Molecular markers, identification methods and applications for identifying Sichuan subspecies of sika deer

Abstract

The present invention provides a molecular marker, identification method and application for identifying the Sichuan subspecies of sika deer. In view of the fact that there are no molecular markers and identification methods that can be used to identify the Sichuan subspecies of sika deer in the prior art, the present invention conducts in-depth research on the molecular markers of sika deer, and obtains SNP molecular markers that can be used to identify the Sichuan subspecies of sika deer, and the molecular markers include 5 SNP marker sites. The 5 SNP markers are located on the ATP6 gene fragment and have the characteristics of strong specificity and good stability. The present invention also provides a pair of SNP marker primers that can be used to identify the Sichuan subspecies of sika deer, and establishes an accurate and reliable detection method. The present invention makes up for the deficiency of the molecular marker detection technology that there is currently no molecular marker detection technology for identifying the Sichuan subspecies of sika deer in the field, realizes the accurate identification of sika deer subspecies, and has important theoretical and application value for the protection and management of sika deer resources.

Description

Technical Field

[0001] The present invention relates to molecular markers, identification methods and applications for identifying Cervus nippon sichuanicus, and belongs to the technical field of molecular biology. Background Art

[0002] Sika deer (Cervus nippon) belongs to the class Mammalia, order Artiodactyla, family Cervidae, genus Cervus, and is an iconic animal in the East Asian monsoon region, distributed from the Ussuri River to Vietnam. The currently widely recognized view is that sika deer is divided into 13 subspecies. There are 6 subspecies currently existing in Japan, namely the Hokkaido subspecies (Cervus nippon yesoensis), the Honshu subspecies (Cervus nippon centralis), the nominate subspecies (Cervus nippon nippon), the Yakushima subspecies (Cervus nippon yakushimae), the Mageshima subspecies (Cervus nippon mageshimae), and the Ryukyu subspecies (Cervus nippon keramae). There is 1 subspecies in Vietnam: the Vietnamese subspecies (Cervus nippon pseudaxis). There are 6 subspecies of sika deer in China. Among them, the North China subspecies (Cervus nippon mandarinns) and the Shanxi subspecies (Cervus nippon grassianus) are both extinct. The Northeast subspecies (Cervus nippon hortulorum) is distributed in Liaoning, Jilin, Heilongjiang, southeastern Siberia, the Ussuri River basin and Korea. It is relatively large in size, with a bluish-gray abdomen, reddish-brown summer hair, large but sparse white spots, and the white spots are not obvious or even absent in winter hair. The South China subspecies (Cervus nippon kopschi) is distributed in southern Anhui, northwestern Zhejiang, northeastern Jiangxi, etc. It is small in size, with reddish-brown summer hair, relatively large white spots, sparser white spots on the body side, a grayish-brown abdomen, dark brown winter hair, and the white spots are not obvious. The Sichuan subspecies (Cervus nippon sichuanicus) was discovered and identified as a new sika deer subspecies in 1964. Its habitat is mainly located in the Ruoergai Tiebu and Baozuo Nature Reserves in Sichuan. It is large in size, with a white abdomen, dark red-brown summer hair, small and dense white spots, and the white spots are not obvious in winter hair. The Taiwan subspecies (Cervus nippon taiouanus) is mainly distributed in Taiwan. It is small in size, with yellowish-brown summer hair and a darker color at the back of the neck. Both summer and winter hairs have obvious and relatively large white spots.

[0003] At present, the subspecies division of sika deer is mainly based on morphological differences and geographical distribution, and there is a problem of confusion in the classification of genetic resources. The results of the study on the origin and evolution of sika deer based on the whole mitochondrial genome show that there is great genetic differentiation within the Northeast subspecies, and there is gene exchange between domestic sika deer and other sika deer subspecies, which may be natural or human factors. The Sichuan subspecies, South China subspecies and Taiwan subspecies of wild sika deer are all clustered into separate branches in the systematic evolutionary analysis, which indicates that the subspecies-specific SNPs of protein-coding genes in the mitochondrial genome can be used as candidate molecular markers to identify the Sichuan subspecies, South China subspecies and Taiwan subspecies.

[0004] Molecular SNP markers have the advantages of high accuracy, rich variation, and simple operation. Molecular markers are not affected by environmental factors and can directly reflect differences in animal genetic levels. Therefore, they are widely used in animal individual identification and provenance identification.

[0005] Currently, there is no report on the use of molecular markers to identify the Sichuan subspecies of sika deer in this field. SUMMARY OF THE INVENTION

[0006] The purpose of the present invention is to provide a molecular marker and primers and applications for identifying the Sichuan subspecies of sika deer, in view of the deficiencies of the above-mentioned prior art, which will help solve the current problems faced in accurately identifying the subspecies of sika deer.

[0007] The inventors conducted in-depth research on the mtDNA sequences of samples of different subspecies of sika deer and obtained SNP markers and identification methods that can be used to accurately identify the Sichuan subspecies of sika deer, achieving accurate identification of different subspecies of sika deer, which has important theoretical and application value for the protection and management of sika deer resources.

[0008] In one aspect, the present invention provides a molecular marker for identifying the Sichuan subspecies of sika deer, wherein the molecular marker includes five SNP marker sites: S-1 to S-5, and the site information is shown in Table 1:

[0009] Table 1 SNP marker sites used in the present invention to identify Sichuan subspecies of sika deer

[0010] Marker Mitochondrial DNA genome of sika deer Locus Base S-1 306bp fragment of ATP6 gene 31 T / C S-2 306bp fragment of ATP6 gene 73 C / T S-3 306bp fragment of ATP6 gene 173 T / C S-4 306bp fragment of ATP6 gene 235 T / C S-5 306bp fragment of ATP6 gene 257 C / T

[0011] The five SNP sites S-1 to S-5 provided by the present invention are T, C, T, T, C in the Sichuan subspecies of sika deer; and C, T, C, C, T in the non-Sichuan subspecies of sika deer. The non-Sichuan subspecies of sika deer include the Northeast subspecies of sika deer, the South China subspecies of sika deer, the Taiwan subspecies of sika deer, the Hokkaido subspecies of sika deer, the Honshu subspecies of sika deer, the nominate subspecies of sika deer, and the Yakushima subspecies of sika deer.

[0012] The present invention also provides molecular marker primers for identifying Cervus nippon sichuanicus, and the sequences of the primer pair are shown as SEQ ID NO.1 - SEQ ID NO.2. Amplifying a sample to be tested with the primer pair can obtain a 306bp fragment of the ATP6 gene.

[0013] The present invention also provides the application of the above-mentioned molecular marker for identifying Cervus nippon sichuanicus or the primer for identifying Cervus nippon sichuanicus in identifying Cervus nippon sichuanicus; and its application in preparing a kit or in a detection method, where the use of the kit or detection method is to identify Cervus nippon sichuanicus.

[0014] The present invention further provides a method for identifying Cervus nippon sichuanicus, and the method is as follows: extracting the DNA of the sample to be tested, and performing PCR amplification with the primer pair shown as SEQ ID NO.1 - SEQ ID NO.2; sequencing the PCR product, and identifying whether the sample to be tested is Cervus nippon sichuanicus according to the bases at the SNP marker sites. If the 5 SNP sites of the amplified fragment sequence are T, C, T, T, C respectively, the sample to be tested is Cervus nippon sichuanicus; if the 5 SNP sites are C, T, C, C, T respectively, the sample to be tested is not Cervus nippon sichuanicus.

[0015] Advantages of the present invention:

[0016] (1) The present invention determines 5 SNP sites specific for identifying Cervus nippon sichuanicus, obtains a pair of identification primers, and establishes a method for identifying specific SNPs of Cervus nippon sichuanicus. The present invention makes up for the deficiency that there is currently no molecular detection technology for identifying Cervus nippon sichuanicus in this field, and realizes the accurate identification of Cervus nippon germplasm resources.

[0017] (2) The method of the present invention takes the differential SNPs of Cervus nippon subspecies as the judgment basis, provides a stable and reliable molecular detection method for the subspecies-level identification of Cervus nippon resources, expands the range of available marker sites of Cervus nippon at the gene level, provides new ideas and methods for the identification of Cervus nippon germplasm resources, and has important theoretical and application values in aspects such as the DNA fingerprint mapping of Cervus nippon and the protection and management of wild subspecies.

[0018] (3) The selected sites of the present invention have good stability and the identification method has extremely high accuracy. 120 Cervus nippon samples from China and Japan were detected by the method of the present invention. The results show that: among the 120 samples, 5 samples are Cervus nippon sichuanicus, and the rest are not. The detection accuracy is 100%.

[0019] (4) For the 5 SNP sites of the present invention, only one pair of primers is required, and the efficiency is extremely high. Description of the Drawings

[0020] Figure 1SNP sites with differences in the mtDNA sequences between Cervus nippon sichuanicus and other subspecies of the present invention. In the figure: Cervus nippon hortulorum: Northeast subspecies; Cervus nippon sichuanicus: Sichuan subspecies; Cervus nippon kopschi: South China subspecies; Cervus nippon taiouanus: Taiwan subspecies; Cervus nippon yesoensis: Hokkaido subspecies; Cervus nippon centralis: Honshu subspecies; Cervus nippon nippon: Nominate subspecies; Cervus nippon yakushimae: Yakushima subspecies

[0021] Figure 2 PCR result diagram of Example 2. In the figure, M: DNA Marker 1000; the band obtained by amplification with the primer pair is in Lane 1. Specific embodiments

[0022] The present invention will be further described below in conjunction with specific embodiments, but the present invention is not limited thereto. The methods involved in the present invention are common methods in the art unless otherwise specified, and the reagents involved can be obtained from commercial channels unless otherwise specified.

[0023] Example 1. Obtaining specific SNP markers for identifying Cervus nippon sichuanicus

[0024] 1. Screening of specific SNP sites of Cervus nippon sichuanicus

[0025] Combined with the measured mtDNA sequences of samples of different subspecies such as Cervus nippon hortulorum, Cervus nippon sichuanicus, Cervus nippon kopschi, Cervus nippon taiouanus, Cervus nippon yesoensis, Cervus nippon centralis, Cervus nippon nippon, and Cervus nippon yakushimae, Mega6.0 was used for alignment and analysis. Mainly, sites that are common to the same subspecies and specific to other subspecies were screened, and 5 differential SNP sites were screened, as shown in Figure 1 and Table 1. The 5 marker sites are all located on the 306bp fragment of the ATP6 gene in the mtDNA genome of Cervus nippon; Marker S-1 is at the 31st bp, with base T in the Sichuan subspecies and base C in non-Sichuan subspecies; Marker S-2 is located at the 73rd bp, with base C in the Sichuan subspecies and base T in non-Sichuan subspecies; Marker S-3 is at the 173rd bp, with base T in the Sichuan subspecies and base C in non-Sichuan subspecies; Marker S-4 is at the 235th bp, with base T in the Sichuan subspecies and base C in non-Sichuan subspecies; Marker S-5 is located at the 257th bp, with base C in the Sichuan subspecies and base T in non-Sichuan subspecies. The non-Sichuan subspecies include Cervus nippon hortulorum, Cervus nippon kopschi, Cervus nippon taiouanus, Cervus nippon yesoensis, Cervus nippon centralis, Cervus nippon nippon, and Cervus nippon yakushimae.

[0026] 2. Primer Design

[0027] Use Mega6.0 to intercept the ATP6 gene fragment, which is about 450 bp according to the front and back sequences, and is used to design the identification primers.

[0028] According to the intercepted target gene fragment, combine Primer5.0 and Oligo7.0 to design the identification primers. The primer pair for amplifying the ATP6 gene fragment is obtained:

[0029] F: 5'ATTAACCAAAACACAAAAACAAAATACCCCTT3' (SEQ ID NO.1);

[0030] R: 5'AGTATGGGGATTAGTGGGGTTGG3' (SEQ ID NO.2).

[0031] After the primers are designed, they are synthesized by Sangon Biotech (Shanghai) Co., Ltd.

[0032] Example 2. Establishment of a Method for Identifying Cervus nippon sichuanicus

[0033] Use the primer pair shown in SEQ ID NO.1 - SEQ ID NO.2 above to perform PCR experiments to establish a method for identifying Cervus nippon sichuanicus. The PCR amplification conditions are shown in Table 2.

[0034] Table 2 PCR Amplification Conditions

[0035]

[0036] The PCR reaction system is shown in Table 3.

[0037] Table 3 PCR System

[0038]

[0039] The process of the PCR amplification is as follows: pre-denaturation at 94°C for 5 min; denaturation at 94°C for 30 sec, annealing at 58°C for 30 sec, extension at 72°C for 30 sec, for a total of 30 cycles; then extension at 72°C for 5 min, and preservation at 4°C.

[0040] Take 3.5 μL of the PCR product for detection in 1% agarose gel electrophoresis. The electrophoresis result ( Figure 2 ) is consistent with the target fragment, the band is single and dense, and can be used for subsequent sequencing. The band is single and bright, and the size conforms to the size of the target fragment, and can be used for sequencing.

[0041] Sequencing the PCR products, and the samples to be tested can be identified as Cervus nippon sichuanicus according to the bases at the SNP marker sites. The sequence of Cervus nippon sichuanicus is shown in SEQ ID NO.3; the sequence of Cervus nippon other than sichuanicus is shown in SEQ ID NO.4.

[0042] The experimental results show that the method for effectively identifying Cervus nippon sichuanicus and other subspecies has been successfully established in the present invention.

[0043] Example 3. Specific application of the method for identifying Cervus nippon sichuanicus in the present invention

[0044] A total of 120 samples collected from China and Japan were selected, and the genomic DNA was extracted respectively. Experimenter A randomly mixed these samples, re-numbered them, and Experimenter B used the primers designed in the present invention to perform PCR amplification on these samples. The amplification products were sent to Sangon Biotech (Shanghai) Co., Ltd. for sequencing. By viewing the sequencing peak map with Bioedit 7.0, the peaks and valleys of the sequencing result map were separated, without overlap and misreading, indicating that the sequencing result was reliable. The sequences were aligned with Mega6.0, and the bases at the specific SNP sites of Cervus nippon sichuanicus were used as the judgment basis.

[0045] It was determined according to the mtDNA-specific SNP molecular marker determined in the present invention. The identification results are shown in Table 4, and the results are represented by yes / no for sichuanicus / other subspecies respectively. The results showed that among the 120 Cervus nippon samples, the first SNP site of the 5 samples S61-S65 was T, the second SNP site was C, the third SNP site was T, the fourth SNP site was T, and the fifth SNP site was C; the first SNP site of the 115 samples S1-S60 and S66-S120 was C, the second SNP site was T, the third SNP site was C, the fourth SNP site was C, and the fifth SNP site was T. After checking with Experimenter A, the 5 samples S61-T65 were indeed sichuanicus, with an accuracy rate of 100%, and the 115 samples S1-S60 and S66-S120 were non-sichuanicus, with an accuracy rate of 100%.

[0046] In summary, it shows that the 5 SNP sites proposed in the present invention have high accuracy and good stability when used to identify Cervus nippon sichuanicus and other subspecies.

[0047] Table 4 Detection results of Cervus nippon samples

[0048]

[0049]

[0050]

[0051]

[0052] Sequence Listing <110> Institute of Special Wild Economic Animal and Plant Sciences, Chinese Academy of Agricultural Sciences <120> Molecular Markers, Identification Methods and Applications for Identifying Cervus nippon sichuanicus <141> 2022-05-31 <160> 4 <170> SIPOSequenceListing 1.0 <210> 1 <211> 32 <212> DNA <213> Artificial sequence <400> 1 attaaccaaa acacaaaaac aaaatacccc tt 32 <210> 2 <211> 23 <212> DNA <213> Artificial sequence <400> 2 agtatgggga ttagtggggt tgg 23 <210> 3 <211> 306 <212> DNA <213> Cervus nippon <400> 3 aataatacta ggccttccac tagctactct tatcgttata tttcctagcc tattatttcc 60 aacatcaaat cgcctagtaa ataaccgtct tatttccctc caacaatgga tacttcaact 120 tgtatcaaaa caaataatag gaattcacaa tgccaaagga caaacatgaa cattaatact 180 catgtctcta atcttattta ttggatccac aaatcttctg ggcttattac cccattcatt 240 tacaccaacc acacaactat caataaacct aggcatagcc attcccctgt gagcaggagc 300 tgtaat 306 <210> 4 <211> 306 <212> DNA <213> Sika deer (Cervus nippon) <400> 4 aataatacta ggccttccac tagctactct catcgttata ttccctagcc tattatttcc 60 aacatcaaat cgtctagtaa ataaccgtct tatttccctc caacaatgga tacttcaact 120 tgtatcaaaa caaataatag gaattcacaa tgccaaagga caaacatgga cactaatact 180 catgtctcta atcttattta ttggatccac aaatcttctg ggcttattac cccactcatt 240 tacaccaacc acacaattat caataaacct aggcatagcc attcccctgt gagcaggagc 300 tgtaat 306

Claims

1. Molecular markers for identifying Sichuan subspecies of sika deer, characterized by: The molecular marker is located in the 306bp fragment of the ATP6 gene in the mtDNA genome of sika deer, and the fragment is shown in SEQ ID NO.

3. There are 5 SNP sites S-1, S-2, S-3, S-4, and S-5. The S-1 site is the 31bp base of the 306bp fragment of the ATP6 gene, which is T / C; the S-2 site is the 73bp base of the 306bp fragment of the ATP6 gene, which is C / T; the S-3 site is the 173bp base of the 306bp fragment of the ATP6 gene, which is T / C; the S-4 site is the 235bp base of the 306bp fragment of the ATP6 gene, which is T / C; the S-5 site is the 257bp base of the 306bp fragment of the ATP6 gene, which is C / T; the 5 SNP sites S-1 to S-5 are T, C, T, T, and C in the Sichuan subspecies of sika deer; and are C, T, C, C, and T in non-Sichuan subspecies of sika deer.

2. The molecular marker for identifying the Sichuan subspecies of sika deer as claimed in claim 1, characterized in that: The non-Sichuan subspecies of sika deer are the Northeast subspecies of sika deer, the South China subspecies of sika deer, the Taiwan subspecies of sika deer, the Hokkaido subspecies of sika deer, the Honshu subspecies of sika deer, the nominate subspecies of sika deer, and the Yakushima subspecies of sika deer.

3. A primer for identifying the Sichuan subspecies of sika deer, characterized in that: The primer pair sequences are shown in SEQ ID NO.1 and SEQ ID NO.

2.

4. The primer for identifying the Sichuan subspecies of sika deer as claimed in claim 3, characterized in that: The primer pair is used to amplify a 306 bp fragment of the ATP6 gene of sika deer.

5. Use of the molecular marker for identifying the Sichuan subspecies of sika deer as described in claim 1 or the primer for identifying the Sichuan subspecies of sika deer as described in claim 3 in identifying the Sichuan subspecies of sika deer.

6. Use of the molecular marker for identifying the Sichuan subspecies of sika deer according to claim 1 or the primer for identifying the Sichuan subspecies of sika deer according to claim 3 in preparing a kit or in a detection method, characterized in that: The kit or detection method is used to identify the Sichuan subspecies of sika deer.

7. A method for identifying the Sichuan subspecies of sika deer, characterized in that: The method comprises: extracting DNA of a sample to be tested, and performing PCR amplification using the primers described in claim 3; The PCR products were sequenced, and the bases at the SNP marker sites were used to identify whether the sample was the Sichuan subspecies of sika deer.

8. A kit for identifying the Sichuan subspecies of sika deer, characterized in that: The kit comprises the primer pair according to claim 3.

Images