Use of miRNA marker detection reagent in preparation of product for predicting mental condition of offspring
By detecting miR-9-5p and/or miR-9-3p in the sperm of elderly fathers, combined with specific primers and PCR methods, the challenge of detecting sperm miRNA markers has been solved, enabling efficient prediction and early diagnosis of offspring mental health.
Patent Information
- Application Number
- CN202210486514.7
- Authority / Receiving Office
- CN · China
- Patent Type
- Patents(China)
- Current Assignee / Owner
- Filing Date
- 2022-05-06
- Publication Date
- 2025-12-09
- Estimated Expiration
- 2042-05-06
AI Technical Summary
Existing miRNA detection technologies cannot effectively quantify miRNA markers in sperm, making it impossible to accurately predict the mental health of offspring born to older fathers.
Using miR-9-5p and/or miR-9-3p as miRNA markers, combined with specific primers and internal reference gene primers, the expression levels of miRNAs in sperm samples were detected by reverse transcription and quantitative real-time PCR to prepare a product for predicting the mental status of offspring.
It improves the specificity and sensitivity of detecting offspring's mental state, can assist in the early diagnosis of mental abnormalities caused by advanced maternal age, and supports the concept of eugenics.
Smart Images

Figure CN114891875B_ABST
Abstract
Description
TECHNICAL FIELD
[0001] The present application relates to the field of biological detection technology, and particularly relates to application of an miRNA marker detection reagent in preparation of a product for predicting mental conditions of offspring. BACKGROUND
[0002] Research data shows that the possibility of a female getting pregnant within 12 months by a male over 40 years old is more than 30% lower than that by a male under 30 years old, and the time required for a female to get pregnant by a male over 45 years old is 5 times that by a male under 25 years old. Research in the British Medical Journal shows that the older the father is, the higher the risk of premature birth of a newborn is, and the lower the birth weight is. In addition, a plurality of researches show that the older the male is, the higher the probability of a child suffering from schizophrenia is, and the earlier the child suffers from schizophrenia is. Data shows that the risk of a child of a male over 40 years old suffering from autism spectrum disorder is increased by 4.75 times. With the increase of the birth age of parents, the mental health of offspring is greatly threatened. Therefore, it is of great significance to explore whether the mental health of offspring of high-age parents is affected by the high age of parents and the mechanism thereof, so as to prevent the high age of parents from affecting the mental health of offspring. The applicant's previous researches show that offspring mice born by high-age fathers have mental abnormality related phenotypes, which indicates that high-age fathers affect the mental health of offspring through intergenerational epigenetic ways, and the gene transcription level of embryonic cells is significantly changed by sperm small RNAs of high-age mice, the β-estradiol (17β-estradiol) pathway is abnormal, some miRNAs (such as miR-9-5p and miR-9-3p) are highly expressed in sperm of high-age mice and humans, and the injection of synthesized miR-9-5p and miR-9-3p into normal fertilized eggs induces abnormal expression of the β-estradiol pathway in early embryos, and the offspring obtained after implantation also have mental abnormality phenotypes, which indicates that miR-9-5p and miR-9-3p in sperm of high-age fathers mediate the intergenerational epigenetic process of high-age fathers inducing mental abnormality phenotypes of offspring.
[0003] However, the application prospect of miRNAs in sperm in non-invasive diagnosis of mental abnormality of offspring still needs to be explored. If miRNAs abnormally expressed in sperm can be screened as biomarkers and corresponding diagnostic kits can be developed, the current diagnosis of mental conditions of offspring of high-age fathers will be greatly promoted.
[0004] Since the content of miRNAs in the body is usually low, especially in small amounts of body fluids such as sperm, the detection is extremely difficult, and the existing detection reagents cannot realize effective quantitative detection of miRNA markers. SUMMARY
[0005] In view of the above-mentioned restraint limitations, the application provides application of the miRNA marker detection reagent in preparation of a product for predicting mental conditions of offspring, which overcomes the deficiencies and defects mentioned in the background art.
[0006] To achieve the above-mentioned object, the application adopts the following technical solutions.
[0007] The application point of the application is to provide application of the miRNA marker detection reagent in preparation of a product for predicting mental conditions of offspring, wherein the miRNA marker is miR-9-5p and / or miR-9-3p.
[0008] In detection, the miR-9-5p marker can be detected alone, the miR-9-3p marker can be detected alone, and more preferably, the miR-9-5p and miR-9-3p markers are detected together, the detection results of the two are integrated, and then used for predicting mental conditions of offspring.
[0009] Further, in the application of the miRNA marker detection reagent in preparation of a product for predicting mental conditions of offspring, the nucleotide sequence of the miR-9-5p is shown in SEQ ID NO: 1, and the nucleotide sequence of the miR-9-3p is shown in SEQ ID NO: 2.
[0010] The SEQ ID NO: 1 is specifically UCUUUGGUUAUCUAGCUGUAUGA.
[0011] The SEQ ID NO: 2 is specifically AUAAAGCUAGAUAACCGAAAGU.
[0012] Further, in the application of the miRNA marker detection reagent in preparation of a product for predicting mental conditions of offspring, the detection primer of the miR-9-5p comprises a first reverse transcription primer, a first forward primer and a first reverse primer, the nucleotide sequence of the first reverse transcription primer is shown in SEQ ID NO: 3, the nucleotide sequence of the first forward primer is shown in SEQ ID NO: 4, and the nucleotide sequence of the first reverse primer is shown in SEQ ID NO: 5.
[0013] The first reverse transcription primer sequence (miR-9-5p) is shown in SEQ ID NO: 3.
[0014] GTCGTATCCAGTGCAGGGTCCGAGGTATTCGCACTGGATACGACTC ATAC;
[0015] The first forward primer sequence (miR-9-5p) is shown in SEQ ID NO: 4.
[0016] GCGCGTCTTTGGTTATCTAGCT;
[0017] First reverse primer sequence (miR-9-5p), SEQ ID NO: 5:
[0018] AGTGCAGGGTCCGAGGTATT.
[0019] Further, the use of the above-mentioned miRNA marker detection reagent in the preparation of a product for predicting the mental state of offspring, wherein the miRNA marker detection reagent further comprises a primer for detecting the expression amount of the miRNA marker miR-9-5p, and the primer for detecting the expression amount of the miRNA marker miR-9-5p comprises a third reverse transcription primer, a third forward primer and a third reverse primer; the nucleotide sequence of the third reverse transcription primer is shown as SEQ ID NO: 9, the nucleotide sequence of the third forward primer is shown as SEQ ID NO: 10, and the nucleotide sequence of the third reverse primer is shown as SEQ ID NO: 11.
[0020] Third reverse transcription primer sequence (internal reference gene U6), SEQ ID NO: 9:
[0021] GTCGTATCCAGTGCAGGGTCCGAGGTATTCGCACTGGATACGACAAAATA;
[0022] Third forward primer sequence (internal reference gene), SEQ ID NO: 10:
[0023] CAAATTCGTGAAGCGTTCCA;
[0024] Third reverse primer sequence (internal reference gene), SEQ ID NO: 11:
[0025] AGTGCAGGGTCCGAGGTATT.
[0026] Further, the use of the above-mentioned miRNA marker detection reagent in the preparation of a product for predicting the mental state of offspring, wherein the detection primer of miR-9-3p comprises a second reverse transcription primer, a second forward primer and a second reverse primer; the nucleotide sequence of the second reverse transcription primer is shown as SEQ ID NO: 6, the nucleotide sequence of the second forward primer is shown as SEQ ID NO: 7, and the nucleotide sequence of the second reverse primer is shown as SEQ ID NO: 8.
[0027] Second reverse transcription primer sequence (miR-9-3p), SEQ ID NO: 6:
[0028] GTCGTATCCAGTGCAGGGTCCGAGGTATTCGCACTGGATACGACAC TTTC;
[0029] Second forward primer sequence (miR-9-3p), SEQ ID NO: 7:
[0030] CGCGCGATAAAGCTAGATAACC;
[0031] Second reverse primer sequence (miR-9-3p), SEQ ID NO: 8:
[0032] AGTGCAGGGTCCGAGGTATT.
[0033] Further, the use of the above-mentioned miRNA marker detection reagent in the preparation of a product for predicting the mental state of offspring, wherein the miRNA marker detection reagent further comprises a reference gene primer for detecting the expression amount of the miRNA marker miR-9-3p, and the reference gene primer comprises a fourth reverse transcription primer, a fourth forward primer and a fourth reverse primer; the nucleotide sequence of the fourth reverse transcription primer is shown as SEQ ID NO: 12, the nucleotide sequence of the fourth forward primer is shown as SEQ ID NO: 13, and the nucleotide sequence of the fourth reverse primer is shown as SEQ ID NO: 14.
[0034] Fourth reverse transcription primer sequence (reference gene U6), SEQ ID NO: 12:
[0035] GTCGTATCCAGTGCAGGGTCCGAGGTATTCGCACTGGATACGACAA AATA;
[0036] Fourth forward primer sequence (reference gene), SEQ ID NO: 13:
[0037] CAAATTCGTGAAGCGTTCCA;
[0038] Fourth reverse primer sequence (reference gene), SEQ ID NO: 14:
[0039] AGTGCAGGGTCCGAGGTATT.
[0040] Further, the use of the above-mentioned miRNA marker detection reagent in the preparation of a product for predicting the mental state of offspring, wherein the miRNA marker is a miRNA marker in the sperm of the father, preferably a miRNA marker in the sperm of an advanced age father.
[0041] The "advanced age" in the advanced age paternal sperm as described in the present application refers to a father with an age greater than or equal to 50% of the average age of the father, and in the case of human, refers to a father with an age greater than or equal to 45 years old.
[0042] Further, the application of the miRNA marker detection reagent in the preparation of a product for predicting the mental state of the offspring refers to the susceptibility of the offspring to mental anxiety or social disorder.
[0043] Further, the application of the miRNA marker detection reagent in the preparation of a product for predicting the mental state of the offspring is to detect the expression amount of miRNA markers miR-9-5p and / or miR-9-3p, and the detection method comprises the following steps:
[0044] S1. Processing of semen sample, centrifugation, sperm extraction, preservation and standby;
[0045] S2. Extraction of total RNA;
[0046] S3. Detection of total amount of RNA by using ultramicro spectrophotometer;
[0047] S4. Reverse transcription to obtain cDNA, and fluorescence quantitative detection of the obtained cDNA.
[0048] Further, the application of the miRNA marker detection reagent in the preparation of a product for predicting the mental state of the offspring is a kit, and the kit further comprises the following preparations: dNTP / AMV reverse transcriptase, buffer, MgCl2, DEPC water and Taq enzyme.
[0049] The 10 μL reverse transcription system used is specifically shown in Table 1.
[0050] Reagent Volume (μL) AMV reverse transcriptase dNTP 0.5 5x AMV buffer 1 Reverse transcription primer (10 μM) 2 DEPC water 1 RNA 3.5 2 (10 pg - 1 μg) Reagent Volume (μL)
[0051] The 20 μL qPCR system used is specifically shown in Table 2.
[0052] rTaq dNTP MgCl2 0.3 10x buffer 0.4 Forward primer (10 μM) 1.2 Reverse primer (10 μM) 2.0 SYBR 0.5 cDNA 0.5 Figure 1 1.0 ddH2O 13.1 Figure 2 1.0
[0053] Compared with the prior art, the application has the following advantages: the application provides the use of the miRNA marker detection reagent in the preparation of a product for predicting the mental state of offspring, discloses "intergenerational epigenetic factors", namely miR-9-5p and miR-9-3p in reproductive cells, and the two mediate the epigenetic phenomenon that male advanced age reproduction causes offspring anxiety and social disorder susceptibility. The specificity and sensitivity of miR-9-5p and miR-9-3p for detecting offspring anxiety and social disorder susceptibility are high, and through detection of the above markers, the concept of "eugenics and better upbringing" of the advanced age population can be effectively improved, and the application can also be used for auxiliary early diagnosis of offspring mental abnormality susceptibility. BRIEF DESCRIPTION OF DRAWINGS
[0054] Figure 3 A result graph of anxiety and social disorder symptoms of offspring of advanced age male reproduction. Among them, A: reproduction strategy of advanced age male (F0-Aged vs. F0-Ctl) and F1 offspring behavior index detection mode (F1-Aged vs. F1-Ctl); B: offspring forced swimming test statistical graph (left), sucrose preference test statistical graph (right); C: offspring open field test trajectory representative graph; D: offspring elevated plus maze test trajectory representative graph; E: offspring three-box social test trajectory representative heat map; F: offspring open field test, total moving distance (left), central area residence time proportion (right); G: offspring elevated plus maze test, open arm entry frequency proportion, open arm residence time proportion; H: offspring three-box social test, social stage statistical graph (left), social preference stage statistical graph (right).
[0055] Figure 4 A result graph of susceptibility of offspring anxiety-like symptoms and social disorder caused by sperm small RNA. Among them, A: reproduction strategy of sRNA microinjection (sRNA-Aged vs. sRNA-Ctl) and behavior index detection mode of F1 offspring ARS exposure; B: offspring open field test trajectory representative graph; C: offspring elevated plus maze test trajectory representative graph; D: offspring three-box social test trajectory representative heat map; E: offspring open field test, total moving distance (left), central area residence time proportion (right); F: offspring elevated plus maze test, open arm entry frequency proportion, open arm residence time proportion; G: offspring three-box social test, social stage statistical graph (left), social preference stage statistical graph (right).
[0056] Figure 5Significant changes of miRNAs in aged mouse sperm. A: Sperm length distribution and sRNA classification plot (F0-Aged vs. F0-Ctl), normal group (upper), aged group (lower). B: Heatmap comparison of differentially expressed sperm miRNAs between F0-Aged and F0-Ctl. C: Single sample verification of miRNAs changes. Quantitative RT-PCR analysis of the expression levels of sperm miRNAs from F0-Aged and F0-Ctl (upper), and the expression levels of miRNAs in aged and young human sperm (lower).
[0057] Figure 6 Significant changes of sRNAs in aged mouse sperm led to significant changes of embryonic cell genes. A: Heatmap comparison of the top 100 DEGs of sRNA-Aged and sRNA-Ctl at 8-cell stage (left) and blastocyst stage (right). B: GO analysis of DEGs between 8-cell stage (upper) and blastocyst stage (lower). C: IPA analysis results at 8-cell stage (upper) and blastocyst stage (lower).
[0058] Figure 7 Changes of Zfp36l2, Itgb3, Myolb, Trpv5 and Gjal genes downstream of 17β-estradiol signaling pathway at early embryonic development. A: Timeline of offspring formed by microinjection of sperm sRNAs (sRNA-Aged vs. sRNA-Ctl). B-F: Quantitative RT-PCR analysis of the expression levels of Zfp36l2, Itgb3, Myolb, Trpv5 and Gjal mRNA at 2-cell (B), 4-cell (C), 8-cell (D), blastocyst (E) and E12.5 (F) stages.
[0059] Figure 8A: Schematic diagram of the 3'UTR interaction between miR-9-5p and GPER1. B: Western blot results. C: Western blot grayscale quantitative analysis. D: Quantitative RT-PCR analysis of GPER1 and ERα mRNA expression levels in N2A cells transfected with scrRNA or miR-9-5p. E: Changes in GPER1 mRNA at 2-cell, 4-cell, 8-cell, blastocyst, and E12.5 stages of embryonic development were detected by quantitative RT-PCR after injecting sperm sRNA (sRNA-Aged vs. sRNA-Ctl) into fertilized eggs. F: Immunofluorescence analysis of GPER1 in 8-cell embryos and blastocysts developed from fertilized eggs (left), and immunofluorescence analysis of GPER1 in 8-cell embryos and blastocysts developed from fertilized eggs injected with mouse sperm sRNA (right). G: Immunofluorescence intensity statistics. H: Immunofluorescence analysis of GPER1 in 8-cell embryos and blastocysts developed from fertilized eggs injected with scrRNA or miR-9-5p (left); immunofluorescence analysis of GPER1 in 8-cell embryos and blastocysts developed from fertilized eggs injected with sRNAs from sperm of older or younger donors (right). I: Immunofluorescence intensity statistics.
[0060] 5 min Offspring microinjected with miR-9-5p showed susceptibility to anxiety and social disorders. A: Microinjection of miR-9-5p breeding strategy and F1 offspring behavioral indicators (miR-9-5p vs. scrRNA). B: Resting state, offspring open field test, total distance traveled (left), percentage of time spent in the central region (right). C: Resting state, offspring elevated cross maze test, percentage of open-arm entry, percentage of time spent in open-arm position. D: Resting state, offspring three-box social test, social phase statistics (left), social preference phase statistics (right). E: After ARS exposure, offspring open field test, total distance traveled (left), percentage of time spent in the central region (right). F: After ARS exposure, offspring elevated cross maze test, percentage of open-arm entry, percentage of time spent in open-arm position. G: After ARS exposure, offspring three-box social test, social phase statistics (left), social preference phase statistics (right).
[0061] 15 min A comparison of transcriptional changes in blastocysts induced by human and mouse sperm sRNAs. A: Venn diagram. B: Comparison of differentially expressed genes using RRHO analysis. Detailed Implementation
[0062] For the purposes of the present application, the technical solutions and advantages will be more clearly and specifically described below. However, it should be understood that the description herein is only used to explain the present application and is not intended to limit the scope of the present application.
[0063] Unless otherwise defined, all technical and scientific terms used herein have the same meaning as commonly understood by one of ordinary skill in the art to which this application belongs. The terminology used in the description herein is for the purpose of describing particular embodiments only and is not intended to be limiting of the present application. The reagents and instruments used herein are commercially available, and the characterization means involved can be referred to the related description in the prior art, which will not be described herein.
[0064] For a further understanding of the present application, the present application will be further described in detail below with reference to the best mode.
[0065] Example 1
[0066] The application of the miRNA marker detection reagent in the preparation of a product for predicting the mental state of offspring, the miRNA marker being miR-9-5p and / or miR-9-3p.
[0067] In detection, the miR-9-5p marker can be detected alone, the miR-9-3p marker can be detected alone, and more preferably, the miR-9-5p and miR-9-3p markers are detected together, and the detection results of both are combined for predicting the mental state of offspring.
[0068] The nucleotide sequence of miR-9-5p is shown in SEQ ID NO: 1, and the nucleotide sequence of miR-9-3p is shown in SEQ ID NO: 2.
[0069] SEQ ID NO: 1 is specifically: UCUUUGGUUAUCUAGCUGUAUGA;
[0070] SEQ ID NO: 2 is specifically: AUAAAGCUAGAUAACCGAAAGU.
[0071] The detection primer of miR-9-5p includes a first reverse transcription primer, a first forward primer and a first reverse primer; the nucleotide sequence of the first reverse transcription primer is shown in SEQ ID NO: 3, the nucleotide sequence of the first forward primer is shown in SEQ ID NO: 4, and the nucleotide sequence of the first reverse primer is shown in SEQ ID NO: 5.
[0072] The first reverse transcription primer sequence (miR-9-5p) is shown in SEQ ID NO: 3:
[0073] GTCGTATCCAGTGCAGGGTCCGAGGTATTCGCACTGGATACGACTCATAC;
[0074] First forward primer sequence (miR-9-5p), SEQ ID NO: 4:
[0075] GCGCGTCTTTGGTTATCTAGCT;
[0076] First reverse primer sequence (miR-9-5p), SEQ ID NO: 5:
[0077] AGTGCAGGGTCCGAGGTATT.
[0078] The miRNA marker detection reagent further comprises a reference gene primer for detecting the expression amount of the miRNA marker miR-9-5p, and the reference gene primer comprises a third reverse transcription primer, a third forward primer and a third reverse primer; the nucleotide sequence of the third reverse transcription primer is shown as SEQ ID NO: 9, the nucleotide sequence of the third forward primer is shown as SEQ ID NO: 10, and the nucleotide sequence of the third reverse primer is shown as SEQ ID NO: 11.
[0079] Third reverse transcription primer sequence (reference gene U6), SEQ ID NO: 9:
[0080] GTCGTATCCAGTGCAGGGTCCGAGGTATTCGCACTGGATACGACA AAATA;
[0081] Third forward primer sequence (reference gene), SEQ ID NO: 10:
[0082] CAAATTCGTGAAGCGTTCCA;
[0083] Third reverse primer sequence (reference gene), SEQ ID NO: 11:
[0084] AGTGCAGGGTCCGAGGTATT.
[0085] The detection primer of miR-9-3p comprises a second reverse transcription primer, a second forward primer and a second reverse primer; the nucleotide sequence of the second reverse transcription primer is shown as SEQ ID NO: 6, the nucleotide sequence of the second forward primer is shown as SEQ ID NO: 7, and the nucleotide sequence of the second reverse primer is shown as SEQ ID NO: 8.
[0086] Second reverse transcription primer sequence (miR-9-3p), SEQ ID NO: 6:
[0087] GTCGTATCCAGTGCAGGGTCCGAGGTATTCGCACTGGATACGACAC TTTC;
[0088] Second forward primer sequence (miR-9-3p), SEQ ID NO: 7:
[0089] CGCGCGATAAAGCTAGATAACC;
[0090] Second reverse primer sequence (miR-9-3p), SEQ ID NO: 8:
[0091] AGTGCAGGGTCCGAGGTATT.
[0092] The miRNA marker detection reagent further comprises a reference gene primer for detecting the expression amount of the miRNA marker miR-9-3p, and the reference gene primer comprises a fourth reverse transcription primer, a fourth forward primer and a fourth reverse primer; the nucleotide sequence of the fourth reverse transcription primer is shown as SEQ ID NO: 12, the nucleotide sequence of the fourth forward primer is shown as SEQ ID NO: 13, and the nucleotide sequence of the fourth reverse primer is shown as SEQ ID NO: 14.
[0093] Fourth reverse transcription primer sequence (reference gene), SEQ ID NO: 12:
[0094] GTCGTATCCAGTGCAGGGTCCGAGGTATTCGCACTGGATACGACAA AATA;
[0095] Fourth forward primer sequence (reference gene), SEQ ID NO: 13:
[0096] CAAATTCGTGAAGCGTTCCA;
[0097] Fourth reverse primer sequence (reference gene), SEQ ID NO: 14:
[0098] AGTGCAGGGTCCGAGGTATT.
[0099] The miRNA marker is a miRNA marker in paternal sperm, preferably a miRNA marker in paternal sperm of advanced age.
[0100] The "advanced age" of the paternal sperm of advanced age described in the present application refers to a father who is older than or equal to 50% of the average age of the father, and in the case of humans, refers to a father who is older than or equal to 45 years old.
[0101] Offspring mental status refers to offspring mental anxiety or social disorder susceptibility.
[0102] The expression amount of the miRNA marker miR-9-5p and / or miR-9-3p is detected, and the detection method comprises the following steps:
[0103] S1. Processing of semen samples, centrifugation, sperm extraction, preservation and standby, specifically: centrifuging semen at 10000g, 4°C, 5min, aspirating and discarding the supernatant (seminal plasma), and resuspending and dispersing the sediment (i.e. sperm) with 20ul of PBS, and storing in a-80°C refrigerator;
[0104] S2. Extraction of total RNA, and the extraction method is specifically:
[0105] a) Adding 500ul of Trizol to the sperm sample, and standing at room temperature for 5 minutes;
[0106] b) Adding chloroform (100ul) in an amount of 1 / 5 of Trizol, vortexing, standing at room temperature for 5 minutes, and centrifuging at 4°C, 16000g for 15 minutes;
[0107] c) Aspirating the supernatant into a new EP tube, and taking care not to aspirate the impurities at the interface between the aqueous phase and the organic phase, and aspirating 200-300ul of supernatant per 500ul of Trizol;
[0108] d) Adding an equal volume of isopropanol to the supernatant, vortexing, and standing at-20°C for 2 hours or overnight;
[0109] e) Centrifuging the precipitated sample at 4°C, 16000g for 15 minutes, and the RNA precipitate can be seen at the bottom of the tube;
[0110] f) Aspirating the supernatant, and adding 1ml of 75% ethanol prepared with DEPC water to the precipitate, and vortexing gently to allow the precipitate to float up;
[0111] g) Centrifuging at 4°C, 16000g for 15 minutes;
[0112] h) Pouring and aspirating the supernatant, and drying the precipitate by inverting the EP tube on absorbent paper for 15-20 minutes;
[0113] i) Adding an appropriate amount of DEPC water to dissolve the precipitate, and measuring the RNA concentration and purity after vortexing gently at room temperature or 37°C for 5 minutes;
[0114] j) Storing the RNA at-80°C;
[0115] S3. Detecting the concentration and A260 / A280 value of the RNA using an ultramicro spectrophotometer;
[0116] S4. Reverse transcription was performed to obtain cDNA, and the obtained cDNA was subjected to fluorescent quantitative detection. The reverse transcription PCR system is shown in Table 1, and the PCR reaction conditions are shown in Table 3:
[0117] 25℃ 5 min 50℃ Example 2 85℃ Example 3
[0118] The qPCR system is shown in Table 2, and the qPCR reaction conditions are shown in Table 4:
[0119] Table 4
[0120]
[0121] Example 2
[0122] Using the expression detection method described in Example 1, miR-9-5p was detected alone.
[0123] Example 3
[0124] Using the expression detection method described in Example 1, miR-9-3p was detected alone.
[0125] Example 4
[0126] Using the expression detection method described in Example 1, miR-9-5p and miR-9-3p were detected simultaneously.
[0127] Example 5
[0128] Using the methods of Examples 2-4, 3 detections were performed for miR-9-5p, miR-9-3p and miR-9-5p+miR-9-3p, respectively, and the average of the detection results is shown in Table 5.
[0129] Example 4 Sensitivity Specificity Limit of detection 85% 82% 88% Detection accuracy 90% 86% 92% Detection range >1 >1 >1 Figure 1 87% 86% 89% Figure 1 1.5-2.5 2.5-4.0 1.5-4.0
[0130] As can be seen from Table 3, the sensitivity, specificity, i.e. detection accuracy, and other indicators of simultaneously detecting miR-9-5p and miR-9-3p using the primer sequences provided by the present application are all superior to detecting one of the miRNA markers alone.
[0131] Example 6
[0132] Experiment 1: Male advanced age is prone to cause offspring to have phenotypes of anxiety and social impairment.
[0133] Aged male mice (F0-Aged) and normal male mice (F0-Ctl) were mated with normal female mice to obtain the F1 generation (F1-Aged vs. F1-Ctl). Once the F1 generation reached adulthood, they were subjected to 30 minutes of acute restraint stimulation, and behavioral indicators were measured. Figure 1 A). It was found that, compared to F1-Ctl, older male mouse offspring (F1-Aged) did not exhibit depressive-like behavior in the forced swimming and sucrose preference tests. Figure 1 B), but the dwell time in the center of the open field in the open field experiment was significantly reduced ( Figure 1 C, 1F), and the time spent in the open arm area of the elevated cross maze was significantly shortened ( Figure 2 D, 1G), these results indicate that older male offspring are more likely to develop anxiety-like phenotypes after experiencing adverse stimuli. In the three-box social experiment assessing social novelty preference, F1-Ctl performed normally, spending more time sniffing unfamiliar mice, indicating a greater preference for communicating with unfamiliar mice, while F1-Aged spent almost the same amount of time sniffing both unfamiliar and familiar mice (D, 1G). Figure 2 E and 1H indicate that older male mice offspring are more prone to social impairment-like phenotypes when subjected to adverse effects. In summary, behavioral tests revealed that offspring of older males exhibited abnormal mental phenotypes after acute stimulation, with the abnormalities mainly concentrated in susceptibility to anxiety and social impairment-like phenotypes, verifying the intergenerational epigenetic phenomenon that older male reproduction leads to mental abnormalities in offspring.
[0134] Experiment 2: Small RNAs from older male sperm confer susceptibility to anxiety and social disorder symptoms in offspring.
[0135] To investigate whether sperm small RNAs play a causal role in the intergenerational epigenetic inheritance of offspring mental problems caused by advanced maternal age, small RNAs (<200 nt) were purified from F0-Aged and F0-Ctl sperm and injected into normal fertilized eggs. The embryos were then transferred to female mice, and the corresponding offspring (sRNA-Aged vs. sRNA-Ctl) were tested for anxiety and social behavior indicators upon reaching adulthood. Figure 2 A). When exposed to acute stimulation for 30 minutes, the time spent by sRNA-Aged in the central region of the open field was significantly reduced. Figure 2 In the elevated cross maze experiment, the number of times the arms were opened and the time spent in the arms were also significantly reduced (B and 2E). Figure 2 C and 2F) exhibited significant anxiety-like behaviors. Analysis of social behavior revealed that sRNA-Ctl showed a preference for novel mice in the sociality or social novelty preference component of the three-box social test (C and 2F). Figure 3D and 2G) indicate that their social abilities and social memory are normal; in contrast, sRNA-Aged mice showed a significantly shorter time spent interacting with unfamiliar mice in the social novelty preference test (D and 2G). Figure 3 D and 2G) indicate impaired social recognition memory and manifested social impairment. Therefore, injecting small RNA from the sperm of older male mice into fertilized eggs produced the same behavioral abnormalities and mental symptoms as offspring born to older males, suggesting that sperm small RNA is involved in the intergenerational epigenetic phenomenon of mental abnormalities in offspring caused by advanced male fertility.
[0136] Experiment 3: Significant changes were observed in small RNAs in the sperm of older mice.
[0137] To determine which specific sperm small RNA subtypes caused the offspring abnormalities, small RNAs (<200 bp) were isolated from the sperm of older male mice and subjected to high-throughput sequencing. Analysis of non-coding small RNAs with reads greater than 1000 and a fold change greater than 2% revealed highly significant changes in the quantity and expression levels of miRNAs in sperm, while other types of non-coding small RNAs (including piRNA, tsRNA, etc.) showed no significant changes. Figure 3 (A and 3B) This suggests that sperm miRNAs may be the main molecules involved in the intergenerational epigenetic process of male aging leading to offspring mental abnormalities, and are also the main research object of subsequent experiments. Single-sample validation analysis of mouse sperm RNA samples revealed that miR-9-3p and miR-9-5p were significantly elevated in F0-Aged sperm, while miR-31-5p and miR-184-3p were significantly downregulated (A and 3B). Figure 4 C). Furthermore, miR-9-3p and miR-9-5p were shown to be significantly higher in the sperm of older donors than in younger donors. Figure 4 C).
[0138] Experiment 4: Small RNAs from sperm of older mice caused significant changes in the gene transcription level of embryonic cells, and abnormalities were found in the β-estradiol (17β-estradiol) pathway.
[0139] F0-Aged or F0-Ctl sperm small RNAs were injected into fertilized eggs (sRNA-Aged vs. sRNA-Ctl), and single-cell transcriptome RNA sequencing was used to assess changes in the genetic profile at the 8-cell stage (E2.0) and blastocyst stage (E3.5). In both 8-cell and blastocysts, a large number of genes showed significant changes compared to the sRNA-Ctl group (fold-change > 2 and P < 0.05) (Figure 4A). GO analysis revealed that differentially expressed genes (DEGs) in 8-cell and blastocysts were mainly related to embryonic development and cell proliferation and differentiation.Figure 5 B). To elucidate the signaling pathways and interaction networks leading to large-scale aberrant gene expression in 8-cell embryos and blastocysts, Ingenuity Pathway Analysis (IPA) was used to identify upstream regulators associated with DEG. The analysis revealed that the β-estradiol (17β-estradiol) signaling pathway is a common upstream regulatory pathway between 8-cell embryos and blastocysts. Figure 5 C). This result suggests that abnormal 17β-estradiol signaling may be a key factor in mental disorders in offspring caused by advanced male fertility.
[0140] Experiment 5: Early embryos injected with small RNA from older sperm showed abnormal expression of genes Zfp36l2, Itgb3, Myo1b, Trpv5, and Gja1 downstream of the 17β-estradiol signaling pathway.
[0141] F0-Aged or F0-Ctl sperm sRNAs were injected into normal zygotes (sRNA-aged vs. sRNA-ctl). Quantitative RT-PCR was used to detect changes in downstream genes of the 17β-estradiol signaling pathway (fp36l2, Itgb3, Myo1b, Trpv5, and Gja1) at the 2-cell, 4-cell, 8-cell, blastocyst, and E12.5 stages of embryonic development. Figure 5 A). Starting from the 8-cell stage, the expression of these genes gradually increases ( Figure 6 B-5E). Particularly at the E12.5 stage, widespread dysregulation of the Zfp36l2, Itgb3, Myo1b, Trpv5, and Gja1 genes was found in sRNA-Aged embryos. Figure 6 F).
[0142] Experiment 6: miR-9-5p directly inhibits the expression of 17β-estradiol receptor GPER1.
[0143] GPER1 is predicted to be a direct target gene of miR-9-5p. Figure 6 A). In N2A cells and early embryos, miR-9-5p was found to posttranscriptionally repress GPER1 expression rather than ERα expression. Figure 6 BE). Since GPER1 is typically localized to the plasma membrane, immunofluorescence staining was performed, and the location and expression of GPER1 were observed using confocal microscopy. In 8-cell embryos and blastocysts obtained from F0-Aged in vitro fertilization, the fluorescence intensity of GPER1 was significantly lower than that obtained from F0-Ctl in vitro fertilization (Fig. 6F and 6G). Similarly, in embryos developing from zygotes injected with F0-Aged sperm sRNAs, the fluorescence intensity of GPER1 also decreased at the 8-cell and blastocyst stages. Figure 6F and 6G). Moreover, when zygotes injected with miR-9-5p mimic were developed to 8-cell and blastocyst stage, GPER1 was again found to be decreased ( Figure 7 H and 61). Finally, after injecting sRNAs from both aged and young donor sperm into normal zygotes, GPER1 was consistently decreased in 8-cell embryos and blastocysts injected with sRNA set from aged sperm ( Figure 7 H and I).
[0144] Experiment 7: Offspring of microinjection of miR-9-5p represent susceptibility to anxiety and social disorders.
[0145] To further confirm that miRNAs mediated this transgenerational epigenetic phenomenon, miR-9-5p and a nonsense control scrRNA were synthesized and injected into normal mouse zygotes, respectively. The corresponding offspring (miR-9-5p vs. scrRNA) were tested for anxiety and social interaction behavior indicators after adulthood ( Figure 7 A). In the open field test, miR-9-5p performed normally, with similar total distance and center stay time compared to sRNA-Ctl ( Figure 7 B and 7E). In the elevated + maze test, in the resting state, miR-9-5p tended to spend less time in the open arms than scrRNA ( Figure 7 C). After ARS stimulation, miR-9-5p exhibited more obvious anxiety-like behavior, characterized by a significant decrease in open arm entries and open arm stay time ( Figure 7 F). For social behavior analysis, scrRNA showed a preference for old mice in the social novelty preference part of the three-chamber social test ( Figure 8 D and 7G). In contrast, miR-9-5p significantly shortened the time spent with strange mice in the social novelty preference test, both in the resting state and after ARS exposure, indicating impaired social recognition memory ( Figure 8 D and 7G). Therefore, injecting sperm miR-9-5p into zygotes produced similar behavioral abnormalities and psychiatric symptoms in offspring as those born from male advanced age, which proved that miR-9-5p mediated the occurrence of the transgenerational epigenetic phenomenon of psychiatric abnormalities in offspring caused by male advanced age to some extent.
[0146] Experiment 8: Human and mouse sperm small RNAs induce consistent changes in blastocyst transcription.
[0147] Comparing the development of blastocysts from zygotes injected with human sperm sRNAs and zygotes injected with mouse sperm sRNAs, it was found that there was a large overlap in genes that were significantly up- or down-regulated Figure 3A). Similarly, rank-rank hypergeometric overlap (RRHO) analysis showed that there was a significant overlap of up- and down-regulated genes in the blastocysts Figure 6 B), indicating that the transcriptional changes in early embryos induced by sRNAs from aged human sperm were consistent with those induced by sRNAs from aged mouse sperm.
[0148] From the results of Experiment 3 Figure 7 C, it can be seen that in the aged mouse sperm small RNA sample of the mouse sperm RNA sample, only miR-9-3p and miR-9-5p were significantly increased, miR-31-5p and miR-184-3p were significantly down-regulated, and the increase in miR-9-3p was also significantly higher than that of miR-9-5p, suggesting that miR-9-3p and miR-9-5p may be associated with the offspring's susceptibility to anxiety and social disorders, so as to avoid excessive experimental data, the applicant only provides further verification experiments for miR-9-5p, as shown in Experiments 6 and 7, Experiment 6 shows that miR-9-5p can inhibit the expression of 17β-estradiol receptor GPER1 Figure 7 F, 6G, 6H and 6I), and Experiment 7 shows that offspring injected with miR-9-5p will exhibit susceptibility to anxiety and social disorders, especially after ARS stimulation, miR-9-5p group mice will exhibit anxiety-like behavior Figure 3 F), and significantly lower than ordinary group mice (scrRNA) in social or social novelty preference D, 7G), and since Experiment 3 has already shown that miR-9-3p is more associated with the offspring's susceptibility to anxiety and social disorders than miR-9-5p, that is, the experimental results of miR-9-3p will also be similar to or more than those of miR-9-5p (i.e., Experiments 6-7), thereby effectively verifying that the detection of miR-9-5p+miR-9-3p markers will more effectively reflect the offspring's susceptibility to anxiety and social disorders.
[0149] Meanwhile, the current experimental results show that male advanced paternal age leads to offspring anxiety and social impairment susceptibility, and early embryos injected with miRNA from the sperm of advanced male mice have abnormal estrogen signal transduction, and the miRNA of advanced male sperm mediates the occurrence of this intergenerational inheritance. Considering the key role of GPER1 in the rapid effect of estrogen signal transduction, the down-regulation and dysfunction of sperm miRNA-mediated GPER1 can lead to abnormal estrogen signal transduction, resulting in a cascade of changes and a profound impact on early embryonic development. This eventually leads to the susceptibility of offspring to mental problems.
[0150] The above only describes the preferred embodiments of the present application and is not intended to limit the present application. Any modification, equivalent replacement or improvement made within the spirit and principle of the present application shall be included in the protection scope of the present application. SEQUENCE LISTING <110> Nanjing University <120> Use of miRNA marker detection reagent in preparation of product for predicting mental state of offspring <130> 2200140-I <160> 14 <170> SIPOSequenceListing 1.0 <210> 1 <211> 23 <212> RNA <213> miR-9-5p <400> 1 ucuuugguua ucuagcugua uga 23 <210> 2 <211> 22 <212> RNA <213> miR-9-3p <400> 2 auaaagcuag auaaccgaaa gu 22 <210> 3 <211> 50 <212> DNA <213> Artificial Sequence <400> 3 gtcgtatcca gtgcagggtc cgaggtattc gcactggata cgactcatac 50 <210> 4 <211> 22 <212> DNA <213> Artificial Sequence <400> 4 gcgcgtcttt ggttatctag ct 22 <210> 5 <211> 20 <212> DNA <213> Artificial Sequence <400> 5 agtgcagggt ccgaggtatt 20 <210> 6 <211> 50 <212> DNA <213> Artificial Sequence <400> 6 gtcgtatcca gtgcagggtc cgaggtattc gcactggata cgacactttc 50 <210> 7 <211> 22 <212> DNA <213> Artificial Sequence <400> 7 cgcgcgataa agctagataa cc 22 <210> 8 <211> 20 <212> DNA <213> Artificial Sequence <400> 8 agtgcagggt ccgaggtatt 20 <210> 9 <211> 50 <212> DNA <213> Artificial Sequence <400> 9 gtcgtatcca gtgcagggtc cgaggtattc gcactggata cgacaaaata 50 <210> 10 <211> 20 <212> DNA <213> Artificial Sequence <400> 10 caaattcgtg aagcgttcca 20 <210> 11 <211> 20 <212> DNA <213> Artificial Sequence <400> 11 agtgcagggt ccgaggtatt 20 <210> 12 <211> 50 <212> DNA <213> Artificial Sequence <400> 12 gtcgtatcca gtgcagggtc cgaggtattc gcactggata cgacaaaata 50 <210> 13 <211> 20 <212> DNA <213> Artificial Sequence <400> 13 caaattcgtg aagcgttcca 20 <210> 14 <211> 20 <212> DNA <213> Artificial Sequence <400> 14 agtgcagggt ccgaggtatt 20
Claims
1. Use of a miRNA marker detection reagent in the manufacture of a product for predicting the mental status of an offspring, characterized in that, The miRNA marker is miR-9-5p and miR-9-3p; the miRNA marker is in the paternal sperm; and the offspring mental condition refers to offspring mental anxiety or social disorder susceptibility.
2. Use of the miRNA marker detection reagent according to claim 1 in the manufacture of a product for predicting mental conditions of offspring, characterized in that, The miR-9-5p and miR-9-3p marker is a miRNA marker in the sperm of an advanced paternal age.
3. Use of a miRNA marker detection reagent according to claim 1 or 2 for the manufacture of a product for predicting mental conditions in offspring, characterized in that, The nucleotide sequence of the miR-9-5p is shown in SEQ ID NO: 1, and the nucleotide sequence of the miR-9-3p is shown in SEQ ID NO:
2.
4. Use of the miRNA marker detection reagent according to claim 3 in the manufacture of a product for predicting mental conditions of offspring, characterized in that, The detection primer of the miR-9-5p comprises a first reverse transcription primer, a first forward primer and a first reverse primer; the nucleotide sequence of the first reverse transcription primer is shown in SEQ ID NO: 3, the nucleotide sequence of the first forward primer is shown in SEQ ID NO: 4, and the nucleotide sequence of the first reverse primer is shown in SEQ ID NO:
5.
5. Use of the miRNA marker detection reagent according to claim 4 in the manufacture of a product for predicting mental conditions of offspring, characterized in that, The miRNA marker detection reagent further comprises a reference gene primer for detecting the expression amount of the miRNA marker miR-9-5p, and the reference gene primer comprises a third reverse transcription primer, a third forward primer and a third reverse primer; the nucleotide sequence of the third reverse transcription primer is shown in SEQ ID NO: 9, the nucleotide sequence of the third forward primer is shown in SEQ ID NO: 10, and the nucleotide sequence of the third reverse primer is shown in SEQ ID NO:
11.
6. Use of the miRNA marker detection reagent according to claim 3 in the manufacture of a product for predicting mental conditions of offspring, characterized in that, The detection primer of the miR-9-3p comprises a second reverse transcription primer, a second forward primer and a second reverse primer; the nucleotide sequence of the second reverse transcription primer is shown in SEQ ID NO: 6, the nucleotide sequence of the second forward primer is shown in SEQ ID NO: 7, and the nucleotide sequence of the second reverse primer is shown in SEQ ID NO:
8.
7. Use of the miRNA marker detection reagent according to claim 6 in the manufacture of a product for predicting mental conditions of offspring, characterized in that, The miRNA marker detection reagent further comprises a reference gene primer for detecting the expression amount of the miRNA marker miR-9-3p, and the reference gene primer comprises a fourth reverse transcription primer, a fourth forward primer and a fourth reverse primer; the nucleotide sequence of the fourth reverse transcription primer is shown in SEQ ID NO: 12, the nucleotide sequence of the fourth forward primer is shown in SEQ ID NO: 13, and the nucleotide sequence of the fourth reverse primer is shown in SEQ ID NO:
14.
8. Use of the miRNA marker detection reagent according to claim 7 in the manufacture of a product for predicting mental conditions of offspring, characterized in that, The product is a kit, and the kit further comprises the following preparations: dNTP / AMV reverse transcriptase, buffer, MgCl2, DEPC water and Taq enzyme. 9. Use of the miRNA marker detection reagent according to claim 8 in the manufacture of a product for predicting mental conditions of offspring, characterized in that,