An SDC2 methylation detection kit and its application

By using methylation-dependent restriction endonuclease and universal primers for real-time quantitative PCR, the problems of false positives and low sensitivity in SDC2 gene methylation detection have been solved, achieving high specificity and high sensitivity for early screening of colorectal cancer.

CN114854854BActive Publication Date: 2026-05-26SHANGHAI HEALZONE BIOTECHNOLOGY CO LTD

Patent Information

Authority / Receiving Office
CN · China
Patent Type
Patents(China)
Current Assignee / Owner
SHANGHAI HEALZONE BIOTECHNOLOGY CO LTD
Filing Date
2021-02-03
Publication Date
2026-05-26

Smart Images

  • Figure CN114854854B_ABST
    Figure CN114854854B_ABST
Patent Text Reader

Abstract

This invention provides an SDC2 methylation detection kit and its application. The kit includes a methylation-dependent restriction endonuclease, a capture oligonucleotide, and universal primers. The capture oligonucleotide includes a first universal sequence, a folded sequence, and a binding capture sequence from the 5' end to the 3' end. The folded sequence is at least partially identical to the 5' end sequence of the SDC2 methylation site after digestion with the methylation-dependent restriction endonuclease. The binding capture sequence specifically binds to the fragment region containing the detected SDC2 methylation site. This invention, based on methylation-dependent restriction endonuclease and universal primers, utilizes real-time quantitative PCR technology, eliminating the need for bisulfite conversion, and achieves sensitive and specific detection of SDC2 methylation with a detection limit as low as 10 copies / reaction.
Need to check novelty before this filing date? Find Prior Art

Description

Technical Field

[0001] This invention belongs to the field of biotechnology and relates to an SDC2 methylation detection kit and its application. Background Technology

[0002] Colorectal cancer (CRC) is a common gastrointestinal malignancy. With changes in people's lifestyles, the incidence and mortality rates of colorectal cancer have increased significantly, seriously threatening human health. Early symptoms of colorectal cancer are not obvious. As the tumor grows, symptoms such as changes in bowel habits, rectal bleeding, diarrhea, alternating diarrhea and constipation, and localized abdominal pain may appear. In advanced stages, systemic symptoms such as anemia and weight loss may develop.

[0003] Currently, fecal occult blood test (FOBT) and colonoscopy are the main clinical methods for colorectal cancer screening. As routine screening methods, FOBT is easily affected by food, medication, and other factors, resulting in a high false-positive rate and poor stability. Colonoscopy is an invasive procedure requiring bowel preparation to ensure a good view of the large intestine. Furthermore, colonoscopy carries a series of complications, such as intestinal perforation and peritonitis at the biopsy site. Therefore, patient compliance with colonoscopy is poor. There is an urgent need for colorectal cancer detection methods that offer high compliance, convenient testing, and accurate results to improve screening accuracy.

[0004] DNA methylation refers to the modification of cytosine at the 5' end of a CpG island with methyl groups without altering the DNA sequence, resulting in DNA expression silencing. It is a recognized mechanism of tumorigenesis. Abnormal DNA methylation usually occurs before cell carcinogenesis; therefore, timely detection of DNA methylation can provide early warning of malignant tumors, offering crucial information for early screening, diagnosis, prognosis, and treatment evaluation. Syndecan-2 (SDC2), a protein involved in cell division and migration, is expressed in colonic mesenchymal cells. The methylation level of the SDC2 target region in tumor tissue is significantly higher than that in paired adjacent non-tumor tissues. Related clinical studies have shown that the methylation level of the transcriptional regulatory region of the SDC2 gene in tumor tissue samples is significantly higher than that in adjacent non-tumor tissue samples. The methylation sites of the SDC2 gene are relatively constant, mostly occurring on CpG islands in the promoter region.

[0005] Although SDC2 methylation can serve as an effective biomarker for early screening of CRC, the proportion of abnormally methylated SDC2 is low compared to wild-type genes with normal methylation. The biggest challenge in detecting SDC2 methylation is how to detect trace amounts of abnormally methylated genes in a background of high wild-type genes.

[0006] Bisulfite conversion is the most commonly used method for methylation detection. The principle is that DNA is treated with bisulfite, converting cytosine residues into uracil, while the methylated cytosine residues remain unaffected. Therefore, bisulfite-treated DNA fragments retain only methylated cytosine. Based on this principle, bisulfite can reveal the methylation status of DNA at the single nucleotide level. Several detection methods exist for analyzing bisulfite-treated DNA sequences; the practical problem in analysis is understanding the differences caused by bisulfite altering the base sequence from C to U and ultimately to T.

[0007] However, the bisulfite conversion method also has many shortcomings: (1) Bisulfite sequencing requires that the bisulfite conversion reaction be complete, that is, every unmethylated cytosine is converted into uracil. If the conversion reaction is incomplete, false positive results will occur; (2) Since only single-stranded DNA cytosine can be attacked by bisulfite, DNA needs to be denatured and stranded before conversion. Temperature, salt concentration and other factors must be strictly controlled, otherwise the conversion will fail or be incomplete; (3) DNA may be degraded during the conversion reaction. If the incubation time is too long, the temperature and bisulfite concentration are too high, up to 90% of the DNA may be degraded. The degraded DNA depurinates and forms random breaks, which may lead to PCR amplification failure or a small number of DNA samples, resulting in low accuracy and false negatives; (4) Bisulfite treatment will significantly reduce the complexity of the sample, making it more difficult to design multiplex PCR primers and increasing the error.

[0008] Therefore, developing a highly sensitive DNA methylation detection method that does not require bisulfite treatment or a control reaction has become an urgent problem to be solved. Summary of the Invention

[0009] To address the shortcomings of existing technologies and practical needs, this invention provides an SDC2 methylation detection kit and its application. Based on methylation-dependent restriction endonuclease and universal primer real-time PCR technology, it detects the methylation status at specific sites of the SDC2 gene, which is closely related to colorectal cancer. It has the advantages of not requiring bisulfite conversion, simple operation, high accuracy, and strong specificity.

[0010] To achieve this objective, the present invention adopts the following technical solution:

[0011] In a first aspect, the present invention provides an SDC2 methylation detection kit, the kit comprising a methylation-dependent restriction endonuclease, a capture oligonucleotide, and universal primers;

[0012] The capturing oligonucleotide comprises, from the 5' end to the 3' end, a first universal sequence, a folded sequence, and a binding capture sequence;

[0013] The folded sequence is at least partially identical to the 5' end sequence of the SDC2 methylation site after digestion with a methylation-dependent restriction endonuclease;

[0014] The binding capture sequence can specifically bind to the fragment region where the detected SDC2 methylation site is located.

[0015] In this invention, the SDC2 methylation detection kit mainly comprises two parts: a methylation-dependent restriction endonuclease and a quantitative real-time PCR detection reagent based on universal primers. The methylation-dependent restriction endonuclease digests the methylation site of the SDC2 methylation template to form an intermediate product with a well-defined 5' end sequence. The capture oligonucleotide uses the binding capture sequence to capture this intermediate product and uses it as a template for extension. A nucleotide complementary to the SDC2 methylation gene is added to the 3' end of the capture oligonucleotide to form an extended capture oligonucleotide. The extended capture oligonucleotide pairs with the folded sequence within the molecule through complete or incomplete matching to form a half-hairpin structure product. The half-hairpin structure product undergoes further extension, and a nucleotide complementary to the first universal sequence within the molecule is added to the 3' end to form a complete hairpin structure product. The hairpin structure product is amplified by PCR using universal primers and / or specific primers, and combined with a detection probe, the quantitative real-time PCR detection of the SDC2 methylation site is achieved.

[0016] Preferably, the capturing oligonucleotide further includes a second universal sequence.

[0017] Preferably, the second universal sequence is located at the 5' end of the combined capture sequence.

[0018] Preferably, the capturing oligonucleotide further includes nucleic acid elongation blocking modification.

[0019] Preferably, the nucleic acid extension blocking site is located at the 3' end of the folded sequence.

[0020] Preferably, the nucleic acid extension blocking modification includes any one or a combination of at least two of the following: a spacer, a thio group, or a uracil base.

[0021] Preferably, the folded sequence is modified with a nucleic acid analog, which can suppress the elongation of primer synthesis byproducts while ensuring complementary base pairing in the folded region, thereby improving detection specificity.

[0022] Preferably, the nucleic acid analogue includes any one or a combination of at least two of peptide nucleic acids, locked nucleic acids, transposed bases, 2'-O,4'-C-methylenebridge RNA, 2'-O-Methyl RNA, or 2'-Fluoro RNA.

[0023] Preferably, the nucleic acid sequence of the universal primer is the same as or partially the same as the first universal sequence of the capturing oligonucleotide.

[0024] Preferably, the methylation-dependent restriction endonuclease includes any one or a combination of at least two of GlaI, FspEI, MspJI, LpnPI, AspBHI, or MseI.

[0025] Preferably, the kit further includes a detection probe.

[0026] Preferably, the detection probe is labeled with a fluorescent group and / or a quenching group.

[0027] Preferably, the fluorescent group is labeled on the 5' end of the detection probe.

[0028] Preferably, the quenching group is labeled on the 3' end of the detection probe.

[0029] Preferably, the fluorescent group includes any one of FAM, VIC, JOE, TET, CY3, CY5, ROX, Texas Red, or LCRED460.

[0030] Preferably, the quenching group includes any one of BHQ1, BHQ2, BHQ3, Dabcy1, or Tamra.

[0031] Preferably, the kit further includes DNA polymerase, UDG enzyme, dNTPs, or Mg. 2+ Any one or at least two of them.

[0032] Preferably, the kit further includes an enzyme digestion buffer and / or a PCR buffer.

[0033] Preferably, the kit further includes internal reference gene PCR primers and / or detection probes.

[0034] Preferably, the internal reference gene includes β-actin.

[0035] Preferably, the captured oligonucleotide comprises the nucleic acid sequence shown in SEQ ID NO:1 or SEQ ID NO:6.

[0036] Preferably, the universal primer comprises the nucleic acid sequence shown in SEQ ID NO:2 or SEQ ID NO:3.

[0037] Preferably, the SDC2 methylation-specific primer comprises the nucleic acid sequence shown in SEQ ID NO:7.

[0038] Preferably, the detection probe comprises the nucleic acid sequence shown in SEQ ID NO:4 or SEQ ID NO:8.

[0039] Preferably, the internal reference gene PCR primers comprise the nucleic acid sequences shown in SEQ ID NO:10-11.

[0040] Preferably, the internal reference gene detection probe includes the nucleic acid sequence shown in SEQ ID NO:12.

[0041] Secondly, the present invention provides an SDC2 methylation detection system, the system comprising 1–20 nM capture oligonucleotides, 100–400 nM universal primers, 100–300 nM detection probes, 1–2 U / μL Taq polymerase, 1–2 U / μL UDG enzyme, 100–300 μM dNTPs, 1–5 mM MgCl2 and PCR buffer.

[0042] Preferably, the system further includes 100–300 nM SDC2 methylation-specific primers.

[0043] Thirdly, the present invention provides a method for detecting SDC2 methylation, the method comprising:

[0044] The methylation-dependent restriction endonuclease was used to digest the methylated SDC2 template to be tested. The digested product was added to the system described in the second aspect for quantitative real-time PCR.

[0045] Preferably, the temperature of the enzymatic digestion treatment is 30-40°C, for example, 30°C, 31°C, 32°C, 33°C, 34°C, 35°C, 36°C, 37°C, 38°C, 39°C or 40°C, preferably 37°C.

[0046] Preferably, the enzyme digestion treatment time is 0.5 to 2 hours, for example, it can be 0.5 hours, 1 hour, 1.5 hours or 2 hours, preferably 1 hour.

[0047] Preferably, the program for the real-time PCR is as follows: pre-denaturation at 92–95°C for 2–5 min; denaturation at 92–95°C for 10–20 s, annealing at 65–70°C for 80–100 s, for 10–15 cycles; denaturation at 92–95°C for 10–20 s, annealing at 65–70°C for 20–30 s, for 30–50 cycles.

[0048] Fourthly, the present invention provides an SDC2 methylation detection device, the device comprising:

[0049] Enzyme digestion unit: The methylation-dependent restriction endonuclease was used to digest the methylated SDC2 template to obtain a pretreated product with a well-defined 5' end sequence.

[0050] The real-time PCR unit utilizes a real-time PCR system containing capture oligonucleotides, universal primers, and detection probes to perform real-time PCR detection on pretreated products.

[0051] Preferably, the enzyme digestion unit provides an enzyme digestion temperature of 30-40°C, for example, 35°C, 36°C, 37°C, 38°C, 39°C or 40°C, preferably 37°C.

[0052] Preferably, the enzyme digestion unit provides an enzyme digestion time of 0.5 to 2 hours, for example, 0.5 hours, 1 hour, 1.5 hours or 2 hours, preferably 1 hour.

[0053] Preferably, the real-time PCR program provided by the real-time PCR unit is as follows: pre-denaturation at 92-95℃ for 2-5 min; denaturation at 92-95℃ for 10-20 s, annealing at 65-70℃ for 80-100 s, for 10-15 cycles; denaturation at 92-95℃ for 10-20 s, annealing at 65-70℃ for 20-30 s, for 30-50 cycles.

[0054] Preferably, the real-time PCR unit further includes real-time PCR detection of the pretreated product using SDC2 methylation-specific primers.

[0055] Fifthly, the present invention provides the use of the reagent kit described in the first aspect, the system described in the second aspect, or the device described in the fourth aspect in the preparation of reagents and / or devices for early diagnosis of diseases.

[0056] Preferably, the disease includes a tumor.

[0057] Preferably, the tumor includes any one or a combination of at least two of colorectal cancer, liver cancer, or esophageal cancer.

[0058] Compared with the prior art, the present invention has the following beneficial effects:

[0059] (1) The SDC2 methylation detection kit of the present invention mainly includes two parts: a methylation-dependent restriction endonuclease and a fluorescence quantitative PCR detection reagent based on universal primers. It does not require additional steps such as ligation reaction and chemical treatment of methylated samples. It only requires pretreatment of the sample before PCR detection to obtain a sample with a clear 5' end sequence, thus realizing high specificity and high sensitivity of nucleic acid multiplex detection.

[0060] (2) In the SDC2 methylation detection kit of the present invention, the captured oligonucleotide and the universal primer are specially designed and work together. In the presence of the target molecule, the target molecule triggers the extension reaction mediated by the captured oligonucleotide to form a hairpin structure product, which is used as a template for the universal primer amplification reaction. Since the amplification reaction is based on the enzyme digestion product determined by the 5' sequence, the false positive problem is effectively avoided.

[0061] (3) In this invention, the 3' extension sequence of the captured oligonucleotide and the folding sequence can form a complementary pair, which can trigger the self-folding of the captured oligonucleotide to form a hairpin structure, effectively ensuring the specificity of the reaction;

[0062] (4) The folding sequence of the capture oligonucleotide of the present invention is modified with a nucleic acid analog, which can suppress the extension of primer synthesis byproducts while ensuring complementary base pairing in the folding region, thereby improving detection specificity, and is especially suitable for the detection of target fragments in a high concentration of unmethylated background;

[0063] (5) When the SDC2 methylation detection kit of the present invention is used to detect different target molecules, it is only necessary to design the folding sequence and binding capture sequence of the capture oligonucleotide according to the target molecule, while keeping the first universal sequence unchanged, which greatly reduces the interference between multiple primers in multiple target amplification and improves the sensitivity of amplification.

[0064] (6) The SDC2 methylation detection kit of the present invention achieves signal amplification through an exponential amplification process, which not only meets the sensitivity requirements of DNA / RNA detection, but also the exponential amplification process is completed using only extended capture oligonucleotides and universal primers, which can achieve equivalent amplification of multiple target molecules while keeping the number and concentration of universal primers unchanged, thus avoiding the deviation of amplification efficiency caused by sequence differences.

[0065] (7) The SDC2 methylation detection method of the present invention is simple to operate, can detect SDC2 methylated DNA down to 10 copies, and has high analytical sensitivity. Attached Figure Description

[0066] Figure 1 The results show the analytical sensitivity of the SDC2 gene in methylated samples with different GlaI concentrations.

[0067] Figure 2 The results show the analytical sensitivity of the SDC2 gene in methylated samples with different concentrations of FspEI.

[0068] Figure 3 This refers to the amplified signal of the SDC2 target in a dual amplification system.

[0069] Figure 4 This is the amplification signal of the β-actin internal reference in the dual amplification system;

[0070] Figure 5 The results of sensitivity analysis experiments using the human SDC2 gene methylation detection kit against a fecal DNA background. Detailed Implementation

[0071] To further illustrate the technical means and effects of this invention, the following description, in conjunction with embodiments and accompanying drawings, provides a further explanation of the invention. It is understood that the specific embodiments described herein are merely illustrative of the invention and not intended to limit it.

[0072] Where specific techniques or conditions are not specified in the examples, they shall be performed in accordance with the techniques or conditions described in the literature in this field, or in accordance with the product instructions. Reagents or instruments whose manufacturers are not specified are all conventional products that can be purchased through legitimate channels.

[0073] Example 1: Detection of hypermethylation at relevant sites in the human SDC2 gene

[0074] In this embodiment, Jurkat DNA treated with methyltransferase was used as a positive standard for human SDC2 gene methylation, and nuclease-free water was used as a negative control. The CG site was 5mCG. Specific methylation sites in the SDC2 gene were detected. The steps are as follows:

[0075] (1) The positive standard and negative control were digested with the methylation-dependent restriction endonuclease GlaI. The reaction system consisted of 1×PCR buffer (Nanjing Novizan, P122-d1), 5U GlaI, and different concentrations of genomic DNA, with a total volume of 10μL. The reaction conditions were incubation at 37℃ for 1 hour. After the digestion reaction, the system was heated to 85℃ and incubated for 10 min to heat inactivate GlaI.

[0076] (2) Add SDC2 gene capture oligonucleotides, universal primers, specific primers, and detection probes to the above enzyme digestion reaction system respectively. PCR detection of the methylation status of the SDC2 gene was performed. The PCR amplification system included enzyme-digested DNA template, 5 nM capture oligonucleotides, 150 nM universal primers, 150 nM specific primers, 150 nM detection probes, 0.8 U / μL Taq polymerase, 1 U / μL UDG enzyme, 300 μM dNTPs, and 1×PCR buffer, with a final volume of 20 μL. The PCR reaction program was: 94℃ pre-denaturation for 5 min; 94℃ denaturation for 10 s, 63℃ annealing for 90 s, 10 cycles; 94℃ denaturation for 10 s, 60℃ annealing for 30 s, 40 cycles. Real-time PCR was performed on a ROCHE instrument (480), and the corresponding fluorescence values ​​were collected.

[0077] Capture oligonucleotides (SEQ ID NO:1):

[0078] TGTCAGCCAACGGTATTCATCGCACACGAATCCGGAGCAGATGTGGCACTGACAAGAGTCCCCGAGCCTGAGCC;

[0079] Universal primer 1 (SEQ ID NO:2):

[0080] TGTCAGCCAACGGTATTCATC;

[0081] Universal primer 2 (SEQ ID NO:3):

[0082] CGGCGTCAGATGTGGCACTGACAA;

[0083] Detection probe (SEQ ID NO:4):

[0084] FAM-CAATCGCTGCGGTACTC-MGB;

[0085] The human SDC2 gene is shown in SEQ ID NO:5, where the underlined areas indicate methylation sites and / / indicates restriction enzyme sites.

[0086] AGCCCG C / / G CACACGAATCCGGAGCAGAGTACCGCAGCGATTGCGGCTCAGGCTCGGGGACTCGGGCT.

[0087] like Figure 1 The figure shows the sensitivity detection of the SDC2 gene in methylated samples of different concentrations. From left to right, they are DNA methylation positive samples of 1200 copies / reaction, 120 copies / reaction, and 12 copies / reaction, respectively. As can be seen from the qPCR curves, there is a clear concentration gradient in the amplification. DNA methylation templates as low as about 10 copies can be detected by enzyme digestion and amplification, indicating that the system has high sensitivity.

[0088] Example 2: SDC2 genome FspEI digestion and amplification results

[0089] In this embodiment, Jurkat DNA treated with methyltransferase was used as a positive standard for human SDC2 gene methylation, and nuclease-free water was used as a negative control. The CG site was 5mCG. Specific methylation sites in the SDC2 gene were detected. The steps are as follows:

[0090] (1) The positive standard and negative control were digested with the methylation-dependent restriction endonuclease FspEI. The reaction system was as follows: Buffer (NEB, R0662S), 1×Enzyme Activator Solution, 5U FspEI, and different concentrations of genomic DNA were added to a total system of 10μL. The reaction conditions were: incubation at 37℃ for 1 hour; after the enzyme digestion reaction, the system was heated to 85℃ and incubated for 10 minutes to heat-inactivate the FspEI.

[0091] (2) Add SDC2 gene capture oligonucleotides, universal primers, specific primers, and detection probes to the above enzyme digestion reaction system respectively. PCR detection of the methylation status of the SDC2 gene was performed. The PCR amplification system included enzyme-digested DNA template, 5 nM capture oligonucleotides, 150 nM universal primers, 150 nM specific primers, 150 nM detection probes, 0.8 U / μL Taq polymerase, 1 U / μL UDG enzyme, 300 μM dNTPs, and 1×PCR buffer, with a final volume of 20 μL. The PCR reaction program was: 94℃ pre-denaturation for 5 min; 94℃ denaturation for 10 s, 66℃ annealing for 90 s, 10 cycles; 94℃ denaturation for 10 s, 65℃ annealing for 30 s, 40 cycles. Real-time PCR was performed on a ROCHE instrument (480), and the corresponding fluorescence values ​​were collected.

[0092] Capture oligonucleotides (SEQ ID NO:6):

[0093] TGTCAGCCAACGGTATTCATCGGAGCGCCACC+TG+GG / spacer18 / AAGGGTGACCGGACGAGCGCA (The base following the + indicates that the base modifies the locked nucleic acid);

[0094] Universal primer 1 (SEQ ID NO:2):

[0095] TGTCAGCCAACGGTATTCATC;

[0096] SDC2 specific primer (SEQ ID NO:7):

[0097] TGTCCCAGCGGATCTCCGGT;

[0098] Detection probe (SEQ ID NO:8):

[0099] FAM-CCCAGTCCCCAAGTATAC-MGB;

[0100] The human SDC2 gene is shown in SEQ ID NO:9, where the underlined areas indicate methylation sites and / / indicates restriction enzyme sites.

[0101] AGCC CG CAGGGAATAGG / / GGAGCGCCACCTGGGGAACCCCCAGTCCCCAAGTATACACCGGAGATCCGCTGGGACAAATGCGCTCGTCCGGTCACCCTTTCCCCCT.

[0102] like Figure 2 As shown, FspEI was used to digest methylation-positive genomes, followed by amplification. Methylation-positive genomes of 1200 copies, 120 copies, and 40 copies were all amplified, indicating that the FspEI system can also detect specific methylation sites with high sensitivity. The methylation detection model is applicable to various digestion systems.

[0103] Example 3: Human SDC2 gene methylation detection kit

[0104] In this embodiment, Jurkat DNA treated with methyltransferase was used as a positive standard for human SDC2 gene methylation, and nuclease-free water was used as a template-free control. The CG site was 5mCG, which was incorporated into the fecal sample DNA for SDC2 gene methylation site detection. The steps are as follows:

[0105] (1) The mixed samples and template-free control were digested with the methylation-dependent restriction endonuclease GlaI. The reaction system consisted of 1×PCR buffer (purchased from Nanjing Novizan, P122-d1), 5U GlaI, and different concentrations of genomic DNA, with a total system volume of 10μL. The reaction conditions were incubation at 37℃ for 1 hour. After the digestion reaction, the system was heated to 85℃ and incubated for 10 minutes to heat-inactivate GlaI.

[0106] (2) Add SDC2 gene-capturing oligonucleotides, universal primers, SDC2-specific primers, SDC2 detection probes, β-actin gene primer pairs, and β-actin detection probes to the above-mentioned enzyme digestion reaction system, respectively. PCR was used to detect the methylation status of the SDC2 gene and the expression level of β-actin. The PCR amplification system included enzyme-digested DNA template, 5 nM SDC2-capturing oligonucleotides, 150 nM universal primers, 150 nM SDC2-specific primers, 150 nM SDC2 detection probes, 150 nM β-actin-specific primer pairs, 150 nM β-actin detection probes, 1 U / μL Taq polymerase, 1 U / μL UDG enzyme, and 300 μM... dNTPs and 1×PCR buffer were used in a final volume of 20 μL. The PCR reaction program was as follows: 94℃ pre-denaturation for 5 min; 94℃ denaturation for 10 s, 66℃ annealing for 90 s, 10 cycles; 94℃ denaturation for 10 s, 65℃ annealing for 30 s, 40 cycles. Real-time PCR was performed on a ROCHE instrument (480), and the corresponding fluorescence values ​​were collected.

[0107] SDC2 gene captures oligonucleotides (SEQ ID NO:1):

[0108] TGTCAGCCAACGGTATTCATCGCACACGAATCCGGAGCAGATGTGGCACTGACAAGAGTCCCCGAGCCTGAGCC;

[0109] Universal primer 1 (SEQ ID NO:2):

[0110] TGTCAGCCAACGGTATTCATC;

[0111] Universal primer 2 (SEQ ID NO:3):

[0112] CGGCGTCAGATGTGGCACTGACAA;

[0113] SDC2 detection probe (SEQ ID NO:4):

[0114] FAM-CAATCGCTGCGGTACTC-MGB;

[0115] β-actin-F (SEQ ID NO:10):

[0116] TGGTGATGGAGGAGGCTC;

[0117] β-actin-R (SEQ ID NO:11):

[0118] AGCCAATGGGACCTGCTC;

[0119] β-actin detection probe (SEQ ID NO:12):

[0120] CY5-CTGTGGCCTCTGCAACCT-BHQ2;

[0121] The human SDC2 gene is shown in SEQ ID NO:5, where the underlined areas indicate methylation sites and / / indicates restriction enzyme sites.

[0122] AGCCCG C / / G CACACGAATCCGGAGCAGAGTACCGCAGCGATTGCGGCTCAGGCTCGGGGACTCGGGCT.

[0123] like Figure 3 and Figure 4 The results of methylation detection are shown. After 80 copies of the sample were incorporated into 200 ng of fecal DNA methylation-positive template, they were stably amplified in both systems containing and without the β-actin internal reference gene. This indicates that the kit and detection system described in this invention can be used in a dual PCR system containing the β-actin internal reference gene without affecting the amplification efficiency.

[0124] Example 4: Sensitivity Analysis Experiment of Human SDC2 Gene Methylation Detection Kit

[0125] In this embodiment, methylated DNA at different ratios of 80 copies (6.7‰), 60 copies (5.0‰), and 40 copies (3.3‰) were introduced into a 400 ng fecal DNA background as test samples. The human SDC2 gene methylation detection kit of Example 3 was used for detection, and the sensitivity of the kit was analyzed.

[0126] The test results are shown in Table 1 and Figure 5 As shown in the figure, the kit can detect as few as 40 copies of methylated host DNA in a 400 ng fecal DNA background, confirming that the kit has high analytical sensitivity.

[0127] Table 1

[0128]

[0129] In summary, this invention combines methylation-dependent restriction endonuclease with PCR amplification based on universal primers, eliminating the need for bisulfite treatment and control reactions. This enables accurate quantitative detection of SDC2 methylated DNA with high sensitivity and specificity, making it suitable for widespread application.

[0130] The applicant declares that the detailed method of the present invention is illustrated by the above embodiments, but the present invention is not limited to the above detailed method, that is, it does not mean that the present invention must rely on the above detailed method to be implemented. Those skilled in the art should understand that any improvements to the present invention, equivalent substitutions of the raw materials of the product of the present invention, addition of auxiliary components, selection of specific methods, etc., all fall within the protection scope and disclosure scope of the present invention. SEQUENCE LISTING <110> Shanghai Maijing Nanotechnology Co., Ltd.; Shanghai Jiao Tong University <120> An SDC2 methylation detection kit and its application <130> 20210129 <160> 12 <170> PatentIn version 3.3 <210> 1 <211> 74 <212> DNA <213> Artificial sequence <400> 1 tgtcagccaa cggtattcat cgcacacgaa tccggagcag atgtggcact gacaagagtc 60 cccgagcctg agcc 74 <210> 2 <211> twenty one <212> DNA <213> Artificial sequence <400> 2 tgtcagccaa cggtattcat c 21 <210> 3 <211> twenty four <212> DNA <213> Artificial sequence <400> 3 cggcgtcaga tgtggcactg acaa 24 <210> 4 <211> 17 <212> DNA <213> Artificial sequence <400> 4 caatcgctgc ggtactc 17 <210> 5 <211> 67 <212> DNA <213> Artificial sequence <400> 5 agcccgcgca cacgaatccg gagcagagta ccgcagcgat tgcggctcag gctcggggac 60 tcgggct 67 <210> 6 <211> 57 <212> DNA <213> Artificial sequence <400> 6 tgtcagccaa cggtattcat cggagcgcca cctgggaagg gtgaccggac gagcgca 57 <210> 7 <211> 20 <212> DNA <213> Artificial sequence <400> 7 tgtcccagcg gatctccggt 20 <210> 8 <211> 18 <212> DNA <213> Artificial sequence <400> 8 cccagtcccc aagtatac 18 <210> 9 <211> 105 <212> DNA <213> Artificial sequence <400> 9 agcccgcagg gaatagggga gcgccacctg gggaaccccc agtccccaag tatacaccgg 60 agatccgctg ggacaaatgc gctcgtccgg tcaccctttc cccct 105 <210> 10 <211> 18 <212> DNA <213> Artificial sequence <400> 10 tggtgatgga ggaggctc 18 <210> 11 <211> 18 <212> DNA <213> Artificial sequence <400> 11 agccaatggg acctgctc 18 <210> 12 <211> 18 <212> DNA <213> Artificial sequence <400> 12 ctgtggcctc tgcaacct 18

Claims

1. An SDC2 methylation detection kit, characterized in that, The kit includes a methylation-dependent restriction endonuclease, a capture oligonucleotide, and universal primers; The capturing oligonucleotide comprises, from the 5' end to the 3' end, a first universal sequence, a folded sequence, and a binding capture sequence; The folded sequence is at least partially identical to the 5' end sequence of the SDC2 methylation site after digestion with a methylation-dependent restriction endonuclease; The binding capture sequence specifically binds to the fragment region containing the detected SDC2 methylation site; The captured oligonucleotide also includes a nucleic acid extension blocking site; The nucleic acid extension blocking site is located at the 3' end of the folded sequence; The nucleic acid extension blocking site is modified with any one or a combination of at least two of the following: a spacer, a thio group, or a uracil base; The nucleic acid sequence of the universal primer is the same as or partially the same as the first universal sequence of the captured oligonucleotide.

2. The reagent kit according to claim 1, characterized in that, The folded sequence is modified with a nucleic acid analog; The nucleic acid analogues include any one or a combination of at least two of peptide nucleic acids, locked nucleic acids, transposed bases, 2'-O,4'-C-methylene bridge RNA, 2'-O-Methyl RNA, or 2'-Fluoro RNA.

3. The reagent kit according to claim 1, characterized in that, The methylation-dependent restriction endonucleases include any one or a combination of at least two of GlaI, FspEI, MspJI, LpnPI, AspBHI, or MseI.

4. The reagent kit according to claim 1, characterized in that, The kit also includes SDC2 methylation-specific primers.

5. The reagent kit according to claim 1, characterized in that, The kit also includes detection probes.

6. The reagent kit according to claim 5, characterized in that, The detection probe is labeled with a fluorescent group and / or a quenching group.

7. The reagent kit according to claim 6, characterized in that, The fluorescent group is labeled on the 5' end of the detection probe.

8. The reagent kit according to claim 6, characterized in that, The quenching group is labeled on the 3' end of the detection probe.

9. The reagent kit according to claim 6, characterized in that, The fluorescent group includes any one of FAM, VIC, JOE, TET, CY3, CY5, ROX, Texas Red, or LC RED460.

10. The reagent kit according to claim 6, characterized in that, The quenching group includes any one of BHQ1, BHQ2, BHQ3, Dabcy1, or Tamra.

11. The reagent kit according to claim 1, characterized in that, The kit also includes DNA polymerase, UDG enzyme, dNTPs, or Mg. 2+ Any one or at least two of them.

12. The kit according to claim 1, characterized in that, The kit also includes enzyme digestion buffer and / or PCR buffer.

13. The reagent kit according to claim 1, characterized in that, The kit also includes internal reference gene PCR primers and / or detection probes.

14. The kit according to claim 13, characterized in that, The internal reference gene includes β-actin.

15. The kit according to claim 1, characterized in that, The captured oligonucleotide is a nucleic acid sequence as shown in SEQ ID NO: 1 or SEQ ID NO: 6; The universal primers are nucleic acid sequences as shown in SEQ ID NO: 2 or SEQ ID NO:

3.

16. The reagent kit according to claim 4, characterized in that, The SDC2 methylation-specific primers are nucleic acid sequences as shown in SEQ ID NO:

7.

17. The reagent kit according to claim 5, characterized in that, The detection probe is a nucleic acid sequence as shown in SEQ ID NO: 4 or SEQ ID NO:

8.

18. The reagent kit according to claim 13, characterized in that, The PCR primers for the internal reference gene are nucleic acid sequences as shown in SEQ ID NO: 10~11; The internal reference gene detection probe is a nucleic acid sequence as shown in SEQ ID NO:

12.

19. An SDC2 methylation detection system, characterized in that, The system comprises the 1-20 nM capture oligonucleotide as described in claim 1, the 100-400 nM universal primer as described in claim 1, the 100-300 nM detection probe as described in claim 5, 1-2 U / μL Taq polymerase, 1-2 U / μL UDG enzyme, 100-300 μM dNTP, 1-5 mM MgCl2, PCR buffer, and methylation-dependent restriction endonuclease; The system also includes the 100-300 nM SDC2 methylation specific primers as described in claim 4.

20. The use of the kit according to any one of claims 1-18 or the system according to claim 19 in the preparation of an early tumor diagnostic device; The tumor is any one of colorectal cancer, liver cancer, or esophageal cancer, or a combination of at least two of them.