Low-Intensity Focused Ultrasound for the Treatment of Cancer and Metastasis
By using low-intensity focused ultrasound (LOFU) combined with chemotherapy drugs in cancer treatment, induced endoplasmic reticulum stress and unfolded protein response in tumor cells, the shortcomings of HIFU in preventing metastasis and enhancing immune responses were solved, and more efficient cancer treatment effects were achieved.
Patent Information
- Application Number
- CN202210152097.2
- Authority / Receiving Office
- CN · China
- Patent Type
- Patents(China)
- Current Assignee / Owner
- Priority Date
- 2015-08-12
- Filing Date
- 2016-06-02
- Publication Date
- 2025-06-24
- Estimated Expiration
- 2036-06-02
AI Technical Summary
In the treatment of cancer and metastasis, high-intensity focused ultrasound (HIFU) may not be effective in preventing local and distal metastasis caused by surviving tumor cells, and may also reduce the release of immune stimulator molecules in the tumor microenvironment, limiting the effectiveness of cancer immunotherapy.
Low-intensity focused ultrasound (LOFU) combined with chemotherapy drugs are used to induce endoplasmic reticulum (ER) stress and/or unfolded protein response (UPR) in tumor cells to improve the efficacy of chemotherapy and induce tumor-specific immune activation.
It improves the efficacy of chemotherapy, enhances the therapeutic effect of anti-tumor tumors, and reduces the possibility of tumor metastasis through immune activation.
Smart Images

Figure CN114886412B_ABST
Abstract
Description
[0001] This application is a divisional application of the Chinese patent application with application date of June 2, 2016, application number 201680045882.0, and invention name “Low-intensity focused ultrasound for the treatment of cancer and metastasis” (the application date of its corresponding PCT application is June 2, 2016, and application number PCT / US2016 / 35440).
[0002] CROSS-REFERENCE TO RELATED APPLICATIONS
[0003] This application claims the benefit of U.S. Provisional Application No. 62 / 170,378, filed June 3, 2015, and U.S. Provisional Application No. 62 / 204,312, filed August 12, 2015, the contents of both of which are incorporated herein by reference.
[0004] Government Support Statement
[0005] This invention was made with government support through Grants EB009040 and AI059738 awarded by the National Institutes of Health. The government has certain rights in this invention. Background Art
[0006] Throughout this application, various publications are cited in parentheses. Full citations for these references can be found at the end of this specification. The disclosures of these publications, as well as all patents, patent application publications, and books mentioned herein, are hereby incorporated by reference in their entirety into this application to more fully describe the field to which this invention pertains.
[0007] The immune response to cancer cells is often limited by the immunosuppressive properties of the tumor microenvironment, which is also the reason why the efficacy of cancer immunotherapy is limited (1, 2). Several mechanisms have been discovered for the ability of tumors to generate an immunosuppressive environment, including secretion of cytokines or other factors with inhibitory activity (3-5), recruitment of regulatory T cells and bone marrow-derived suppressor cells (6-9), increased expression of ligands for co-inhibitory receptors (10-13), or inhibition of dendritic cell maturation (14, 15). As a result of these mechanisms, T cells often exhibit an anergy to tumor antigens (15). The induction of a hyporesponsive state to tumor antigens occurs in both CD4+ and CD8+ T cell populations and generally results in the inability of the adaptive immune system to mount an effective anti-tumor response (16-18). The reduction in T cell responses to tumor antigens occurs in both solid tumors and hematological tumors and appears to be caused by insufficient antigen presentation by dendritic cells, which leads to preferential activation of a tolerogenic program that depends on gene expression of the transcription factors NFAT and Egr2 (18-21). The importance of tumor-induced T cell hyporesponsiveness is emphasized by the fact that genetic mouse models that prevent the induction of this tolerogenic gene expression program result in enhanced antitumor T cell responses and control of tumor growth (19, 21).
[0008] Focused ultrasound (FUS) is an image-guided minimally invasive therapy for in situ tumor ablation using a range of input energies (22, 23). Depending on the delivered energy, FUS is applied to biological tissues with associated thermal and cavitation effects, leading to changes in target cell physiology. High-intensity focused ultrasound (HIFU) has been used clinically for thermal ablation of localized tumors (23-26). The large amount of thermal energy generated by FUS treatment leads to rapid coagulative necrosis of tissue at the targeted focal point. Although several studies have reported some immunomodulatory effects, including increased lymphocyte infiltration, generation of tumor-specific IFNγ-producing T cells in lymphoid organs, and maturation and migration of dendritic cells into tumors (26, 27), the heat-induced coagulative necrosis caused by HIFU treatment can also reduce the release of immunostimulatory molecules in the tumor microenvironment. Therefore, while HIFU can prevent the progression of established primary tumors, it may not be able to prevent local and distant metastases caused by surviving tumor cells.
[0009] The present invention provides improved treatment of tumors and cancers using low-intensity focused ultrasound, as well as methods of inducing chemosensitization and increasing the efficacy of cancer therapy treatments. Summary of the Invention
[0010] Provided is a method for improving the efficacy of chemotherapy in a subject, comprising administering to the subject (i) an amount of low-intensity focused ultrasound (LOFU) and (ii) an amount of a chemotherapeutic agent, wherein the chemotherapeutic agent achieves endoplasmic reticulum (ER) stress and / or an unfolded protein response (UPR) in tumor cells, wherein the amounts of (i) and (ii) together are sufficient to improve the efficacy of the chemotherapy.
[0011] Also provided is a method for improving the efficacy of chemotherapy in a predetermined volume of tissue in a subject, the volume being smaller than the entire subject, the method comprising (i) administering to the subject an amount of a chemotherapy drug, wherein the chemotherapy drug effects endoplasmic reticulum (ER) stress and / or an unfolded protein response (UPR) in tumor cells, and (ii) administering to the predetermined volume of tissue in the subject an amount of low-intensity focused ultrasound (LOFU), wherein the amounts of (i) and (ii) taken together are sufficient to improve the efficacy of the chemotherapy in the predetermined volume of tissue.
[0012] Provided is a method of treating a tumor in a subject, wherein the tumor is resistant to a chemotherapeutic drug, the method comprising:
[0013] receiving an identification that the subject has a tumor that is resistant to a particular chemotherapeutic drug;
[0014] administering (i) a certain amount of low-intensity focused ultrasound (LOFU) and (ii) a certain amount of the specific chemotherapy drug,
[0015] The amounts of (i) and (ii) combined are sufficient to treat the tumor.
[0016] Also provided is a method of treating a chemoresistant tumor in a subject, wherein the tumor has become chemoresistant to a previously administered chemotherapy drug, the method comprising:
[0017] administering to the subject (i) an amount of low-intensity focused ultrasound (LOFU) and (ii) an amount of the chemotherapeutic drug,
[0018] wherein the amounts of (i) and (ii) taken together are sufficient to treat the chemoresistant tumor.
[0019] An acoustic priming therapy (APT) system according to various exemplary embodiments of the present invention includes a device configured to generate 10 to 1000 W / cm 2The invention relates to a transducer having an acoustic power of a spatial peak time average intensity (Ispta), wherein the ultrasound has a frequency in the range of 0.01 to 10 MHz, a mechanical index of less than 4, and is applied continuously for a time in the range of 0.5 to 5 seconds for any particular volume in the treatment area. Such treatment is identified herein as acoustic stimulation therapy (APT) treatment.
[0020] An acoustic stimulation therapy device according to an exemplary embodiment of the present invention includes: a control system for generating a frequency waveform; and one or more transducers, each transducer being configured to generate a frequency waveform based on a peak frequency in the range of 0.05 to 5 MHz and an acoustic output intensity of 20-1000 W / cm 2 of ultrasonic beam.
[0021] In an exemplary embodiment, each transducer is configured to generate columnated ultrasound such that the beam profile waist at -3 dB in the treatment volume is no less than 5 mm.
[0022] In an exemplary embodiment, two or more transducers may be operated sequentially or simultaneously and produce an average spatial peak energy of 250 J / cm in the treatment volume during a treatment period. 2 Ultrasound
[0023] In an exemplary embodiment, the transducer operates in a continuous mode, wherein ultrasound is generated in the treatment zone for a treatment period in the range of 0.1 to 10 seconds.
[0024] A system according to an exemplary embodiment of the present invention includes an acoustic therapy device comprising: a control system for generating a frequency waveform; and one or more transducers configured to generate 1 to 1000 W / cm2 of acoustic energy in a treatment area. 2 Ultrasound based on a frequency waveform having a spatial peak time average acoustic output intensity (Ispta), wherein the ultrasound is continuously applied for a time in the range of 0.5 to 5 seconds and wherein the ultrasound frequency is in the range of 0.01 to 10 MHz; a radiotherapy treatment machine; and a control system operably configured to control the sonic therapy device and the radiotherapy treatment machine so that a first amount of the ultrasound and a second amount of radiotherapy are administered to a subject, wherein the first amount and the second amount together are sufficient to treat a tumor in the subject.
[0025] The system according to an exemplary embodiment of the present invention includes an acoustic stimulation therapy device comprising: a control system for generating a frequency waveform; and one or more transducers configured to generate 1 to 1000 W / cm 2Ultrasound based on a frequency waveform having a spatial peak time average acoustic output intensity (Ispta), wherein the ultrasound is continuously applied for a time in the range of 0.5 to 5 seconds, and wherein the ultrasound frequency is in the range of 0.01 to 10 MHz; the sonotherapy device is used in combination with chemotherapy such that a first amount of the ultrasound and a second amount of the chemotherapy are administered to a subject, wherein the first amount and the second amount together are sufficient to treat a tumor in the subject.
[0026] The system according to an exemplary embodiment of the present invention includes an acoustic stimulation therapy device comprising: a control system for generating a frequency waveform; and one or more transducers configured to generate 1 to 1000 W / cm 2 Ultrasound based on a frequency waveform having a spatial peak time average acoustic output intensity (Ispta), wherein the ultrasound is continuously applied for a time in the range of 0.5 to 5 seconds, and wherein the ultrasound frequency is in the range of 0.01 to 10 MHz; the sonic therapy device is used in combination with immunotherapy such that a first amount of the ultrasound and a second amount of the immunotherapy are administered to a subject, wherein the first amount and the second amount together are sufficient to treat a tumor in the subject.
[0027] Provided is a method of treating a tumor in a subject, comprising administering to the subject (i) an amount of low-intensity focused ultrasound (LOFU) and (ii) an amount of chemotherapy, or an amount of radiation therapy, or an amount of immunotherapy, wherein the amounts of (i) and (ii) together are sufficient to treat the tumor.
[0028] Also provided is a method of inhibiting tumor metastasis in a subject, comprising administering to a subject having a tumor an amount of low-intensity focused ultrasound (LOFU) and an amount of radiation therapy, wherein the amounts together are sufficient to treat the tumor.
[0029] Also provided is a method of reducing the effective dose of anti-cancer chemotherapy required to treat a tumor in a subject, comprising administering to the subject undergoing the anti-cancer chemotherapy an amount of low-intensity focused ultrasound (LOFU) sufficient to reduce the effective dose of the anti-cancer chemotherapy required to treat the tumor.
[0030] Also provided is a method of sensitizing a tumor in a subject to an amount of an anti-cancer therapy, the method comprising administering to the subject, before or during a course of anti-cancer therapy, an amount of sonic therapy effective to sensitize the tumor in the subject to an amount of another anti-cancer therapy modality.
[0031] A method of treating a tumor in a subject is provided, comprising administering to the subject (i) an amount of low-intensity focused ultrasound (LOFU), wherein LOFU herein represents an exemplary embodiment of an ultrasound configuration for use in an APT system, and (ii) an amount of chemotherapy, or an amount of radiation therapy, or an amount of immunotherapy, wherein the amounts of (i) and (ii) together are sufficient to treat the tumor.
[0032] Also provided is a method of inhibiting tumor metastasis in a subject, comprising administering to a subject having a tumor an amount of low-intensity focused ultrasound (LOFU) and an amount of radiation therapy, wherein the amounts together are sufficient to inhibit tumor metastasis in the subject.
[0033] Also provided is a method of reducing the effective dose of anti-cancer chemotherapy required to treat a tumor in a subject, comprising administering to the subject undergoing the anti-cancer chemotherapy an amount of low-intensity focused ultrasound (LOFU) sufficient to reduce the effective dose of the anti-cancer chemotherapy required to treat the tumor.
[0034] Also provided is a method of sensitizing a tumor in a subject to an amount of an anti-cancer therapy, the method comprising administering to the subject, before or during a course of anti-cancer therapy, an amount of low-intensity focused ultrasound (LOFU) effective to sensitize the subject's tumor to the amount of the anti-cancer therapy modality. BRIEF DESCRIPTION OF THE DRAWINGS
[0035] Figures 1A-1F Cytokine output of melanoma tumor suppressor CD4+ T cells: 1A-B: 3×10 5 C57Bl / 6 mice were challenged with B16-F1 melanoma cells in the flank. The tumors were allowed to grow to 7-8 mm. 3 CD4+ T cells were isolated from the tumor DLN and distal contralateral NDLN and stimulated with anti-CD3 and anti-CD28 antibodies. IL-2 and IFNγ were measured by ELISA. CD4+ T cells from tumor-free mice were used as controls. 1C-D: 3×10 5B16-F1-OVA melanoma cells were used to attack OTII mice. T cells were stimulated with splenocytes loaded with OVA323-339 peptide, and the production of IL-2 and IFNγ was measured by ELISA. 1E-F. As described above, tumors were induced in Tyrp1 mice using B16-F1 cells. Isolated CD4+ T cells were stimulated with anti-CD3 and anti-CD28 antibodies, and the production of IL-2 and IFNγ was measured by ELISA. The figures show the mean ± SEM of 4 (1A-B) or 3 (1C-F) independent experiments. The results are shown as the mean ± SEM of 3-5 mice per experiment. Data were analyzed using ANOVA and Tukey's post-test (***P<0.01; **P<0.01; *P<0.05).
[0036] Figures 2A-2D Treatment of melanoma tumors with LOFU overcomes tumor-induced CD4+ T cell tolerance: 2A-B. In C57Bl / 6 mice, 3×10 5 B16-F1 melanoma cells were used to induce tumors. Tumors were either untreated or treated with LOFU. 36 hours after FUS treatment, CD4+ T cells were isolated from tumor DLN or NDLN and stimulated with anti-CD3 and anti-CD28 antibodies. The production of IL-2 and IFNγ was assessed by ELISA. The results (total cytokine production and the ratio of cytokine levels produced by T cells from NDLN and DLN in each group) are presented as the mean ± SEM from 3 different mice per condition. The differences in cytokine production by DLN T cells in untreated or treated mice were analyzed using a two-tailed t-test (*P<0.05). 2C. 3×10 5 Individual B16 melanoma cells attack mice to induce tumors. After tumor development, total RNA samples were extracted from CD4+T cells isolated from the DLN and NDLN of tumor-bearing mice and tumor-free control mice. The expression of anergy-related genes was measured by quantitative RT-PCR. The results are shown as the induction fold of gene expression in resident T cells of DLN or NDLN in tumor-bearing mice compared with T cells isolated from tumor-free mice. The data represent the mean ± SEM from 3 independent experiments. 2D. B16-F1 melanoma tumors were subsequently induced in Tyrp1 mice that were not treated or treated with LOFU. The expression of different anergy-related genes was measured by RT-PCR in CD4+T cells isolated from DLN and NDLN. The expression of anergy-related genes was presented as the induction fold (mean ± SEM from 5 independent experiments) of the value obtained in the T cells of tumor-free Tyrp1 mice.
[0037] Figures 3A-3B. Lysates from LOFU-treated B16-F1 melanoma tumors can reverse the low-responsiveness of anergic T cells. 3A. Naive CD4+ T cells were isolated from the spleen and lymph nodes of Tyrp1 mice and differentiated into TH1 cells. The cells were then left untreated or treated with anti-CD3 alone for 16 hours to induce anergy. The cells were then placed in the strict absence of IL-2 for 72 hours and restimulated with anti-CD3 and anti-CD28 antibodies. IL-2 levels were measured by ELISA. The results are shown as mean ± SEM from 2 independent experiments. 3B. CD11c+ dendritic cells were isolated from the spleen of tumor-free Tyrp1 mice. Anergic TH1 cells generated from CD4+ T cells derived from Tyrp1 mice as described in (3A) were co-cultured with dendritic cells and tumor lysates derived from untreated or LOFU-treated B16-F1 melanoma tumors. The supernatant was collected after 24 hours and IL-2 was measured by ELISA. Results are shown as mean ± SEM from two independent experiments using three independent sets of tumor lysates in each experiment. Data were analyzed using ANOVA and Tukey's post-test (**P < 0.01).
[0038] Figures 4A-4D . FUS treatment causes changes in the expression and cellular distribution of Hsp70 and calreticulin in B16-F1 melanoma cells. 4A. Total DLN-resident cells were isolated from untreated and LOFU-treated B16-F1 melanoma-bearing mice and immunostained for CD11c to gate dendritic cells. Surface expression of B7.1, B7.2, and MHCII was then assessed by flow cytometry. Appropriate isotype controls were used for each primary antibody. Representative histograms are shown. 4B. Representative FACS dot plots of B16 tumor cell suspensions obtained from untreated or LOFU-treated mice were stained with viability markers (live / dead Mk). Relative quantification of dead cells is reported. Boxes and arrows indicate dead cells (live / dead MK+). 4C. Immunofluorescence staining of B16-F1 tumor tissue isolated from untreated mice or from mice treated with LOFU. Tissue sections were stained with antibodies detecting calreticulin or Hsp70 and TRP1. Nuclei were stained with DAPI. Magnification: 60x. 4D. Cells from tumors of LOFU-treated and untreated mice were stained for CD45 and TRP1 expression. CD45-TRP1+ B16 cells were then analyzed for Hsp70 expression. Representative histograms are shown. Gates and arrows indicate the population selected for analysis.
[0039] Figures 5A-5BFUS treatment of melanoma tumors enhances dendritic cell-mediated priming of CD4+ T cells: 5A. CD11c+ splenic dendritic cells were purified from C57Bl / 6 mice and co-cultured with responding naive CD4+ T cells isolated from OT-II mice. B16-F1-OVA melanoma tumor lysates were prepared from untreated or LOFU-treated tumor-bearing mice and added to the respective cultures to drive dendritic cell-mediated T cell stimulation. In separate samples, exogenous OVA was also added. 323-339 Peptides were added together with tumor lysates. Supernatants were collected 24 hours later and IL-2 production was assessed by ELISA. Results are shown as mean ± SEM from 4 independent experiments and analyzed using one-way ANOVA followed by Tukey's post-hoc test (*P < 0.05; ***P < 0.001; ns, not significant). 5B. B16-F1 melanoma tumors were untreated or treated with LOFU. Tumor DLNs were isolated and depleted of T cells. DLN cells were then co-cultured with naive Tyrp1 CD4+ T cells and stimulated with B16 melanoma tumor lysates obtained from in vitro cultures. Supernatants were collected 24 hours later and IL-2 levels were analyzed by ELISA. Data are shown as mean ± SEM from 3 independent experiments. Differences in cytokine production in cultures of DLN cells from untreated or LOFU-treated mice were analyzed using a two-tailed t-test (*P < 0.05).
[0040] Figures 6A-6D FUS followed by hypofractionated IGRT results in T cell-mediated long-term primary tumor control and reduced distant metastasis: 6A, which will have a 50mm 3 C57Bl / 6 mice bearing subcutaneous dorsal right hindlimb tumors were assigned to one of four treatment groups: untreated, LOFU, hypofractionated IGRT, or LOGU+IGRT, and tumor growth was monitored for 62 days or until primary tumors exceeded 300 mm. 3. Shown are the mean ± SEM of tumor volumes from one of two representative experiments (3-5 mice per group). Data were analyzed using one-way ANOVA followed by a Bonferroni-corrected post-test (before day 29) or by a two-tailed student t-test (after day 29). Significant differences (defined as P < 0.05) occurred between untreated or LOFU-treated mice and IGRT or LOFU+IGRT-treated mice after day 25, and between IGRT-treated mice and LOFU+IGRT-treated mice after day 35. Individual diagrams showing the distribution of tumor size on specific days are also shown. 6B. Similar experiments as described in 6A were performed in BALB / c nude mice. No significant differences were observed between the different groups at any time point. 6C. C57Bl / 6 mice were monitored for primary tumor progression / recurrence, which was defined as a recurrence reaching 150 mm 3 volume or local metastasis to the popliteal or inguinal lymph nodes. In addition, animals that died spontaneously were scored as disease recurrence or progression. Recurrence-free survival data were analyzed using the Mantel-Cox test. 6D. Lungs were collected from animals that died spontaneously, required euthanasia due to excessive tumor burden, or were sacrificed at the end of the two-month long experiment. Lung metastasis was then measured. Lungs with nodules that merged into plaques or more than 250 nodules were considered too many to count and were assigned a maximum of 250. Representative specimens are shown for each treatment group. Results are shown as mean ± SEM, with n = 3-5 mice per group, analyzed using the Kruskal-Wallis test followed by a Dunn post-test. *P < 0.05.
[0041] Figures 7A-7GLOFU induces the UPR. 7A. LOFU increases Bip / Grp78 and EDEM mRNA expression. Real-time PCR analysis of RNA isolated from LOFU-treated RM1 tumors revealed a 29.73±0.56-fold increase in Bip / Grp78 and a 9.27±1.18-fold increase in EDEM mRNA levels compared to untreated controls. 7B. LOFU increased IRE1α mRNA expression by 2.8±0.4-fold. Real-time PCR analysis demonstrated that the LOFU-induced increase in IRE1α expression was not altered by 17AAG treatment. 7C. LOFU induces XBP1 mRNA splicing. 17AAG treatment inhibits XBP1 splicing. XBP1s, XBP1h, and XBP1u denote the spliced, hybrid, and unspliced forms of XBP1, respectively. 7D-G. LOFU+17AAG combination therapy prolongs ER stress in RM1 tumor cells. Western blot and bar graphs showed that the expression of ERP78 (7D and 7E), ERP57 (7D and 7F), and ERp44 (7D and 7G) proteins were induced in the combination treatment group.
[0042] Figures 8A-8E : LOFU+17AAG activates the pro-apoptotic pathway of the UPR and induces apoptosis in tumor cells. 8A and 8B. Western blot of pPERK (8A) and peIF2a (8B). LOFU+17AAG activates PERK through the phosphorylation of PERK (pPERK), which further induces the phosphorylation of eIF2α phosphorylation (peIF2α). 8C. Real-time PCR analysis of CHOP mRNA. Compared with the control, the increase in CHOP transcripts in the LOFU+17AAG treatment group was 25±1.3 times. 8D. Real-time PCR array of RNA isolated from LOFU+17AAG-treated tumors. Heat map analysis showed that the LOFU+17AAG treatment group increased the transcript levels of apoptotic genes several times compared with the untreated control or LOFU group. 8E. TUNEL staining. Immunohistochemical staining showed that there were mainly TUNEL-positive cells in the LOFU+17AAG treatment group compared with the control or LOFU group. Note that administration of 17AAG alone also induced apoptosis in tumor tissues which was enhanced by LOFU.
[0043] Figures 9A-9C LOFU + 17AAG treatment inhibits chaperone-mediated autophagy (CMA) in RM1 tumor cells. (9A and 9B) Immunoblot analysis shows a multifold downregulation of LAMP2a, a SMA marker, in the combined treatment group. Treatment with either LOFU or 17AAG upregulates LAMP2a expression. (9A and 9C) Combination treatment with LOFU and 17AAG did not alter Beclin expression, a marker of macroautophagy.
[0044] Figures 10A-10C : Tumor growth in murine and human prostate tumors is retarded after LOFU+17AAG treatment. 10A. Treatment mode. Palpable tumors were treated with LOFU every 3-4 days, with five portions administered over two weeks. During this period, animals received 17AAG three times a week. Tumors were harvested 24 hours after the last portion of LOFU. 10B. RM1 tumor. In C57B16 mice, LOFU+17AAG combination treatment significantly slowed RM1 tumor growth compared to controls (p<0.004). Note that LOFU or 17AAG alone did not significantly control tumors. LOFU sensitized the effects of low-dose (25 mg / kg body weight) 17AAG. 10C. PC3 tumor. In BalbCnu / nu mice, LOFU+17AAG combination treatment showed a significant reduction in PC3 tumor growth (p<0.007).
[0045] Figures 11A-11F LOFU+17AAG treatment reduced the expression of prostate cancer stem cell markers in RM1 cells. Flow cytometry of isolated RM1 tumor cells revealed a significant decrease in cell surface expression of SCA1 (11A and 11B), CD44 (11A and 11C), CD133 (11A and 11D), and α2β1 integrin (11A and 11E) on RM1 tumor cells following LOFU+17AAG treatment. (11F) qRT-PCR arrays and subsequent heat map analysis revealed that the LOFU+17AAG combination treatment group downregulated the mRNA levels of stem cell transcription factors.
[0046] Figure 12 is a block diagram of an APT device according to an exemplary embodiment of the present invention.
[0047] Figure 13 is a block diagram of an APT device according to another exemplary embodiment of the present invention.
[0048] Figure 14 is a block diagram of an APT device according to another exemplary embodiment of the present invention.
[0049] Figure 15-17 is a block diagram of an APT device according to an exemplary embodiment of the present invention including an integrated ultrasound imaging device.
[0050] Figure 18 is a perspective view of a transducer according to an exemplary embodiment of the present invention.
[0051] Figure 19 A positioning device according to an exemplary embodiment of the present invention is illustrated. DETAILED DESCRIPTION
[0052] Disclosed herein is an ultrasound (US) therapy that delivers reduced energy levels to the treatment area compared to HIFU configurations. In an exemplary embodiment, treatment of a specific lesion volume is performed at 1 MHz continuous power for a short time (e.g., ~1.5 seconds), and the tumor tissue temperature is elevated to less than about 45°C. This ultrasound therapy, which utilizes a concave transducer to focus ultrasound in the treatment area and is referred to herein as "low-energy non-ablative focused ultrasound" (LOFU), produces mild mechanical and thermal stress in tumor cells while avoiding cavitation and coagulative necrosis, both of which lead to tissue damage. A non-ablative "acoustic" stress response is induced in the tumor, which increases the expression of heat shock proteins without actually killing them directly. LOFU has the potential to release immunomodulatory factors (including heat shock proteins) (28, 29) and can effectively induce tumor-specific immune activation (30, 31). Using a murine B16 melanoma tumor model, it was disclosed that LOFU treatment reversed tumor-induced tolerance, resulting in increased production of effector cytokines in tumor antigen-specific CD4+ T cells, which appeared to be caused by the release of immunogenic molecules by tumor cells. Furthermore, the combination of LOFU with ablative hypofractionated cone-beam computed tomography (CT) image-guided radiotherapy (IGRT) resulted in synergistic control of the primary tumor and also resulted in reduced spontaneous lung metastasis and prolonged recurrence-free survival in immunocompetent mice (see Example 1). In addition, LOFU was found to sensitize cancer cells (in this example, prostate cancer) to chemotherapy (see Example 2).
[0053] In one exemplary embodiment, LOFU (also referred to herein as "acoustic therapy") involves directing a pulse of 10 to 1000 W / cm2 of light into the treatment area. 2 Ultrasound is applied at an acoustic power of a spatial peak time average intensity (Ispta), wherein the ultrasound is applied continuously for a time in the range of 0.5 to 5 seconds, wherein the frequency is in the range of 0.01 to 10 MHz, and the mechanical index is less than 4. The mechanical index (MI) is the ratio of the rarefaction pressure in MPa to the square root of the center frequency in MHz. The energy and intensity of the applied ultrasound are intended to fall between the energy and intensity of ultrasound that causes a primarily ablation effect or a primarily diagnostic effect.
[0054] As explained in more detail below, the various treatment methods discussed herein can be administered using a LOFU or sonication device that includes generating 10 to 1000 W / cm 2 Spatial peak time average intensity (I spta) of acoustic power. The ultrasound is applied continuously for a time in the range of 0.5 to 5 seconds, or is pulsed with a pulse duration of 1 to 100 ms, with a frequency in the range of 0.01 to 10 MHz. In some embodiments, the frequency is in the range of 0.05 to 5 MHz. In some embodiments, the frequency range is 0.1 to 2 MHz. In some embodiments, the minimum diameter of any ultrasound beam in the treatment area is about 1 cm. In one embodiment, the LOFU is applied in the treatment area at a power of 10 to 100 W / cm 2 I spta In one embodiment, the LOFU is applied at a power of 100 to 200 W / cm in the treatment area. 2 I spta In one embodiment, the LOFU is applied at 300 to 400 W / cm in the treatment area. 2 I spta In one embodiment, the LOFU is applied at 400 to 500 W / cm in the treatment area. 2 I spta In one embodiment, the LOFU is applied at a power of 500 to 600 W / cm in the treatment area. 2 I spta In one embodiment, the LOFU is applied at 600 to 700 W / cm in the treatment area. 2 I spta In one embodiment, the LOFU is applied at 700 to 800 W / cm in the treatment area. 2 I spta In one embodiment, the LOFU is applied at a power of 800 to 900 W / cm in the treatment area. 2 I spta In one embodiment, the LOFU is applied at a power of 900 to 1000 W / cm in the treatment area. 2 I sptaAdministration. In one embodiment, the ultrasound is applied for a time in the range of 0.5 to 1 second. In one embodiment, the ultrasound is applied for a time in the range of 1 to 2 seconds. In one embodiment, the ultrasound is applied for a time in the range of 2 to 3 seconds. In one embodiment, the ultrasound is applied for a time in the range of 4 to 5 seconds. In an embodiment, the ultrasound is applied at a frequency of 0.01 to 1 MHz. In an embodiment, the ultrasound is applied at a frequency of 1 to 2 MHz. In an embodiment, the ultrasound is applied at a frequency of 2 to 3 MHz. In an embodiment, the ultrasound is applied at a frequency of 3 to 4 MHz. In an embodiment, the ultrasound is applied at a frequency of 4 to 5 MHz. In an embodiment, the ultrasound is applied at a frequency of 5 to 6 MHz. In an embodiment, the ultrasound is applied at a frequency of 6 to 7 MHz. In an embodiment, the ultrasound is applied at a frequency of 7 to 8 MHz. In an embodiment, the ultrasound is applied at a frequency of 8 to 9 MHz. In an embodiment, the ultrasound is applied at a frequency of 9 to 10 MHz.
[0055] A method for improving the efficacy of chemotherapy in a subject is provided, comprising administering to the subject (i) an amount of low-intensity focused ultrasound (LOFU) and (ii) an amount of a chemotherapeutic agent, wherein the chemotherapeutic agent achieves endoplasmic reticulum (ER) stress and / or an unfolded protein response (UPR) in tumor cells, wherein the amounts of (i) and (ii) together are sufficient to improve the efficacy of chemotherapy.
[0056] Also provided is a method for improving the efficacy of chemotherapy in a predetermined volume of tissue in a subject, the volume being smaller than the entire subject, the method comprising (i) administering to the subject an amount of a chemotherapy drug, wherein the chemotherapy drug effects endoplasmic reticulum (ER) stress and / or an unfolded protein response (UPR) in tumor cells, and (ii) administering to the predetermined volume of tissue in the subject an amount of low-intensity focused ultrasound (LOFU), wherein the amounts of (i) and (ii) together are sufficient to improve the efficacy of the chemotherapy in the predetermined volume of tissue.
[0057] Also provided is a method of treating a tumor in a subject, wherein the tumor is resistant to a chemotherapeutic drug, the method comprising:
[0058] receiving an identification of the subject as having a tumor that is resistant to a particular chemotherapeutic drug;
[0059] administering (i) a certain amount of low-intensity focused ultrasound (LOFU) and (ii) a certain amount of a specific chemotherapy drug,
[0060] wherein the amounts of (i) and (ii) combined are sufficient to treat the tumor.
[0061] Also provided is a method of treating a chemoresistant tumor in a subject, wherein the tumor is chemoresistant to a previously administered chemotherapy drug, the method comprising:
[0062] administering to the subject (i) an amount of low-intensity focused ultrasound (LOFU) and (ii) an amount of a chemotherapeutic drug,
[0063] wherein the amounts of (i) and (ii) together are sufficient to treat the chemoresistant tumor.
[0064] In one embodiment of the method, the chemotherapeutic agent effects endoplasmic reticulum (ER) stress and / or an unfolded protein response (UPR) in the tumor cell.
[0065] In one embodiment of the method, the chemotherapeutic drug has been previously administered to the subject multiple times, and wherein the tumor has been diagnosed as resistant to the chemotherapeutic drug after the initial administration of the chemotherapeutic drug.
[0066] In one embodiment of the method involving chemoresistance, the method can further comprise receiving an identification of the subject as having a tumor that is chemoresistant to a previously administered chemotherapeutic drug.
[0067] In one embodiment of the method, the chemotherapeutic drug effects a UPR in tumor cells.
[0068] In one embodiment of the method, the chemotherapeutic drug effects ER stress in the tumor cell.
[0069] In one embodiment of the method, the amounts of (i) and (ii) together are sufficient to induce or increase apoptosis of tumor cells.
[0070] In one embodiment of the method, the amount of chemotherapeutic agent administered alone is subtherapeutic for treating the tumor without increasing its therapeutic efficacy.
[0071] In one embodiment of the method, the administered LOFU is directed to the location of a tumor in the subject.
[0072] In one embodiment of the method, low-intensity focused ultrasound (LOFU) is administered to the subject prior to or concurrently with chemotherapy, radiotherapy, or immunotherapy. In one embodiment of the method, LOFU is administered to the subject prior to the administration of radiotherapy. In one embodiment of the method, LOFU is administered to the subject prior to the administration of chemotherapy. In one embodiment of the method, LOFU is administered to the subject prior to the administration of immunotherapy. In one embodiment of the method, LOFU is administered to the subject concurrently with the administration of radiotherapy. In one embodiment of the method, LOFU is administered to the subject concurrently with the administration of chemotherapy. In one embodiment of the method, LOFU is administered to the subject concurrently with the administration of immunotherapy.
[0073] In one embodiment of the method, the chemotherapeutic agent is an HSP90 inhibitor. In one embodiment, the HSP90 inhibitor is 17AAG (tanespimycin or 17-N-allylamino-17-demethoxygeldanamycin). In one embodiment, the chemotherapeutic agent is an HSP90 inhibitor. An example of an HSP90 inhibitor is 17AAG (tanespimycin or 17-N-allylamino-17-demethoxygeldanamycin). In one embodiment, the chemotherapeutic agent is an alkylating agent. In one embodiment, the chemotherapeutic agent is trabectidin. In one embodiment, the chemotherapeutic agent is a mustard gas derivative. In one embodiment, the chemotherapeutic agent is a metal salt. In one embodiment, the chemotherapeutic agent is a plant alkaloid. In one embodiment, the chemotherapeutic agent is an anti-tumor antibiotic. In one embodiment, the chemotherapeutic agent is an antimetabolite. In one embodiment, the chemotherapeutic agent is a topoisomerase inhibitor. In one embodiment, the chemotherapeutic agent is a proteasome inhibitor. In one embodiment, the chemotherapeutic agent is a chemotherapeutic NSAID. In one embodiment, the chemotherapeutic agent is one of the other anti-tumor agents listed below.
[0074] In one embodiment of the method, LOFU is delivered via an ultrasound beam from an ultrasound machine comprising a transducer, and the machine and the subject are positioned such that at least a portion of the tumor is positioned at the focus of the transducer. In one embodiment of the method, LOFU is delivered to at least a portion of the tumor, and the location of the tumor in the subject is monitored via an imaging technique. In one embodiment of the method, the imaging technique is magnetic resonance imaging. In one embodiment of the method, the imaging technique is computed tomography. In one embodiment of the method, the imaging technique is ultrasound imaging.
[0075] In one embodiment of the method, LOFU is administered to multiple volumes within the tumor at least once within a period of less than 1 hour.
[0076] In one embodiment of the method, LOFU is non-ablative.In one embodiment of the method, LOFU does not cause cavitation in the tissue to which it is applied.
[0077] In one embodiment of the method, the ultrasound component of LOFU is administered at a frequency of 0.5 MHz to 1.5 MHz. In one embodiment of the method, LOFU is administered for 1 to 3 seconds. In one embodiment of the method, LOFU is administered via an ultrasound beam such that within the treatment area, the in situ intensity is 250 W / cm at a tissue depth of 1 mm to 75 mm in the subject. 2 Up to 750W / cm 2 .
[0078] In one embodiment of the method, LOFU is administered over the entire tumor volume. In one embodiment of the method, the method delivers 300-3000 joules / cc of tumor energy to the tumor. In one embodiment of the method, high intensity focused ultrasound (HIFU) is not administered to the subject. In one embodiment, HIFU is focused ultrasound that achieves a tissue temperature of about 80°C or higher in the focal zone. For a few seconds of exposure time on solid tissue, HIFU results in elevated temperatures of up to 60 to 85°C and / or causes thermal ablation in the tissue. Thermal ablation is typically delivered at a rate of greater than 1 kW / cm 2 On the other hand, LOFU can be achieved with power intensities of, for example, 1 to 3 W / cm 2 The power intensity and frequency of 0.5 to 3 MHz are achieved (however, see other LOFU ranges in this article). By adjusting the duty cycle, LOFU can be continuous (100% DC) or pulsed (<100% DC, some literature refers to low-intensity pulsed ultrasound or LIPUS) focused ultrasound. At 1 MHz and 1 W / cm 2 Continuous LOFU for 10 minutes can produce a temperature increase of 0.1℃ in the tissue. In vivo experiments on muscle tissue showed that 1MHz frequency ultrasound treatment at 0.5W / cm 2 The temperature was raised at a rate of 0.04°C / min; at 1.0W / cm 2 0.16℃ / min at 1.5W / cm 2 0.33℃ / min at 2.0W / cm 2 The lower one is 0.38℃ / min.
[0079] In one embodiment of the method, the effects of said amount of radiation therapy and said amount of LOFU are synergistic in treating the tumor.
[0080] In one embodiment of the method, the subject is a human.
[0081] In one embodiment of the method, the tumor is a tumor of the prostate, breast, nasopharynx, pharynx, lung, bone, brain, salivary gland, stomach, esophagus, testicle, ovary, uterus, endometrium, liver, small intestine, appendix, colon, rectum, bladder, gallbladder, pancreas, kidney, bladder, cervix, vagina, vulva, prostate, thyroid, or skin, head or neck, a glioma, or a soft tissue sarcoma. In one embodiment of the method, the tumor is prostate cancer.
[0082] In one embodiment of the method, the metastasis is a lung metastasis.
[0083] In one embodiment of the method, LOFU is administered using a device comprising:
[0084] a control system for generating a frequency waveform; and
[0085] One or more transducers configured to generate 1 to 1000 W / cm2 of radiation in the treatment area 2 Spatial peak time average sound output intensity (I spta ) based on a frequency waveform, wherein the ultrasound is continuously applied to the treatment area for a time in the range of 0.5 to 5 seconds, wherein the ultrasound frequency is in the range of 0.01 to 10 MHz, and wherein the mechanical index of any beam is less than 4. In an embodiment of the method, each of the one or more transducers is configured to generate a frequency waveform based on a center frequency in the range of 0.05 to 5 MHz and an acoustic output intensity of 20-1000 W / cm 2 In one embodiment of the method, each of the one or more transducers is configured to generate a frequency waveform based on a center frequency in the range of 0.5 to 1.5 MHz and an acoustic output intensity of 20-1000 W / cm 2 In one embodiment of the method, each transducer is configured to generate a cylindrical ultrasound beam such that the beam profile waist at -3 dB in the treatment zone is no less than 5 mm. In one embodiment of the method, one or more beams are mechanically moved during treatment. In one embodiment of the method, the one or more transducers include two or more transducers configured to operate sequentially or simultaneously and generate an average spatial peak power of 250 W / cm in the treatment zone during the treatment period. 2In one embodiment of the method, the one or more transducers are configured to generate ultrasound with a frequency in the range of 10 kHz to 300 kHz. In one embodiment of the method, the one or more transducers are configured to generate ultrasound with a frequency in the range of 300 kHz to 3 MHz. In one embodiment of the method, one or more transducers operate at a frequency of 300 kHz to 3 MHz, and one or more transducers operate at a frequency of 30 to 300 kHz. In one embodiment of the method, two or more ultrasound transducers generate ultrasound beams that pass through the treatment area, wherein each beam has a power of 10 to 500 W / cm in the intersection zone. 2 I within the range spta In one embodiment of the method, the treatment time is less than 5 seconds per cubic centimeter of tumor. In one embodiment of the method, two transducers generate ultrasound beams that intersect within the treatment zone, wherein each beam has a power of 50 to 500 W / cm in the intersection zone. 2 I within the range spta In one embodiment of the method, three transducers generate ultrasound beams across the treatment area, wherein each beam has a power of 50 to 500 W / cm 2 I within the range spta In one embodiment of the method, the one or more transducers generate ultrasound beams that are substantially in phase with each other within the treatment zone. In one embodiment of the method, two ultrasound beams emitted from separate ultrasound transducers are substantially in phase and intersect within the treatment zone, and each beam has a power of 70 to 100 W / cm in the intersection zone. 2 The acoustic power spatial peak intensity is within a range of 100 nm and the ultrasound is applied continuously for 1 to 5 seconds.
[0086] In one embodiment of the method, three ultrasound beams emitted from separate ultrasound transducers are substantially in phase and intersect within the treatment zone, and each beam has a power of 50 to 70 W / cm2 in the intersection zone. 2 The ultrasound is applied continuously for 1 to 5 seconds. In one embodiment of the method, each of the ultrasound beams originating from the individual transducers generates approximately 100 to 1000 W / cm2 of acoustic power in the treatment area. 2 I within the range sptaIn one embodiment of the method, at least one transducer generates an ultrasound beam having a high intensity diameter that is much larger than the treatment zone, and is directed so that the treatment zone is completely within the beam. In one embodiment of the method, a strong treatment zone is formed when two or more ultrasound beams cross paths, and the strong treatment zone is equal to or greater than about 1 cm in the direction perpendicular to the transmitted energy and also equal to or greater than about 1 cm in the direction parallel to the transmission. In one embodiment of the method, the sound pressure applied to the treatment zone from each transducer is 0.1 to 10 MPa. In one embodiment of the method, the number of transducers providing a strong ultrasound treatment zone is 1 to 1000. In one embodiment of the method, ultrasound from one or more transducers is applied continuously during the treatment time. In one embodiment of the method, ultrasound is generated with a duty cycle in the range of 1 on time unit to 9 off time units. In one embodiment of the method, the transducer is configured to generate ultrasound with a single frequency tone or a multi-frequency linear frequency modulation wave (chirps). In one embodiment of the method, the one or more transducers operate sequentially in time. In one embodiment of the method, the total energy delivered to the target tissue and the desired margin around the target tissue during the entire application process is greater than the total energy delivered to the surrounding tissue. In one embodiment of the method, the one or more transducers are configured so that the frequency of the ultrasound is swept during the application. In one embodiment of the method, the one or more transducers include a two-dimensional phased array. In one embodiment of the method, the one or more transducers include an annular array. In one embodiment of the method, the one or more transducers include a three-dimensional phased array. In one embodiment of the method, the one or more transducers are incorporated into one or more endoscopic devices. In one embodiment of the method, the one or more transducers are incorporated into a magnetic resonance imaging machine.
[0087] In one embodiment of the method, the one or more transducers are incorporated into a radiotherapy treatment machine.
[0088] In one embodiment of the method, the one or more transducers are configured to generate ultrasound such that the maximum temperature reached in the treatment area is less than 45°C during a treatment period of about 2 seconds or less when ultrasound is applied to the treatment area.
[0089] In one embodiment of the method, the one or more transducers are configured to generate ultrasound such that a maximum temperature reached in the treatment area is less than 50° C. during a treatment period of about 2 seconds or less in which ultrasound is applied to the treatment area.
[0090] In one embodiment of the method, the one or more transducers are configured to generate ultrasound such that the maximum temperature reached in the treatment area is less than 55° C. during a treatment period of about 2 seconds or less in which ultrasound is applied to the treatment area.
[0091] In one embodiment of the method, LOFU and radiation therapy are administered by a system comprising:
[0092] A LOFU device comprising:
[0093] a control system for generating a frequency waveform; and
[0094] One or more transducers configured to generate 1 to 1000 W / cm2 of radiation in the treatment area 2 Spatial peak time average sound output intensity (I spta ) frequency waveform-based ultrasound, wherein the ultrasound is applied continuously for a time in the range of 0.5 to 5 seconds, and wherein the ultrasound frequency is in the range of 0.01 to 10 MHz;
[0095] radiotherapy treatment machines; and
[0096] A control system is operably configured to control the LOFU device and the radiotherapy treatment machine so that a first amount of ultrasound and a second amount of radiotherapy are administered to the subject, wherein the first amount and the second amount together are sufficient to treat the tumor of the subject.
[0097] Provided is a method of treating a tumor in a subject, comprising administering to the subject (i) an amount of low-intensity focused ultrasound (LOFU) and (ii) an amount of chemotherapy, or an amount of radiation therapy, or an amount of immunotherapy, wherein the amounts of (i) and (ii) together are sufficient to treat the tumor.
[0098] In one embodiment of the method, the subject is administered the amount of LOFU and the amount of radiation therapy. In another embodiment of the method, the subject is administered the amount of LOFU and the amount of radiation therapy. In another embodiment of the method, the subject is administered the amount of LOFU and the amount of immunotherapy.
[0099] Provided is a method for treating a tumor in a subject, comprising administering to the subject (i) an amount of low-intensity focused ultrasound (LOFU) and (ii) an amount of a targeted anticancer therapy, wherein the amounts of (i) and (ii) taken together are sufficient to treat the tumor. In one embodiment, the targeted therapy comprises a mAb directed against Her2 or VEGFR. In one embodiment, the targeted therapy comprises a tyrosine kinase inhibitor.
[0100] Also provided is a method of inhibiting tumor metastasis in a subject, comprising administering to a subject having a tumor an amount of low-intensity focused ultrasound (LOFU) and an amount of radiation therapy, wherein the amounts together are sufficient to inhibit tumor metastasis in the subject.
[0101] In the method, the radiation therapy may be ablative hypofractionated radiation therapy.
[0102] Preferably, in the method, LOFU is directed to the location of a tumor in the subject.
[0103] Also provided is a method of reducing the effective dose of anti-cancer chemotherapy required to treat a tumor in a subject, comprising administering to a subject undergoing the anti-cancer chemotherapy an amount of low-intensity focused ultrasound (LOFU) sufficient to reduce the effective dose of the anti-cancer chemotherapy required to treat the tumor.
[0104] In one embodiment of each method, LOFU is administered to the subject prior to or concurrently with chemotherapy or radiation therapy or immunotherapy.
[0105] In one embodiment, LOFU is administered to the subject prior to administration of radiation therapy.
[0106] In the method of administering anticancer chemotherapy, in one embodiment, the anticancer chemotherapy comprises administering an HSP90 inhibitor to the subject. The HSP90 inhibitor can be 17AAG (tansspiramycin or 17-N-allylamino-17-demethoxygeldanamycin). In one embodiment, the chemotherapy drug is an alkylating agent. In one embodiment, the chemotherapy drug is trabectedin. In one embodiment, the chemotherapy drug is a mustard gas derivative. In one embodiment, the chemotherapy drug is a metal salt. In one embodiment, the chemotherapy drug is a plant alkaloid. In one embodiment, the chemotherapy drug is an anti-tumor antibiotic. In one embodiment, the chemotherapy drug is an antimetabolite. In one embodiment, the chemotherapy drug is a topoisomerase inhibitor. In one embodiment, the chemotherapy drug is a proteasome inhibitor. In one embodiment, the chemotherapy drug is a chemotherapeutic NSAID. In one embodiment, the chemotherapy drug is one of the other anti-tumor drugs listed below.
[0107] In one embodiment of the method, LOFU is delivered via an ultrasound beam from an ultrasound machine comprising a transducer, and the machine and subject are positioned so that at least a portion of the tumor is positioned at the focal length of the transducer.
[0108] In one embodiment of the method, LOFU is delivered to at least a portion of the tumor, and the location of the tumor is monitored via an imaging technique. Magnetic resonance imaging may be such an imaging technique.
[0109] In the method, LOFU may be administered to multiple points within the tumor at least once within a period of less than one hour.
[0110] In one embodiment of the method, LOFU is non-ablative.
[0111] In one embodiment of the method, LOFU is administered at a frequency of 0.5 MHz to 1.5 MHz.
[0112] In one embodiment of the method, LOFU is administered for 1.5-3 seconds.
[0113] In one embodiment of the method, LOFU is administered by an ultrasound beam such that the in situ intensity at the focus of the ultrasound beam is 250 W / cm 2 Up to 750W / cm 2 In one embodiment of the method, LOFU is administered via an ultrasound beam such that the in situ intensity at the focus of the ultrasound beam is 250 W / cm at a tissue depth of 1 mm to 75 mm in the subject. 2 Up to 750W / cm 2 In one embodiment of the method, LOFU is administered via an ultrasound beam such that the in situ intensity at the focus of the ultrasound beam is 350 W / cm at a tissue depth of 1 mm to 75 mm in the subject. 2 Up to 650W / cm 2 In one embodiment of the method, LOFU is administered via an ultrasound beam such that the in situ intensity at the focus of the ultrasound beam is 450 W / cm at a tissue depth of 1 mm to 75 mm in the subject. 2 Up to 550W / cm 2 .
[0114] LOFU can be administered over the entire tumor volume, or can be administered over a portion of the tumor volume. In a preferred embodiment, LOFU is administered over the entire tumor volume.
[0115] In one embodiment of the method, LOFU delivers at least 500-5000 joules of energy per cc of tumor tissue. In one embodiment of the method, LOFU delivers at least 1000-4000 joules of energy per cc of tumor tissue. In one embodiment of the method, LOFU delivers at least 2000-3000 joules of energy per cc of tumor tissue.
[0116] In one embodiment, high-intensity focused ultrasound (HIFU) is not administered to the subject. In one embodiment, high-intensity focused ultrasound has not been administered to the subject. In one embodiment, high-intensity focused ultrasound has not been administered to the tumor. In embodiments where LOFU is administered to the subject prior to anti-cancer therapy, high-intensity focused ultrasound is not administered to the subject after the administration of LOFU and before the administration of anti-cancer therapy.
[0117] In one embodiment, the anti-cancer efficacy of said amount of radiation therapy and said amount of LOFU is synergistic.
[0118] In one embodiment, the administered LOFU increases the temperature of the tissue / tumor to 40°C-45°C. In one embodiment, the administered LOFU increases the temperature of the tissue / tumor to no more than 40°C. In one embodiment, the administered LOFU increases the temperature of the tissue / tumor to no more than 45°C. In one embodiment, the administered LOFU increases the temperature of the tissue / tumor to no more than 50°C. HIFU typically increases tissue temperature even higher than this.
[0119] In one embodiment, LOFU is administered for 0.5 to 3 seconds. In one embodiment, LOFU is administered for 1.5 to 3 seconds. In one embodiment, LOFU is administered at a duty cycle of 100%. In one embodiment, LOFU is administered at one of the individual embodiments of a duty cycle of 10, 20, 30, 40, 50, 60, 70, 80, or 90%.
[0120] Also provided is a method for sensitizing a tumor in a subject to an amount of anticancer therapy, the method comprising administering to the subject an amount of low-intensity focused ultrasound (LOFU) before, during, or after the anticancer therapy, the amount being effective in sensitizing the subject's tumor to the amount of anticancer therapy. In one embodiment, the anticancer therapy comprises chemotherapy, or radiotherapy, or immunotherapy, or targeted therapy, or surgery. In one embodiment, the anticancer therapy comprises chemotherapy. In one embodiment, the anticancer therapy comprises immunotherapy. In one embodiment, the anticancer therapy comprises radiotherapy. In one embodiment, the anticancer therapy comprises surgery, such as resection of the tumor. The method may also comprise administering the anticancer therapy to the subject. Sensitizing a tumor to an amount of anticancer therapy makes the tumor more sensitive to treatment. For example, a parameter that can measure tumor treatment (e.g., tumor volume reduction) is greater for the same amount of anticancer therapy applied to a sensitized tumor than for a non-sensitized tumor of equivalent mass, vascular supply, location, and type in the same or equivalent subject. In one embodiment, the amount of LOFU effective to sensitize a tumor in a subject to an amount of an anti-cancer therapy and the anti-cancer therapy are synergistic in effect.
[0121] In any of the methods described herein, the subject is a mammal. In one embodiment, the subject is a human.
[0122] The tumor involved in the method can be a tumor of the prostate, breast, nasopharynx, pharynx, lung, bone, brain, salivary gland, stomach, esophagus, testicle, ovary, uterus, endometrium, liver, small intestine, appendix, colon, rectum, bladder, gallbladder, pancreas, kidney, bladder, cervix, vagina, vulva, prostate, thyroid or skin, head or neck, or a glioma or soft tissue sarcoma. In one embodiment, the tumor is prostate cancer. In one embodiment, the tumor is a soft tissue sarcoma. In one embodiment, a primary tumor is treated. In one embodiment, a secondary tumor is treated. In one embodiment, the treatment of a tumor reduces the likelihood of a secondary tumor. In one embodiment, the metastasis comprises one or more lung metastases.
[0123] As used herein, the term "tumor," unless otherwise indicated, refers to neoplastic cell growth and includes precancerous and cancerous cells and tissues. A tumor typically manifests as a lesion or mass. In one embodiment, the tumor is a malignant tumor.
[0124] As used herein, "metastasis" (or grammatical equivalents) with respect to cancer or tumors refers to the spread of a cancer or tumor from one organ or tissue of a subject to another organ or tissue of the subject that is spatially separated from the first organ or tissue.
[0125] As used herein, "treating" a tumor means that one or more symptoms of the disease, such as the tumor itself, the vascularization of the tumor, or other parameters characterizing the disease, are reduced, improved, inhibited, placed in remission, or maintained in remission. "Treating" a tumor also means that one or more characteristics of a tumor can be eliminated, reduced, or prevented by treatment. Non-limiting examples of such characteristics include uncontrolled degradation of the basement membrane and proximal extracellular matrix, endothelial cells migrating, dividing, and organizing into new functional capillaries, and the continued presence of such functional capillaries. In one embodiment, treating a tumor means reducing the size or volume of a tumor.
[0126] As used herein, "inhibiting metastasis" of a tumor in a subject means reducing, ameliorating, or inhibiting one or more symptoms or one or more other parameters that characterize the disease. Non-limiting examples of such parameters include uncontrolled degradation of the basement membrane and proximal extracellular matrix, and the travel of tumor cells through the bloodstream or lymph, invasion, adhesion disorders, and proliferation at a distant or local second site. In one embodiment, treating metastasis means reducing the occurrence of metastasis or inhibiting the development of metastasis.
[0127] Radiotherapy is well known in the art. Radiotherapy included herein includes the medical therapeutic radiation delivered by a machine (external beam radiotherapy) outside the body or from a radioactive substance (internal radiotherapy, also referred to as brachytherapy) or whole body radiotherapy placed in the body near cancer cells. Radiotherapy included herein includes three-dimensional conformal radiotherapy (3D-CRT), intensity modulated radiation therapy (IMRT), image guided radiation therapy (IGRT) and tomotherapy. This radiotherapy can also be a part for stereotactic radiosurgery or stereotactic body radiation therapy (SBRT). Also included is the delivery of any particle beam known in the art, for example, by proton therapy, carbon ion therapy or the delivery of other charged particle beams depending on tumor type and position.
[0128] In one embodiment, the radiation therapy is CT image-guided. In one embodiment, the radiation therapy is hypofractionated cone-beam radiation therapy. In one embodiment, the radiation therapy is hypofractionated cone-beam CT image-guided radiation therapy. All combinations of the various elements described herein are within the scope of the present invention unless otherwise indicated herein or otherwise clearly contradicted by context.
[0129] The chemotherapeutic drugs that can be used in the present invention are various. Examples of chemotherapeutic drugs include:
[0130] Alkylating agents (e.g., trabectedin ((1'R,6R,6aR,7R,13S,14S,16R)-6',8,14-trihydroxy-7',9-dimethoxy-4,10,23-trimethyl-19-oxo-3',4',6,7,12,13,14,16-octahydrospiro[6,16-(epithiopropyl-oxymethoxy)-7,13-imino-6aH-1,3-dioxolano[7,8]isoquinolino[3,2-b][3]benzazepine-20,1'(2'H)-isoquinolin]-5-yl acetate))
[0131] Mustard gas derivatives (e.g., nitrogen mustard, cyclophosphamide, chlorambucil, melphalan, and ifosfamide);
[0132] Ethylenimines (such as thiotepa and hexamethylmelamine);
[0133] Alkyl sulfonates (e.g., busulfan);
[0134] Hydrazines and triazines (such as altretamine, procarbazine, dacarbazine, and temozolomide);
[0135] Nitrosoureas (such as carmustine, lomustine, and streptozotocin);
[0136] Metal salts (such as carboplatin, cisplatin, and oxaliplatin);
[0137] Plant alkaloids (for example, vinca alkaloids such as vincristine, vinblastine, and vinorelbine, taxanes such as paclitaxel and docetaxel, podophyllotoxins such as etoposide and tenisopide, camptothecin analogs (topoisomerase inhibitors) such as irinotecan and topotecan);
[0138] Antitumor antibiotics (e.g., anthracyclines: doxorubicin, daunorubicin, epirubicin, mitoxantrone, and idarubicin; chromomycins: dactinomycin and plicamycin; other classes, such as mitomycin and bleomycin);
[0139] Antimetabolites (e.g., folate antagonists: methotrexate; pyrimidine antagonists: 5-fluorouracil, floxuridine, cytarabine, capecitabine, and gemcitabine; purine antagonists: 6-mercaptopurine and 6-thioguanine; adenosine deaminase inhibitors: cladribine, fludarabine, nelarabine, and pentostatin);
[0140] topoisomerase inhibitors (e.g., irinotecan, topotecan; amsacrine, etoposide, etoposide phosphate, teniposide);
[0141] protease inhibitors;
[0142] Chemotherapeutic NSAIDS; and
[0143] Other antineoplastic agents (e.g., ribonucleotide reductase inhibitors: hydroxyurea; adrenocortical steroid inhibitors: mitotane; enzymes: asparaginase and pegaspargase; antimicrotubule agents: estramustine; retinoids: bexarotene, isotretinoin, tretinoin (ATRA).
[0144] Chemotherapeutic drugs that induce endoplasmic reticulum (ER) stress and / or the unfolded protein response (UPR) in cells are known in the art. For example, proteasome inhibitors such as bortezomib (Velcade; formerly known as PS-341) induce an ER stress response. Furthermore, proteasome inhibitors such as bortezomib induce the UPR. Histone deacetylase (HDAC) inhibitors induce an ER stress response. Chemotherapeutic NSAIDs (e.g., indomethacin, diclofenac, and celecoxib) can induce an ER stress response and can induce the UPR. Estrogen receptor alpha inhibitors such as BHPI (1,3-dihydro-3,3-bis(4-hydroxyphenyl)-7-methyl-2H-indol-2-one) can activate the UPR. Platinum-containing anticancer drugs: Cisplatin is known to induce an ER stress response. Taxanes: Paclitaxel is known to induce an ER stress response. Anthracyclines such as doxorubicin are known to induce ER stress. Cyclophosphamide is known to induce ER stress. See also Table 2 of Hetz et al., Nature Reviews, Drug Discovery, 12:703-719 (September 2013), which is incorporated herein by reference.
[0145] The endoplasmic reticulum (ER) is the site of synthesis and folding of secretory, membrane-bound, and organelle-targeted proteins. 2+ The stress of concentration is highly sensitive. These stresses reduce the protein folding ability of ER, which may lead to the accumulation and aggregation of unfolded proteins, and / or the imbalance between the load of resident and transported proteins in ER and the ability of this load of the organelle to process. This situation is referred to as " ER stress " in this article and in the art. The ER stress response can promote cell repair and sustained survival, which is to reduce the load of unfolded proteins by the overall attenuation of protein synthesis and / or the increase of molecular chaperones, enzymes and the structural components of ER, thereby enhancing protein folding. This response is generally referred to as the unfolded protein response (UPR). The accumulation of unfolded proteins causes GRP78 to dissociate from PERK, ATF6 and IRE1, thereby triggering UPR.
[0146] Table 1 - Non-limiting examples of chemotherapy that can be used with LOFU
[0147]
[0148]
[0149]
[0150]
[0151]
[0152] In one embodiment of the method, the chemotherapeutic agent is an HSP90 inhibitor. An example of an HSP90 inhibitor is 17AAG (tanespiramycin or 17-N-allylamino-17-demethoxygeldanamycin). In one embodiment, the chemotherapeutic agent is an alkylating agent. In one embodiment, the chemotherapeutic agent is trabectedin. In one embodiment, the chemotherapeutic agent is a mustard gas derivative. In one embodiment, the chemotherapeutic agent is a metal salt. In one embodiment, the chemotherapeutic agent is a plant alkaloid. In one embodiment, the chemotherapeutic agent is an anti-tumor antibiotic. In one embodiment, the chemotherapeutic agent is an antimetabolite. In one embodiment, the chemotherapeutic agent is a topoisomerase inhibitor. In one embodiment, the chemotherapeutic agent is a proteasome inhibitor. In one embodiment, the chemotherapeutic agent is a chemotherapeutic NSAID. In one embodiment, the chemotherapeutic agent is one of the other anti-tumor drugs listed above.
[0153] Unless otherwise indicated, other non-limiting examples of chemotherapeutic drugs or agents encompassed by the present invention include anthracyclines, maytansinoids, alkylating agents, antimetabolites, plant alkaloids or terpenes, and cytotoxic antibiotics. In embodiments, the chemotherapeutic agent is cyclophosphamide, bleomycin, etoposide, a platinum agent (cisplatin), fluorouracil, vincristine, methotrexate, paclitaxel, epirubicin, leucovorin (folinic acid), or irinotecan.
[0154] Anti-tumor immunotherapy (i) included herein includes monoclonal antibodies (including unmodified, chemical, radioactive or toxin-conjugated antibodies and bispecific antibodies), their related antigen-binding fragments, such as fragments consisting of Fab or scFv fragments, which bind to cancer-related biomolecule targets with high affinity; (ii) non-specific for tumor cells and tumor cell antigens; anti-tumor immunotherapy, such as cytokines, interleukins, interferons, GM-CSF, organic small molecules (e.g., 1,500 Daltons or less) or other drugs that bind to cytokines or cytokine receptors; and substances targeting checkpoints, including but not limited to one of CTLA-4, PD-1, PDL-1 and other organic small molecules, peptides and aptamers that target immune responses. In one embodiment, immunotherapy as used herein excludes anti-cancer or anti-tumor immunotherapy based on bacteria. In one embodiment, immunotherapy as used herein excludes immunotherapy based on Listeria.
[0155] In one embodiment, enhancing the therapeutic efficacy means that the degree of therapeutic effect achieved is increased relative to the degree achieved with the same therapeutic amount (e.g., a given therapeutic dose) without the efficacy enhancing method.
[0156] Also provided is an acoustic stimulation therapy device, comprising:
[0157] a control system for generating a frequency waveform; and
[0158] One or more transducers configured to generate 1 to 1000 W / cm2 of radiation in the treatment area 2 Spatial peak time average sound output intensity (I spta ) frequency waveform-based ultrasound, wherein the ultrasound is continuously applied to the treatment area for a time in the range of 0.5 to 5 seconds, wherein the ultrasound frequency is in the range of 0.01 to 10 MHz, and wherein the mechanical index of any beam is less than 4.
[0159] In one embodiment of the device, each of the one or more transducers is configured to generate a frequency waveform based on a center frequency in the range of 0.05 to 5 MHz and an acoustic output intensity of 20-1000 W / cm 2 of ultrasonic beam.
[0160] In one embodiment of the device, each of the one or more transducers is configured to generate a frequency waveform based on a center frequency in the range of 0.5 to 1.5 MHz and an acoustic output intensity of 20-1000 W / cm 2 of ultrasonic beam.
[0161] In one embodiment of the device, each transducer is configured to generate cylindrical ultrasound such that the beam profile waist at -3 dB in the treatment zone is no less than 5 mm.
[0162] In one embodiment of the device, one or more beams are mechanically moved during treatment.
[0163] In one embodiment of the device, the one or more transducers include two or more transducers configured to operate sequentially or simultaneously and to produce an average spatial peak power of 250 W / cm in the treatment area during the treatment period. 2 Ultrasound.
[0164] In one embodiment of the device, the one or more transducers are configured to generate ultrasound having a frequency in the range of 10 kHz to 300 kHz.
[0165] In one embodiment of the device, the one or more transducers are configured to generate ultrasound having a frequency in the range of 300 kHz to 3 MHz.
[0166] In one embodiment of the device, one or more transducers operate at a frequency of 300 kHz to 3 MHz, and one or more transducers operate at a frequency between 30 and 300 kHz.
[0167] In one embodiment of the device, two or more ultrasound transducers generate ultrasound beams that pass through the treatment area, wherein each beam has a power of 10 to 500 W / cm in the intersection region. 2 I within the range spta .
[0168] In one embodiment of the device, the treatment time is less than 5 seconds per cubic centimeter of tumor.
[0169] In one embodiment of the device, two transducers generate ultrasound beams that intersect within the treatment zone, wherein each beam has a power of 50 to 500 W / cm 2 I within the range spta .
[0170] In one embodiment of the device, three transducers generate ultrasound beams across the treatment area, wherein each beam has a power of 50 to 500 W / cm in the intersection region. 2 I within the range spta .
[0171] In one embodiment of the device, the one or more transducers generate ultrasound beams that are substantially in phase with each other within the treatment volume.
[0172] In one embodiment of the device, two ultrasound beams emitted from separate ultrasound transducers are substantially in phase and intersect within the treatment zone, and each beam has a power of 70 to 100 W / cm 2 The acoustic power spatial peak intensity is within a range of 100 nm, and the ultrasound is continuously applied for 1 to 5 seconds.
[0173] In one embodiment of the device, three ultrasound beams emitted from separate ultrasound transducers are substantially in phase and intersect within the treatment zone, and each beam has a power of 50 to 70 W / cm2 in the intersection zone. 2 The acoustic power spatial peak intensity is within a range of 100 nm, and the ultrasound is continuously applied for 1 to 5 seconds.
[0174] In one embodiment of the device, the ultrasound beams from the separate transducers each generate approximately 100 to 1000 W / cm2 in the treatment area. 2 I within the range spta .
[0175] In one embodiment of the device, at least one transducer generates a high intensity ultrasound beam having a diameter much larger than the treatment zone and is directed so that the treatment zone is entirely within the beam.
[0176] In one embodiment of the device, an intense treatment zone is formed when two or more ultrasound beams cross paths, and the intense treatment zone is equal to or greater than about 1 cm in the direction perpendicular to the transmission energy and also equal to or greater than about 1 cm in the direction parallel to the transmission direction.
[0177] In one embodiment of the device, the acoustic pressure applied to the treatment area from each transducer is 0.1 to 10 MPa.
[0178] In one embodiment of the device, the number of transducers providing the intense ultrasound treatment zone is 1 to 1000.
[0179] In one embodiment of the device, the ultrasound from the one or more transducers is applied continuously during the treatment time.
[0180] In one embodiment of the device, the ultrasound is generated with a duty cycle in the range of 1 on time unit to 9 off time units.
[0181] In one embodiment of the device, the transducer is configured to generate ultrasound as a single frequency tone or a multi-frequency chirp wave.
[0182] In one embodiment of the device, the one or more transducers operate sequentially in time.
[0183] In one embodiment of the device, the total energy delivered to the target tissue and the required edge around the target tissue during the entire application process is greater than the total energy delivered to the surrounding tissue. In one embodiment of the device, the one or more transducers are configured so that the frequency of the ultrasound is scanned during application. In one embodiment of the device, the one or more transducers include a two-dimensional phased array. In one embodiment of the device, the one or more transducers include an annular array. In one embodiment of the device, the one or more transducers include a three-dimensional phased array. In one embodiment of the device, the one or more transducers are incorporated into one or more endoscopic devices. In one embodiment of the device, the one or more transducers are incorporated into a magnetic resonance imaging machine. In one embodiment of the device, the one or more transducers are incorporated into a radiotherapy treatment machine.
[0184] In one embodiment of the device, the one or more transducers are configured to generate ultrasound such that during a treatment period of about 2 seconds or less of ultrasound being applied to the treatment area, the maximum temperature reached in the treatment area is less than 45° C. In one embodiment of the device, the one or more transducers are configured to generate ultrasound such that during a treatment period of about 2 seconds or less of ultrasound being applied to the treatment area, the maximum temperature reached in the treatment area is less than 50° C.
[0185] In one embodiment of the device, the one or more transducers are configured to generate ultrasound such that the maximum temperature reached in the treatment area is less than 55°C during a treatment period of about 2 seconds or less when ultrasound is applied to the treatment area.
[0186] Also provided is a system comprising:
[0187] An acoustic stimulation therapy device comprising:
[0188] a control system for generating a frequency waveform; and
[0189] One or more transducers configured to generate 1 to 1000 W / cm2 of radiation in the treatment area. 2 Spatial peak time average sound output intensity (I spta ) frequency waveform-based ultrasound, wherein the ultrasound is applied continuously for a time in the range of 0.5 to 5 seconds, and wherein the ultrasound frequency is in the range of 0.01 to 10 MHz;
[0190] radiotherapy treatment machines; and
[0191] A control system is operably configured to control the sonic therapy device and the radiotherapy machine so that a first amount of the ultrasound and a second amount of the radiotherapy are administered to the subject, wherein the first amount and the second amount together are sufficient to treat the tumor in the subject.
[0192] Also provided is a system comprising:
[0193] An acoustic stimulation therapy device comprising:
[0194] a control system for generating a frequency waveform; and
[0195] One or more transducers configured to generate 1 to 1000 W / cm2 of radiation in the treatment area 2 Spatial peak time average sound output intensity (I spta ) frequency waveform-based ultrasound, wherein the ultrasound is applied continuously for a time in the range of 0.5 to 5 seconds, and wherein the ultrasound frequency is in the range of 0.01 to 10 MHz;
[0196] The sonic therapy device is used in conjunction with chemotherapy such that a first amount of the ultrasound and a second amount of the chemotherapy are administered to a subject, wherein the first amount and the second amount together are sufficient to treat a tumor in the subject.
[0197] Also provided is a system comprising:
[0198] An acoustic therapy device comprising:
[0199] a control system for generating a frequency waveform; and
[0200] One or more transducers configured to generate 1 to 1000 W / cm2 of radiation in the treatment area 2 Spatial peak time average sound output intensity (I spta ) frequency waveform-based ultrasound, wherein the ultrasound is applied continuously for a time in the range of 0.5 to 5 seconds, and wherein the ultrasound frequency is in the range of 0.01 to 10 MHz;
[0201] The sonic therapy device is used in conjunction with immunotherapy such that a first amount of the ultrasound and a second amount of the immunotherapy are administered to a subject, wherein the first amount and the second amount together are sufficient to treat a tumor in the subject.
[0202] The present invention will be better understood through the following examples. However, one skilled in the art will readily appreciate that the specific methods and results discussed are merely illustrative of the present invention, which is more fully described in the claims that follow.
[0203] The present invention provides embodiments including but not limited to the following:
[0204] 1. A method for improving the efficacy of chemotherapy in a subject, comprising administering to the subject (i) an amount of low-intensity focused ultrasound (LOFU) and (ii) an amount of a chemotherapeutic agent, wherein the chemotherapeutic agent achieves endoplasmic reticulum (ER) stress and / or an unfolded protein response (UPR) in tumor cells, wherein the amounts of (i) and (ii) together are sufficient to improve the efficacy of the chemotherapy.
[0205] 2. A method for improving the efficacy of chemotherapy in a predetermined volume of tissue in a subject, the volume being smaller than the entire subject, the method comprising (i) administering to the subject an amount of a chemotherapy drug, wherein the chemotherapy drug effects endoplasmic reticulum (ER) stress and / or an unfolded protein response (UPR) in tumor cells, and (ii) administering to the predetermined volume of tissue in the subject an amount of low-intensity focused ultrasound (LOFU), wherein the amounts of (i) and (ii) taken together are sufficient to improve the efficacy of the chemotherapy within the predetermined volume of tissue.
[0206] 3. A method of treating a tumor in a subject, wherein the tumor is resistant to a chemotherapeutic drug, comprising:
[0207] receiving an identification that the subject has a tumor that is resistant to a particular chemotherapeutic drug;
[0208] administering (i) a certain amount of low-intensity focused ultrasound (LOFU) and (ii) a certain amount of the specific chemotherapy drug,
[0209] wherein the amounts of (i) and (ii) combined are sufficient to treat the tumor.
[0210] 4. A method of treating a chemoresistant tumor in a subject, wherein the tumor is chemoresistant to a previously administered chemotherapy drug, the method comprising:
[0211] administering to the subject (i) an amount of low-intensity focused ultrasound (LOFU) and (ii) an amount of the chemotherapeutic drug,
[0212] wherein the amounts of (i) and (ii) taken together are sufficient to treat the chemoresistant tumor.
[0213] 5. The method of embodiment 3 or 4, wherein the chemotherapeutic drug effects endoplasmic reticulum (ER) stress and / or unfolded protein response (UPR) in tumor cells.
[0214] 6. The method of embodiment 3, wherein the chemotherapeutic drug has been previously administered to the subject multiple times, and wherein the tumor has been diagnosed as resistant to the chemotherapeutic drug after the initial administration of the chemotherapeutic drug.
[0215] 7. The method of embodiment 4, further comprising receiving an identification that the subject has a tumor that is chemoresistant to a previously administered chemotherapy drug.
[0216] 8. The method of any one of embodiments 1-7, wherein the chemotherapeutic drug effects a UPR in tumor cells.
[0217] 9. The method of any one of embodiments 1-7, wherein the chemotherapeutic drug effects ER stress in tumor cells.
[0218] 10. The method of any one of embodiments 1-9, wherein the amounts of (i) and (ii) taken together are sufficient to induce or increase apoptosis of tumor cells.
[0219] 11. The method of any one of embodiments 1, 2, or 8-10, wherein the amount of the chemotherapeutic drug administered alone without enhancing therapeutic efficacy is a subtherapeutic dose.
[0220] 12. A method of treating a tumor in a subject, comprising administering to the subject (i) an amount of low-intensity focused ultrasound (LOFU) and (ii) an amount of chemotherapy or an amount of radiation therapy or an amount of immunotherapy, wherein the amounts of (i) and (ii) together are sufficient to treat the tumor.
[0221] 13. A method of inhibiting tumor metastasis in a subject, comprising administering to a subject having a tumor an amount of low-intensity focused ultrasound (LOFU) and an amount of radiation therapy, wherein the amounts together are sufficient to inhibit tumor metastasis in the subject.
[0222] 14. The method of embodiment 12, wherein the amount of LOFU and the amount of radiation therapy are administered to the subject.
[0223] 15. The method of embodiment 12, wherein the amount of LOFU and the amount of chemotherapy are administered to the subject.
[0224] 16. The method of embodiment 12, wherein the amount of LOFU and the amount of immunotherapy are administered to the subject.
[0225] 17. The method of embodiment 12, 13 or 14, wherein the radiation therapy is ablative hypofractionated radiation therapy.
[0226] 18. The method of any one of embodiments 1-17, wherein the administered LOFU is targeted to the location of a tumor in the subject.
[0227] 19. A method of reducing the effective dose of an anti-cancer chemotherapy required to treat a tumor in a subject, comprising administering to the subject undergoing the anti-cancer chemotherapy an amount of low-intensity focused ultrasound (LOFU) sufficient to reduce the effective dose of the anti-cancer chemotherapy required to treat the tumor.
[0228] 20. The method of any one of embodiments 1-19, wherein the low-intensity focused ultrasound (LOFU) is administered to the subject prior to or concurrently with the chemotherapy or the radiotherapy or the immunotherapy.
[0229] 21. The method of any one of embodiments 12, 13, 14, 17 or 18, wherein the LOFU is administered to the subject prior to administering the radiation therapy.
[0230] 22. The method of any one of embodiments 1-12, 15, 18 or 19, wherein the LOFU is administered to the subject prior to administration of the chemotherapy.
[0231] 23. The method of embodiment 22, wherein the chemotherapeutic drug is an HSP90 inhibitor.
[0232] 24. The method of any one of embodiments 1-23, wherein the LOFU is delivered via an ultrasound beam from an ultrasound machine comprising a transducer, and the machine and subject are positioned such that at least a portion of the tumor is positioned at a focus of the transducer.
[0233] 25. The method of any one of embodiments 1-24, wherein the LOFU is delivered to at least a portion of the tumor, and the location of the tumor in the subject is monitored via imaging techniques.
[0234] 26. The method of embodiment 25, wherein the imaging technique is magnetic resonance imaging.
[0235] 27. The method of any one of embodiments 1-26, wherein the LOFU is administered to multiple volumes within the tumor at least once within a period of less than one hour.
[0236] 28. The method of any one of embodiments 1-27, wherein the LOFU is non-ablative.
[0237] 29. The method of any one of embodiments 1-28, wherein the LOFU does not cause cavitation in the tissue to which it is applied.
[0238] 30. The method of any one of embodiments 1-29, wherein the ultrasound component of the LOFU is administered at a frequency of 0.5 MHz to 1.5 MHz.
[0239] 31. The method of any one of embodiments 1-30, wherein the LOFU is applied for 1 to 3 seconds.
[0240] 32. The method of any one of embodiments 1-31, wherein the LOFU is administered via an ultrasound beam such that within the treatment zone, the in situ intensity is 250 W / cm at a tissue depth of 1 mm to 75 mm in the subject. 2 Up to 750W / cm 2 .
[0241] 33. The method of any one of embodiments 1-32, wherein the LOFU is administered over the entire tumor volume.
[0242] 34. The method of any one of embodiments 1-33, wherein the method delivers energy to the tumor in the range of 300-3000 Joules / cc of tumor.
[0243] 35. The method of any one of embodiments 1-34, wherein high intensity focused ultrasound (HIFU) is not administered to the subject.
[0244] 36. The method of any one of embodiments 12-14, 17, 18, 20, 21 or 24-35, wherein the effects of said amount of radiation therapy and said amount of LOFU are synergistic in treating said tumor.
[0245] 37. A method of sensitizing a tumor in a subject to an amount of an anti-cancer therapy, the method comprising administering to the subject an amount of low-intensity focused ultrasound (LOFU) prior to the anti-cancer therapy, the amount effective to sensitize the subject's tumor to the amount of the anti-cancer therapy.
[0246] 38. The method of embodiment 37, wherein the anti-cancer therapy comprises chemotherapy, or radiotherapy, or immunotherapy, or surgery.
[0247] 39. The method of embodiment 37 or 38, further comprising administering the anti-cancer therapy to the subject.
[0248] 40. The method of any one of embodiments 1-39, wherein the subject is human.
[0249] 41. The method of any one of embodiments 1-40, wherein the tumor is a tumor of the prostate, breast, nasopharynx, pharynx, lung, bone, brain, salivary gland, stomach, esophagus, testicle, ovary, uterus, endometrium, liver, small intestine, appendix, colon, rectum, bladder, gallbladder, pancreas, kidney, bladder, cervix, vagina, vulva, prostate, thyroid, or skin, head or neck, a glioma, or a soft tissue sarcoma.
[0250] 42. The method of embodiment 41, wherein the tumor is prostate cancer.
[0251] 43. The method of any one of embodiments 13, 17, 18, 20, or 24-35, wherein the metastasis is a lung metastasis.
[0252] 44. The method of any one of embodiments 1-43, wherein the LOFU is administered using a device comprising:
[0253] a control system for generating a frequency waveform; and
[0254] One or more transducers configured to generate 1 to 1000 W / cm2 of radiation in the treatment area 2 Spatial peak time average sound output intensity (I spta ) frequency waveform-based ultrasound, wherein the ultrasound is continuously applied to the treatment area for a time in the range of 0.5 to 5 seconds, wherein the ultrasound frequency is in the range of 0.01 to 10 MHz, and wherein the mechanical index of any beam is less than 4.
[0255] 45. The method of embodiment 44, wherein each of the one or more transducers is configured to generate a frequency waveform based on a center frequency in the range of 0.05 to 5 MHz and an acoustic output intensity of 20-1000 W / cm 2 of ultrasonic beam.
[0256] 46. The method of embodiment 44, wherein each of the one or more transducers is configured to generate a frequency waveform based on a center frequency in the range of 0.5 to 1.5 MHz and an acoustic output intensity of 20-1000 W / cm 2 of ultrasonic beam.
[0257] 47. The method of embodiment 44, wherein each transducer is configured to generate cylindrical ultrasound such that the beam profile waist at -3 dB in the treatment volume is no less than 5 mm.
[0258] 48. The method of embodiment 44, wherein one or more beams are mechanically moved during treatment.
[0259] 49. The method of embodiment 44, wherein the one or more transducers include two or more transducers configured to operate sequentially or simultaneously and to produce an average spatial peak power of 250 W / cm in the treatment volume during the treatment period. 2 Ultrasound.
[0260] 50. The method of embodiment 44, wherein the one or more transducers are configured to generate ultrasound having a frequency in the range of 10 kHz to 300 kHz.
[0261] 51. The method of embodiment 44, wherein the one or more transducers are configured to generate ultrasound having a frequency in the range of 300 kHz to 3 MHz.
[0262] 52. The method of embodiment 44, wherein one or more transducers operate at a frequency of 300 kHz to 3 MHz, and one or more transducers operate at a frequency of 30 to 300 kHz.
[0263] 53. The method of embodiment 44, wherein two or more ultrasound transducers generate ultrasound beams across the treatment area, wherein each beam has a power of 10 to 500 W / cm2 in the intersection region. 2 I within the range spta .
[0264] 54. The method of embodiment 53, wherein the treatment time is less than 5 seconds per cubic centimeter of tumor.
[0265] 55. The method of embodiment 53, wherein two transducers generate ultrasound beams that intersect within the treatment region, wherein each beam has a power of 50 to 500 W / cm2 in the intersection region. 2 I within the range spta .
[0266] 56. The method of embodiment 52, wherein three transducers generate ultrasound beams across the treatment region, wherein each beam has a power of 50 to 500 W / cm in the intersection region. 2 I within the range spta .
[0267] 57. The method of embodiment 44, wherein the one or more transducers generate ultrasound beams that are substantially in phase with each other within the treatment area.
[0268] 58. The method of embodiment 57, wherein two ultrasound beams emitted from separate ultrasound transducers are substantially in phase and intersect within the treatment zone, and each beam has a power of 70 to 100 W / cm in the intersection zone. 2 The acoustic power spatial peak intensity is within a range of 100 nm, and the ultrasound is continuously applied for 1 to 5 seconds.
[0269] 59. The method of embodiment 57, wherein three ultrasound beams emitted from separate ultrasound transducers are substantially in phase and intersect within the treatment zone, and each beam has a power of 50 to 70 W / cm 2 The acoustic power spatial peak intensity is within a range of 100 nm, and the ultrasound is continuously applied for 1 to 5 seconds.
[0270] 60. The method of embodiment 44, wherein the ultrasound beams from separate transducers each generate approximately 100 to 1000 W / cm 2 I within the range spta .
[0271] 61. The method of embodiment 44, wherein at least one transducer generates an ultrasound beam having a high intensity diameter that is much larger than the treatment zone and is directed so that the treatment zone is entirely within the beam.
[0272] 62. A method according to embodiment 44, wherein an intense treatment zone is formed when two or more ultrasound beams cross paths, and the intense treatment zone is equal to or greater than about 1 cm in a direction perpendicular to the transmission energy and also equal to or greater than about 1 cm in a direction parallel to the transmission direction.
[0273] 63. The method of embodiment 44, wherein the acoustic pressure applied to the treatment area from each transducer is 0.1 to 10 MPa.
[0274] 64. The method of embodiment 44, wherein the number of transducers providing the intense ultrasound treatment zone is between 1 and 1000.
[0275] 65. The method of embodiment 44, wherein ultrasound from the one or more transducers is applied continuously during the treatment time.
[0276] 66. The method of embodiment 44, wherein the ultrasound is generated with a duty cycle in the range of 1 on time unit to 9 off time units.
[0277] 67. The method of embodiment 44, wherein the transducer is configured to generate ultrasound with a single frequency tone or a multi-frequency linear frequency modulated wave.
[0278] 68. The method of embodiment 44, wherein the one or more transducers operate sequentially in time.
[0279] 69. The method of embodiment 44, wherein the total energy delivered to the target tissue and the desired margin around the target tissue during the entire application process is greater than the total energy delivered to the surrounding tissue.
[0280] 70. The method of embodiment 44, wherein the one or more transducers are configured such that the frequency of ultrasound is swept during application.
[0281] 71. The method of embodiment 44, wherein the one or more transducers comprise a two-dimensional phased array.
[0282] 72. The method of embodiment 44, wherein the one or more transducers comprise an annular array.
[0283] 73. The method of embodiment 44, wherein the one or more transducers comprise a three-dimensional phased array.
[0284] 74. The method of embodiment 44, wherein the one or more transducers are incorporated into one or more endoscopic devices.
[0285] 75. The method of embodiment 44, wherein the one or more transducers are incorporated into a magnetic resonance imaging machine.
[0286] 76. The method of embodiment 44, wherein the one or more transducers are incorporated into a radiotherapy treatment machine.
[0287] 77. The method of embodiment 44, wherein the one or more transducers are configured to generate ultrasound such that during a treatment period of about 2 seconds or less of applying ultrasound to the treatment area, the maximum temperature reached in the treatment area is less than 45°C.
[0288] 78. The method of embodiment 44, wherein the one or more transducers are configured to generate ultrasound such that during a treatment period of about 2 seconds or less of applying ultrasound to the treatment area, the maximum temperature reached in the treatment area is less than 50°C.
[0289] 79. The method of embodiment 44, wherein the one or more transducers are configured to generate ultrasound such that a maximum temperature reached in the treatment area during a treatment period of about 2 seconds or less in which ultrasound is applied to the treatment area is less than 55°C.
[0290] 80. A system comprising:
[0291] An acoustic stimulation therapy device comprising:
[0292] a control system for generating a frequency waveform; and
[0293] One or more transducers configured to generate 1 to 1000 W / cm2 of radiation in the treatment area 2 Spatial peak time average sound output intensity (I spta ) frequency waveform-based ultrasound, wherein the ultrasound is applied continuously for a time in the range of 0.5 to 5 seconds, and wherein the ultrasound frequency is in the range of 0.01 to 10 MHz;
[0294] radiotherapy treatment machines; and
[0295] A control system is operably configured to control the sonic therapy device and the radiotherapy machine so that a first amount of the ultrasound and a second amount of the radiotherapy are administered to the subject, wherein the first amount and the second amount together are sufficient to treat the tumor in the subject.
[0296] 81. The method of any one of embodiments 12-14, 17, 18, 20, 21, 24, 25, 36, or 37-43, wherein the LOFU and radiation therapy are administered by a system comprising:
[0297] A LOFU device comprising:
[0298] a control system for generating a frequency waveform; and
[0299] One or more transducers configured to generate 1 to 1000 W / cm2 of radiation in the treatment area 2 Spatial peak time average sound output intensity (I spta) frequency waveform-based ultrasound, wherein the ultrasound is applied continuously for a time in the range of 0.5 to 5 seconds, and wherein the ultrasound frequency is in the range of 0.01 to 10 MHz;
[0300] radiotherapy treatment machines; and
[0301] A control system is operably configured to control the LOFU device and the radiotherapy treatment machine so that a first amount of the ultrasound and a second amount of radiotherapy are administered to a subject, wherein the first amount and the second amount together are sufficient to treat a tumor in the subject.
[0302] 82. A system comprising:
[0303] An acoustic stimulation therapy device comprising:
[0304] a control system for generating a frequency waveform; and
[0305] One or more transducers configured to generate 1 to 1000 W / cm2 of radiation in the treatment area 2 Spatial peak time average sound output intensity (I spta ) frequency waveform-based ultrasound, wherein the ultrasound is applied continuously for a time in the range of 0.5 to 5 seconds, and wherein the ultrasound frequency is in the range of 0.01 to 10 MHz;
[0306] The sonic therapy device is used in conjunction with chemotherapy such that a first amount of the ultrasound and a second amount of the chemotherapy are administered to a subject, wherein the first amount and the second amount together are sufficient to treat a tumor in the subject.
[0307] 83. A system comprising:
[0308] An acoustic stimulation therapy device comprising:
[0309] a control system for generating a frequency waveform; and
[0310] One or more transducers configured to generate 1 to 1000 W / cm2 of radiation in the treatment area 2 Spatial peak time average sound output intensity (I spta ) frequency waveform-based ultrasound, wherein the ultrasound is applied continuously for a time in the range of 0.5 to 5 seconds, and wherein the ultrasound frequency is in the range of 0.01 to 10 MHz;
[0311] The sonic therapy device is used in conjunction with immunotherapy such that a first amount of the ultrasound and a second amount of the immunotherapy are administered to a subject, wherein the first amount and the second amount together are sufficient to treat a tumor in the subject.
[0312] Example 1
[0313] B16 melanoma tumors suppress IL-2 and IFNγ production by tumor-specific CD4+ T cells: To determine how melanoma cells modulate tumor-induced effector CD4+ T cell responses, three different mouse models were used. First, B16-F1 melanoma tumors were induced in C57Bl / 6J mice by subcutaneous injection of B16 cells in the flank. Tumors were allowed to grow to 7-8 mm in size, and CD4+ T cells were subsequently isolated from both the ipsilateral inguinal draining lymph nodes (DLN) and the distal contralateral non-draining cervical lymph nodes (NDLN). T cells were also obtained from control mice that did not carry any tumors. When stimulated ex vivo with anti-CD3 and anti-CD28 antibodies, CD4+ T cells isolated from tumor DLN produced significantly less IL-2 than cells isolated from the distal contralateral NDLN of the same mouse or from lymph nodes of control tumor-free mice, supporting previous reports on tumor antigen-specific T cell tolerance in murine melanoma (18, 21). Similar, but less pronounced, effects were observed for IFNγ ( Figure 1A and B).
[0314] To confirm these data, a B16-F1 melanoma cell line that had been stably transfected to express OVA as a surrogate tumor antigen was used. These cells were subcutaneously injected into OT-II mice, a mouse strain that has T cells expressing a transgenic MHC class II restricted TCR that recognizes the OVA323-339 peptide. T cells were collected from these mice as described above and stimulated in vitro with splenocytes loaded with the OVA323-339 peptide. CD4+ T cells from the ipsilateral DLN again produced significantly reduced amounts of IL-2 and IFNγ (compared to cells from the contralateral NDLN or from tumor-free mice). Figure 1C and 1D ).
[0315] These results were further confirmed in a third model using Tyrp1 mice, which lack tyrosinase-related protein 1 and carry T cells expressing an MHC class II-restricted TCR specific for the TRP-1113-127 peptide, an endogenous melanocyte differentiation antigen. These mice were injected with B16-F1 cells. As in the previous two models, CD4+ T cells harvested from the ipsilateral DLN produced significantly less IL-2 and IFNγ than cells harvested from the contralateral NDLN or from tumor-free mice. ( Figure 1E and 1F Together, these results support that melanoma tumors induce hyporesponsiveness in tumor antigen-specific CD4+ T cells, as indicated by a reduced capacity to produce effector cytokines upon restimulation.
[0316] Treatment of primary B16 melanoma with LOFU overcomes tumor-induced CD4+ T cell tolerance: HIFU is currently used primarily to induce tumor ablation by generating massive amounts of heat within tumor tissue, leading to coagulative necrosis. While HIFU is a highly effective, non-invasive ablation procedure for achieving local tumor control, it almost instantaneously destroys vasculature and tissue infrastructure, thereby limiting the infiltration of dendritic cells and immune cells for antigen presentation and recognition. We investigated whether administration of LOFU could induce non-lethal thermal / mechanical stress in tumor tissue that could generate new tumor antigens and / or induce the expression of stress-induced proteins, thereby increasing tumor immunogenicity and overcoming tumor-induced CD4+ T cell tolerance. To examine this possibility, separate groups of primary B16-F1 melanoma tumors grown in C57Bl / 6J mice were either untreated or treated with LOFU. 36 hours after LOFU treatment, DLN- and NDLN-resident CD4+ T cells were isolated from both groups of mice and restimulated ex vivo with anti-CD3 and anti-CD28 antibodies. CD4+ T cells from the DLNs of LOFU-treated mice produced significantly more IL-2 compared to cells obtained from the group of mice with untreated tumors. In contrast, T cells from the corresponding NDLNs produced comparable amounts of IL-2 in treated and untreated mice. Figure 2A Similar, but less pronounced, effects on IFNγ production were observed in these same experimental groups of mice ( Figure 2B Collectively, these results indicate that LOFU treatment of B16 melanoma tumors appears to enhance CD4+ T cells to overcome the hyporesponsive state induced by the melanoma tumor microenvironment, suggesting improved activation and reduced tumor-induced T cell tolerance.
[0317] It has been previously shown that melanoma tumors can induce an NFAT1-dependent gene expression program that produces a set of proteins that interfere with TCR signaling and directly inhibit cytokine expression, leading to the establishment of functional anergy in CD4+ T cells (21). To determine the possibility that LOFU treatment inhibits tumor-induced T cell tolerance by preventing anergy induction and that LOFU treatment is responsible for the increased cytokine expression observed in DLN-resident CD4+ T cells after LOFU treatment, the expression of those anergy-associated genes was first monitored in CD4+ T cells isolated from the DLN of B16 tumor-bearing mice and compared with the expression of those genes in T cells harvested from the NDLN of the same mice. T cells from the DLN of tumor-bearing mice expressed higher levels of anergy-associated genes, including the E3 ubiquitin ligases Grail, Cbl-b, and Itch, and the transcription factor Egr2 ( Figure 2CHowever, no difference in Foxp3 expression was observed between DLN and NDLN T cells in tumor-bearing mice, suggesting that the increased presence of regulatory T cells is unlikely to contribute to the reduced CD4+ T cell response under the conditions used in this study ( Figure 2C ).
[0318] It was then determined whether treatment of B16 melanomas with LOFU would affect the expression of those anergy-associated genes in T cells. To assess responses induced by endogenous tumor antigens, B16 tumors grown in Tyrp1 mice were left untreated or treated with LOFU. CD4+ T cells were isolated from DLN and NDLN, and the expression of several anergy-associated genes was assessed. T cells derived from DLN showed varying degrees of upregulation of six of the seven anergy genes analyzed, including Grail, Itch, and Cblb, as well as the transcription factors Egr2 and Grg4 and the protease Caspase 3 (Caspase 3). Figure 2D Another transcription factor, Ikaros, which is also upregulated in several in vitro and in vivo models of T cell anergy, was not significantly upregulated in this melanoma model of tumor-induced anergy, and its levels remained roughly similar in DLN- and NDLN-derived T cells ( Figure 2D Interestingly, when tumors were treated with LOFU, the expression of five of those genes (Grail, Itch, Cblb, Egr2, and Grg4) was not upregulated in T cells isolated from DLNs and showed levels comparable to those of these genes in NDLNs ( Figure 2D ), thus supporting that LOFU treatment inhibits the induction of anergy-inducing gene expression in tumor antigen-specific CD4 + T cells.
[0319] LOFU-treated melanoma tumors are able to reactivate anergic tumor antigen-specific T cells: The results support that tumor-induced T cell tolerance can be overcome after LOFU treatment. This observation was confirmed by the fact that after LOFU treatment of the tumor site, the expression of several anergy-related genes was reduced in T cells from the tumor DLN, while the expression of activation-induced cytokines was restored to levels close to those detected in T cells isolated from the distal NDLN or from control tumor-free mice.
[0320] We investigated whether LOFU could not only prevent the induction of tumor antigen-specific T cell anergy but also reverse established anergy and generate effective effector responses in previously tolerant T cells. Naive CD4+ T cells were isolated from the spleen and lymph nodes of Tyrp1 mice, differentiated into TH1 cells in vitro, and rendered anergic by partially activating them with anti-CD3 antibodies in the absence of costimulation. As expected, T cells became hyporesponsive and showed a substantial reduction in IL-2 production upon restimulation with anti-CD3 and anti-CD28 antibodies ( Figure 3A These anergic cells were then reactivated with CD11c+ dendritic cells loaded with lysates from untreated or LOFU-treated melanoma tumors. As expected, anergic Tyrp1 T cells stimulated with dendritic cells loaded with tumor lysates from untreated B16-F1 melanoma produced negligible amounts of IL-2. However, when dendritic cells were loaded with tumor lysates prepared from LOFU-treated tumors, the previously anergic T cells produced significantly more IL-2 than T cells activated with the untreated lysate ( Figure 3B These results suggest that LOFU treatment of melanoma tumors may lead to the production of immunogenic molecules that enable dendritic cells to deliver activating signals that break tolerance and enable otherwise anergic T cells to respond to antigen re-encounter and mount an effective response.
[0321] Treatment of melanoma with LOFU induces changes in the expression and subcellular distribution of the molecular chaperone proteins calreticulin and Hsp70 in melanoma cells: Activation of melanoma-specific T cells by dendritic cells is a key event that determines their fate. Successful antigen presentation events capable of eliciting effector T cell responses are strictly dependent on the activation state of dendritic cells that would otherwise deliver tolerogenic stimuli. The results show that treatment of melanoma tumors with LOFU leads to increased CD4+ T cell activation, a consequence of hindering tumor-induced T cell tolerance. This may be due to the generation of a more immunogenic dendritic cell population. To examine the effect of LOFU on the ability of dendritic cells to effectively present antigens to T cells, total cells were first isolated from the DLN of tumor-bearing mice that were untreated or treated with LOFU, and immunostained by flow cytometry to determine the expression of B7.1, B7.2, and MHCII on the CD11c+ dendritic cell population. No significant increase in the expression of these proteins was detected in LOFU-treated mice ( Figure 4A ).
[0322] Trafficking of tumor antigens by molecular chaperones including calreticulin and Hsp70 is also crucial for the subsequent efficient presentation of antigens to T cells (32-35). In vivo and in vitro methods were used to detect membrane calreticulin and Hsp70 in untreated and LOFU-treated B16 melanoma tumors. Tumors from tumor-bearing mice that were untreated or treated with LOFU were harvested, prepared into single-cell suspensions, and stained with live / dead markers to assess cell viability. No differences in cell viability were observed in response to LOFU treatment, supporting the view that the low-energy form of FUS does not directly induce tumor cell death ( Figure 4B B16 melanoma tumors were left untreated or exposed to LOFU treatment, and tumor tissue sections were placed on slides. The slides were stained with anti-Hsp70 or anti-calreticulin antibodies and then detected by immunofluorescence. Immunofluorescence analysis of LOFU-treated melanoma tumors confirmed that LOFU induced an increase in Hsp70 expression ( Figure 4C Interestingly, LOFU-treated cells also showed changes in the distribution of calreticulin compared to untreated cells, which appeared to accumulate in discrete regions of the plasma membrane on B16 cells ( Figure 4C To determine whether the increase in Hsp70 expression was also associated with an increased membrane presence of this protein, non-permeabilized CD45-TRP-1+ B16 melanoma cells were stained for Hsp70 and cell surface expression after LOFU treatment assessed by FACS. This analysis confirmed that LOFU treatment of B16 melanoma resulted in an increase in the membrane presence of Hsp-70 in tumor cells ( Figure 4D ).
[0323] LOFU-treated melanoma tumors enhance dendritic cell-mediated tumor antigen presentation, leading to stronger CD4+ T cell responses: To address the possibility that LOFU-treated tumors may result in enhanced stimulatory capacity of resident dendritic cells, we directly tested whether lysates prepared from LOFU-treated tumors could elicit enhanced priming of antigen-specific T cells, resulting in stronger effector responses. For this experiment, tumors were induced in C57BL / 6 mice using B16-F1-OVA melanoma cells. Lysates were prepared from untreated and LOFU-treated tumors. Splenic dendritic cells and responding naive CD4+ T cells were isolated from C57BL / 6 and OT-II tumor-free mice, respectively, and cocultured in the presence or absence of the various tumor lysates described above. Although OVA-containing tumor lysates can serve as a source of tumor antigens for priming responding T cells, exogenous OVA323-339 peptide was also added to ensure uniform peptide loading of dendritic cells under all conditions and to more accurately determine the tolerogenic or activating properties of the various tumor lysates.
[0324] As expected, control responder OT-II T cells showed a robust response with elevated levels of IL-2 production when activated with dendritic cells loaded with OVA323-339 peptide. However, lysates obtained from untreated tumors significantly suppressed the OT-II response and resulted in a substantial decrease in IL-2 production, even when exogenous OVA323-339 peptide was added to the cultures. Figure 5A Interestingly, in contrast to untreated lysates, lysates derived from LOFU-treated tumors not only had no negative impact on the response of OT-II cells to OVA323-339, but were also able to elicit robust activation of OT-II responder T cells even in the absence of exogenous peptide ( Figure 5A These results further support the observation that LOFU treatment of B16 melanoma tumors prevents a negative impact on the T cell priming capacity of normally occurring dendritic cells in the tumor microenvironment.
[0325] We next determined whether tumor DLN-resident antigen-presenting cells would be functionally more effective in activating target T cells following LOFU treatment of melanoma tumors. To this end, B16-F1 melanomas were induced in C57BL / 6 mice and left untreated or treated with LOFU. DLN cell suspensions were depleted of T cells and used to test the ability of DLN antigen-presenting cells to activate tumor antigen-specific T cells. T cell-depleted DLN cells were therefore co-cultured for 24 hours with naive Tyrp1CD4+ T cells and lysates prepared from B16 in vitro cultures. IL-2 production was measured by ELISA to monitor responder T cell priming. Cells isolated from the DLN of tumor-bearing mice treated with LOFU showed a significantly increased ability to activate Tyrp1CD4+ T cells compared to cells isolated from untreated mice ( Figure 5B These data support that LOFU treatment of B16 melanoma results in the generation of antigen-presenting cells that are functionally more efficient at activating tumor antigen-responsive T cells.
[0326] Tumor ablation followed by LOFU by hypofractionated IGRT results in enhanced T cell-mediated control of primary melanoma lesions: To further confirm our observation that LOFU therapy modulates tumor immunogenicity and enhances antitumor immune responses, a series of in vivo treatment strategies for primary tumor control were evaluated in established B16-M1 tumors located subcutaneously on the right dorsal hindlimb using LOFU with or without tumor ablation using daily 10 Gy hypofractionated IGRT to a total dose of 30 Gy per mouse. 3 Treatment was initiated on all mice at 4 hr. Tumor volumes were then measured three times per week in each group for up to 62 days ( Figure 6AUntreated C57BL / 6 mice or mice treated with LOFU alone continued to experience rapid primary tumor growth, reaching ≥300 mm within 10 days of treatment. 3 volume, then a below-knee amputation (BKA) is performed ( Figure 6A In contrast, mice in the hypofractionated IGRT or LOFU+IGRT groups experienced significant growth delays for up to 3 weeks after treatment, after which mice treated with IGRT alone began to show regrowth of primary tumors, reaching ≥300 mm at approximately 5 weeks. 3 Remarkably, mice in the LOFU+IGRT group had a sustained response, with tumor growth restricted for more than 6 weeks after treatment. The reduction in tumor volume in the groups receiving LOFU+IGRT or IGRT compared to the untreated or LOFU alone groups was statistically significant at day 25 (P<0.05). In addition, the reduction in tumor volume in the LOFU+IGRT group compared to the IGRT alone group was statistically significant at day 35 and remained statistically significant for the duration of the experiment (P<0.05). Figure 6A In addition, mice in the LOFU+IGRT group showed tumor regression from their baseline measurements, and 4 of 5 mice had a complete tumor-free response.
[0327] To confirm the immunomodulatory effects of LOFU, similar experiments were performed using an immunocompromised BALB / c nude mouse model. In these mice, B16-M1 tumors grew much faster, reaching ≥300 mm approximately 1 week earlier than in C57BL / 6 mice. 3 The overall treatment responses were similar, with no treatment and LOFU alone resulting in no significant primary tumor control, whereas IGRT and LOFU+IGRT delayed primary tumor growth ( Figure 6B However, primary tumor control was short-lived in both IGRT and LOFU+IGRT treatments. In fact, BKA was required less than 2 weeks after the start of treatment in the IGRT group, whereas BKA was required less than 3 weeks in the LOFU+IGRT group. Furthermore, LOFU+IGRT in immunocompromised mice failed to result in statistically significant primary tumor control compared with IGRT alone ( Figure 6B ).
[0328] Hypofractionated IGRT after LOFU results in prolonged recurrence-free survival and reduced lung metastasis: Based on this data, it is hypothesized that the enhanced antitumor T-cell response induced by LOFU could enhance therapeutic IGRT to achieve better control not only of local disease but also of microscopic disease and distant metastases. Because B16-F10 is an aggressive cell line that rapidly grows to an unacceptable size if left untreated, primary tumors >300 mm 3Of the mice that required BKA. Notably, at the time of BKA, cells from the primary tumor had already spread to the draining popliteal LN (data not shown). Over the following weeks, the draining popliteal LN grew rapidly and became significantly enlarged, while the more distal inguinal LN became clearly palpable. When the tumor reached this point, no procedures could be performed to relieve the discomfort, so these mice were euthanized. Therefore, in mice with a large tumor burden, overall survival could not be adequately assessed. Therefore, it was decided to assess two additional parameters: relapse-free survival, where spontaneous death or euthanized animals with excessive local recurrence tumor burden were scored as positive events; and the development of lung metastases.
[0329] In C57BL / 6 mice, the combination of LOFU+IGRT provided a statistically significant (P=0.04) relapse-free survival advantage compared with either treatment alone ( Figure 6C Notably, in all groups except the C57BL / 6 LOFU+IGRT group, local metastasis to draining popliteal or inguinal LNs frequently necessitated euthanasia. Furthermore, mice treated with LOFU+IGRT showed tight control of lung metastasis, whereas in the other three groups, even animals with relatively few local recurrences ultimately succumbed to excessive lung metastasis ( Figure 6D ).
[0330] discuss
[0331] The adaptive immune system constantly monitors malignantly transformed cells. This is achieved in large part by recognizing tumor-associated antigens that trigger the appropriate T cell repertoire to establish an antitumor immune response. However, tumors also employ different mechanisms to evade the adaptive immune system and prevent antitumor T cell responses (1). Therefore, successful anticancer therapy must overcome the major obstacle of tumor-induced tolerance (36). Several mechanisms have been described to explain how tumors induce tolerance in different T cell subtypes, including defective presentation of tumor antigens and insufficient activation of antigen-presenting cells, signaling through co-inhibitory receptors, immunosuppression caused by factors released within the tumor microenvironment, and local recruitment of suppressor cells (9, 15-17, 20, 37-39). Therapies that promote immunogenic cell death (ICD) of cancer cells can alleviate and drive the reversal of tolerance. Characteristics of ICD include the release of damage-associated molecular patterns (DAMPs), the translocation of certain molecular chaperone complexes to the cell surface, and increased dendritic cell-mediated cross-presentation of tumor-associated antigens (40). In the present study, we sought to investigate whether a novel treatment of melanoma using non-ablative LOFU would lead to the prevention, reversal, or alleviation of tumor-induced resistance and, therefore, an enhancement of the antitumor immune response.
[0332] Although thermal ablative HIFU can control primary tumors, it is generally ineffective in preventing micrometastatic invasion of surrounding or distant tissues, suggesting that the cell death induced by this form of FUS does not adequately trigger an adaptive antitumor immune response. Indeed, local or distant micrometastatic invasion can be prevented or ameliorated by a well-primed immune system that can eliminate the relatively small tumor burden of cells that escape initial ablative therapy. In this study, using a B16 murine melanoma model, we show that treatment with non-ablative LOFU enhances T cell effector responses by overcoming the tolerogenic effects of the tumor microenvironment and prevents local recurrence and distant metastasis when administered prior to ablative therapy.
[0333] The development of T cell hyporesponsiveness to tumor antigens has been described in T cells of several mouse tumor models and human cancers (15, 18, 41). This laboratory has previously reported that tumor antigen-specific CD4+ T cells become anergic in tumor-bearing mice and express a series of anergy-associated genes that have been shown to hinder their ability to proliferate and produce effector cytokines (21, 42). Furthermore, blocking the expression of NFAT1 or Egr2, two transcription factors responsible for the expression of anergy-inducing genes (43-45), in mice lacking these genes resulted in suppression of tumor antigen-specific T cell hyporesponsiveness and improved control of local tumor growth (19, 21). Using two different B16 mouse melanoma models, data demonstrated that tumor antigen-specific CD4+ T cells resident in tumor DLNs upregulated the expression of anergy-associated genes including Grail, Itch, Cblb, Grg4, and Egr2. Activation of this gene expression program correlated strongly with a reduced capacity to produce cytokines upon ex vivo restimulation, supporting the idea that B16 melanoma induces an intrinsic state of hyporesponsiveness in tumor antigen-specific CD4+ T cells. Importantly, treatment of the primary tumor with LOFU resulted in an increase in the capacity of those tumor antigen-specific CD4+ T cells to produce cytokines upon restimulation. FUS-induced restoration of responsiveness to TCR engagement was accompanied by varying degrees of reduction in the expression of most anergy-inducible genes in otherwise anergic cells. However, the lack of FUS-induced changes in Foxp3 transcripts in DLN-resident CD4+ T cells in tumor-bearing mice suggests that FUS does not affect Foxp3+ Treg migration or differentiation and supports the idea that LOFU prevents tumor-induced tolerance by suppressing T cell anergy.
[0334] Initial studies of tumor-induced T cell anergy identified a key role played by antigen-presenting cells in this process, and defective dendritic cell maturation has been defined as a major determinant of inefficient priming of tumor antigen-specific T cells (20, 46). More recently, it has been shown that unstable immune synapses formed between T cells and dendritic cells presenting tumor antigens lead to delayed nuclear export of NFAT and possible activation of a tolerogenic NFAT-dependent program of gene expression, including Egr2 (47). The increase in T cell activation after LOFU treatment of B16 melanoma may be caused by several different phenomena. First, treating tumors with LOFU provides both thermal and mechanical stress to tumor cells. This stress can help produce novel and unique "non-self" tumor antigens, which in turn can make tumors more immunogenic and unable to induce tolerance. Alternatively or additionally, the release of stress-induced danger signals by tumor cells can create a tumor microenvironment in which targeting dendritic cells will be less conducive to inducing tolerance of T cells. Stress-related molecular chaperones, including heat shock proteins and calreticulin, have been implicated in dendritic cell maturation and enhanced antitumor immunity (32, 48-51). There is evidence that primary tumor lysates are enriched in heat shock proteins, which can trigger maturation signals in dendritic cells (52). Importantly, heat shock proteins are also able to bind to antigenic peptides from tumor cells and deliver them to dendritic cells, and their presence in the plasma membrane of tumor cells is associated with increased immune responses (53-55). Calreticulin has also been described to play an important role in antitumor responses, and its translocation to the surface of tumor cells is associated with increased phagocytosis and immune activation by dendritic cells (56, 57). Previous studies using HIFU in a murine adenocarcinoma model showed that this treatment significantly increased the expression of costimulatory molecules on dendritic cells, which also produced higher levels of IL-12 and led to increased CTL activity (58, 59). The data showed that LOFU induced redistribution of calreticulin and increased expression of the inducible heat shock protein Hsp70 in B16 cells, suggesting that LOFU-mediated cellular stress can induce changes in the expression of these stress-induced proteins. Although no significant differences in MHC-II or B7 protein expression were detected, it cannot be ruled out that LOFU may also induce other changes in dendritic cell function that may contribute to enhanced efficient presentation of tumor antigens. In any case, the data support that the thermal / mechanical stress caused by LOFU may be responsible for enhanced tumor immunogenicity and promote T cell activation rather than anergy.
[0335] T cell tolerance induced by tumor antigens remains a major obstacle to cancer treatment. Effectively reversing tumor-specific T cell tolerance is a key goal of clinical anti-tumor strategies. Our data found that pre-established anergy in T cells can be reversed by lysates prepared from melanoma tumors treated with LOFU. This finding opens up the possibility that LOFU-treated tumors can release new immunogenic molecules from tumor cells that can not only prevent but also reverse pre-established tumor tolerance in T cells. Signaling through the IL-2 receptor has long been known to prevent and reverse clonal anergy in T cells (60-62). However, no elevated IL-2 levels were detected in any lysates from untreated or LOFU-treated cells (data not shown), making the presence of IL-2 an unlikely candidate for causing anergy reversal in the experiments. However, other factors may contribute to this phenotype. In fact, T cell co-stimulation by the OX-40 ligand, a member of the TNFR family, has also been shown to prevent and overcome T cell anergy in addition to increasing effector responses in both CD4+ and CD8+ T cells (63-65). Engagement of CD137, CD40, and blockade of PD1 have also been reported to prevent and reverse pre-established CD8+ T cell tolerance in vivo (66-68).
[0336] Pretreatment of melanoma tumors with LOFU prior to ablative therapy with hypofractionated IGRT resulted in a significant delay in tumor growth, and in several cases, complete tumor regression was observed only in immunocompetent mice. Relapse-free survival in these mice was also significantly improved following this regimen. Furthermore, the incidence of lung metastases was lowest in mice that received LOFU prior to tumor ablation compared with mice that received ablative IGRT alone. Strikingly, when similar experiments were performed in T-cell-deficient nude mice, LOFU failed to confer similar protection. This observation suggests that the protective effect of LOFU is not limited to controlling the primary tumor but also prevents the establishment of local or distant metastases. This prevention of metastasis may result from the prevention / reversal of T-cell tolerance to tumor antigens, or both. Pretreatment with LOFU not only more effectively controls tumor growth but, as previously discussed, may also result in the generation of potent immunogenic IGRT-induced tumor death, which provides protection against metastasis and ensures longer relapse-free survival.
[0337] Preventing T cell tolerance to endogenous tumor antigens is crucial for cancer treatment. Our work demonstrates that treating primary tumors with LOFU can achieve this, making it a promising candidate for developing in situ autologous tumor vaccines. FUS therapy of solid tumors, combined with ablative approaches, could be shown to enhance primary tumor eradication and prevent metastasis.
[0338] Methods and Materials
[0339] Mice: 6-8 week old C57BL / 6, B6.Cg-Rag1tm1MomTyrp1B-wTg(TcraTcrb)9Rest / J(Tyrp1), and B6.Cg-Tg(TcraTcrb)425Cbn / J(OT-II) mouse strains were purchased from The Jackson Laboratory. BALBc / nude mice were obtained from the National Cancer Institute and distributed by Charles River. All mice were housed and maintained in a pathogen-free facility.
[0340] B16 cell lines and primary CD4+ T cell culture: B16-F1 and B16-F10 melanoma cell lines were purchased from the American Type Culture Collection (ATCC). A highly aggressive subclone of B16-F10 (B16-M1) was generated by isolating and expanding a metastatic clone that emerged 6 weeks after surgical resection of an established primary tumor in C57BL / 6 mice. The B16-OVA melanoma cell line was a kind gift from E.M. Lord (University of Rochester Medical Center, Rochester, NY). OVA expression by B16-OVA cells was confirmed by real-time PCR. All melanoma cells were cultured in DMEM (Thermo Scientific) supplemented with 10% heat-inactivated FBS, 2 mM L-glutamine, and 250 IU penicillin / streptomycin.
[0341] CD4+ T cells were isolated using anti-CD4 conjugated magnetic Dynabeads (Life Technologies) according to the manufacturer's protocol. CD4+ T cells were differentiated into TH1 helper cells by activation with plate-bound anti-CD3Σ (clone 2C11; 0.25 μg / mL) and anti-CD28 (clone 37.51; 0.25 μg / mL) antibodies (BD Biosciences) as indicated and cultured for 6 days in DMEM supplemented with 10% heat-inactivated FBS, 2 mM L-glutamine, 50 μM 2-mercaptoethanol, non-essential amino acids, and essential vitamins (Cambrex) in the presence of murine IL-12 (10 ng / mL) (eBioscience), anti-mouse IL-4 antibody (clone 11C.11; 10 μg / ml), and 10 U / mL recombinant human IL-2 (Biological Resources Branch of the National Cancer Institute).
[0342] Tumor model: 3×10 5 B16-F1 melanoma cells were injected subcutaneously into the flank of mice. 2 × 10 5 B16-M1 cells induce melanoma tumors in the footpad.
[0343] Tumor growth monitoring: Primary B16-M1 melanoma dorsal hindlimb tumors were measured three times weekly using a vernier caliper. Tumor volume was calculated using the ellipsoid formula: V = (π / 6 × length × width × height). Primary dorsal hindlimb tumors exhibited Gompertzian growth, with a stage I volume of 30-50 mm. 3 , stage II volume is 90-150mm 3 , stage III volume is 300-500mm 3 Therefore, by measuring to 90-150mm 3 The efficacy of treatment is determined by the tumor growth delay (TGD) at which time the tumor is in index II stage. 3 Tumors with ≥300-500 mm ≥300-500 mm ≥500 mm ≥300-500 mm ≥500 mm 3 The mice underwent below-knee amputation.
[0344] ELISA: 1.5-2.5×10 4 Individual T cells were either rested or stimulated with the following: anti-CD3Σ+anti-CD28 antibodies; T cell-depleted splenocytes loaded with OVA peptide 323-339 (OVA323-339) (T cell:splenocyte ratio of 1:5); or CD11c+ purified dendritic cells (using CD11c-beads; Miltenyi Biotech) loaded with OVA323-339 or melanoma tumor lysate at a dendritic cell:T cell ratio of 1:3. Culture supernatants were typically harvested 24 hours after stimulation and IL-2 or IFN levels were measured by sandwich ELISA (BD Biosciences).
[0345] Tumor lysate: Tumors were excised from tumor-bearing mice, cut into 1-2 mm pieces, and passed through a 40 μm nylon mesh. Cells were washed in PBS and resuspended in serum-free DMEM. The cell suspension was then snap-frozen in liquid nitrogen and thawed at 37°C for five cycles, with complete lysis confirmed visually by light microscopy. The lysate was centrifuged at 10,000 g for 15 minutes at 4°C, and the pellet containing cell debris was discarded. The supernatant was used with purified dendritic cells to stimulate T cells.
[0346] Immunofluorescence stained tumor tissue was isolated, washed in PBS, and embedded in OCT compound (Electron Microscopy Sciences). Tissue sections (5 μm) were prepared and permeabilized with acetone for 5 min and incubated with goat serum for 30 min to block nonspecific protein-protein interactions. Tissue sections were incubated overnight with the following antibodies: anti-calreticulin (Pierce, PA5-25922), anti-Trp1 (Abcam, ab3312; clone TA99), and anti-Hsp70 (Novus Biologicals, NBP1-77455). Appropriate secondary antibodies were used for 30 minutes at room temperature. Cell nuclei were detected using DAPI (Invitrogen). At least 10 fields / samples were analyzed using an inverted Olympus IX81 fluorescence microscope.
[0347] Focused ultrasound therapy system. The treatment and imaging probe system (TIPS, Philips Research North America, Briarcliff Manor, NY, USA) is used for all ultrasound exposures. The system can deliver focused and spatiotemporally controlled ultrasonic energy and consists of a treatment control workstation, an RF generator and control electronics, an 8-element spherical shell annular array ultrasonic transducer (80mm radius of curvature, 80mm aperture), and a mobile platform that allows the transducer in the plane to move and be precisely positioned perpendicular to the ultrasound beam axis. Utilizing electronic deflection of the focus, the focused ultrasound beam can also be guided approximately ±15mm out of plane. The ultrasound beam propagates vertically into the target through a thin (25μm) circular plastic film, wherein acoustic coupling is provided by degassed water. During treatment, the system allows adjustment of acoustic output power, ultrasound exposure duration, duty cycle, and ultrasound frequency.
[0348] In vivo focused ultrasound (FUS) therapy. Mice were anesthetized with a continuous flow of 1.5% isoflurane at 1.5 liters / minute in pure oxygen. To ensure proper acoustic coupling, the legs or flanks of the tumor-bearing animals were carefully shaved. Once the animal was positioned for treatment, the tumor was acoustically coupled to the TIPS system using degassed water and ultrasound gel. The center of the tumor was then placed at a focal length of 80 mm from the transducer. Ultrasound exposure was delivered to the tumor using a 1 mm grid pattern extending over the entire tumor volume. Two layers of grid points (5 mm apart) were performed in each tumor, resulting in approximately 160 discrete focal points per tumor and an exposure duration of 5 minutes. The ultrasound transducer was operated at 1.0 MHz, resulting in an ellipsoidal focal spot (-6 dB pressure) with a diameter of approximately 1.5 mm and a length of 12 mm, as measured along the ellipsoid axis. Ultrasound exposure was delivered to the tumor using a 1 mm grid pattern extending over the entire tumor volume. Before treatment, the tumor volume was measured to calculate the grid size for a specific treatment. The duration of ultrasound exposure at each grid point was 1.5 seconds, after which the transducer was automatically positioned on the next grid point and the process was repeated until the entire tumor volume was covered. Two layers of grid points were performed in each tumor. The therapeutic ultrasound device was operated in continuous wave mode under a specific acoustic power / pressure regimen: acoustic power 3W, peak negative pressure = 2.93MPa (80mm focal length) / 3.81MPa (85mm focal length); providing non-ablative low-energy FUS (LOFU). The in situ intensity (Ispta) generated at the focus was estimated to be 550W / cm at a tissue depth of 4mm. 2 The total energy deposition in the tumor was approximately 900 J.
[0349] In vivo hypofractionated cone-beam CT image-guided radiotherapy (IGRT): Total radiation was delivered using the Small Animal Radiation Research Platform (SARRP) from Xstrahl Limited to deliver a dose of 10 Gy to the target tumor in 341 seconds. The anesthetized animal was placed on a table attached to a motorized platform, and the tumor-bearing right hind limb was extended, elevated, and secured to a 1.5 cm adhesive platform to minimize exposure to extraneous tissue. Once secured, a cone-beam CT (CBCT) was performed and the data was opened in a 3D slicer for tissue segmentation and treatment planning. 10 Gy was delivered on three consecutive days for a total hypofractionated dose of 30 Gy. In the combined treatment group, LOFU was performed 2-4 hours before CBCT.
[0350] Lung metastasis assessment: isolate lungs from animals that died spontaneously, were euthanized, or were killed at the end of the 8-week experiment. 1 mL of Fekete solution (a bleaching fixative based on ethanol, glacial acetic acid, and formaldehyde) was injected to insufflate the lungs. The trachea was then clamped, and the entire lung and heart were removed and washed with PBS. The lungs were then placed in Fekete solution and bleached for 48 hours before analysis. The 4 lobes of the left and right lungs were separated and nodules were counted with the aid of a dissecting microscope. Unclear or fused nodules could not be reliably counted; therefore, the lungs were marked as too many to count, and an arbitrary metastasis count of 250 was assigned. Statistical analysis was performed using the nonparametric Kruskal-Wallis test, followed by a Dunn post-test for multiple comparisons.
[0351] Relapse-free survival: The following events were scored as positive in our relapse-free survival analysis: spontaneous death due to tumor confirmed at autopsy, euthanasia due to extensive local metastasis to the draining popliteal or inguinal lymph nodes, or euthanasia due to moribund appearance indicating extensive systemic tumor burden. The following non-tumor-dependent deaths were treated as censored data: death within 24-48 hours of any animal amputated or sacrificed at the end of the 8-week experiment. To prevent selective killing of control or treated animals, cages were labeled with alphanumeric codes to blind the animal institution veterinarian to the treatment and control groups. Relapse-free survival was analyzed using the Mantel-Cox test, and statistical significance was defined as P < 0.05.
[0352] Real-time PCR: Total RNA was extracted from cells using the RNeasy Micro kit (Qiagen), and cDNA was synthesized using qScript cDNA supermix (Quanta Biosciences). Real-time PCR was performed on the cDNA samples using PowerSYBR (Applied Biosystems) as a reporter dye on a StepOnePlus Real-Time PCR System (Applied Biosystems). Expression of the transcripts studied was normalized to β-actin. The primer sets used were as follows:
[0353] Actin b: F-GTGACGTTGACATCCGTAAAGA (SEQ ID NO: 1),
[0354] R-GCCGGACTCATCGTACTCC(SEQ ID NO:2);
[0355] Cblb:F-GCAGCATCATTGACCCTTTCA (SEQ ID NO:3),
[0356] R-ATGTGACTGGTGAGTTCTGCC(SEQ ID NO:4);
[0357] Grail:F-ATGCAAGAGCTCAAAGCAGGAAGC(SEQ ID NO:5)
[0358] R-GTGCGCAGCTGAAGCTTTCCAATA(SEQ ID NO:6)
[0359] Icharos:F-GCTGGCTCTCGGAGGAG(SEQ ID NO:7).
[0360] R-CGCACTTGTACACCTTCAGC(SEQ ID NO:8);
[0361] Formula 3:F-ACGCGCACAAGCTAGAATTT(SEQ ID NO:9),
[0362] R-CTTTGCGTGGAAAGTGGAGT(SEQ ID NO:10);
[0363] Egr2:F-TCAGTGGTTTTATGCACCAGC(SEQ ID NO:11).
[0364] R-GAAGCTACTCGGATACGGGAG(SEQ ID NO:12);
[0365] Grg4:F-TCACTCAAGTTTGCCCACTG(SEQ ID NO:13).
[0366] R-CACAGCTAAGCACCGATGAG(SEQ ID NO:14);
[0367] Itch:F-GTGTGGAGTCACCAGACCCT(SEQ ID NO:15),
[0368] R-GCTTCTACTTGCAGCCCATC(SEQ ID NO:16);
[0369] Foxp3:F-GGCCCTTCTCCAGGACAGA(SEQ ID NO:17)
[0370] R-GCTGATCATGGCTGGGTTGT(SEQ ID NO:18).
[0371] Flow cytometry: Cells were pre-blocked with Fc blocking (CD16 / CD32) antibodies before immunostaining. The following fluorochrome-conjugated antibodies were used: anti-B7.1, B7.2, CD11c, MHC-II, CD45, and their respective isotype control antibodies (eBiosciences); anti-Hsp70 (Novus Biologicals), and anti-TRP1 (Abcam). Dead cells were detected using the Fixable Dead Cell Stain Kit (Invitrogen). Immunostained cells were analyzed on an LSR-II flow cytometer (Becton Dickinson) and post-acquisition analysis was performed using FlowJo software.
[0372] Example 2
[0373] The hypoxic tumor microenvironment generates oxidative endoplasmic reticulum (ER) stress, leading to protein misfolding and the unfolded protein response (UPR). The UPR induces multiple molecular chaperones, including heat shock protein 90 (HSP90), which corrects protein misfolding and improves cancer cell survival and resistance to tumor treatment, although prolonged activation of the UPR induces cell death. The HSP90 inhibitor 17AAG has shown promise against various solid tumors, including prostate cancer (PC). However, therapeutic doses of 17AAG cause systemic toxicity. This article discloses a new paradigm in which a combination therapy of non-ablative and non-invasive low-energy focused ultrasound (LOFU) and non-toxic, low-dose 17AAG causes comprehensive lethality and significant tumoricidal effects in mice and human PC xenografts. LOFU induces ER stress and UPR in tumor cells without inducing cell death. Treatment with non-toxic doses of 17AAG further increases ER stress in LOFU-treated PC and switches the UPR from a cytoprotective to an apoptotic response in tumors, resulting in significant induction of apoptosis and tumor growth retardation. LOFU-induced ER stress makes ultrasound-treated tumors more sensitive to chemotherapeutic drugs such as 17AAG. LOFU-induced chemosensitization is a novel therapy that can be used for tumors such as locally advanced and recurrent tumors.
[0374] Treatment regimen and toxicity of LOFU and 17AAG therapy: For each grid location, LOFU was applied for 1.5 seconds at 100% duty cycle, 3 W acoustic power, and 1 MHz ultrasound frequency. This regimen generated approximately 270 W / cm 2The in situ spatial peak time-averaged acoustic intensity resulted in an estimated mean intratumoral temperature increase of 3.2°C. After treatment, there were no signs of normal tissue toxicity such as hair loss, thermal damage, or skin trauma. Preclinical pharmacokinetic studies in mice showed that 17AAG was widely distributed and underwent extensive hepatic metabolism. Systemic administration of 17AAG is known to be associated with significant hepatotoxicity, characterized by increases in transaminases and bile acids and drug-related histopathological lesions in the gall bladder, common bile duct, and gastrointestinal tract. Therefore, we determined a dose of 17AAG that was non-toxic for our therapy. C57B1 / 6 mice were treated with intraperitoneal injections of 17AAG (25-75 mg / kg body weight) three times a week. Control mice were injected with an equal volume of DMSO, the vehicle used to dissolve 17AAG. Although the 17AAG dose was significantly higher than that of untreated controls (untreated tumors, 1879±98.65 mm 3 , respectively, relative to 17AAG 75mg / kg body weight, 485±24.25mm 3 , p < 0.003 and 50-75 mg / kg body weight, 964 mm 3 Kaplan Meier survival analysis showed that 50% of mice died after 21 days of treatment with a dose of 75 mg / kg body weight.
[0375] The low dose of 17AAG found to be nontoxic was 25 mg / kg in C57Bl / 6 mice and 14 mg / kg in Balb / c nude mice. Therefore, these dose levels were chosen for this study. The goal was to combine two nontoxic treatments, even if subtherapeutic, and to examine whether this combination could be therapeutic. The combined treatment of LOFU + 17AAG enhanced ER stress: the accumulation of misfolded proteins in the ER induces a stress response in which the induction of molecular chaperone proteins helps correct protein misfolding. To examine the level of ER stress, the expression levels of the ER chaperones ERp44, ERp57, and ERp72 were quantified in the different treatment groups. ERp44 is responsible for oxidative protein folding
[69] . ERp57 is an ER-resident thiol disulfide oxidoreductase
[70] , while Erp72 is a disulfide isomerase. All of these proteins are involved in the protein folding machinery of the ER. Immunoblot analysis confirmed the expression of ERp78 in tumor tissues after combined treatment with LOFU+17AAG compared to tumor tissues from animals that did not receive treatment or received LOFU or 17AAG alone (p<0.03, Figure 7D and 7E ), ERp44(p<0.05, Figure 7D and 7G ) and ERp57 (p<0.04, Figure 7D and7F ) protein expression was significantly increased, suggesting that 17AAG-mediated HSP90 inhibition may increase the unfolded protein load in the ER, thereby prolonging ER stress.
[0376] LOFU+17AAG activates the pro-apoptotic pathway of the UPR and induces apoptosis in mouse and human prostate cancer tissues: ER stress simultaneously activates the three groups of the UPR, thereby generating antagonistic cytoprotective and apoptotic signals simultaneously. The fate of the cell depends on the ability of its protein correction machinery to reduce ER stress and thus attenuate the UPR. If EER stress persists, the cytoprotective pathway is eventually destroyed with chronic activation of the PERK-mediated apoptotic pathway, leading to cell death. Since PERK phosphorylation at Thr980 serves as a marker of its activation state, we performed immunoblot analysis, which showed a significant increase in pPERK levels in tumor tissues after treatment with 17AAG ( Figure 8A ). Phosphorylated PERK levels were absent in untreated and LOFU-treated tumors. However, the combination of LOFU+17AAG treatment showed the highest level of PERK phosphorylation ( Figure 8A ).
[0377] Since prolonged PERK activation attenuates protein synthesis in response to ER stress by phosphorylating the translation initiation factor eIF2a at serine 51, the levels of phosphorylated eIF2α were determined. Treatment of RM1 tumors with 17AAG induced eIF2α phosphorylation above the basal level of untreated controls. LOFU treatment resulted in a minimal decrease in phosphorylated eIF2α levels. However, the highest levels of phosphorylated eIF2α were seen in tumors receiving the combination of LOFU and 17AAG ( Figure 8B ), demonstrating the highest activation of PERK phosphorylation in these tumors compared with the other groups.
[0378] Although phosphorylated eIF2α reduces the translation of most cellular proteins (including pro-survival and anti-apoptotic proteins), it increases the translation of the transcription factor ATF4, which is responsible for inducing the transcription of pro-apoptotic genes such as CCAAT / enhancer binding protein homologous protein copy (CHOP), thereby preparing cells for programmed cell death in the absence of repair of misfolded proteins and persistent ER stress
[71] . As expected, LOFU treatment failed to induce CHOP levels above the untreated control group (1.6 ± 0.7-fold). In contrast, treatment with 17AAG alone induced CHOP transcript levels to 14.8 ± 2-fold compared to the untreated control group, which was further increased to 25 ± 1.3-fold in the LOFU + 17AAG combination treatment group (p < 0.006) ( Figure 8C ).
[0379] To examine whether downstream apoptotic genes are expressed after CHOP induction by LOFU+17AAG combination treatment, a mouse UPR qRT-PCR array was used on total RNA isolated from tumor tissues of various treatment groups. Heat map analysis confirmed that pro-apoptotic target genes such as Bax, Vcp, Pdia3, Armet, Ddit3, Mapk8, Mapk9, and Mapk10 were induced several-fold after LOFU+17AAG combination treatment compared to untreated controls ( Figure 8D ). Treatment with LOFU alone or 17AAG alone resulted in minimal induction of pro-apoptotic genes. This result suggests that the combined LOFU+17AAG treatment activates PERK, induces CHOP, and initiates the pro-apoptotic pathway of the UPR. In fact, TUNEL staining demonstrated that LOFU induced minimal apoptosis compared to the untreated control group. Treatment with 17AAG induced significant apoptosis in prostate tumors, which was further increased by LOFU (p<0.004) ( Figure 8E ). Thus, through the combination of LOFU+17AAG, 17AAG-mediated inhibition of HSP90 and activation of CHOP initiated apoptotic cell death in prostate tumors. LOFU+17AAG inhibited chaperone-mediated autophagy (CMA) in tumor cells.
[0380] The degradation of misfolded proteins is mediated by the proteasome pathway and autophagy. Autophagy has been implicated in tumorigenesis in a context-dependent manner, where it may provide amino acids and other essential nutrients to the metabolic pathways of nutrient-deficient, hypoxic tumors
[72] . Indeed, increased CMA activity has been described in a variety of human tumors and has been associated with tumor cell survival, proliferation, and metastasis
[73] . Therefore, the levels of two key proteins involved in autophagy were quantified, namely Beclin (a macroautophagy marker) and the LAMP-2A lysosomal receptor (a CMA marker) in tumor tissues from each treatment group. As Figures 9A-9C As shown, Beclin levels remained unchanged with LOFU or 17AAG or combined therapy ( Figure 9A and 9C ), indicating that ultrasound therapy did not alter macroautophagy. However, LOFU alone or 17AAG alone induced the expression of LAMP-2A ( Figure 9A and 9B ), indicating a compensatory increase in CMA after treatment that increases the misfolded protein load in the ER. Interestingly, the combination of LOFU and 17AAG suppressed LAMP-2A levels below the basal levels seen in these tumors. This suggests that the combination therapy reduces tumor cell growth and induces apoptosis by increasing ER stress while simultaneously inhibiting CMA.
[0381] LOFU sensitized human and murine prostate cancer xenografts to non-toxic low-dose 17AAG: treatment with LOFU alone or low-dose 17AAG alone (25 mg / kg body weight) did not show any normal tissue toxicity but failed to inhibit tumor growth. However, LOFU+17AAG combination therapy reduced the growth of RM1 tumors in mice ( Figure 10B The mean estimated tumor growth was 5% (p<0.0001), 9% (p<0.0001), and 11% (p<0.0001) slower in the LOFU, 17AAG, and LOFU+17AAG groups compared to the control group. Tumors reached a size of 2000 mm in the control, LOFU, and LOFU+17AAG groups. 3 The median time to reach 42 days was 18 days, 22 days, and 42 days, respectively. All animals in the 17AAG group reached this size within the interval of 26-30 days.
[0382] A similar degree of chemosensitization was observed in human PC3 tumors in BalbC nu / nu mice when LOFU was applied together with a low non-toxic dose of 17AAG (14 mg / kg body weight), resulting in significant tumor growth retardation (p < 0.007) ( Figure 10C ), without any direct adverse side effects.
[0383] LOFU+17AAG treatment reduces prostate cancer stem cell populations in tumor tissues: The effects of LOFU+17AAG-induced ER stress on PC stem / progenitor cell populations were evaluated by flow cytometric analysis of PC stem / progenitor cell surface markers [24, 25]. Compared with the control or single treatment groups, the expression of cell surface SCA1 ( Figure 11A and 11B )(p<0.004), CD44( Figure 11A and 11C )(p<0.003), CD133( Figure 11A and 11D )(p<0.007) and α2β1 integrin (p<0.005) ( Figure 11A and 11E ) were significantly reduced in the combined treatment group. The mean fluorescence intensity (MFI) of all these markers remained unchanged in all three groups. qRT-PCR arrays of stem cell transcription factors showed an increase (>2-fold) in the mRNA levels of TIx3, Hoxa11, Pcna, Gli2, Runx1, Foxa2, Sp1, Tbx5, Hoxa10, Nfatc1, Gata6, and Notch2 ( Figure 11F), indicating that LOFU induces transcriptional signaling in PC stem cells. Treatment with 17AAG also increased the expression of transcription factor mRNAs such as FoxP1, Nrf2f, and Pou5f1, present in LOFU-treated tumors. However, tumors treated with LOFU plus 17AAG downregulated the expression of these genes, suggesting that maximizing ER stress through combined treatment may reduce the PC stem / progenitor cell population in tumors.
[0384] discuss
[0385] The results demonstrated that the combination of LOFU and chemotherapy reprogrammed the expression of pro-apoptotic genes in tumors and induced massive apoptosis in tumor xenografts, leading to significant tumor growth retardation in both mouse and human PC tumors. The effects of LOFU could ameliorate resistance to chemotherapy and achieve chemosensitization.
[0386] Methods and Materials
[0387] animal
[0388] Male C57Bl / 6 (NCI-Fort Dietrich, MD, USA) mice and athymic nude mice (BalbC nu / nu mice, Jackson Laboratory, Bay Harbor, ME, USA) aged 5 to 6 weeks were maintained free-range, and all studies were performed under the guidance and protocols of the Institutional Animal Care and Use Committee of the Albert Einstein College of Medicine.
[0389] Tumor models and treatments
[0390] C57Bl / 6 and BalbC nu / nu mice were injected subcutaneously in the flank with 1×10 5 RM-1 (murine prostate cancer cell line) and 1×10 6 PC3 (human prostate cancer cell line) cells. After about 10 days, tumors became palpable (3-5 mm in diameter), so LOFU treatment was started. Mice were divided into 4 groups (n=5 / group) that received no treatment, LOFU, 17AAG (InvivoGen, San Diego, CA, USA), and 17AAG+LOFU. Palpable tumors were treated with LOFU every 3-4 days, with five portions administered over two weeks. During this period, animals received 17AAG three times a week. Tumor volume measurements were performed twice a week using a vernier caliper, and physical assessments were performed for systemic toxicity signs (discomfort and diarrhea).
[0391] LOFU system
[0392] All ultrasound exposures were performed using a Therapeutic and Imaging Probe System (TIPS, Philips Research North America, Briarcliff Manor, NY, USA). This system consists of an 8-element spherical shell annular array transducer (80 mm radius of curvature, 80 mm aperture) and a motion platform that allows for transducer movement and precise positioning. The transducer operates at 1.0 MHz and produces a focal spot approximately 1.5 mm in diameter and 12 mm in length (−6 dB pressure). [12, 13]
[0393] LOFU treatment options.
[0394] On the day of treatment, animals were anesthetized with ketamine and xylazine (7.1 mg / ml for 100 l / mouse, intraperitoneally).Once positioned for treatment, the tumor was acoustically coupled to the TIPS system using degassed water and ultrasound gel.
[0395] Ultrasound exposure parameters were as follows: acoustic power of 3 W and a duty cycle of 100%, producing approximately 270 W / cm at an ultrasound depth of 3 mm in the tissue. 2 The in situ spatial peak time average intensity (Ispta)
[74] was calculated, assuming an attenuation coefficient of 0.5 dB cm-1 MHz-1
[75] . Ultrasound exposure was delivered to the tumor using a 2 mm grid pattern extending over the entire tumor volume. Prior to LOFU, the tumor volume was measured to calculate the grid size for a specific treatment. The duration of the LOFU exposure at each grid point was 1.5 s, after which the transducer was automatically positioned on the next grid point and the process was repeated until the entire tumor volume was covered. This resulted in uneven energy delivery to the tumor.
[0396] Estimation of in vitro temperature rise.
[0397] Estimation of intratumoral temperature by invasive means is not ideal for modulating the therapeutic response to combined therapy. Therefore, to estimate the intratumoral temperature increase using the above-described setup and treatment protocol, ultrasound exposures were performed in a 6 mm × 6 mm area within a simulated tissue phantom
[76] , in which a T-type thermocouple (200 μm diameter) was embedded at a depth of 3 mm. These in vitro exposures were repeated five times, and the results were averaged.
[0398] In situ apoptosis detection
[0399] Apoptotic cells were detected in situ by TUNEL (TdT-mediated digoxigenin-labeled dUTP nick end labeling) staining. Briefly, paraffin-embedded sections were dewaxed, rehydrated with graded alcohols, and stained using the ApopTag kit (Intregen Co, Norcross, GA, USA). The apoptotic rate of tumor cells was quantified by calculating the percentage of apoptotic cells per high-power field.
[0400] Immunoblot analysis
[0401] 24 hours after LOFU, tumor cells were collected, washed with phosphate-buffered saline, and lysed using TPER (ThermoFisher Scientific, Rockford, IL, USA). Cell lysates were subjected to SDS-PAGE, transferred to polyvinylidene difluoride membranes, and immunoblotted with the first antibody and horseradish peroxidase-conjugated second antibody for PERK, pPERK, eIF2, peIF2, ERp72, ERp44, ERp57, Beclin (Cell signaling, Danvers, MA, USA), Lamp2a (Abcam, Cambridge, MA, USA). Blots were developed using ECL kits (GE Healthcare, Piscataway, NJ, USA). Densitometric analysis of the immunoreactive bands of each blot was photographed, and images were then digitized and analyzed using a Gel Doc XR system (Bio-Rad, Hercules, CA, USA).
[0402] Real-time PCR analysis of UPR target genes was performed 24 h after LOFU treatment. RM1 tumor cells were lysed using RLT buffer mixed with 1% β-mercaptoethanol from the RNeasy Mini Kit (Qiagen, Valencia, CA, USA).
[0403] RNA was isolated from tumor lysates using the Qiagen protocol with on-column DNA digestion for the RNeasy Mini Kit. RNA samples were stored at −80°C before further use. cDNA synthesis was performed on the isolated RNA using the SuperScript™ First-Strand Synthesis System (Invitrogen, Grand Island, NY, USA). Splicing of XBP1 RNA was detected using the following primer pair: 5′-ACTCGGTCTGGAAATCTG-3′ (SEQ ID NO: 19) and 5′-TAGCCAGGAAACGTCTAC-3′ (SEQ ID NO: 20) (Fisher Scientific, Pittsburg, PA, USA)
[77] . Real-time PCR was performed in a Light Cycler real-time PCR instrument (Bio Rad Laboratories, Hercules, CA, USA) using Absolute QPCR SYBER Green Mix (ABgene, Rochester, NY, USA) according to the standard ABgene protocol. To check primer amplification specificity, a melting curve was generated at the end of PCR, and different samples containing the same primer pair showed matching amplicon melting temperatures.
[0404] Primers used for real-time PCR included GRP78 5'TTGCTTATGGCCTGGATAAGAGGG3' (SEQ ID NO: 21) and 5'TGTACCCTTGTCTTCAGCTGTCAC3' (SEQ ID NO: 22); EDEM 5'TCATCCGAGTTCCAGAAAGCAGTC3' (SEQ ID NO: 23) and 5'TTGACATAGAGTGGAGGGTCTCCT 3' (SEQ ID NO: 24) (Fisher Scientific). All qRT-PCR and real-time PCR experiments were repeated three times. qRT-PCR and PCR arrays of apoptosis genes and stem cell transcription factors were performed by the SABiosciences PCR array system (Frederick, MD, USA) according to the manufacturer's protocol. Briefly, RT-PCR was used. 2 cDNA was prepared from purified total RNA using the First Strand Kit (Qiagen) and subsequently PCR arrays were performed using the SA Bioscience PCR Array Kit. Data were analyzed by web-based PCR array data analysis software from SA Biosciences.
[0405] Flow cytometric analysis
[0406] Flank tumors were treated with LOFU, 17AAG, and LOFU+17AAG in various groups. After 24 hours of treatment, tumor cells were isolated by collagenase digestion and analyzed by flow cytometry for the expression of prostate cancer stem cell markers SCA1, CD44, and CD133. Isolated tumor cells were stained with anti-SCA1 conjugated to FITC (BD Biosciences, La Jolla, CA, USA), anti-CD133 conjugated to pacific blue (eBioscience, San Diego, CA, USA), and anti-CD44 conjugated to PE (BD Biosciences, La Jolla, CA, USA). Data were acquired using LSRII (BD Biosciences) and analyzed using FlowJo v.7.1 (Treestar Inc, Ashland, OR, USA) software.
[0407] Kaplan-Meier survival analysis
[0408] The survival / mortality of mice in the different treatment groups was analyzed by Kaplan-Meier as a function of radiation dose using Sigma-Plot and GraphPad Prism (version 4.0 for OS X, San Diego, CA, USA) software.
[0409] Statistical analysis
[0410] For digital images, random sampling areas were selected for data collection for data quantification. Digital image data were evaluated in a blinded manner for any treatment. Two-tailed Student's t-test was used to determine significant differences (p < 0.05) between experimental groups with representative mean standard error (SEM).
[0411] Figure 12An acoustic stimulation therapy (APT) device according to an exemplary embodiment of the present invention is shown, generally designated by reference numeral 1. The APT device 1 is powered by a power supply (not shown) and includes a control system 10, an amplifier 12, a matching transformer 14, and a transducer 16. To provide treatment, an ultrasonic transducer 16 can be positioned near or within an area of a patient's body 1000. A clinician can use a function generator at the control system 10 to appropriately adjust the frequency and duration of the ultrasonic pulses delivered by the transducer 16. When the ultrasonic transducer 16 is excited, the emitting surface of the transducer element generates a pressure wave in the body fluid surrounding the ultrasonic transducer 16. The pressure wave then propagates through the fluid and tissue within the patient's body 1000 and ultimately reaches the target area, thereby generating non-ablative acoustic stress to the target tissue. As explained in further detail herein, the acoustic stress delivered to tissue can have many therapeutic uses, and in the case of cancer treatment, such stress of cancer cells in a tumor can lead to immunogenic modulation, radiosensitization, and chemosensitization. The ultrasonic transducer 16 can be repositioned to an adjacent area of the patient's body for further treatment.
[0412] The matching transformer 14 provides impedance transformation between the power supply and the ultrasonic transducer.
[0413] The amplifier 12 generates a transducer drive signal for driving the transducer 16 based on the output signal of the control system 10. In an exemplary embodiment, the amplifier 12 can be a switched resonant power amplifier, an example of which is disclosed in U.S. Patent No. 7,396,336, the contents of which are incorporated herein by reference in their entirety. In another embodiment, a low impedance ultrasonic driver-transducer system can be employed
[78] .
[0414] The transducer 16 generates 10 to 1000 W / cm2 of radiation in the treatment area. 2 Spatial peak time average intensity (I spta ) of acoustic power. The ultrasound is applied continuously for a time in the range of 0.5 to 5 seconds, with a frequency range of 0.01 to 10 MHz. In some embodiments, the minimum diameter of any ultrasound beam in the treatment area is about 1 cm.
[0415] exist Figure 12 In the embodiment shown, the frequency of the ultrasound generated by the APT device 1 is in the range of about 10 KHz to about 300 KHz. However, the APT device according to the present invention can generate higher frequencies, for example, frequencies in the range of about 300 KHz to about 3 MHz. Figure 13 As shown, an embodiment of such an APT device, generally designated by reference numeral 100, may include a control system 110, an amplifier 112, a matching transformer 114, and a transducer 116, which components have similarities to those of reference numeral 100. Figure 12Same function and structure as previously described. In an embodiment, the transducer 116 can be a flat or concave piston-type transducer composed of single or multiple elements that converts another type of energy into acoustic energy.
[0416] like Figure 14 As shown, the APT device 1 and the APT device 100 can be integrated into a single system, generally designated by reference numeral 200, to provide improved efficacy and / or lower overall energy input. The integrated system 200 provides focused low-frequency and collimated high-frequency beams for APT treatment. In some embodiments, the low-frequency ultrasound is substantially focused based on the frequency achievable for a given frequency or frequency range, and the intermediate frequency is collimated. In some embodiments, the transducer used to generate the low frequency is concave, and the transducer used to generate the intermediate frequency is planar.
[0417] exist Figure 15-17 As shown, the APT devices 1, 100, 200 can operate in conjunction with an ultrasound monitoring system, generally designated by reference numeral 300. The ultrasound monitoring system 300 can be powered by a power source (not shown) and includes a control system 310, an amplifier 312, and a pulse-receiver system 314. The ultrasound monitoring system 300 can be used to monitor and / or provide imaging of target tissue before, during, and / or after APT treatment. In particular, the pulse-receiver system 314 can include a transducer that receives pressure waves reflected by, generated by, or generated within the target tissue and an amplifier 312 that generates an electrical signal corresponding to the received pressure wave. The control system 310 generates an output based on the electrical signal that can be used by a clinician to determine treatment status and / or other parameters. Although the ultrasound monitoring system 300 is shown as a separate component from the APT devices 1, 100, 200, it should be understood that monitoring and APT delivery can be performed by a single system.
[0418] In some embodiments, ultrasound monitoring system 300 is used to provide information about the location of tissue to be treated.One or more non-therapeutic ultrasound transmit and receive subsystems may be used to monitor the APT treatment and the effects of the treatment on the tissue.
[0419] In some embodiments, data collected and used to plan radiation therapy is also used, at least in part, to plan ultrasound therapy.
[0420] In some embodiments, data collected for APT treatment planning or APT treatment is used for radiation therapy planning. In some embodiments, data collected for radiation therapy planning is used for APT treatment planning. In some embodiments, data collected during APT treatment is used for radiation therapy planning.
[0421] In some embodiments, ultrasound is applied at a lower frequency to treat a specific location or locations identified in part by ultrasound imaging performed at a higher frequency.
[0422] Various ultrasound-based imaging and monitoring modalities can be used to monitor power deposition in tissue during APT treatment. In some embodiments, tissue temperature can be monitored by acoustic means
[79] .
[0423] In some embodiments, ultrasound elastography is used to monitor treatment. In some embodiments, harmonic imaging is used to monitor treatment. In some embodiments, thermal strain is measured. In some embodiments, the system consists of one or more ultrasound transmit and receive transducer subsystems for measuring tissue strain. Tissue strain information can be used to target the therapeutic ultrasound beam to the desired tissue, and in some embodiments, before full therapeutic power is applied to the therapeutic transducer. For example, in one embodiment, power is applied to one or more therapeutic transducers at 10% to 50% of the intended therapeutic power, and ultrasonic feedback is used to measure the strain of the target tissue. Based on strain imaging, the APT transducer can be physically or electronically repositioned or more effectively directed to the target tissue. In some embodiments, full power is applied from one or more transducers, but for a shorter time than the time used for therapeutic effect during the strain measurement period until the desired targeting is confirmed.
[0424] In some embodiments, temperature measurements are used to monitor treatment.
[0425] Each transducer of the APT system 1 , 100 , 200 may be a single transducer, or may be an array of multiple transducers. Figure 18 FIG2 is a perspective view of a transducer, generally designated by reference numeral 400, according to an exemplary embodiment of the present invention. Transducer 400 includes an array of transducer elements 402. Any number of transducer elements 402 may be arranged sequentially along an azimuth axis. Transducer elements 402 are supported on a backing plate 404. As is well known, signal leads couple the electrodes of each transducer element 402 to transmit and receive circuitry. Transducer elements 402 convert electrical signals provided by the transmission circuitry into pressure waves.
[0426] In some medium frequency embodiments (about 300 KHz to about 3 MHz), two or more ultrasound transducers generate ultrasound beams that intersect within a treatment zone, denoted herein as the intersection zone, wherein each beam has a power of between 10 and 500 W / cm 2 I within the range spta In an embodiment, two transducers generate ultrasound beams that intersect within the treatment zone, wherein each beam has a power of 50 to 500 W / cm2 in the intersection zone. 2 I within the range sptaIn an embodiment, three transducers generate ultrasound beams that intersect within the treatment zone, each beam having a power of 50 to 500 W / cm 2 I within the range spta .
[0427] In some embodiments, the multiple beams are substantially in phase with each other. In some embodiments, two ultrasound beams emitted from separate ultrasound transducers are substantially in phase and intersect within the treatment zone, and each beam has a power of 70 to 100 W / cm in the intersection zone. 2 The acoustic power spatial peak intensity is within the range of , and the ultrasound is continuously applied for 1 to 5 seconds. In some embodiments, the three ultrasound beams emitted from the separate ultrasound transducers have substantially the same frequency, are in phase and intersect within the treatment area, and each beam has a power of 50 to 70 W / cm in the intersection area. 2 The acoustic power spatial peak intensity is within a range, and the ultrasound is applied continuously for 1 to 5 seconds.
[0428] In some embodiments, the beams from individual transducers or transducer elements each produce approximately 300 W / cm2 of radiation in the treatment area. 2 I spta .
[0429] In some embodiments, at least one transducer diameter and the ultrasound beam emitted from the transducer are substantially larger than the treatment area. Using one or more such large transducers in combination with smaller transducers advantageously allows for low-precision aiming of high-power, high-volume beams while achieving effective and faster treatment.
[0430] In some embodiments, an intense treatment zone is formed where two or more beams cross paths, the intense treatment zone being equal to or greater than about 1 cm in the direction perpendicular to the transmitted energy and also equal to or greater than about 1 cm in the direction parallel to the transmission.
[0431] In some embodiments, the acoustic pressure applied to the treatment area from each transducer is between 0.1 and 10 MPa.
[0432] In some embodiments, the number of transducers providing the intense ultrasound treatment zone is between 1 and 1000.
[0433] In some embodiments, one or more center frequencies are employed during treatment having a center frequency in the range of approximately 100 kHz to 20 MHz.
[0434] In some embodiments, ultrasound from a given transducer is applied continuously. In some embodiments, ultrasound emitted from a given transducer is applied in pulses that repeat on time units and off time units (referred to as a duty cycle). The duty cycle can be in the range of 1 on time unit to 9 off time units.
[0435] In some embodiments, the transducer transmits a single frequency tone or a multi-frequency chirp wave.
[0436] In some embodiments, the transducers are operated sequentially so that the total energy delivered to the target tissue during the entire application is greater than the total energy delivered to the surrounding tissue.
[0437] In some embodiments, the frequency is swept during application, partially reducing undesirable high intensity regions in the area near the transducer.
[0438] In some embodiments, the transducer comprising the treatment tip is mechanically vibrated.
[0439] In some embodiments, the transducer is comprised of a two-dimensional phased array, an annular array, and / or a three-dimensional phased array.
[0440] In some embodiments, one or more ultrasound transducers are incorporated into one or more endoscopic devices.
[0441] The APT treatment systems disclosed herein have a low thermal dose compared to typical heat administration protocols in hyperthermia and ablative thermal therapy. In some embodiments, the maximum temperature reached in the treatment area during a treatment period lasting about 2 seconds or less is 45°C.
[0442] Given the thermal dose, it is expected that the therapeutic effect is achieved through a thermal mechanism. Although not wishing to be bound by theory, mechanical effects combined with thermal effects may partially explain the therapeutic effects of using the disclosed devices, systems, and methods.
[0443] In some embodiments, a coupling medium is used between the transducer and the patient's body to effectively transmit ultrasound waves and, in some embodiments, to provide the desired distance between the transducer and the treatment area. In some embodiments, the coupling medium is circulated during treatment to cool the transducer, the patient's body, or both. Separate fluids can be used to transmit ultrasound waves, provide spacing, and provide cooling for the patient and system components.
[0444] While not being bound by theory, APT treatment using the systems described herein may promote interactions between cells and between cells and matrix proteins, between cancer cells and immune cells, and between immune cells (eg, T cells and DCs).
[0445] In some embodiments, APT treatment can disrupt a protein complex, such as a protein folding complex.
[0446] For patients with disease that would benefit from treatment with multiple modalities, penetration of the entire targeted treatment zone and lesions within those zones, ease of application, and short duration of treatment for each modality are desirable.
[0447] Various other aspects of the APT treatment device and APT treatment modality according to exemplary embodiments of the present invention will now be described:
[0448] Positioning device
[0449] In some embodiments, the transducer applicators are designed so that they can be hand-held by a clinician or caregiver. In some embodiments, the applicators are mounted to a mechanical positioning device, such as Figure 19 The positioning device 500 shown in FIG. The positioning device 500 can be manually operated or robotically controlled. In this embodiment, the positioning device 500 is an arcuate track on which the transducer travels, and in particular, the transducer can be attached to a cable drive carriage that is in turn mounted on the track. The track itself can be rotatable so that the transducer can be positioned in three dimensions. The positioning device 500 can be large enough so that the patient can be placed under and within the target range of the transducer. Although Figure 19 Only one transducer is shown on the track, but it should be understood that more than one transducer can be configured on the track and / or additional tracks can be provided to support one or more additional transducers. In some embodiments, a Stewart platform, sometimes referred to as a hexapod, can be used in the positioning device. Computer programming can be used to set treatment parameters and operate the positioning device.
[0450] Equipment and patient cooling
[0451] In some embodiments, the treatment system includes a patient cooling mechanism to cool the skin exposed to ultrasound energy or other energy.
[0452] References
[0453] 1. Rabinovich, GA, Gabrilovich, D., and Sotomayor, EM2007. Immunosuppressive strategies that are mediated by tumor cells. AnnuRev Immunol 25:267-296.
[0454] 2. Dougan, M., and Dranoff, G. 2009. Immune therapy for cancer. Annu Rev Immunol 27:83-117.
[0455] 3.Uyttenhove,C.,Pilotte,L.,Theate,I.,Stroobant,V.,Colau,D.,Parmentier,N.,Boon,T.,and Van den Eynde,B.J.2003.Evidence for a tumoralimmune resistance mechanism based on tryptophan degradation by indoleamine 2,3-dioxygenase.Nat Med 9:1269-1274.
[0456] 4.Thomas,D.A.,and Massague,J.2005.TGF-beta directly targets cytotoxicT cell functions during tumor evasion of immune surveillance.Cancer Cell 8:369-380.
[0457] 5.Gerlini,G.,Tun-Kyi,A.,Dudli,C.,Burg,G.,Pimpinelli,N.,and Nestle,F.O.2004.Metastatic melanoma secreted IL-10down-regulates CD1 molecules ondendritic cells in metastatic tumor lesions.Am J Pathol 165:1853-1863.
[0458] 6.Turk,M.J.,Guevara-Patino,J.A.,Rizzuto,G.A.,Engelhorn,M.E.,Sakaguchi,S.,and Houghton,A.N.2004.Concomitant tumor immunity to a poorlyimmunogenic melanoma is prevented by regulatory T cells.J Exp Med 200:771-782.
[0459] 7. Huang, B., Pan, P.Y., Li, Q., Sato, A.I., Levy, D.E., Bromberg, J., Divino, C.M., and Chen, S.H. 2006. Gr-1+CD115+ immature myeloid suppressor cells mediate the development of tumor-induced T regulatory cells and T-cell anergy in tumor-bearing host. Cancer Res 66:1123-1131.
[0460] 8. Sica, A., and Bronte, V. 2007. Altered macrophage differentiation and immune dysfunction in tumor development. J Clin Invest 117:1155-1166.
[0461] 9. Curiel, T.J., Coukos, G., Zou, L., Alvarez, X., Cheng, P., Mottram, P., Evdemon-Hogan, M., Conejo-Garcia, J.R., Zhang, L., Burow, M., et al. 2004. Specific recruitment of regulatory T cells in ovarian carcinoma fosters immune privilege and predicts reduced survival. Nat Med 10:942-949.
[0462] 10. van Elsas, A., Hurwitz, A. A., and Allison, J. P. 1999. Combination immunotherapy of B16 melanoma using anti-cytotoxic T lymphocyte-associated antigen 4 (CTLA-4) and granulocyte / macrophage colony-stimulating factor (GM-CSF)-producing vaccines induces rejection of subcutaneous and metastatic tumors accompanied by autoimmune depigmentation. J Exp Med 190:355-366.
[0463] 11. Phan, G. Q., Yang, J. C., Sherry, R. M., Hwu, P., Topalian, S. L., Schwartzentruber, D. J., Restifo, N. P., Haworth, L. R., Seipp, C. A., Freezer, L. J. et al. 2003. Cancer regression and autoimmunity induced by cytotoxic T lymphocyte-associated antigen 4 blockade in patients with metastatic melanoma. Proc Natl Acad Sci USA 100:8372-8377.
[0464] 12. Dong, H., Strome, S. E., Salomao, D. R., Tamura, H., Hirano, F., Flies, D. B., Roche, P. C., Lu, J., Zhu, G., Tamada, K. et al. 2002. Tumor-associated B7-H1 promotes T-cell apoptosis: a potential mechanism of immune evasion. Nat Med 8:793-800.
[0465] 13.Rubinstein,N.,Alvarez,M.,Zwirner,N.W.,Toscano,M.A.,Ilarregui,J.M.,Bravo,A.,Mordoh,J.,Fainboim,L.,Podhajcer,O.L.,and Rabinovich,G.A.2004.Targeted inhibition of galectin-1gene expression in tumor cellsresults in heightened T cell-mediated rejection;A potential mechanism oftumor-immune privilege.Cancer Cell 5:241-251.
[0466] 14.Troy,A.J.,Summers,K.L.,Davidson,P.J.,Atkinson,C.H.,and Hart,D.N.1998.Minimal recruitment and activation of dendritic cells within renalcell carcinoma.Clin Cancer Res 4:585-593.
[0467] 15.Staveley-O'Carroll,K.,Sotomayor,E.,Montgomery,J.,Borrello,I.,Hwang,L.,Fein,S.,Pardoll,D.,and Levitsky,H.1998.Induction of antigen-specificT cell anergy:An early event in the course of tumor progression.Proc NatlAcad Sci U S A 95:1178-1183.
[0468] 16.Willimsky,G.,and Blankenstein,T.2005.Sporadic immunogenic tumoursavoid destruction by inducing T-cell tolerance.Nature 437:141-146.
[0469] 17. Overwijk, W.W., Theoret, M.R., Finkelstein, S.E., Surman, D.R., de Jong, L.A., Vyth-Dreese, F.A., Dellemijn, T.A., Antony, P.A., Spiess, P.J., Palmer, D.C. et al. 2003. Tumor regression and autoimmunity after reversal of a functionally tolerant state of self-reactive CD8+ T cells. J Exp Med 198:569-580.
[0470] 18. Cuenca, A., Cheng, F., Wang, H., Brayer, J., Horna, P., Gu, L., Bien, H., Borrello, I.M., Levitsky, H.I., and Sotomayor, E.M. 2003. Extra-lymphatic solid tumor growth is not immunologically ignored and results in early induction of antigen-specific T-cell anergy: dominant role of cross-tolerance to tumor antigens. Cancer Res 63:9007-9015.
[0471] 19. Zheng, Y., Zha, Y., Driessens, G., Locke, F., and Gajewski, T.F. 2012. Transcriptional regulator early growth response gene 2 (Egr2) is required for T cell anergy in vitro and in vivo. J Exp Med 209:2157-2163.
[0472] 31. Zhang, H.G., Mehta, K., Cohen, P., and Guha, C. 2008. Hyperthermia on immune regulation: a temperature's story. Cancer Lett 271:191-204.
[0473] 32.Basu,S.,and Srivastava,P.K.1999.Calreticulin,a peptide-bindingchaperone of the endoplasmic reticulum,elicits tumor-and peptide-specificimmunity.J Exp Med 189:797-802.
[0474] 33.Castelli,C.,Ciupitu,A.M.,Rini,F.,Rivoltini,L.,Mazzocchi,A.,Kiessling,R.,and Parmiani,G.2001.Human heat shock protein 70 peptidecomplexes specifically activate antimelanoma T cells.Cancer Res 61:222-227.
[0475] 34.Haug,M.,Dannecker,L.,Schepp,C.P.,Kwok,W.W.,Wernet,D.,Buckner,J.H.,Kalbacher,H.,Dannecker,G.E.,and Holzer,U.2005.The heat shock protein Hsp70enhances antigen-specific proliferation of human CD4+memory T cells.Eur JImmunol 35:3163-3172.
[0476] 35.Pawaria,S.,and Binder,R.J.2011.CD91-dependent programming of T-helper cell responses following heat shock protein immunization.Nat Commun 2:521.
[0477] 36.Gajewski,T.F.,Woo,S.R.,Zha,Y.,Spaapen,R.,Zheng,Y.,Corrales,L.,andSpranger,S.2013.Cancer immunotherapy strategies based on overcoming barrierswithin the tumor microenvironment.Curr Opin Immunol 25:268-276.
[0478] 37.Driessens,G.,Kline,J.,and Gajewski,T.F.2009.Costimulatory andcoinhibitory receptors in anti-tumor immunity.Immunol Rev 229:126-144.
[0479] 38.Leach,D.R.,Krummel,M.F.,and Allison,J.P.1996.Enhancement ofantitumor immunity by CTLA-4blockade.Science 271:1734-1736.
[0480] 39.Munn,D.H.,and Mellor,A.L.2007.Indoleamine 2,3-dioxygenase andtumor-induced tolerance.J Clin Invest 117:1147-1154.
[0481] 40.Green,D.R.,Ferguson,T.,Zitvogel,L.,and Kroemer,G.2009.Immunogenicand tolerogenic cell death.Nat Rev Immunol 9:353-363.
[0482] 41. Lee, P.P., Yee, C., Savage, P.A., Fong, L., Brockstedt, D., Weber, J.S., Johnson, D., Swetter, S., Thompson, J., Greenberg, P.D. et al. 1999. Characterization of circulating T cells specific for tumor-associated antigens in melanoma patients. Nat Med 5:677-685.
[0483] 42. Valdor, R., and Macian, F. 2013. Induction and stability of the anergic phenotype in T cells. Semin Immunol 25:313-320.
[0484] 43. Macian, F., Garcia-Cozar, F., Im, S.H., Horton, H.F., Byrne, M.C., and Rao, A. 2002. Transcriptional mechanisms underlying lymphocyte tolerance. Cell 109:719-731.
[0485] 44. Safford, M., Collins, S., Lutz, M.A., Allen, A., Huang, C.T., Kowalski, J., Blackford, A., Horton, M.R., Drake, C., Schwartz, R.H. et al. 2005. Egr-2 and Egr-3 are negative regulators of T cell activation. Nat Immunol 6:472-480.
[0486] 45.Soto-Nieves,N.,Puga,I.,Abe,B.T.,Bandyopadhyay,S.,Baine,I.,Rao,A.,and Macian,F.2009.Transcriptional complexes formed by NFAT dimers regulatethe induction of T cell tolerance.J Exp Med 206:867-876.
[0487] 46.Enk,A.H.,Jonuleit,H.,Saloga,J.,and Knop,J.1997.Dendritic cells asmediators of tumor-induced tolerance in metastatic melanoma.Int J Cancer 73:309-316.
[0488] 47.Marangoni,F.,Murooka,T.T.,Manzo,T.,Kim,E.Y.,Carrizosa,E.,Elpek,N.M.,and Mempel,T.R.2013.The transcription factor NFAT exhibits signal memoryduring serial T cell interactions with antigen-presenting cells.Immunity 38:237-249.
[0489] 48.Srivastava,P.2002.Interaction of heat shock proteins with peptidesand antigen presenting cells:chaperoning of the innate and adaptive immuneresponses.Annu Rev Immunol 20:395-425.
[0490] 49.Udono,H.,and Srivastava,P.K.1993.Heat shock protein 70-associatedpeptides elicit specific cancer immunity.J Exp Med 178:1391-1396.
[0491] 50.Udono,H.,and Srivastava,P.K.1994.Comparison of tumor-specificimmunogenicities of stress-induced proteins gp96,hsp90,and hsp70.J Imunol152:5398-5403.
[0492] 51.Ullrich,S.J.,Robinson,E.A.,Law,L.W.,Willingham,M.,and Appella,E.1986.A mouse tumor-specific transplantation antigen is a heat shock-relatedprotein.Proc Natl Acad Sci U S A 83:3121-3125.
[0493] 52.Somersan,S.,Larsson,M.,Fonteneau,J.F.,Basu,S.,Srivastava,P.,andBhardwaj,N.2001.Primary tumor tissue lysates are enriched in heat shockproteins and induce the maturation of human dendritic cells.J Immunol 167:4844-4852.
[0494] 53.Liu,B.,DeFilippo,A.M.,and Li,Z.2002.Overcoming Immune Tolerance toCancer by Heat Shock Protein Vaccines.Mol Cancer Ther 1:1147-1151.
[0495] 54.Chen,X.,Tao,Q.,Yu,H.,Zhang,L.,and Cao,X.2002.Tumor cell membrane-bound heat shock protein 70 elicits antitumor immunity.Immunol Lett 84:81-87.
[0496] 55.Vega,V.L.,Rodriguez-Silva,M.,Frey,T.,Gehrmann,M.,Diaz,J.C.,Steinem,C.,Multhoff,G.,Arispe,N.,and De Maio,A.2008.Hsp70 translocates intothe plasma membrane after stress and is released into the extracellularenvironment in a membrane-associated form that activates macrophages.JImmunol 180:4299-4307.
[0497] 56.Basu,S.,Binder,R.J.,Suto,R.,Anderson,K.M.,and Srivastava,P.K.2000.Necrotic but not apoptotic cell death releases heat shock proteins,which deliver a partial maturation signal to dendritic cells and activate theNF-kappa B pathway.Int immunol 12:1539-1546.
[0498] 57.Obeid,M.,Panaretakis,T.,Tesniere,A.,Joza,N.,Tufi,R.,Apetoh,L.,Ghiringhelli,F.,Zitvogel,L.,and Kroemer,G.2007.Leveraging the immune systemduring chemotherapy:moving calreticulin to the cell surface convertsapoptotic death from"silent"to immunogenic.Cancer Res 67:7941-7944.
[0499] 58.Hu,Z.,Yang,X.Y.,Liu,Y.,Morse,M.A.,Lyerly,H.K.,Clay,T.M.,and Zhong,P.2005.Release of endogenous danger signals from HIFU-treated tumor cells andtheir stimulatory effects on APCs.Biochem Biophys Res Comm 335:124-131.
[0500] 59.Hu,Z.,Yang,X.Y.,Liu,Y.,Sankin,G.N.,Pua,E.C.,Morse,M.A.,Lyerly,H.K.,Clay,T.M.,and Zhong,P.2007.Investigation of HIFU-induced anti-tumorimmunity in a murine tumor model.J Transl Med 5:34-34.
[0501] 60.Boussiotis,V.A.,Barber,D.L.,Nakarai,T.,Freeman,G.J.,Gribben,J.G.,Bernstein,G.M.,D'Andrea,A.D.,Ritz,J.,and Nadler,L.M.1994.Prevention of T cellanergy by signaling through the gamma c chain of the IL-2receptor.Science266:1039-1042.
[0502] 61.Dure,M.,and Macian,F.2009.IL-2signaling prevents T cell anergy byinhibiting the expression of anergy-inducing genes.Mol Immunol 46:999-1006.
[0503] 62. Gao, B., Kong, Q., Kemp, K., Zhao, Y. S., and Fang, D. 2012. Analysis of sirtuin 1 expression reveals a molecular explanation of IL-2-mediated reversal of T-cell tolerance. Proc Natl Acad Sci USA 109:899-904.
[0504] 63. Gramaglia, I., Weinberg, A. D., Lemon, M., and Croft, M. 1998. Ox-40 ligand: a potent costimulatory molecule for sustaining primary CD4 T cell responses. J Immunol 161:6510-6517.
[0505] 64. Lathrop, S. K., Huddleston, C. A., Dullforce, P. A., Montfort, M. J., Weinberg, A. D., and Parker, D. C. 2004. A signal through OX40(CD134) allows anergic, autoreactive T cells to acquire effector cell functions. J Immunol 172:6735-6743.
[0506] 65. Murata, S., Ladle, B. H., Kim, P. S., Lutz, E. R., Wolpoe, M. E., Ivie, S. E., Smith, H. M., Armstrong, T. D., Emens, L. A., Jaffee, E. M., et al. 2006. OX40 costimulation synergizes with GM-CSF whole-cell vaccination to overcome established CD8+ T cell tolerance to an endogenous tumor antigen. J Immunol 176:974-983.
[0507] 66.Tsushima,F.,Yao,S.,Shin,T.,Flies,A.,Flies,S.,Xu,H.,Tamada,K.,Pardoll,D.M.,and Chen,L.2007.Interaction between B7-H1 and PD-1 determinesinitiation and reversal of T-cell anergy.Blood 110:180-185.
[0508] 67.Wilcox,R.A.,Tamada,K.,Flies,D.B.,Zhu,G.,Chapoval,A.I.,Blazar,B.R.,Kast,W.M.,and Chen,L.2004.Ligation of CD137 receptor prevents and reversesestablished anergy of CD8+cytolytic T lymphocytes in vivo.Blood 103:177-184.
[0509] 68.Zhang,L.,Chen,X.,Liu,X.,Kline,D.E.,Teague,R.M.,Gajewski,T.F.,andKline,J.2013.CD40 ligation reverses T cell tolerance in acute myeloidleukemia.J Clin Invest 123:1999-2010.
[0510] 69.Anelli T,Alessio M,Mezghrani A,Simmen T,Talamo F,Bachi A and SitiaR.ERp44,a novel endoplasmic reticulum folding assistant of the thioredoxinfamily.EMBO J.2002;21(4):835-844.
[0511] 70.Jessop CE,Chakravarthi S,Garbi N,Hammerling GJ,Lovell S andBulleid NJ.ERp57 is essential or efficient folding of glycoproteins sharingcommon structural domains.EMBO J.2007;26(1):28-40.
[0512] 71.Ron D and Walter P.Signal integration in the endoplasmic reticulumunfolded protein response.Nat Rev Mol Cell Biol.2007;8(7):519-529.
[0513] 72.White E.Deconvoluting the context-dependent role for autophagy incancer.Nat Rev Cancer.2012;12(6):401-410.
[0514] 73.Kon M,Kiffin R,Koga H,Chapochnick J,Macian F,Varticovski L andCuervo AM.Chaperone-mediated autophagy is required for tumor growth.SciTransl Med.2011;3(109):109ra117.
[0515] 74.Haar G,Shaw A,Pye S,Ward B,Bottomley F,Nolan R and CoadyAM.Guidance on reporting ultrasound exposure conditions for bio-effectsstudies.Ultrasound Med Biol.2011;37(2):177-183.
[0516] 75.Duck FA.(1990).Physical properties of tissue:a comprehensivereference book:Academic Press).
[0517] 76.Partanen A, Tillander M, Yarmolenko PS, Wood BJ, Dreher MR and KohlerMO. Reduction of peak acoustic pressure and shaping of heated region by use of multifoci sonications in MR-guided high-intensity focused ultrasound mediatedmild hyperthermia. Med Phys. 2013; 40(1):013301.
[0518] 77.Back SH,Schroder M,Lee K,Zhang K and Kaufman RJ.ER stresssignaling by regulated splicing:IRE1 / HAC1 / XBP1.Methods.2005;35(4):395-416.
[0519] 78. Lewis and Olbricht, Review of Scientific Instruments 80, 114704 (2009).
[0520] 79. Pouch et al. Ultrasound Med 2010;29:1595–1606.
[0521] 80. Sahu et al. Scientific Reports 2014 Dec 3;4:7303. doi:10.1038 / srep07303. Sequence Listing <110> Montefiore Medical Center Albert Einstein College of Medicine, Inc. <120> Low-intensity focused ultrasound for the treatment of cancer and metastasis <130> 60537 / 63 <140> PCT / US2016 / 35440 <141> 2016-06-02 <150> US 62 / 170,378 <151> 2015-06-03 <150> US 62 / 204,312 <151> 2015-08-12 <160> twenty four <170> PatentIn version 3.5 <210> 1 <211> twenty two <212> DNA <213> Artificial sequence <220> <223> Forward primer for actinb <400> 1 gtgacgttga catccgtaaa ga 22 <210> 2 <211> 19 <212> DNA <213> Artificial sequence <220> <223> Reverse primer for actinb <400> 2 gccggactca tcgtactcc 19 <210> 3 <211> twenty one <212> DNA <213> Artificial sequence <220> <223> Forward primer for Cblb <400> 3 gcagcatcat tgaccctttc a 21 <210> 4 <211> twenty one <212> DNA <213> Artificial sequence <220> <223> Reverse primer for Cblb <400> 4 atgtgactgg tgagttctgc c 21 <210> 5 <211> twenty four <212> DNA <213> Artificial sequence <220> <223> Forward primer for Grail <400> 5 atgcaagagc tcaaagcagg aagc 24 <210> 6 <211> twenty four <212> DNA <213> Artificial sequence <220> <223> Reverse primer for Grail <400> 6 gtgcgcagct gaagctttcc aata 24 <210> 7 <211> 17 <212> DNA <213> Artificial sequence <220> <223> Forward primer for Ikaros <400> 7 gctggctctc ggaggag 17 <210> 8 <211> 20 <212> DNA <213> Artificial sequence <220> <223> Reverse primer for Ikaros <400> 8 cgcacttgta caccttcagc 20 <210> 9 <211> 20 <212> DNA <213> Artificial sequence <220> <223> Forward primer for caspase 3 <400> 9 acgcgcacaa gctagaattt 20 <210> 10 <211> 20 <212> DNA <213> Artificial sequence <220> <223> Reverse primer for caspase 3 <400> 10 ctttgcgtgg aaagtggagt 20 <210> 11 <211> twenty one <212> DNA <213> Artificial sequence <220> <223> Forward primer for Egr2 <400> 11 tcagtggttt tatgcaccag c 21 <210> 12 <211> twenty one <212> DNA <213> Artificial sequence <220> <223> Reverse primer for Egr2 <400> 12 gaagctactc ggatacggga g 21 <210> 13 <211> 20 <212> DNA <213> Artificial sequence <220> <223> Forward primer for Grg4 <400> 13 tcactcaagt ttgcccactg 20 <210> 14 <211> 20 <212> DNA <213> Artificial sequence <220> <223> Reverse primer for Grg4 <400> 14 cacagctaag caccgatgag 20 <210> 15 <211> 20 <212> DNA <213> Artificial sequence <220> <223> Forward primer for Itch <400> 15 gtgtggagtc accagaccct 20 <210> 16 <211> 20 <212> DNA <213> Artificial sequence <220> <223> Reverse primer for Itch <400> 16 gcttctactt gcagcccatc 20 <210> 17 <211> 19 <212> DNA <213> Artificial sequence <220> <223> Foxp3 <400> 17 ggcccttctc caggacaga 19 <210> 18 <211> 20 <212> DNA <213> Artificial sequence <220> <223> Foxp3 <400> 18 gctgatcatg gctgggttgt 20 <210> 19 <211> 18 <212> DNA <213> Artificial sequence <220> <223> TAGCCAGGAAACGTCTAC <400> 19 actcggtctg gaaatctg 18 <210> 20 <211> 18 <212> DNA <213> Artificial sequence <220> <223> Primers based on human sequences <400> 20 tagccaggaa acgtctac 18 <210> twenty one <211> twenty four <212> DNA <213> Artificial sequence <220> <223> Primers based on human sequences <400> twenty one ttgcttatgg cctggataag aggg 24 <210> twenty two <211> twenty four <212> DNA <213> Artificial sequence <220> <223> Primers based on human sequences <400> twenty two tgtacccttg tcttcagctg tcac 24 <210> twenty three <211> twenty four <212> DNA <213> Artificial sequence <220> <223> Primers based on human sequences <400> twenty three tcatccgagt tccagaaagc agtc 24 <210> twenty four <211> twenty four <212> DNA <213> Artificial sequence <220> <223> Primers based on human sequences <400> twenty four ttgacataga gtggagggtc tcct 24
Claims
1. A system, comprising: A sonodynamic therapy device, comprising: One or more transducers configured to generate one or more ultrasonic beams, wherein the frequency waveform of the one or more ultrasonic beams has a spatial peak temporal average acoustic output intensity of 1 to 1000 W / cm 2 in the treatment area, wherein the one or more ultrasonic beams are applied in the treatment area for 0.5 to 5 seconds, and wherein the one or more ultrasonic beams have one or more ultrasonic frequencies in the range of 0.01 to 10 MHz, wherein the one or more transducers include at least two transducers configured to generate one or more cylindrical ultrasonic beams; and A control system operably configured to control the sonodynamic therapy device.
2. The system according to claim 1, wherein the system comprises a radiotherapy treatment machine, wherein the radiotherapy treatment machine generates a certain amount of radiotherapy, and wherein the control system is operably configured to be used in combination with the radiotherapy treatment machine.
3. The system according to claim 2, wherein the control system is operably configured to control the sonodynamic therapy device and the radiotherapy treatment machine, and wherein the control system controls the generation of a first amount of the one or more ultrasonic beams and a second amount of radiotherapy.
4. The system according to claim 2, wherein the radiotherapy comprises proton therapy, carbon ion therapy, or the delivery of charged particle beams.
5. The system according to claim 2, wherein the radiotherapy comprises external beam radiotherapy, brachytherapy, three-dimensional conformal radiotherapy, intensity-modulated radiotherapy, image-guided radiotherapy, tomotherapy, stereotactic radiosurgery, or stereotactic body radiotherapy, or ablative hypofractionated radiotherapy.
6. The system according to claim 1, wherein the one or more ultrasonic beams are configured to induce non-ablative stress in the cells in the treatment area.
7. The system according to claim 1, wherein the one or more ultrasonic beams are configured to induce the release of immunomodulatory factors in the cells in the treatment area.
8. The system according to claim 7, wherein the immunomodulatory factor comprises a heat shock protein.
9. The system according to claim 1, wherein the one or more transducers are configured to sequentially generate two or more ultrasonic beams.
10. The system according to claim 1, wherein the one or more transducers operate at a frequency of 300 KHz to 3 MHz.
11. The system according to claim 1, wherein the one or more transducers operate at a frequency of 30 KHz to 300 KHz.
12. The system according to claim 1, wherein the one or more transducers are configured to simultaneously generate two or more ultrasonic beams.
13. The system according to claim 1, wherein the system is used in combination with a chemotherapeutic agent.
14. The system according to claim 13, wherein the chemotherapeutic agent comprises a proteasome inhibitor, a PI3-kinase inhibitor, an autophagy inhibitor, an mTOR inhibitor, a PPARγ agonist, a COX-2 inhibitor, a calcium channel inhibitor, a CHOP expression regulator, an ER stress inducer, an eIF2a phosphatase inhibitor, a chemical chaperone for saving α1-antitrypsin, or an HSP90 inhibitor.
15. The system according to claim 13, wherein the chemotherapeutic agent comprises 17-allylamino-17-demethoxygeldanamycin.
16. The system according to claim 13, wherein the system in combination with the chemotherapeutic agent is configured to induce the release of immunogenic molecules in the cells in the treatment area.
17. The system according to claim 1, wherein the system is used in combination with an immunotherapeutic agent.
18. The system according to claim 17, wherein the immunotherapeutic agent comprises a cytokine, an interleukin, an interferon, GM-CSF, a small molecule, an agent that binds to a cytokine or cytokine receptor, or an agent that targets a checkpoint.
19. The system according to claim 18, wherein the checkpoint comprises CTLA-4, PD-1, or PDL-1.
20. The system according to claim 1, wherein the system is used in combination with a molecular chaperone inhibitor.
21. The system according to claim 20, wherein the molecular chaperone inhibitor comprises a heat shock protein 90 inhibitor.
22. The system according to claim 21, wherein the heat shock protein 90 inhibitor comprises 17-allylamino-17-demethoxygeldanamycin.
23. The system according to claim 21, wherein the heat shock protein 90 inhibitor comprises 17-dimethylamino-ethylamino-17-demethoxygeldanamycin.
24. The system according to claim 1, wherein the ultrasonic beam does not cause cavitation in the treatment area.
25. The system according to claim 1, wherein the one or more transducers are configured to generate one or more ultrasonic beams in the treatment area for treating a tumor of a subject.
26. The system according to claim 25, wherein the tumor comprises a tumor of the prostate, breast, pharynx, lung, bone, salivary gland, stomach, esophagus, testis, ovary, uterus, liver, small intestine, appendix, colon, rectum, bladder, gallbladder, pancreas, kidney, vagina, vulva, thyroid, skin, head or neck, or a soft tissue sarcoma.
27. The system according to claim 26, wherein the tumor comprises a tumor of the breast, skin, liver, or bone, or a soft tissue sarcoma.
28. The system according to claim 26, wherein the tumor comprises a tumor of the prostate, skin, or lung.
29. The system according to claim 25, wherein the tumor is a tumor of the nasopharynx.
30. The system according to claim 25, wherein the tumor is a tumor of the endometrium.
31. The system according to claim 25, wherein the tumor is a tumor of the cervix.
32. The system according to claim 25, wherein the tumor is a glioma.
33. The system according to claim 25, wherein the tumor is a tumor of the brain.
Citation Information
Patent Citations
Switched resonant ultrasonic power amplifier system
US7396336B2
Systems for inducing hyperthermia
WO2011128693A1