP70 gene expression amount of 106 oyster individuals of ZF2-3 family is shown in Figure 1 .

[0060] D) eQTL linkage analysis: MapQTL6 software was used to perform linkage analysis by interval mapping and multiple QTL mapping. The cofactor was selected by interval mapping, and multiple QTL mapping was performed multiple times until stable results were obtained. The LOD threshold was obtained by 3000 times of permutation test, and the sites exceeding the threshold of chromosome level were considered to be significantly related to the expression of the target gene, and the candidate trans-regulatory site Marker13973 of HSP70 gene was obtained. The eQTL mapping diagram is shown in Figure 2. Figure 2 .

[0061] Example 2

[0062] The site obtained above was used to verify its correlation with the expression of HSP70 gene:

[0063] A) Pretreatment of experimental samples: 95 individuals of ZF offspring of the pseudo-backcross F2 generation of Crassostrea gigas and Crassostrea hongkongensis were taken, the father was a Crassostrea gigas and a Crassostrea hongkongensis F1 individual, and the mother was a wild Crassostrea gigas collected in Qingdao. After being washed clean, the single individuals were placed in 35℃ seawater for stress, and the gill tissues were taken and stored in liquid nitrogen for 3 hours, and then stored at -80℃ for standby.

[0064] B) DNA extraction: The DNA of 95 oyster individuals was extracted according to the instructions of the Genomic DNA Extraction Kit for Marine Animal Tissues. The DNA concentration was determined by Nanodrop 2000 spectrophotometer. The quality was identified by 1.0% gel electrophoresis.

[0065] C) Genotyping: SNaPshot (multiple single base extension technology) was used to detect the genotype of each individual target site (Marker13973).

[0066] Using the above extracted DNA template, the target fragment was amplified by peripheral primer, and then the specific single base primer was used for SNaPshot PCR to detect the genotype of the target site.

[0067] 1) The specific peripheral primer was used to amplify the periphery of the SNP site:

[0068] Template: The extracted DNA sample was diluted to 20 ng / μl and used as a PCR template;

[0069] Primer sequence:

[0070] Marker13973-F: 5'-TACATTAACTGTAAATTAATTCAACTTT-3';

[0071] Marker13973-R: 5'-TCTTAAAAAAGTAGAGAAAAATATGAA-3';

[0072] Reaction system:

[0073] Component Volume DNA polymerase 22 μl Forward primer 1 μl Reverse primer 1 μl Template DNA 1 μl Total 25 μl

[0074] Reaction procedure:

[0075]

[0076] 2) The SNP site was detected using specific primers:

[0077] SNaPshot PCR: In this reaction system, the primer is extended by one base and terminated.

[0078] Template: The above PCR product was purified and used as the reaction template for SNaPshot PCR.

[0079] Single base extension primer sequence:

[0080] Marker13973:

[0081] 5'-TTTTTTTTTTTTTTTTTTTTTTTTTTTTTTTTTTTATGCAGTACATTTCATCATT TG-3';

[0082] The single base extension primer was diluted to 10 μM, equal volumes of single base extension primers for each site were mixed to obtain Pooled Primers, and SNaPshot PCR was performed;

[0083] The PCR system and components are as follows:

[0084] Component Volume DNA polymerase 2 μl Mixed primer 2 μl PCR product after purification 1 μl Total 5 μl

[0085] Reaction procedure:

[0086]

[0087] The above amplification product was then subjected to capillary electrophoresis on a 3730 sequencer to identify the genotype of each individual at this marker (Marker13973), specifically:

[0088] Component Volume (μl) HiDi (formamide) 9.09 GS120 LIZ (special molecular ruler) 0.91 SNaPshot product 1 Total 11

[0089] After adding each component in turn according to the above system, pre-denature at 95℃ for 5 minutes, cool at -20℃, then perform capillary electrophoresis detection on 3730 sequencer. Analyze the accurate site data using Gene mapper 4.1 software, analyze the data according to the peak corresponding to the SNP site to perform genotyping, and the genotyping results are shown in Table 1.

[0090] Table 1

[0091]

[0092] D) RNA extraction: RNA was extracted using a RNAprep pure Tissue Kit reagent box. DNA concentration was determined using a Nanodrop 2000 spectrophotometer. Quality identification was performed using a 1.0% gel electrophoresis method. Reverse transcription was performed to obtain cDNA for subsequent quantitative experiments.

[0093] E) Quantitative PCR: Quantitative PCR primers were designed according to the sequence of the HSP70 gene, and a SYBR fluorescent quantitative kit from Japan TaKaRa Company was used to perform the experiment. The primer sequence is:

[0094] HSP70-F: 5'-TCACTCCGCTGTCGTTGGGTAT-3'

[0095] HSP70-R: 5'-TGTCCATCAGCAGCCGTTGAGA-3'

[0096] Reaction system:

[0097] Reagent Volume (μl) 2 x SYBR Premix Ex Taq 10 Forward primer 0.4 Reverse primer 0.4 Dye II dye 0.4 Diluted 20 times cDNA template 2 DEPC water 6.8 Total 20

[0098] Reaction procedure:

[0099] Stage Temperature Time Cycle number Pre-denaturation 95℃ 30s 1 Denaturation 95℃ 5s 40 Annealing extension 60℃ 30s 40 Incubation 4℃ -- --

[0100] CgEF as an internal reference gene, the gene expression level was normalized by the internal reference, and then 2 -△△CT Method to analyze the relative expression level of the target gene. The HSP70 gene expression level of each offspring individual of the ZF pseudo-backcross family of C. gigas and C. japonica was obtained, and the relevant information is shown in Table 2 below.

[0101] Table 2

[0102] Maximum Minimum Average Standard deviation HSP70 gene expression 2.014 0.223 1.086 0.4612

[0103] E) Association analysis: 95 individuals of Crassostrea gigas were genotyped at Marker 13973 locus and HSP70 gene expression data were imported into Graph Primer software for association analysis. Mann-Whitney test results (see Table 3 and Figure 2 ).

[0104] Table 3 is the expression of HSP70 gene

[0105]

[0106] From Table 1 and Figure 2 It can be seen that Marker 13973 locus is significantly associated with the expression of HSP70 gene (p<0.05), and the expression of HSP70 gene: CG>CC; Subsequently, the oyster individuals with high expression of HSP70 gene can be selected by screening the individual genotypes (CG).

[0107] Example 3

[0108] Using the above obtained Marker 13973 regulatory locus significantly associated with the expression of HSP70 gene, further verify the relationship between this marker genotype and high temperature tolerance:

[0109] The above Marker 13973 locus was verified in Crassostrea gigas (high temperature tolerance) and Crassostrea angulata (high temperature sensitive) to verify its relationship with high temperature tolerance:

[0110] A) Preparation of experimental samples: 50 wild Crassostrea gigas and Crassostrea angulata individuals were collected in Xiamen and Qingdao respectively for subsequent experiments.

[0111] B) DNA extraction: The DNA of the 100 oyster individuals was extracted according to the instructions of the Tian Gen Marine Animal Tissue Genomic DNA Extraction Kit. The DNA concentration was determined by Nanodrop 2000 spectrophotometer. The quality was identified by 1.0% gel electrophoresis.

[0112] C) Genotyping: SNaPshot (multiple single base extension technology) was used to detect the genotype of each individual target site (Marker 13973).

[0113] D) Difference analysis: The chi-square test was used to analyze the difference of the genotype of this site in Crassostrea angulata and Crassostrea gigas, and then the association between genotype and high temperature tolerance was constructed. The results showed that the genotype frequency of Marker 13973 locus was significantly different between Crassostrea angulata and Crassostrea gigas.

[0114] As can be seen from the above, the genotype of the oyster individual can be identified by the SNP marker of the present application, and the individuals with different expression levels of high-temperature response HSP70 are screened, and then the oyster parents resistant to high temperature are screened, which are used for oyster breeding. In addition, it also provides basic research for predicting the adaptation potential of marine organisms under today's severe global climate change. The present application provides a SNP marker which is significantly related to the expression of HSP70 gene, and the advantage is that the genotype of the parent oyster can be identified before the breeding of the seedling, and the tolerance of the offspring to high-temperature environment is improved. The SNP marker obtained in the present research has high reliability and stable results.

[0115] Information sequence of the sequence listing (1) NO. 1 Length: 2111bp

[0116] Type: nucleic acid

[0117] Chain type: single strand

[0118] Topology:

[0119] Molecular type: DNA

[0120] Source: Crassostrea gigas

[0121] Sequence description:

[0122] ATGTACACTGTACAGGGAATGCTGGGACAGGGTATCCTGGGACGGAGTCAGA ACCAATCAGATTACTGTAATCTTGACCCGGGTTGCAGAATTCAGAATGTACGAAATCTGCACGCCAAATCAATGAAGAAACAGATTCCCTTGCTGACCCTAAATGG AAGTCAGTCAATACAGAAGAGAAACAACAGTTCTGGAAAAGTTAAAGGTCAAGTGATTGGAATAGATTTGGGAACAACAAATTATGTGTAGCTGTAATGGAAGGA AAAACTCCCAAAGTTCTGGAAAATTCTGAGGGATCAAGAACAACCCCTTCTGT CGTGGCGTTCACCAAGGATGGAGAGCGCTTAGTGGGGATGCCTGCCAAAAGACAGGCCGTCACCAATGCAGAAAACACATTCTCTGCAACAAAACGTTTGATTGG TCGCCGTTTTGAGGATGCTGAAGTCCAGAAAGACATGAAGACTGCTTCCTTTAAGATTGTAAAGGCCACCAATGGTGATGCATGGGTAGAGGCTCATGGAAAGAT GTATTCCCCTAGTCAAATCGGTGCATTCGTCTTAATGAAAATGAAGGAGACAGCTGACAATTACCTCGGACAGAAGGTCAAGAACGCAGTCATCACAGTTCCAGCT TATTTCAATGACTCTCAGAGACAGGCCACAAAGGATGCTGGTCAAATTTCTGGATTAAACGTGCTGCGAGTCATCAATGAACCAACAGCTGCCGCTCTGGCCTATG GCATGGACAAGACGGACGACAAGCTCATTGCTGTATATGATTTGGGAGGTGGAACTTTCGACATTTCTATTCTGGAGATGCAGAGGGGCGTGTTTGAGGTGAAAT CAACTAATGGGGACACTTTCCTTGGTGGTGAGGATTTCGACAATGCCTTGGTCACATTTTTGGCCAATGAATTCAAACGTGATCAAGGGCTCGATGTAACCAAAGACAACATGGCTATGCAGAGATTGAGAGAAGCAGCAGAGAAAGCCAAGATAGAG CTCTCATCAAGCATGCAGACTGACATCAACCTCCCCTACCTGACAATGGATGCCACAGGACCCAAACACATGAACATGAAACTGACCCGAGCCAAGTTTGAGGGG ATTGTGGAGAGCTTGGTGAAGCGTACGGTCGGACCGTGTCAGAAGGCTATGAGTGATGCCGAGGTCAAGAAGTCCGACATTGGCGATGTCATCCTTGTAGGAGGA ATGACTCGTATGCCCAGGGTGCAAGCATTGGTACAGGAAGTATTTGGTAGAGC ACCAGGAAAGTCGGTCAATCCGGATGAAGCTGTTGCCATGGGAGCAGCCATTCAGGGAGGAGTTTTGGCAGGAGACGTAACTGATGTCCTTCTGTTGGACGTCACT CCGCTGTCGTTGGGTATTGAGACTCTTGGAGGCGTGTTCACAAAACTGATTGACAGAAATACCACCATCCCCACAAAGAAATCTCAGGTTTTCTCAACGGCTGCTG ATGGACAAACCAGTGTGGAGATCAAAGTTTGTCAAGGGGAGAGAGAGATGGCCGCCGACAACAAGCTCCTCGGCCAGTTTATGTTGGTTGGAATTCCCCCTGCCC CTCGTGGAGTCCCTCAAGTTGAAGTGACTTTTGACATTGACGCTAACGGCATTGTAAATGTATCTGCTAGAGACAAGGGAACTGGAAAAGAACAGCAAATCGTGA TCCAGAGTTCTGGAGGTCTTAGCAAGGAGGAGATTGAGAACATGGTGAAGAACGCAGAGAAGTACGCTGCTGAGGACCATGTCAGAAAGGAAAGAGTAGAGGCA GTAAACCAAGCCGATGCTATTATTCACGACACAGAATCCAAACTGGAAGAATTCAAGAGCCAACTCCCAGAGGAGGATGCCAATAAACTGCGGGAACAAATTGCCGGAGTGAAGGAGCTGATCGCCAAGAAGGACCAAGTAGAAGTAGAGGAGCTGAAACAGGCGACCTCTAACATGCAGCAGGCCTCCCTCAAAGTGTTCGAGCTGGC TTACAAAAAGATGTCTGCTGACAGGGAAAGTCAGAGCGGATCCTCATCAAGT GAAGACAGTGGCTCATCAGAATCTAAAGACGAACAGGAAAAGAAGGAGGAG AAGAACTGA

[0123] Information sequence characteristics of the sequence listing (1) NO. 2

[0124] Type: nucleic acid

[0125] Chain type: single-stranded

[0126] Topology:

[0127] Molecule type: DNA

[0128] Source: Crassostrea gigas

[0129] Sequence description:

[0130] AAATAATAATGATGATGTCAGACTCAAACTCCACTTTGAGACAATTTGTTTCTT TCTTTTATCCAACGACTGAAGTACATTAACTGTAAATTAATTCAACTTTATATAGGACACAAAAACACTTAAAACCAACATGTTCTCAAATATCAGTATACCTTGTA TTCCTACGCACTATGAACTTGCGCGAGAGTTGGTGCAACGTAACAGCGCCACAGCCAGCGCGAAATCACTGCGCGTAAAAATAATATAACCAAATGATGAAATGT ACTGCATGTTATGTACTATAATTAATGAATTCTCATGAAATCTACACCAACAAGTATTATTCCATTTTATTTGTATTTCATAAATGTATAATTGTTCATATTTTTCTC TACTTTTTTAAGAGGCTGACCTTCACAAGCTTTTATAAGAAATATAGATTCACAAGGCAGTTCTAACACCTTCTGTTTTATTTTTTTTCCCTTTGTACAGAGATAAAC TCTTTGGAGGGGGGGGGGGG. SEQUENCE LISTING <110> INSTITUTE OF OCEANOGRAPHY, CHINESE ACADEMY OF SCIENCES <120> SNP marker for expression regulation of high temperature response gene HSP70 in Crassostrea gigas and application thereof <160> 2 <170> SIPOSequenceListing 1.0 <210> 1 <211> 2111 <212> DNA <213> Artificial Sequence (Artificial Sequence) <400> 1 atgtacactg tacagggaat gctgggacag ggtatcctgg gacggagtca gaaccaatca 60 gattactgta atcttgaccc gggttgcaga attcagaatg tacgaaatct gcacgccaaa 120 tcaatgaaga aacagattcc cttgctgacc ctaaatggaa gtcagtcaat acagaagaga 180 aacaacagtt ctggaaaagt taaaggtcaa gtgattggaa tagatttggg aacaacaaat 240 tatgtgtagc tgtaatggaa ggaaaaactc ccaaagttct ggaaaattct gagggatcaa 300 gaacaacccc ttctgtcgtg gcgttcacca aggatggaga gcgcttagtg gggatgcctg 360 ccaaaagaca ggccgtcacc aatgcagaaa acacattctc tgcaacaaaa cgtttgattg 420 gtcgccgttt tgaggatgct gaagtccaga aagacatgaa gactgcttcc tttaagattg 480 taaaggccac caatggtgat gcatgggtag aggctcatgg aaagatgtat tcccctagtc 540 aaatcggtgc attcgtctta atgaaaatga aggagacagc tgacaattac ctcggacaga 600 aggtcaagaa cgcagtcatc acagttccag cttatttcaa tgactctcag agacaggcca 660 caaaggatgc tggtcaaatt tctggattaa acgtgctgcg agtcatcaat gaaccaacag 720 ctgccgctct ggcctatggc atggacaaga cggacgacaa gctcattgct gtatatgatt 780 tgggaggtgg aactttcgac atttctattc tggagatgca gaggggcgtg tttgaggtga 840 aatcaactaa tggggacact ttccttggtg gtgaggattt cgacaatgcc ttggtcacat 900 ttttggccaa tgaattcaaa cgtgatcaag ggctcgatgt aaccaaagac aacatggcta 960 tgcagagatt gagagaagca gcagagaaag ccaagataga gctctcatca agcatgcaga 1020 ctgacatcaa cctcccctac ctgacaatgg atgccacagg acccaaacac atgaacatga 1080 aactgacccg agccaagttt gaggggattg tggagagctt ggtgaagcgt acggtcggac 1140 cgtgtcagaa ggctatgagt gatgccgagg tcaagaagtc cgacattggc gatgtcatcc 1200 ttgtaggagg aatgactcgt atgcccaggg tgcaagcatt ggtacaggaa gtatttggta 1260 gagcaccagg aaagtcggtc aatccggatg aagctgttgc catgggagca gccattcagg 1320 gaggagtttt ggcaggagac gtaactgatg tccttctgtt ggacgtcact ccgctgtcgt 1380 tgggtattga gactcttgga ggcgtgttca caaaactgat tgacagaaat accaccatcc 1440 ccacaaagaa atctcaggtt ttctcaacgg ctgctgatgg acaaaccagt gtggagatca 1500 aagtttgtca aggggagaga gagatggccg ccgacaacaa gctcctcggc cagtttatgt 1560 tggttggaat tccccctgcc cctcgtggag tccctcaagt tgaagtgact tttgacattg 1620 acgctaacgg cattgtaaat gtatctgcta gagacaaggg aactggaaaa gaacagcaaa 1680 tcgtgatcca gagttctgga ggtcttagca aggaggagat tgagaacatg gtgaagaacg 1740 cagagaagta cgctgctgag gaccatgtca gaaaggaaag agtagaggca gtaaaccaag 1800 ccgatgctat tattcacgac acagaatcca aactggaaga attcaagagc caactcccag 1860 aggaggatgc caataaactg cgggaacaaa ttgccggagt gaaggagctg atcgccaaga 1920 aggaccaagt agaagtagag gagctgaaac aggcgacctc taacatgcag caggcctccc 1980 tcaaagtgtt cgagctggct tacaaaaaga tgtctgctga cagggaaagt cagagcggat 2040 cctcatcaag tgaagacagt ggctcatcag aatctaaaga cgaacaggaa aagaaggagg 2100 agaagaactg a 2111 <210> 2 <211> 501 <212> DNA <213> Artificial Sequence <400> 2 aaataataat gatgatgtca gactcaaact ccactttgag acaatttgtt tctttctttt 60 atccaacgac tgaagtacat taactgtaaa ttaattcaac tttatatagg acacaaaaac 120 acttaaaacc aacatgttct caaatatcag tataccttgt attcctacgc actatgaact 180 tgcgcgagag ttggtgcaac gtaacagcgc cacagccagc gcgaaatcac tgcgcgtaaa 240 aataatataa ccaaatgatg aaatgtactg catgttatgt actataatta atgaattctc 300 atgaaatcta caccaacaag tattattcca ttttatttgt atttcataaa tgtataattg 360 ttcatatttt tctctacttt tttaagaggc tgaccttcac aagcttttat aagaaatata 420 GATTCAAGGC AGTTCTAACC TTCTGTTTTA TTTTTTTCCC CTTTGTAAGA GATAA 480 ACTCTTTGGAGGGGGGGGGG 501

Claims

1. A primer set for detecting SNP markers, characterized in that, The primer set consists of specific peripheral amplification primers and single-base extension primer gene sequences. Specific peripheral amplification primers are Marker13973-F:5'-TACATTAACTGTAAATTAATTCAACTTT-3'; Marker13973-R:5'-TCTTAAAAAAGTAGAGAAAAATATGAA-3'; And the following single-base extension primer gene sequences, Marker13973: 5'-TTTTTTTTTTTTTTTTTTTTTTTTTTTTTTTTATGCAGTACATTTCATCATTTG-3'; The SNP marker is located at position 251 in the sequence shown in SEQ ID NO:2, and the mutation type is C / G. The genotype is either homozygous or heterozygous, i.e., the genotype is CC or CG.

2. A kit for detecting SNP markers, characterized in that, It includes the primer set as described in claim 1.

3. The application of the primer set of claim 1 or the kit of claim 2 in identifying heat-resistant oyster individuals.

4. The application according to claim 3, characterized in that: Individuals with the genotype CG of the high-temperature response gene HSP70 are high-temperature tolerant oysters.

5. A method for identifying heat-resistant oyster individuals, characterized in that: The genotype of the oyster to be tested is determined by detecting the SNP marker as described in claim 1, and then the dominant individuals of the heat-tolerant oyster are determined based on the genotype; wherein, the individuals with the genotype CG are heat-tolerant oyster individuals.

6. The method for identifying heat-resistant oyster individuals according to claim 5, characterized in that: Genomic DNA was extracted from the oysters to be tested. Using the primer set described in claim 1, PCR amplification was performed with the genomic DNA of the oysters to be tested as a template to amplify the fragment containing the target SNP site. Then, single-base primers were used to perform genotyping detection on the SNP site to identify the genotype of the oysters to be tested. Individuals with the genotype CG were identified as heat-tolerant oysters.

7. The method for identifying heat-resistant oyster individuals according to claim 6, characterized in that: Identify the SNP sites of the oysters to be tested and perform genotyping: a. The extracted DNA sample was diluted to 20 ng / μl and used as a PCR template. Peripheral amplification was performed using specific primers; the peripheral primer sequences were: Marker13973-F:5'-TACATTAACTGTAAATTAATTCAACTTT-3'; Marker13973-R:5'-TCTTAAAAAAGTAGAGAAAAATATGAA-3'; PCR reaction system: DNA polymerase 22 μl, forward primer 1 μl, reverse primer 1 μl, template DNA 1 μl; PCR amplification reaction procedure: ； b. SNaPshot PCR: The PCR product was used as a template for SNaPshot PCR. After product purification, site detection was performed. The single-base specific primer sequences were as follows: Marker13973: 5'-TTTTTTTTTTTTTTTTTTTTTTTTTTTTTTTATCAGTACATTTCATCATTTG-3'; Reaction system: 2 μl DNA polymerase, 2 μl mixed primers, 1 μl purified PCR product; Reaction procedure: ； c. Use the amplification products described above to identify the genotype of each individual.

Images