Molecular markers, identification methods and applications for identifying the Taiwan subspecies of sika deer

Abstract

The present invention provides a molecular marker, identification method and application for identifying the Taiwan subspecies of sika deer. The molecular marker includes two SNP marker sites, both of which are located on the 572bp fragment of the COX2 gene of the mtDNA genome of sika deer; the marker S‑1 is at the 101bp, which is base A in the Taiwan subspecies and base G in non-Taiwan subspecies; the marker S‑2 is located at the point. The present invention provides an accurate and reliable detection method, which makes up for the deficiency of the molecular marker detection technology for identifying the Taiwan subspecies of sika deer in the field, realizes the accurate identification of sika deer subspecies, and has important theoretical and application value for the protection and management of sika deer resources.

Description

Technical Field

[0001] The invention relates to a molecular marker, an identification method and an application for identifying the Taiwan subspecies of sika deer, and belongs to the technical field of molecular biology. Background Art

[0002] Sika deer (Cervus nippon) belongs to the class Mammalia, order Artiodactyla, family Cervidae, genus Cervus. It is a symbol of the East Asian monsoon region and is distributed from the Wusuli River to Vietnam. The generally accepted view is that sika deer are divided into 13 subspecies. There are 6 subspecies in Japan, namely Hokkaido subspecies (Cervusnipponyesoensis), Honshu subspecies (Cervus nippon centralis), nominate subspecies (Cervusnipponnippon), Yakushima subspecies (Cervus nippon yakushimae), Mageshima subspecies (Cervusnipponmageshimae) and Ryukyu subspecies (Cervus nipponkeramae). There is 1 subspecies in Vietnam: Vietnamese subspecies (Cervus nippon pseudaxis). There are 6 subspecies of Chinese sika deer, of which the North China subspecies (Cervusnipponmandarinns) and the Shanxi subspecies (Cervus nippon grassianus) are both extinct. The Northeast China subspecies (Cervusnippon hortulorum) is distributed in Liaoning, Jilin, Heilongjiang, southeastern Siberia, the Ussuri River Basin and North Korea. It is larger in size, with a blue-gray abdomen, reddish-brown hair in summer, large but sparse white spots, and inconspicuous or even no white spots in winter. The South China subspecies (Cervus nipponkopschi) is distributed in southern Anhui, northwestern Zhejiang and northeastern Jiangxi. It is small in size, with reddish-brown hair in summer, larger white spots, sparse white spots on the sides of the body, gray-brown abdomen, dark brown hair in winter, and inconspicuous white spots. The Sichuan subspecies (Cervus nippon sichuanicus) was discovered in 1964 and identified as a new subspecies of sika deer. Its habitat is mainly located in the Tiebu and Baozuo Nature Reserves in Ruoergai, Taiwan. It is large in size, with a white belly, dark reddish-brown summer fur, small and dense white spots, and inconspicuous white spots in winter fur. The Taiwan subspecies (Cervus nippontaiouanus) is mainly distributed in Taiwan. It is small in size, with yellow-brown summer fur and darker color behind the neck. Both summer and winter fur have obvious large white spots.

[0003] At present, the subspecies division of sika deer is mainly based on morphological differences and geographical distribution, and there is a problem of confusion in the classification of genetic resources. The results of the study on the origin and evolution of sika deer based on the whole mitochondrial genome show that there is great genetic differentiation within the Northeast subspecies, and there is gene exchange between domestic sika deer and other sika deer subspecies, which may be natural or human factors. The Taiwan subspecies, Sichuan subspecies and South China subspecies of wild sika deer are all clustered into separate branches in the phylogenetic analysis, which indicates that the subspecies-specific SNPs of protein-coding genes in the mitochondrial genome can be used as candidate molecular markers to distinguish the Taiwan subspecies, Sichuan subspecies and South China subspecies.

[0004] Molecular SNP markers have the advantages of high accuracy, rich variation, and simple operation. Molecular markers are not affected by environmental factors and can directly reflect differences in animal genetic levels. Therefore, they are widely used in animal individual identification and seed provenance identification.

[0005] At present, there is no report on the use of molecular markers to identify the Taiwan subspecies of sika deer in this field. Summary of the invention

[0006] The purpose of the present invention is to provide a molecular marker and primers and applications for identifying the Taiwan subspecies of sika deer, in view of the deficiencies of the above-mentioned prior art, which will help solve the current problems faced in accurately identifying the Taiwan subspecies of sika deer.

[0007] The inventors conducted in-depth research on the mtDNA sequences of samples of different subspecies of sika deer, and obtained SNP markers and identification methods that can be used to accurately identify the Taiwan subspecies of sika deer, thus achieving accurate identification of different subspecies of sika deer, which has important theoretical and application value for the protection and management of sika deer resources.

[0008] In one aspect, the present invention provides a molecular marker for identifying the Taiwan subspecies of sika deer, wherein the molecular marker includes two SNP marker sites: S-1 to S-2, and the site information is shown in Table 1:

[0009] Table 1 SNP marker sites used in the present invention to identify the Taiwan subspecies of sika deer

[0010] mark Sika deer mtDNA genome Location Base S-1 572 bp fragment of COX2 gene 101bp A / G S-2 572 bp fragment of COX2 gene 500bp C / T

[0011] The two SNP sites S-1 and S-2 provided by the present invention are A and C in the Taiwan subspecies of sika deer; and G and T in the non-Taiwan subspecies of sika deer. The non-Taiwan subspecies of sika deer include the Northeast subspecies of sika deer, the South China subspecies of sika deer, the Sichuan subspecies of sika deer, the Hokkaido subspecies of sika deer, the Honshu subspecies of sika deer, the nominate subspecies of sika deer, and the Yakushima subspecies of sika deer.

[0012] The present invention also provides molecular marker primers for identifying the Taiwan subspecies of sika deer, and the sequences of the primer pairs are shown in SEQ ID NO. 1-SEQ ID NO. 2. The primer pairs are used to amplify the sample to be tested, and a 572 bp fragment of the COX2 gene can be amplified.

[0013] The present invention also provides the use of the above-mentioned molecular markers for identifying the Formosan subspecies of sika deer or primers for identifying the Formosan subspecies of sika deer in identifying the Formosan subspecies of sika deer; and the use of the above-mentioned molecular markers for identifying the Formosan subspecies of sika deer in preparing a kit or in a detection method, wherein the kit or detection method is used to identify the Formosan subspecies of sika deer.

[0014] The present invention further provides a method for identifying the Taiwan subspecies of sika deer, the method comprising: extracting DNA of a sample to be tested, performing PCR amplification using the primer pair shown in SEQ ID NO.1-SEQ ID NO.2; sequencing the PCR product, and identifying whether the sample to be tested is the Taiwan subspecies of sika deer according to the bases of the SNP marker sites. If the two SNP sites of the amplified fragment sequence are A and C, respectively, the sample to be tested is the Taiwan subspecies of sika deer; if the two SNP sites are G and T, respectively, the sample to be tested is not the Taiwan subspecies of sika deer.

[0015] Beneficial effects of the present invention:

[0016] (1) The present invention identifies two SNP sites for identifying the Taiwan subspecies of sika deer, obtains a pair of identification primers, and establishes a method for identifying the Taiwan subspecies of sika deer. The present invention makes up for the lack of molecular detection technology for identifying the Taiwan subspecies of sika deer in the field, and realizes the accurate identification of sika deer germplasm resources.

[0017] (2) The method of the present invention uses the differential SNPs of sika deer subspecies as the basis for determination, providing a stable and reliable molecular detection method for the identification of sika deer subspecies level, expanding the range of available marker sites for sika deer at the genetic level, and providing new ideas and methods for the identification of sika deer germplasm resources. It has important theoretical and application value in the mapping of DNA fingerprints of sika deer and the protection and management of wild subspecies.

[0018] (3) The selected loci of the present invention are stable and the identification method has a very high accuracy. The method of the present invention was used to detect 105 sika deer samples from China and Japan. The results showed that 15 of the 105 samples were Formosan subspecies, and the remaining samples were not Formosan subspecies. The detection accuracy was 100%. BRIEF DESCRIPTION OF THE DRAWINGS

[0019] Figure 1This is the SNP site of the difference in mtDNA sequence between the Taiwan subspecies of sika deer and other subspecies of the present invention. In the figure: Cervus nippon hortulorum: Northeast subspecies; Cervus nippon sichuanicus: Sichuan subspecies; Cervusnippon kopschi: South China subspecies; Cervus nippon taiouanus: Taiwan subspecies; Cervus nipponyesoensis: Hokkaido subspecies; Cervus nippon centralis: Honshu subspecies; Cervus nippon nippon: Nominate subspecies; Cervus nippon yakushimae: Yakushima subspecies

[0020] Figure 2 This is a diagram of the PCR results of Example 2. In the diagram, M: DNAMaker1000; Lane 1 is the band amplified by the primer pair. DETAILED DESCRIPTION

[0021] The present invention is further described below in conjunction with specific embodiments, but the present invention is not limited thereto. The methods involved in the present invention are all commonly used methods in the art unless otherwise specified, and the reagents involved can be obtained from commercial sources unless otherwise specified.

[0022] Example 1: Acquisition of specific SNP markers for identifying the Taiwan subspecies of sika deer

[0023] 1. Screening of specific SNP loci for the Taiwan subspecies of sika deer

[0024] Combined with the mtDNA sequences of samples of different subspecies of sika deer, including the Northeast subspecies, Sichuan subspecies, South China subspecies, Taiwan subspecies, Hokkaido subspecies, Honshu subspecies, nominate subspecies and Yakushima subspecies, Mega6.0 was used for comparison analysis, mainly targeting sites shared by the same subspecies and specific to other subspecies, and 2 differential SNP sites were screened, such as Figure 1 As shown. Both marker sites are located on the 572bp fragment of COX2 gene in the mtDNA genome of sika deer; marker S-1 is at the 101bp, which is base A in the Taiwan subspecies and base G in the non-Taiwan subspecies; marker S-2 is located at the 500bp, which is base C in the Taiwan subspecies and base T in the non-Taiwan subspecies. The non-Taiwan subspecies include the Northeast subspecies of sika deer, the South China subspecies of sika deer, the Sichuan subspecies of sika deer, the Hokkaido subspecies of sika deer, the Honshu subspecies of sika deer, the nominate subspecies of sika deer, and the Yakushima subspecies of sika deer.

[0025] 2. Primer design

[0026] The COX2 gene fragment was cut by Mega6.0, and the total length of about 750 bp was used to design identification primers based on the preceding and following sequences.

[0027] According to the intercepted target gene fragment, the identification primers were designed by combining Primer5.0 and Oligo7.0. The primer pair for amplifying the COX2 gene fragment was obtained:

[0028] F: 5'TGCTACATTTTCATGATCATACATTAATAATTGT3' (SEQ ID NO. 1);

[0029] R: 5'AATATTGATATAATTATTATAAGTCATGTGGACGTG3' (SEQ ID NO. 2).

[0030] After the primers were designed, they were synthesized by Sangon Biotechnology (Shanghai) Co., Ltd.

[0031] Example 2: Establishment of a method for identifying the Taiwan subspecies of sika deer

[0032] The primer pair shown in SEQ ID NO.1-SEQ ID NO.2 was used to perform PCR experiments to establish a method for identifying the Taiwan subspecies of sika deer. The PCR amplification conditions are shown in Table 2.

[0033] Table 2 PCR amplification conditions

[0034]

[0035] The PCR reaction system is shown in Table 3.

[0036] Table 3 PCR system

[0037]

[0038]

[0039] The PCR amplification process is as follows: pre-denaturation at 94°C for 5 min; denaturation at 94°C for 30 sec, annealing at 58°C for 30 sec, extension at 72°C for 30 sec, for a total of 30 cycles; extension at 72°C for another 5 min, and storage at 4°C.

[0040] 3.5 μL of the PCR product was tested by 1% agarose gel electrophoresis. The electrophoresis results ( Figure 2 ) is consistent with the target fragment, the band is single and dense, and can be used for subsequent sequencing. The band is single and bright, and the size is consistent with the target fragment size, and can be used for sequencing.

[0041] The PCR product is sequenced, and the bases of the SNP marker sites can be used to identify whether the sample to be tested is the Taiwan subspecies of sika deer. The Taiwan subspecies sequence of sika deer is shown in SEQ ID NO.3; the non-Taiwan subspecies sequence of sika deer is shown in SEQ ID NO.4.

[0042] The experimental results show that the present invention has successfully established a method for effectively distinguishing the Taiwan subspecies of sika deer from other subspecies.

[0043] Example 3. Specific application of the method of the present invention for identifying the Taiwan subspecies of sika deer

[0044] A total of 105 samples collected from China and Japan were selected, and genomic DNA was extracted respectively. The samples were randomly mixed and renumbered by experimenter A. The samples were amplified by PCR by experimenter B using the primers designed by the present invention, and the amplified products were sent to Sangon Biotech (Shanghai) Co., Ltd. for sequencing. The sequencing peak graph was viewed by Bioedit 7.0, and the peaks and valleys of the sequencing result graph were separated, without overlap and misreading, indicating that the sequencing results were credible. The sequences were aligned by Mega6.0, and the bases of the specific SNP sites of the Taiwan subspecies of sika deer were used as the basis for judgment.

[0045] The determination was made according to the mtDNA specific SNP molecular markers determined by the present invention. The identification results are shown in Table 4, and the results are indicated by yes / no as Taiwan subspecies / other subspecies. The results show that among the 105 sika deer samples, the S-1 and S-2 sites of the 15 samples T1-T15 were A and C respectively, and the S-1 and S-2 sites of the 90 samples T16-T105 were G and T respectively. After checking with experimenter A, the 15 samples T1-T15 were indeed Taiwan subspecies with an accuracy rate of 100%, and the 90 samples T16-T105 were non-Taiwan subspecies with an accuracy rate of 100%.

[0046] In summary, it is shown that the two SNP sites proposed in the present invention have high accuracy and good stability when used to distinguish the Taiwan subspecies of sika deer from other subspecies.

[0047] Table 4 Sika deer sample test results

[0048]

[0049]

[0050]

[0051] Sequence Listing <110> Specialty Products Research Institute, Chinese Academy of Agricultural Sciences <120> Molecular markers, identification methods and applications for identifying the Taiwan subspecies of sika deer <141> 2022-05-31 <160> 4 <170> SIPOSequenceListing 1.0 <210> 1 <211> 34 <212> DNA <213> Artificial sequence <400> 1 tgctacattt tcatgatcat acattaataa ttgt 34 <210> 2 <211> 36 <212> DNA <213> Artificial sequence <400> 2 aatattgata taattattat aagtcatgtg gacgtg 36 <210> 3 <211> 612 <212> DNA <213> Cervus nippon <400> 3 caaaattaac acacactagc acaatagacg ctcaagaggt agagacaatc tgaacaatcc 60 taccggctgt catcctaatt ttaattgctc tcccatcttt acgaatttta tatatgatgg 120 atgaaattaa caatccatct ctcacagtaa aaactatagg acatcaatga tattgaagct 180 acgaatatac agattatgag gacttaagct tcgactccta tataattcca acatcagaat 240 taaaaccagg agaattacga ctactagagg tagataaccg ggttgtccta ccaatagaaa 300 taacaatccg aatgttagtc tcctctgaag acgtactgca ctctgagcc gtaccctc 360 taggactaaa aacggacgca atcccaggcc gcctaaacca aaaactct atatcaactc 420 gaccaggtct atattacgga caatgctctg aaatctgcgg atcaatcac agctcatac 480 ctatcgttct tgaactagtc ccattaaatt atttcgaaa atgatctgca tcaatactat 540 aaatgccgca actagacacg tccacatgac tatataat tatatcaata ttttagctc 600 she catches it 612 <210> 4 <211> 612 <212> DNA <213> Cervus nippon <400> 4 caaaattaac accacactagc acatagacg ctcaagaggt agagacaatc tgaacaatcc 60 taccggctgt tatcctaatt ttaattgctc ttccatctt gcgaatttta tatatgatag 120 atgaaattaa caatccatct ctcacagtaa aagctatagg acatcaatga tattgaagct 180 acgagtatac agattgag gacctaagct tcgactccta tataattcca acatcagaat 240 taaaaccagg agaattacga ctactagagg tagataccg ggttgttcta ccaatagaaa 300 taacaatccg atattagtc tcctctgaag acgtactgca ctctgagcc gtaccctc 360 taggactaaa aacggacgca atcccaggcc gcctaaacca aaaactct atatcaactc 420 gaccaggtct atattacgga caatgctctg aaatctgcgg atcaatcac agctcatac 480 ctatcgttct tgaactagtt ccattaaatt acttcgaaaa atgatctgca tcaatactat 540 aaatgccgca actagacacg tccacatgac tatataat tatatcaatg ttttaactc 600 she catches it 612

Claims

1. The molecular markers used to identify the Taiwan subspecies of sika deer are characterized by: The molecular marker is located in the 572bp fragment of the COX2 gene in the mtDNA genome of sika deer, and the fragment is shown in SEQ ID NO.

3. It has two SNP sites S-1 and S-2. The S-1 site is the 101bp base of the 572bp fragment of the COX2 gene, which is A / G; the S-2 site is the 500bp base of the 572bp fragment of the COX2 gene, which is C / T; the two SNP sites S-1 and S-2 are A and C in the Taiwan subspecies of sika deer; and G and T respectively in non-Taiwan subspecies of sika deer.

2. The molecular marker for identifying the Taiwan subspecies of sika deer as claimed in claim 1, characterized in that: The non-Taiwan subspecies of sika deer are the Northeast subspecies of sika deer, the South China subspecies of sika deer, the Sichuan subspecies of sika deer, the Hokkaido subspecies of sika deer, the Honshu subspecies of sika deer, the nominate subspecies of sika deer, and the Yakushima subspecies of sika deer.

3. A primer for identifying the Taiwan subspecies of sika deer, characterized in that: The primer pair sequences are shown in SEQ ID NO.1 and SEQ ID NO.

2.

4. The primer for identifying the Taiwan subspecies of sika deer as claimed in claim 3, characterized in that: The primer pair is used to amplify a 572 bp fragment of the COX2 gene of sika deer.

5. Use of the molecular marker for identifying the Formosan subspecies of sika deer as claimed in claim 1 or the primer for identifying the Formosan subspecies of sika deer as claimed in claim 4 in identifying the Formosan subspecies of sika deer.

6. Use of the molecular marker for identifying the Formosan subspecies of sika deer according to claim 1 or the primer for identifying the Formosan subspecies of sika deer according to claim 4 in preparing a kit or in a detection method, characterized in that: The kit or detection method is used to identify the Taiwan subspecies of sika deer.

7. A method for identifying the Taiwan subspecies of sika deer, characterized in that: The method comprises: extracting DNA of a sample to be tested, and performing PCR amplification using the primers described in claim 3; The PCR products are sequenced, and the bases at the SNP marker sites can be used to identify whether the sample to be tested is the Taiwan subspecies of sika deer.

8. A kit for identifying the Taiwan subspecies of sika deer, characterized in that: The kit comprises the primer pair according to claim 3.

Images