Detection of tRF-type gastric cancer molecular markers in plasma and their application in the preparation of gastric cancer auxiliary diagnostic kits
By detecting the nucleotide sequence and reverse transcription primers of specific tRF molecular markers in plasma, combined with real-time PCR technology, a gastric cancer auxiliary diagnostic kit was developed. This kit solves the problems of invasiveness and insufficient sensitivity in the diagnosis of gastric cancer in existing technologies, and achieves efficient and accurate diagnosis of early gastric cancer.
Patent Information
- Application Number
- CN202210400613.9
- Authority / Receiving Office
- CN · China
- Patent Type
- Patents(China)
- Current Assignee / Owner
- Filing Date
- 2022-04-16
- Publication Date
- 2025-11-14
- Estimated Expiration
- 2042-04-16
AI Technical Summary
Existing methods for diagnosing gastric cancer, such as endoscopic tissue sampling, are highly invasive, and traditional tumor markers have low sensitivity and specificity, making it difficult to achieve efficient diagnosis of early gastric cancer.
A diagnostic kit for gastric cancer was developed. By detecting the nucleotide sequences and reverse transcription primers of tRF-18-79MP9P04, tRF-30-87R8WP9N1EWJ, tRF-21-V2989UV3B, and tRF-33-P4R8YP9LON4VDP in plasma, combined with real-time PCR technology, absolute quantitative detection of these molecular markers can be achieved.
This method can quickly and accurately screen and identify early gastric cancer, with high sensitivity and accuracy, and requires only a small number of samples to achieve early diagnosis of gastric cancer.
Smart Images

Figure CN114875146B_ABST
Abstract
Description
Technical Field
[0001] This invention relates to a method for detecting transfer RNA in plasma, and more particularly to the detection and application of tRF-type gastric cancer molecular markers in plasma. Background Technology
[0002] According to epidemiological statistics reported by the World Health Organization in 2021, there were more than 1 million new cases of stomach cancer worldwide in 2020, and more than 760,000 deaths from stomach cancer, making it the fifth leading cause of cancer death globally. In my country, according to an epidemiological survey released in 2020, stomach cancer-related deaths were the third leading cause of cancer-related deaths in 2015, after lung cancer and liver cancer.
[0003] Early diagnosis and treatment are crucial for mitigating the high mortality rate of gastric cancer. Currently, the gold standard for gastric cancer diagnosis is endoscopic tissue biopsy for pathological examination; however, its invasiveness limits its widespread adoption. Traditional tumor markers such as carcinoembryonic antigen (CEA), carbohydrate antigen 125 (CA125), and carbohydrate antigen 19-9 (CA19-9) have low sensitivity and specificity. Therefore, developing novel gastric cancer-related biomarkers is of significant clinical importance for improving the efficiency of early gastric cancer diagnosis.
[0004] In recent years, with the development of high-throughput sequencing technology, a novel class of non-coding RNAs—tRNA-derived fragments (tRFs)—has been discovered. These fragments are formed by the cleavage of pre-tRNA or mature tRNA by specific ribonucleases (such as Dicer enzymes or angiopoietin). tRFs possess various biological functions, including participation in reverse transcription regulation, post-reverse transcription regulation, translation regulation, and epigenetic regulation. Furthermore, they are involved in the development and progression of various cancers. Therefore, they hold significant potential as diagnostic biomarkers for gastric cancer. Summary of the Invention
[0005] The technical problem to be solved by the present invention is to provide a detection kit for the auxiliary diagnosis of gastric cancer, in view of the above-mentioned existing technology.
[0006] The technical solution adopted by the present invention to solve the above-mentioned technical problem is as follows: A detection kit for the auxiliary diagnosis of gastric cancer, characterized in that it includes a reagent for detecting one or a combination of four of tRF-18-79MP9P04, tRF-30-87R8WP9N1EWJ, tRF-21-V2989UV3B, and tRF-33-P4R8YP9LON4VDP in plasma samples, wherein:
[0007] The nucleotide sequence of tRF-18-79MP9P04 is shown in SEQ ID No. 1, GUUUCCGUAGUGUAGUGG. tRF-18-79MP9P04 is significantly downregulated in the plasma of patients with early gastric cancer. The primers are: F1: 5'-GTCCCTGTTGTGTTTCCGTAG 3'; R1: 5'-GGTACCTCCTCTCTTCTCTACT-3'.
[0008] The nucleotide sequence of tRF-30-87R8WP9N1EWJ is shown in SEQ ID No. 2, UCCUGGUGGUCUAGUGGUUAGGAUUCGGC. tRF-30-87R8WP9N1EWJ is significantly upregulated in the plasma of patients with early gastric cancer; F2: 5'-GTGTCCCTGGTGGTCTAGTGGTT-3'; R2: 5'-GGTACCTCCTCTCTTCTCTACT-3';
[0009] The nucleotide sequence of tRF-21-V2989UV3B is shown in SEQ ID No. 3, UAGGAUGGGGUGUGAUAGGUA. tRF-21-V2989UV3B is significantly upregulated in the plasma of patients with early gastric cancer; F3: 5'-CGTTGGTAGGATGGGGTGTGA-3'; R3: 5'-GGTACCTCCTCTCTTCTCTACT-3';
[0010] The nucleotide sequence of tRF-33-P4R8YP9LON4VDP is shown in SEQ ID No. 4: GCAUGGGUGGUUCAGUGGUAGAAUUCUCGCCUG.
[0011] The tRF-33-P4R8YP9LON4VDP was significantly downregulated in the plasma of patients with early gastric cancer; F4: 5'-GCATGGGTGGTTCAGTGGTAGA-3'; R4: 5'-GGTACCTCCTCTCTTCTCTACT-3'.
[0012] Furthermore, the kit also includes reverse transcription primer sequences of tRF-18-79MP9P04, tRF-30-87R8WP9N1EWJ, tRF-21-V2989UV3B, and tRF-33-P4R8YP9LON4VDP, wherein,
[0013] The reverse transcription sequence of tRF-18-79MP9P04 is shown in SEQ ID No. 5: 5'-GCAGACGAGGGTACCTCCTCTCTTCTCTACTCGTGTCCTACCCTCGTCTGCCCACTA-3';
[0014] The reverse transcription sequence of tRF-30-87R8WP9N1EWJ is shown in SEQ ID No. 6: 5'-GCAGACGAGGGTACCTCCTCTCTTCTCTACTCGTGTCCTACCCTCGTCTGCGCCGAA-3';
[0015] The reverse transcription sequence of tRF-21-V2989UV3B is shown in SEQ ID No. 7: 5'-GCAGACGAGGGTACCTCCTCTCTTCTCTACTCGTGTCCTACCCTCGTCTGCTACCTA-3';
[0016] The reverse transcribed sequence of tRF-33-P4R8YP9LON4VDP is shown in SEQ ID No. 8: 5'-ACAGACGAGGGTACCTCCTCTCTTCTCTACTCGTGTCCTACCCTCGTCTGTCAGGCG-3'.
[0017] Furthermore, the kit also includes probe primer sequences of tRF-18-79MP9P04, tRF-30-87R8WP9N1EWJ, tRF-21-V2989UV3B, and tRF-33-P4R8YP9LON4VDP, wherein,
[0018] The probe primer sequence for tRF-18-79MP9P04 is shown in SEQ ID No. 9: 5'-FAM-TGTCCTACCCTCGTCTGCCCACTA-TAMRA-3';
[0019] The probe primer sequence of tRF-30-87R8WP9N1EWJ is shown in SEQ ID No. 10: 5'-FAM-GGATTCGGCGCAGACGAGGGTAGGA-TAMRA-3';
[0020] The probe primer sequence of tRF-21-V2989UV3B is shown in SEQ ID No. 11: 5'-FAM-AGGTAGCAGACGAGGGTAGGACAC-TAMRA-3';
[0021] The probe primer sequence for tRF-33-P4R8YP9LON4VDP is shown in SEQ ID No. 12: 5'-FAM-TTCTCGCCTGACAGACGAGGGTAGGA-TAMRA-3'.
[0022] This invention also provides a method for detecting tRF molecular markers in plasma, characterized in that the tRF molecular markers are tRF-18-79MP9P04, tRF-30-87R8WP9N1EWJ, tRF-21-V2989UV3B, and tRF-33-P4R8YP9LON4VDP, and the method includes the following steps:
[0023] (1) Collect blood and extract total RNA from plasma;
[0024] (2) Reverse transcribe total RNA into cDNA;
[0025] (3) The cDNA solution from step (2) was subjected to real-time PCR detection using specific amplification primers of tRF-18-79MP9P04, tRF-30-87R8WP9N1EWJ, tRF-21-V2989UV3B and tRF-33-P4R8YP9LON4VDP. After the reaction, the fluorescence signal value was detected and the Y value was set.
[0026] (4) Obtain the Cq value (y value) for each sample, and calculate the corresponding copy number x according to the standard curve corresponding to the detected tRF. Then, calculate the copy number x according to 400×10 x / 3 Calculate the copy number of each sample corresponding to 1 mL of plasma, and perform statistical analysis on the copy numbers of tRF-18-79MP9P04, tRF-30-87R8WP9N1EWJ, tRF-21-V2989UV3B, and tRF-33-P4R8YP9LON4VDP in 1 mL of plasma from patients with early gastric cancer.
[0027] Compared with the prior art, the advantages of the present invention are as follows: The kit of the present invention uses tRF-18-79MP9P04, tRF-30-87R8WP9N1EWJ, tRF-21-V2989UV3B and tRF-33-P4R8YP9LON4VDP alone or in combination as biomarkers for the auxiliary diagnosis of early gastric cancer. The corresponding detection target can be selected for absolute quantitative detection according to the detection purpose. Only a small amount of sample is needed to quickly and accurately complete the absolute quantitative detection of target molecules and the screening and identification of early gastric cancer. It has high sensitivity, high accuracy and rapid detection. Attached Figure Description
[0028] Figure 1 This is a diagram showing the next-generation sequencing results of tiRNA in gastric cancer plasma in Embodiment 1 of the present invention;
[0029] Figure 2 This is the ROC curve of the combined detection kit for gastric cancer auxiliary diagnosis in this invention.
[0030] Figure 3 This is a graph showing the results of tRF-18-79MP9P04 levels in the plasma of healthy individuals and patients with early-stage gastric cancer in Example 3 of this invention.
[0031] Figure 3-1 This is the ROC curve obtained by using tRF-18-79MP9P04 alone in Example 3 of the present invention;
[0032] Figure 4 This is an amplification curve of tRF-18-79MP9PO4 in gastric cancer plasma in Example 3 of the present invention;
[0033] Figure 5 This is a fluorescence quantitative standard curve of the plasmid standard tRF-18-79MP9P04 in Example 3 of the present invention;
[0034] Figure 6 This is a graph showing the results of tRF-30-87R8WP9N1EWJ levels in the plasma of healthy individuals and patients with early-stage gastric cancer in Example 4 of this invention.
[0035] Figure 6-1 This is the ROC curve obtained by using tRF-30-87R8WP9N1EWJ alone in Example 4 of the present invention;
[0036] Figure 7 This is an amplification curve of tRF-30-87R8WP9N1EWJ in gastric cancer plasma in Example 4 of the present invention;
[0037] Figure 8This is a fluorescence quantitative standard curve of the plasmid standard tRF-30-87R8WP9N1EWJ in Example 4 of the present invention;
[0038] Figure 9 This is a graph showing the results of tRF-33-P4R8YP9LON4VDP levels in the plasma of healthy individuals and patients with early gastric cancer in Example 5 of this invention.
[0039] Figure 9-1 This is the ROC curve obtained by using tRF-33-P4R8YP9LON4VDP alone in Embodiment 5 of the present invention;
[0040] Figure 10 This is an amplification curve of tRF-33-P4R8YP9LON4VDP in gastric cancer plasma in Example 5 of the present invention;
[0041] Figure 11 This is a fluorescence quantitative standard curve of the plasmid standard tRF-33-P4R8YP9LON4VDP in Example 5 of the present invention;
[0042] Figure 12 This is a graph showing the results of tRF-21-V2989UV3B levels in the plasma of healthy individuals and patients with early-stage gastric cancer in Example 6 of this invention.
[0043] Figure 12-1 This is the ROC curve obtained by using tRF-21-V2989UV3B alone in Example 6 of the present invention;
[0044] Figure 13 This is an amplification curve of tRF-21-V2989UV3B in gastric cancer plasma in Example 6 of the present invention;
[0045] Figure 14 This is a fluorescence quantitative standard curve of the plasmid standard tRF-21-V2989UV3B in Example 6 of the present invention. Detailed Implementation
[0046] The present invention will be further described in detail below with reference to the accompanying drawings and embodiments.
[0047] Example 1
[0048] The expression of tRF-18-79MP9P0, tRF-30-87R8WP9N1EWJ, tRF-21-V2989UV3B, and tRF-33-P4R8YP9LON4VDP in gastric cancer tissues and normal gastric cancer tissues was detected.
[0049] Sequencing detection: The level of tRF in gastric cancer tissue and normal tissue was detected using next-generation sequencing methods with tRF sequencing reagents from Arraystar, USA.
[0050] Results Analysis: The results are as follows Figure 1 As shown, molecular markers of significantly upregulated and downregulated tRNA-derived fragments, tRF-30-87R8WP9N1EWJ, tRF-21-V2989UV3B, and tRF-33-P4R8YP9LON4VDP, were obtained by analyzing gastric cancer tissue and normal gastric cancer tissue. These markers showed differences of 5.12, 8.73, and 173.11-fold, respectively, between gastric cancer tissue and normal tissue. Figure 1 As shown by the second arrow from top to bottom and Table 1, AS-tDR-008225 is named tRF-30-87R8WP9N1EWJ in the MINTbase database, and as... Figure 1 As shown by the third arrow from top to bottom and Table 1, AS-tDR-009407 is named tRF-21-V2989UV3B in the MINTbase database, and as... Figure 1 As shown by the first arrow from top to bottom and Table 1, AS-tDR-001290 is named tRF-33-P4R8YP9LON4VDP in the MINTbase database, suggesting that tRF-18-79MP9P04, tRF-30-87R8WP9N1EWJ, tRF-21-V2989UV3B, and tRF-33-P4R8YP9LON4VDP may play an important role as a gene in gastric cancer.
[0051] Table 1. Differentially expressed tRF-30-87R8WP9N1EWJ, tRF-21-V2989UV3B, and tRF-33-P4R8YP9LON4VDP in gastric cancer plasma.
[0052]
[0053] tRF-18-79MP9P04 is a combination of tRF and tiRNA database MINTbase ( https: / / cm.jefferson.edu / MINTbase / ) Selected.
[0054] Example 2
[0055] This diagnostic kit for gastric cancer includes reagents for detecting tRF-18-79MP9P04, tRF-30-87R8WP9N1EWJ, tRF-21-V2989UV3B, and tRF-33-P4R8YP9LON4VDP in plasma samples, wherein:
[0056] The nucleotide sequence of tRF-18-79MP9P04 is shown in SEQ ID No. 1. tRF-18-79MP9P04 is significantly downregulated in the plasma of patients with early gastric cancer. The primers are: F1: 5'-GTCCCTGTTGTGTTTCCGTAG 3'; R1: 5'-GGTACCTCCTCTCTTCTCTACT-3';
[0057] The reverse transcription sequence of tRF-18-79MP9P04 is shown in SEQ ID No. 5: 5'-GCAGACGAGGGTACCTCCTCTCTTCTCTACTCGTGTCCTACCCTCGTCTGCCCACTA-3';
[0058] The probe primer sequence for tRF-18-79MP9P04 is shown in SEQ ID No. 9: 5'-FAM-TGTCCTACCCTCGTCTGCCCACTA-TAMRA-3';
[0059] The nucleotide sequence of tRF-30-87R8WP9N1EWJ is shown in SEQ ID No. 2. tRF-30-87R8WP9N1EWJ is significantly upregulated in the plasma of patients with early gastric cancer; F2: 5'-GTGTCCCTGGTGGTCTAGTGGTT-3'; R2: 5'-GGTACCTCCTCTCTTCTCTACT-3';
[0060] The reverse transcription sequence of tRF-30-87R8WP9N1EWJ is shown in SEQ ID No. 6: 5'-GCAGACGAGGGTACCTCCTCTCTTCTCTACTCGTGTCCTACCCTCGTCTGCGCCGAA-3';
[0061] The probe primer sequence of tRF-30-87R8WP9N1EWJ is shown in SEQ ID No. 10: 5'-FAM-GGATTCGGCGCAGACGAGGGTAGGA-TAMRA-3';
[0062] The nucleotide sequence of tRF-21-V2989UV3B is shown in SEQ ID No. 3. tRF-21-V2989UV3B is significantly upregulated in the plasma of patients with early gastric cancer; F3: 5'-CGTTGGTAGGATGGGGTGTGA-3'; R3: 5'-GGTACCTCCTCTCTTCTCTACT-3';
[0063] The reverse transcription sequence of tRF-21-V2989UV3B is shown in SEQ ID No. 7: 5'-GCAGACGAGGGTACCTCCTCTCTTCTCTACTCGTGTCCTACCCTCGTCTGCTACCTA-3';
[0064] The probe primer sequence of tRF-21-V2989UV3B is shown in SEQ ID No. 11: 5'-FAM-AGGTAGCAGACGAGGGTAGGACAC-TAMRA-3';
[0065] The nucleotide sequence of tRF-33-P4R8YP9LON4VDP is shown in SEQ ID No. 4. tRF-33-P4R8YP9LON4VDP is significantly downregulated in the plasma of patients with early gastric cancer; F4: 5'-GCATGGGTGGTTCAGTGGTAGA-3'; R4: 5'-GGTACCTCCTCTCTTCTCTACT-3'.
[0066] The reverse transcribed sequence of tRF-33-P4R8YP9LON4VDP is shown in SEQ ID No. 8: 5'-ACAGACGAGGGTACCTCCTCTCTTCTCTACTCGTGTCCTACCCTCGTCTGTCAGGCG-3'.
[0067] The probe primer sequence for tRF-33-P4R8YP9LON4VDP is shown in SEQ ID No. 12: 5'-FAM-TTCTCGCCTGACAGACGAGGGTAGGA-TAMRA-3'.
[0068] For details, please refer to the primer sequences designed in Table 1 below: tRF-18-79MP9P04, tRF-30-87R8WP9N1EWJ, tRF-21-V2989UV3B, and tRF-33-P4R8YP9LON4VDP.
[0069] Table 1 Designed tRF primer sequences
[0070]
[0071]
[0072] This embodiment selected 40 plasma samples from gastric cancer patients and healthy individuals from the Affiliated Hospital of Ningbo University School of Medicine. Informed consent was obtained from the patients or their families, and the relevant patient information was complete and a clinical data database was established in accordance with regulations.
[0073] (1) All blood samples were collected strictly in accordance with the specimen collection specifications. 10 mL of peripheral blood was drawn into a regular EDTA anticoagulant blood collection tube, immediately placed in a 4°C refrigerator, allowed to stand for 30 min, and centrifuged at 500 g for 20 min at 4°C to remove residual blood cell components in the plasma. The supernatant plasma was aspirated and transferred to a new centrifuge tube, centrifuged at 1500 g for 20 min at 4°C to thoroughly remove residual cell debris and other substances in the plasma. The obtained plasma was aliquoted and frozen at -80°C.
[0074] (2) Total RNA extraction from plasma: Using TRIzol LS reagent from Invitrogen (USA), 250 μL of plasma sample was transferred to a new nuclease-free 1.5 mL centrifuge tube, 750 μL of TRIzol LS reagent was added, the tube was capped, vortexed for 10 s, and placed in a 4°C refrigerator for 5 min; 200 μL of chloroform was added, the tube was capped, and the tube was shaken 6 times by hand, placed in a 4°C refrigerator for 5 min, and centrifuged at 12000 rpm for 15 min at 4°C to separate the liquid into three clear layers; a new nuclease-free 1.5 mL centrifuge tube was prepared, 500 μL of isopropanol was added, the centrifuged sample was removed, and 500 μL of the upper clear liquid was carefully transferred to another centrifuge tube, the tube was capped, vortexed for 5 s, and placed in a 4°C refrigerator. After incubating for 15 minutes, centrifuge at 12000 rpm for 10 minutes at 4°C, carefully discarding the supernatant. Add 1 mL of pre-chilled 75% ethanol to the centrifuge tube, tighten the cap, and invert the tube to wash away the precipitate. Centrifuge at 12000 rpm for 5 minutes at 4°C, discarding the supernatant. Transfer the tube back to the centrifuge and centrifuge at 12000 rpm for 3 minutes at 4°C, discarding the supernatant again. Dry for 3 minutes, add 8 μL of enzyme-free water, tighten the cap, vortex for a few seconds, and centrifuge at 3000 rpm for 30 seconds at 4°C. Take 1 μL of RNA solution and use a Thermo Fisher Scientific NanoDrop One ultraviolet spectrophotometer to determine the total RNA concentration and purity of the sample, ensuring the obtained RNA solution A... 260 / A 280 If the value is between 1.8 and 2.1, take 6 μL of total RNA for reverse transcription.
[0075] (3) cDNA synthesis: Follow the instructions of the Polestar 1st cDNA Synthesis Kit (gDNA removal) produced by Beijing Baoying Tonghui Biotechnology Co., Ltd., and prepare the reverse transcription reaction solution according to the following composition:
[0076] ①Reverse transcription reaction system (20 μL):
[0077]
[0078] ②The cDNA synthesis reaction program is as follows: 37℃ for 30 min, then 85℃ for 5 min to inactivate MLV. The obtained cDNA can be stored at -20℃ or directly used for quantitative real-time PCR.
[0079] ③ Preparation of plasmid standards:
[0080] The recombinant plasmids tRF-18-79MP9P04pUC57, tRF-30-87R8WP9N1EWJpUC57, tRF-21-V2989UV3B pUC57, and tRF-33-P4R8YP9LON4VDP pUC57 of the amplified cDNA products of tRF-18-79MP9P04, tRF-30-87R8WP9N1EWJpUC57, tRF-21-V2989UV3B pUC57, and tRF-33-P4R8YP9LON4VDP pUC57, each 2.4 μg, were prepared by General Biotechnology (Anhui) Co., Ltd.
[0081] ④ Measure the recombinant plasmid using a UV spectrophotometer:
[0082] The OD260, OD280, and OD260 / OD280 values of tRF-18-79MP9P04pUC57, tRF-30-87R8WP9N1EWJ pUC57, tRF-21-V2989UV3BpUC57, and tRF-33-P4R8YP9LON4VDP pUC57 were determined, and repeated three times, to confirm the concentration and purity of each plasmid DNA.
[0083] Copy number = plasmid concentration × 6.02 × 10 23 The copy number of the plasmid is calculated as (660 × total plasmid length), and then diluted to 1 × 10⁻⁶. 6 Copy / μL, store at –20℃ for later use. (1×10⁻⁶) 6 As the plasmid stock solution, copies / μL were used for 10... -1 × Plasmid stock solution sample, 10 -2 × Plasmid stock solution sample, 10 -3 × Plasmid stock solution sample, 10 -4 × Plasmid stock solution sample and 10 -5 × Real-time PCR detection of plasmid stock solution samples through gradient dilution.
[0084] The pre-defined recombinant plasmid was diluted to 1×10⁻⁶. 5 Copy / μL, then serially diluted 10-fold to obtain 1×10 1 copies / μL, 1×10 2 copies / μL, 1×10 3 copies / μL, 1×10 4copies / μL and 1×10 5 The copy / μL dilution buffer is used as a template for subsequent amplification.
[0085] ⑤ Real-time PCR: Each cDNA sample was prepared in triplicate and added to a 96-well PCR plate for amplification using a two-step method. Simultaneously, negative control samples (using an equal volume of ddH2O instead of plasmid or cDNA) and serially diluted recombinant plasmid standards were amplified using real-time PCR. The reaction program was: 95℃ pre-denaturation for 30 seconds; 95℃ denaturation for 10 seconds; 60℃ extension / annealing for 20 seconds, for a total of 40 cycles. Through real-time quantitative PCR amplification, the real-time PCR system automatically generated the recombinant plasmid based on the fluorescence value changes.
[0086] Standard curves for tRF-18-79MP9P04pUC57, tRF-30-87R8WP9N1EWJ pUC57, tRF-21-V2989UV3BpUC57, and tRF-33-P4R8YP9LON4VDP pUC57.
[0087] The correlation coefficient R of the curve of recombinant plasmid tRF-18-79MP9P04pUC57 2 =0.9993, the correlation coefficient R of the tRF-30-87R8WP9N1EWJ pUC57 curve 2 =0.9994;
[0088] The correlation coefficient R of the tRF-21-V2989UV3B pUC57 curve 2 =0.9998;
[0089] The correlation coefficient R of the tRF-33-P4R8YP9LON4VDP pUC57 curve 2 =0.9896;
[0090] This indicates that the online plasmid dilution concentration range exhibits a good linear relationship:
[0091] The regression equation for tRF-18-79MP9P04 pUC57 is y = -3.590x + 43.91;
[0092] The regression equation for tRF-30-87R8WP9N1EWJ pUC57 is y = -3.297x + 42.04;
[0093] The regression equation for tRF-21-V2989UV3B pUC57 is y = -3.054x + 39.83;
[0094] The regression equation for tRF-33-P4R8YP9LON4VDP pUC57 is y = -3.578x + 44.07;
[0095] In the figure, y represents the Cq value obtained from real-time quantitative PCR detection, 10 x To detect the corresponding copy number within the sample. The amplification efficiency of each curve is 100%, showing that the standard curves established for each recombinant plasmid can accurately reflect the amplification of the target product.
[0096] After obtaining the Cq value (y value) for each sample and calculating the corresponding copy number x according to the standard curve corresponding to the detected tRF, the results will be processed according to 400 × 10⁻⁶. x / 3 Calculate the copy number of each sample corresponding to 1 mL of plasma, and perform statistical analysis on the copy numbers of tRF-18-79MP9P04, tRF-30-87R8WP9N1EWJ, tRF-21-V2989UV3B, and tRF-33-P4R8YP9LON4VDP in 1 mL of plasma from patients with early gastric cancer.
[0097] ⑥ The results show:
[0098] tRF-18-79MP9P04, tRF-30-87R8WP9N1EWJ, tRF-21-V2989UV3B, tRF-33-P4R8YP9LON4VDP
[0099] The combined diagnostic value in plasma for early gastric cancer is as follows: area under the ROC curve is 0.985, sensitivity is 0.925, and specificity is 0.975. Figure 2 (As shown) It can be effectively used for the screening and diagnosis of early gastric cancer.
[0100] Example 3
[0101] The results of using tRF-18-79MP9P04 alone as a molecular marker for the screening and diagnosis of early gastric cancer are as follows:
[0102] The copy number of tRF-18-79MP9PO4 per milliliter of plasma was significantly lower in patients with early gastric cancer than in healthy individuals (P<0.001). For detailed results, please refer to [reference needed]. Figure 3 The cutoff value was 8711997; its combined diagnostic value in early cancer plasma was: area under the ROC curve was 0.851, sensitivity was 0.675, and specificity was 1.000. For details, please refer to [reference needed]. Figure 3-1 ;and Figure 4 This is an amplification curve of tRF-18-79MP9P04 in gastric cancer tissue from Example 3 of the present invention. Figure 5 This is a fluorescence quantitative standard curve of the tRF-18-79MP9P04 plasmid standard from gastric cancer tissue in Example 3 of the present invention.
[0103] Example 4
[0104] The results of using tRF-30-87R8WP9N1EWJ alone as a molecular marker for the screening and diagnosis of early gastric cancer showed that the copy number per milliliter of plasma in patients with early gastric cancer was significantly higher than that in healthy individuals (P<0.05). For detailed results, please refer to [reference needed]. Figure 6 The cutoff value was 840884; its combined diagnostic value in early cancer plasma was as follows: area under the ROC curve was 0.716, sensitivity was 0.550, and specificity was 0.950. For details, please refer to [reference needed]. Figure 6-1 ;and Figure 7 This is an amplification curve of gastric cancer tissue tRF-30-87R8WP9N1EWJ in Example 4 of the present invention. Figure 8 This is a fluorescence quantitative standard curve of the tRF-30-87R8WP9N1EWJ plasmid standard from gastric cancer tissue in Example 4 of the present invention.
[0105] Example 5
[0106] The results of using tRF-33-P4R8YP9LON4VDP alone as a molecular marker for the screening and diagnosis of early gastric cancer were as follows: the copy number of tRF-33-P4R8YP9LON4VDP per milliliter of plasma was higher in patients with early gastric cancer than in healthy individuals (P<0.05). For detailed results, please refer to [reference needed]. Figure 9 The cutoff value was 1113632; its combined diagnostic value in early cancer plasma was: area under the ROC curve 0.740, sensitivity 0.875, and specificity 0.500. For details, please refer to [reference needed]. Figure 9-1 ;and Figure 10 This is an amplification curve of tRF-33-P4R8YP9LON4VDP in gastric cancer tissue from Example 5 of this invention. Figure 11 This is a fluorescence quantitative standard curve of the tRF-33-P4R8YP9LON4VDP plasmid standard from gastric cancer tissue in Example 5 of the present invention.
[0107] Example 6
[0108] The results of using tRF-21-V2989UV3B alone as a molecular marker for the screening and diagnosis of early gastric cancer showed that the copy number of tRF-21-V2989UV3B per milliliter of plasma in patients with early gastric cancer was significantly lower than that in healthy individuals (P<0.001). For detailed results, please refer to [reference needed]. Figure 12 The cutoff value was 40823; its combined diagnostic value in early cancer plasma was as follows: area under the ROC curve was 0.631, sensitivity was 0.775, and specificity was 0.475. For details, please refer to [reference needed]. Figure 12-1 ;and Figure 13This is an amplification curve of tRF-21-V2989UV3B in gastric cancer tissue from Example 6 of the present invention. Figure 14 This is a fluorescence quantitative standard curve of the tRF-21-V2989UV3B plasmid standard from gastric cancer tissue in Example 6 of the present invention. sequence list <110> Ningbo University <120> Detection of tRF-type gastric cancer molecular markers in plasma and their application in the preparation of gastric cancer auxiliary diagnostic kits <160> 1 <170> SIPOSequenceListing 1.0 <210> 1 <211> 18 <212> RNA <213> Homo sapiens <400> 1 guuuccguag uguagugg 18 <400> 2 <211> 30 ucccuggugg ucuagugguu aggauucggc 30 <400> 3 <211> twenty one uaggaugggg ugugauaggu a 21 <400> 4 <211> 33 gcaugggugg uucaguggua gaauucucgc cug 33 <400> 5 <211> 57 gcagacgagg gtacctcctc tcttctctac tcgtgtccta ccctcgtctg cccacta 57 <400> 6 <211> 57 gcagacgagg gtacctcctc tcttctctac tcgtgtccta ccctcgtctg cgccgaa 57 <400> 7 <211> 57 gcagacgagg gtacctcctc tcttctctac tcgtgtccta ccctcgtctg ctaccta 57 <400> 8 <211> 57 acagacgagg gtacctcctc tcttctctac tcgtgtccta ccctcgtctg tcaggcg 57 <400> 9 <211> 24 FAM‑ tgtcctaccc tcgtctgccc acta‑TAMRA 24 <400> 10 <211> 25 FAM‑ggattcggcg cagacgaggg tagga‑TAMRA 25 <400> 11 <211> 24 FAM- aggtagcaga cgagggtagg acac ‑TAMRA 24 <400> 12 <211> 26 FAM‑ttctcgcctg acagacgagg gtagga‑TAMRA 26
Claims
1. A diagnostic kit for the auxiliary diagnosis of gastric cancer, characterized in that: This includes a reagent for detecting four compounds in combination: tRF-18-79MP9P04, tRF-30-87R8WP9N1EWJ, tRF-21-V2989UV3B, and tRF-33-P4R8YP9LON4VDP in plasma samples. The nucleotide sequence of tRF-18-79MP9P04 is shown in SEQ ID NO:
1. tRF-18-79MP9P04 is significantly downregulated in the plasma of patients with early gastric cancer. The amplification primers for tRF-18-79MP9P04 are: F1: 5'-GTCCCTGTTGTGTTTCCGTAG 3'; R1: 5'-GGTACCTCCTCTCTTCTCTACT-3'. The nucleotide sequence of tRF-30-87R8WP9N1EWJ is shown in SEQ ID NO:
2. tRF-30-87R8WP9N1EWJ is significantly upregulated in the plasma of patients with early gastric cancer. The amplification primers for tRF-30-87R8WP9N1EWJ are: F2: 5'-GTGTCCCTGGTGGTCTAGTGGTT-3'; R2: 5'-GGTACCTCCTCTCTTCTCTACT-3'; The nucleotide sequence of tRF-21-V2989UV3B is shown in SEQ ID NO:
3. tRF-21-V2989UV3B is significantly upregulated in the plasma of patients with early gastric cancer. The amplification primers for tRF-21-V2989UV3B are: F3: 5'-CGTTGGTAGGATGGGGTGTGA-3'; R3: 5'-GGTACCTCCTCTCTTCTCTACT-3'. The nucleotide sequence of tRF-33-P4R8YP9LON4VDP is shown in SEQ ID NO:
4. RF-33-P4R8YP9LON4VDP is significantly downregulated in the plasma of patients with early gastric cancer. The amplification primers for RF-33-P4R8YP9LON4VDP are: F4: 5'-GCATGGGTGGTTCAGTGGTAGA-3'; R4: 5'-GGTACCTCCTCTCTTCTCTACT-3'. The kit also includes reverse transcription primer sequences of tRF-18-79MP9P04, tRF-30-87R8WP9N1EWJ, tRF-21-V2989UV3B, and tRF-33-P4R8YP9LON4VDP, wherein... The reverse transcription sequence of tRF-18-79MP9P04 is shown in SEQ ID NO: 5: 5'-GCAGACGAGGGTACCTCCTCTCTTCTCTACTCGTGTCCTACCCTCGTCTG CCCACTA-3'; The reverse transcription sequence of tRF-30-87R8WP9N1EWJ is shown in SEQ ID NO: 6: 5'-GCAGACGAGGGTACCTCCTCTCTTCTCTACTCGTGTCCTACCCTCGTCTG CGCCGAA-3'; The reverse transcription sequence of tRF-21-V2989UV3B is shown in SEQ ID NO: 7: 5'-GCAGACGAGGGTACCTCCTCTCTTCTCTACTCGTGTCCTACCCTCGTCTG CTACCTA-3'; The reverse transcription sequence of tRF-33-P4R8YP9LON4VDP is shown in SEQ ID NO: 8: 5'-ACAGACGAGGGTACCTCCTCTCTTCTCTACTCGTGTCCTACCCTCGTCTG TCAGGCG-3'; The kit also includes probes for tRF-18-79MP9P04, tRF-30-87R8WP9N1EWJ, tRF-21-V2989UV3B, and tRF-33-P4R8YP9LON4VDP, among which... The probe sequence of tRF-18-79MP9P04 is shown in SEQ ID NO: 9: 5'-FAM-TGTCCTACCCTCGTCTGCCCACTA-TAMRA-3'; The probe sequence of tRF-30-87R8WP9N1EWJ is shown in SEQ ID NO: 10: 5'-FAM-GGATTCGGCGCAGACGAGGGTAGGA-TAMRA-3'; The probe sequence of tRF-21-V2989UV3B is shown in SEQ ID NO: 11: 5'-FAM-AGGTAGCAGACGAGGGTAGGACAC-TAMRA-3'; The probe sequence of tRF-33-P4R8YP9LON4VDP is shown in SEQ ID NO: 12: 5'-FAM-TTCTCGCCTGACAGACGAGGGTAGGA-TAMRA-3'.
Citation Information
Patent Citations
Detection and application of novel gastric cancer molecular marker tRF-5026a
CN108165634A