RNA-Targeting Ligands, Compositions Thereof, and Methods for Their Preparation and Use
Through fragment-based screening strategies and structural detection technology, fragment ligands bound to TPP riboswitches were identified, which solved the problem of difficult development of RNA-targeted ligands in the prior art, and achieved the effect of efficiently regulating RNA function.
Patent Information
- Application Number
- CN202080069480.0
- Authority / Receiving Office
- CN · China
- Patent Type
- Patents(China)
- Current Assignee / Owner
- Priority Date
- 2020-05-29
- Filing Date
- 2020-08-05
- Publication Date
- 2025-08-05
- Estimated Expiration
- 2040-08-05
AI Technical Summary
The prior art is difficult to quickly and efficiently identify small molecule ligands that bind to RNA molecules and perturb their functions, especially targeted ligands of non-coding RNA, resulting in a lack of effective methods in regulating cellular status and disease treatment.
Fragment-based screening strategy was adopted to combine SHAPE and SHAPE-mutation spectroscopy (MaP) RNA structure detection to identify fragments bound to TPP riboswitches, and design high-nanomolar affinity ligands through structure-activity relationship studies, and develop high-quality ligands using synergistic and multi-site binding.
The identification and design of fragment ligands bound to TPP riboswitches with high affinity are achieved, which can more effectively regulate RNA function and provide an efficient ligand development pathway for various RNA targets.
Smart Images

Figure CN114901654B_ABST
Abstract
Description
Technical Field
[0001] The present disclosure relates to compounds that bind to target RNA molecules, such as TPP riboswitches, compositions comprising the compounds, and methods of making and using the same. Compared to compounds that bind only to a single RNA binding site, the compounds contain two structurally distinct fragments that allow binding to the target RNA at two different binding sites, thereby generating a higher affinity binding ligand.
[0002] Incorporation by Reference into the Sequence Listing
[0003] The material in the accompanying sequence listing is hereby incorporated by reference into this application in its entirety.The accompanying file, entitled Sequence Listing 39397600002_ST25, was created on August 5, 2020 and is 4 KB.
[0004] Government support
[0005] This invention was made with government support under Grant Nos. GM098662 and AI068462 awarded by the National Institutes of Health (NIH). The government has certain rights in this invention. Background Art
[0006] The vast majority of small molecule ligands are developed primarily to manipulate biological systems by targeting proteins. Proteins have very complex three-dimensional structures that are essential for them to function properly and contain crevices and indentations to which small molecule ligands can bind. 1,2 The transcriptome—the collection of all RNA molecules produced in an organism—also contains promising targets for studying and manipulating biological systems. For example, the RNA transcriptome plays an important role not only in mammalian systems but is also present in both bacteria and viruses and therefore represents a target for small molecules to modulate gene expression.
[0007] Remarkably, RNA can adopt three-dimensional structures of complexity comparable to that of proteins. 3 , which is a key feature required for the development of highly selective ligands 4 , and RNA plays a pervasive role in controlling the behavior of biological systems 5Initially viewed as a carrier of genetic information solely to transmit messages for protein coding and directing the process of protein biosynthesis, the modern view of RNA has evolved to encompass an expanded role, with various RNA molecules now known to have broad and profound roles in regulating gene expression and other biological processes through a variety of mechanisms. Even a large number of newly discovered non-coding RNAs have been found to be associated with diseases such as cancer and non-oncogenic diseases. Therefore, the recognition that RNA contributes to disease states in addition to encoding pathogenic proteins provides a large number of previously unrecognized therapeutic targets.
[0008] However, although it has been demonstrated that small molecule ligands can bind to mRNA and have the potential to upregulate or downregulate translation efficiency, thereby regulating protein expression in cells 6,7 , but identifying small RNA ligands still involves challenges not faced when targeting proteins 4,11,12 This also encompasses the development of small molecules directed against non-coding RNAs, which also represent abundant targets. 8–10 Unfortunately, despite the development of various techniques for analyzing RNA structure and discovering new functions, the ability to efficiently and quickly identify or design inhibitors that bind to RNA and perturb RNA function remains far behind. Therefore, there is a great need in the art to develop new methods and technologies that allow for the rapid and efficient identification of small molecule ligands that target RNA molecules. Summary of the Invention
[0009] As already mentioned above, the transcriptome represents an attractive but underutilized set of targets for small molecule ligands. Small molecule ligands (and ultimately drugs) targeting messenger RNA and non-coding RNA have the potential to regulate cell states and diseases. In the current disclosure, a fragment-based screening strategy using selective 2'-hydroxy acylation (SHAPE) and SHAPE-mutation spectrum (MaP) RNA structure probing by primer extension analysis was used to discover small molecule fragments that bind to target RNA structures. Specifically, fragments that bind to TPP riboswitches with millimolar to micromolar affinities and pairs of fragments that bind cooperatively were identified. Structure-activity relationship (SAR) studies were performed to obtain information to efficiently design linked fragment ligands that bind to TPP riboswitches with high nanomolar affinities. The principles disclosed herein are not meant to be limited to TPP riboswitches, but can also be widely applicable to other target RNA structures, thereby exploiting synergy and multi-site binding to develop high-quality ligands for various RNA targets.
[0010] Thus, one aspect of the presently disclosed subject matter is a compound having the structure of Formula (I):
[0011]
[0012] in
[0013] X1, X2 and X3 are independently selected from CR1, CHR1, N, NH, O and S in each instance, wherein adjacent X1, X2 and X3 are not simultaneously selected to be O or S;
[0014] Dashed lines represent optional double bonds;
[0015] Y1, Y2 and Y3 are independently selected from CR2 and N in each instance;
[0016] n is 1 or 2, wherein when n is 1, only one of the dashed lines is a double bond;
[0017] L is selected from
[0018]
[0019] wherein p, q, r, and v are independently selected from the integers 0, 1, 2, 3, 4, 5, 6, 7, 8, 9, and 10, and z is selected from the integers 1, 2, 3, 4, and 5; and
[0020] A is selected from
[0021]
[0022] wherein X4, X5, X6 and X7 are independently selected from CR3 and N;
[0023] wherein R1, R2 and R3 are independently selected from -H, -Cl, -Br, -I, -F, -CF3, -OH, -CN, -NO2, -NH2, -NH(C1-C6 alkyl), -N(C1-C6 alkyl), -COOH, -COO(C1-C6 alkyl), -CO(C1-C6 alkyl), -O(C1-C6 alkyl), -OCO(C1-C6 alkyl), -NCO(C1-C6 alkyl), -CONH(C1-C6 alkyl) and substituted or unsubstituted C1-C6 alkyl;
[0024] m is 1 or 2; and
[0025] W is -O or -NR4, wherein R4 is selected from -H, -CO(C1-C6 alkyl), substituted or unsubstituted C1-C6 alkyl, substituted or unsubstituted aryl, substituted or unsubstituted heteroaryl, substituted or unsubstituted cycloalkyl, -CO(aryl), -CO(heteroaryl), and -CO(cycloalkyl);
[0026] Provided that at least two of X1, X2, X3, X4, X5, X6 and X7 are N;
[0027] or a pharmaceutically acceptable salt thereof.
[0028] Another aspect of the presently disclosed subject matter includes compounds as described herein that bind to a region of an RNA molecule.
[0029]
[0014] Another aspect of the presently disclosed subject matter includes a composition comprising a therapeutically effective amount of a compound described herein in a pharmaceutically acceptable carrier, diluent, or excipient.
[0030] Yet another aspect of the presently disclosed subject matter includes a method of treating a disease or condition associated with dysfunction of RNA expression, comprising administering to a subject in need thereof a therapeutically effective dose of a composition of a compound described herein.
[0031]
[0014] Another aspect of the presently disclosed subject matter includes methods for preparing the compounds described herein.
[0032] Still another aspect of the presently disclosed subject matter will be presented below. BRIEF DESCRIPTION OF THE DRAWINGS
[0033] Figure 1 A scheme for RNA screening constructs and fragment screening workflow is shown. RNA motifs 1 and 2; the barcode helix; and the structure box helix are shown. RNA is probed using SHAPE in the presence or absence of small molecule fragments, and chemical modifications corresponding to ligand-dependent structural information are read out by multiplexing MaP sequencing.
[0034] Figure 2 Representative mutation rate comparisons for fragment hits and misses are shown. Normalized mutation rates for fragment-exposed samples are labeled as +ligand, +2, or +4 and compared to the no-ligand trace labeled as no-ligand. Statistically significant mutation rate changes are indicated with triangles (for SHAPE validation data, see Figure 8 (Top) Comparison of mutation rates for representative fragments that were not bound to the test construct. (Middle) Fragment hits to the TPP riboswitch region of RNA. (Bottom) Non-specific hits that induced changes in reactivity across the entire test construct. Motif 1 and 2 signatures are shown below the SHAPE profile.
[0035] Figure 3A and 3B Shown by ( Figure 3A ) Clip 17 pairs ( Figure 3B ) natural TPP ligand (2HOJ 28 Comparison of the structures of the TPP riboswitch bound to ) in Figure 1. The RNA structure is shown in a similar orientation in each image. Hydrogen bonds between the ligand and the RNA are shown as dashed lines.
[0036] Figure 4A and 4BThermodynamic cycling and stepwise ligand binding affinities of fragments 2 and 31 are shown. Figure 4A A summary of the binding by compound 2 (dark grey, K1) and compound 31 (light grey, K2) fragments is shown. D The values were determined by ITC. Figure 4B ITC data showing single compound binding and cooperative binding by fragments 2 and 31 are shown. Linking the two fragments showed an additive effect in binding energy, which resulted in a submicromolar ligand compound 37 (K L ). ITC traces are shown with the background trace (ligand titrated into buffer) in light grey and the experimental trace in dark grey. Curve fits and 95% confidence intervals are shown in grey shading.
[0037] Figure 5 The covalent attachment of fragments 17 and 31 is shown as a function of linker type and length, terminal group chemistry, and terminal group orientation. Modifications that increase RNA binding affinity are presented in compounds 36 and 37 (light gray); negative modifications are presented in compounds 35, 39, and 40 (light gray), and neutral modifications are presented in compound 38 (light gray). Dissociation constants were determined by ITC.
[0038] Figure 6 Shown is a comparison of fragment-linker-fragment ligands developed by a fragment-based approach, which are ranked according to their connection coefficients (E). Values are shown on a logarithmic axis. Cooperative connection corresponds to a lower E value (top of the vertical axis). Fragment 37 exhibits an E value of 2.5 and an LE value of 0.34. The dissociation constants of the individual fragments (left, center) and the connected ligands (right) are indicated below the component fragments; E values (top) and ligand efficiency (bottom) are shown. The covalent linkage introduced between the fragments is highlighted in light grey. The structures of the component fragments are detailed in Table 7.
[0039] Figure 7A and 7B Screening construct design is shown. Figure 7A An RNA sequence with the following components is shown (SEQ ID NO: 6): GGUCGCGAGUAAUCGCGACC (SEQ ID NO: 7) is a structural cassette; GCU G CA AGAGAU UG U AGC (SEQ ID NO: 8) is the RNA barcode (barcode NT is underlined); GUGGGCACUUCGGUGUCCAC (SEQ ID NO: 9) is the structural cassette; ACGCGAAGGAAACCGCGUGUCAACUGUGCAACAGCUGACAAAGAGAUUCCU (SEQ ID NO: 10) is the DENV pseudoknot (mutant in bold); AAAACU is a linker; CAGUACUCGGGGUGCCCUUCUGCGUGAAGGCUGAGAAAUACCCGUAUCACCUGAUCUGGAUAAUGCCAGCGUAGGGAAGUGCUG (SEQ ID NO: 11) is the TPP riboswitch (mutant in bold); and GAUCCGGUUCGCCGGAUCAAUCGGGCUUCGGUCCGGUUC (SEQ ID NO: 12) is the structural cassette. Figure 7B The secondary structure of the RNA sequence barcode is shown in the context of its self-folding hairpin structure.
[0040] Figure 8 SHAPE spectra of miss, hit, and nonspecific hit fragments are shown. The mutation rate trace corresponding to the fragment exposure and the no ligand control trace are shaded solid gray and outlined black, respectively. Nucleotides determined to be statistically significantly different in the fragment sample versus the no fragment sample are marked with triangles. The mutation rate trace for the same fragment is shown in Figure 2 It is schematically shown in FIG. DETAILED DESCRIPTION
[0041] The subject matter of the present disclosure will now be described more fully hereinafter. However, benefiting from the teaching presented in the foregoing description, those skilled in the art to which the subject matter of the present disclosure relates will expect many modifications and other embodiments of the subject matter of the present disclosure set forth herein. Therefore, it should be understood that the subject matter of the present disclosure is not limited to the specific embodiments disclosed, and modifications and other embodiments are intended to be included within the scope of the appended claims. In other words, the subject matter described herein encompasses all substitutions, modifications, and equivalents. If one or more of the combined documents, patents, and similar materials are different from or contradictory to the present application, including but not limited to defined terms, term usage, described technology, etc., the present application shall prevail. Unless otherwise defined, all technical terms and scientific terms used herein have the same meaning as those generally understood by those of ordinary skill in the art. All publications, patent applications, patents, and other references mentioned herein are incorporated by reference in their entirety.
[0042] definition
[0043] As used herein, the term "alkyl" refers to a saturated hydrocarbon radical containing 1 to 8, 1 to 6, 1 to 4, or 5 to 8 carbon atoms. In certain embodiments, the saturated group contains more than 8 carbon atoms. Structurally, an alkyl radical is similar to a non-cyclic alkane compound modified by removing a hydrogen from a non-cyclic alkane and replacing it with a non-hydrogen group or free radical. The alkyl radical can be branched or unbranched. The lower alkyl radical has 1 to 4 carbon atoms. The higher alkyl radical has 5 to 8 carbon atoms. Examples of alkyl radicals, lower alkyl radicals, and higher alkyl radicals include, but are not limited to, free radicals such as methyl, ethyl, n-propyl, isopropyl, n-butyl, sec-butyl, tert-butyl, amyl, tert-amyl, n-pentyl, n-hexyl, and isooctyl.
[0044] As used herein, the symbols "(CO)" and "C(O)" are used to indicate a carbonyl moiety. Examples of suitable carbonyl moieties include, but are not limited to, ketone and aldehyde moieties.
[0045] The term "cycloalkyl" refers to a hydrocarbon having 3-8 members or 3-7 members or 3-6 members or 3-5 members or 3-4 members and can be monocyclic or bicyclic. The ring can be saturated or can have a certain degree of unsaturation. Cycloalkyl can optionally be substituted by one or more substituents. In one embodiment, 0, 1, 2, 3 or 4 atoms of each ring of cycloalkyl can be substituted by a substituent. Representative examples of cycloalkyl include cyclopropyl, cyclopentyl, cyclohexyl, cyclobutyl, cycloheptyl, cyclopentenyl, cyclopentadienyl, cyclohexenyl, cyclohexadienyl etc.
[0046] The term "aryl" refers to a hydrocarbon monocyclic, bicyclic, or tricyclic aromatic ring system. An aryl group may optionally be substituted with one or more substituents. In one embodiment, 0, 1, 2, 3, 4, 5, or 6 atoms of each ring of an aryl group may be substituted with a substituent. Examples of aryl groups include phenyl, naphthyl, anthracenyl, fluorenyl, indenyl, azulenyl, and the like.
[0047] The term "heteroaryl" refers to an aromatic 5-10 ring system, wherein a heteroatom is selected from O, N or S, and all the other ring atoms are carbon (unless otherwise indicated, otherwise with suitable hydrogen atoms). Heteroaryl can optionally be substituted with one or more substituents. In one embodiment, 0, 1, 2, 3 or 4 atoms of each ring of heteroaryl can be substituted with a substituent. Examples of heteroaryl include pyridyl, furyl, thienyl, pyrrolyl, oxazolyl, oxadiazolyl, imidazolyl, thiazolyl, isoxazolyl, quinolyl, pyrazolyl, isothiazolyl, pyridazinyl, pyrimidinyl, pyrazinyl, triazinyl, isoquinolyl, indazolyl etc.
[0048] As used herein, the term "substituted" refers to a moiety (such as heteroaryl, aryl, alkyl, and / or alkenyl) that is bound to one or more additional organic or inorganic substituent radicals. In some embodiments, the substituted moiety includes 1, 2, 3, 4, or 5 additional substituent groups or radicals. Suitable organic and inorganic substituent radicals include, but are not limited to, hydroxyl, cycloalkyl, aryl, substituted aryl, heteroaryl, heterocycle, substituted heterocycle, amino, monosubstituted amino, disubstituted amino, acyloxy, nitro, cyano, carboxyl, alkoxycarbonyl, alkylcarboxamide, substituted alkylcarboxamide, dialkylcarboxamide, substituted dialkylcarboxamide, alkylsulfonyl, alkylsulfinyl, thioalkyl, alkoxy, substituted alkoxy, or haloalkoxy radicals, as those terms are defined herein. Unless otherwise specified herein, an organic substituent may include 1 to 4 or 5 to 8 carbon atoms. When more than one substituent radical is bonded to a substituted moiety, the substituent radicals may be the same or different.
[0049] As used herein, the term "unsubstituted" refers to a moiety that is not bonded to one or more additional organic or inorganic substituent radicals as described above (e.g., heteroaryl, aryl, alkenyl, and / or alkyl), meaning that the moiety is substituted only with hydrogen.
[0050] It is understood that structures provided herein and any statement of "substituted" or "substituted by" include the implied proviso that such structures and substitutions are in accordance with the permitted valences of the substituted atoms and substituents and that the substitutions result in stable compounds, e.g., compounds that do not spontaneously undergo transformations such as by rearrangement, cyclization, elimination, and the like.
[0051] As used herein, the term "RNA" refers to ribonucleic acid, a polymer molecule that is crucial in the various biological functions of gene encoding, decoding, regulation, and expression. RNA and DNA are nucleic acids and, together with lipids, proteins, and carbohydrates, constitute four major macromolecules that are crucial for all known life forms. Like DNA, RNA is assembled into nucleotide chains, but unlike DNA, RNA in nature is found as a single strand that folds on itself, rather than a paired double strand. Cellular organisms use messenger RNA (mRNA) to transmit the genetic information (using the nitrogenous bases guanine, uracil, adenine, and cytosine represented by the letters G, U, A, and C) that guides the synthesis of specific proteins. Many viruses use RNA genomes to encode their genetic information. Some RNA molecules play an active role in cells by catalyzing biological reactions, controlling gene expression, or sensing and transmitting responses to cell signals. One of these active processes is protein synthesis, which is a universal function in which RNA molecules guide protein synthesis on ribosomes. This process uses transfer RNA (tRNA) molecules to deliver amino acids to the ribosome, where ribosomal RNA (rRNA) then links the amino acids together to form the encoded protein.
[0052] As used herein, the term "non-coding RNA (ncRNA)" refers to an RNA molecule that is not translated into protein. The DNA sequence from which functional non-coding RNA is transcribed is commonly referred to as an RNA gene. A large number of functionally important types of non-coding RNA include transfer RNA (tRNA) and ribosomal RNA (rRNA) as well as small RNAs such as microRNA, siRNA, piRNA, snoRNA, snRNA, exRNA, scaRNA, and long ncRNAs such as Xist and HOTAIR.
[0053] As used herein, the term "coding RNA" refers to RNA that encodes a protein, i.e., messenger RNA (mRNA). Such RNA includes the transcriptome.
[0054] As used herein, the term "riboswitch" refers to a regulatory segment of a messenger RNA molecule that binds a small molecule, thereby altering the production of the protein encoded by the mRNA. Thus, an mRNA containing a riboswitch is directly involved in regulating its own activity in response to the concentration of its effector molecule.
[0055] As used herein, the term "TPP riboswitch," also known as a THI element and a Thi-box riboswitch, refers to a highly conserved RNA secondary structure. The TPP riboswitch acts as a riboswitch that directly binds to thiamine pyrophosphate (TPP) to regulate gene expression in archaea, bacteria, and eukaryotes through various mechanisms. TPP is the active form of thiamine (vitamin B1), an essential coenzyme synthesized in bacteria by coupling pyrimidine and thiazole moieties.
[0056] As used herein, the term "pseudoknot" refers to a nucleic acid secondary structure containing at least two stem-loop structures, in which one half of one stem is inserted between the two halves of the other stem. Pseudoknots were first discovered in Turnip Yellow Mosaic Virus in 1982. Pseudoknots fold into a knot-like three-dimensional configuration but are not true topological knots.
[0057] "Aptamer" refers to a nucleic acid molecule that can bind to a specific molecule of interest with high affinity and specificity (Tuerk and Gold, 1990; Ellington and Szostak, 1990), and can be human-engineered or naturally derived. The binding of a ligand to an aptamer (the aptamer is typically RNA) changes the configuration of the aptamer and the nucleic acid in which the aptamer is located. In some instances, the configurational change inhibits the translation of the mRNA in which the aptamer is located, for example, or otherwise interferes with the normal activity of the nucleic acid. Aptamers can also be composed of DNA or can include non-natural nucleotides and nucleotide analogs. Aptamers are most typically obtained by in vitro selection for binding to a target molecule. However, in vivo selection of aptamers is also possible. Aptamers are also the ligand binding domain of riboswitches. The length of an aptamer is typically between about 10 and about 300 nucleotides. More commonly, the length of an aptamer is between about 30 and about 100 nucleotides. See, for example, U.S. Patent No. 6,949,379, which is incorporated herein by reference. Examples of aptamers that can be used in the present invention include, but are not limited to, PSMA aptamers (McNamara et al., 2006), CTLA4 aptamers (Santulli-Marotto et al., 2003), and 4-1BB aptamers (McNamara et al., 2007).
[0058] As used herein, the term "PCR" stands for polymerase chain reaction and refers to a method widely used in molecular biology to rapidly prepare millions to billions of copies of a specific DNA sample, allowing scientists to use very small DNA samples and amplify them to large enough quantities for careful study.
[0059] The phrase "pharmaceutically acceptable" indicates that a substance or composition is chemically and / or toxicologically compatible with the other ingredients making up the formulation and / or the subject being treated therewith.
[0060] As used herein, the phrase "pharmaceutically acceptable salt" refers to a pharmaceutically acceptable organic or inorganic salt of a compound of the present invention. Exemplary salts include, but are not limited to, sulfates, citrates, acetates, oxalates, chlorides, bromides, iodides, nitrates, bisulfates, phosphates, acid phosphates, isonicotinates, lactates, salicylates, acid citrates, tartrates, oleates, tannates, pantothenates, bitartrates, ascorbates, succinates, maleates, gentisates, fumarates, gluconates, glucuronates, sucrose salts, formates, benzoates, glutamates, methanesulfonates (mesylate), ethanesulfonates, benzenesulfonates, p-toluenesulfonates, pamoates (i.e., 1,1′-methylene-bis-(2-hydroxy-3-naphthoate)), alkali metal (e.g., sodium and potassium) salts, alkaline earth metal (e.g., magnesium) salts, and ammonium salts. A pharmaceutically acceptable salt may involve the inclusion of another molecule such as an acetate ion, a succinate ion, or other counterion. A counterion can be any organic or inorganic moiety that stabilizes the charge on the parent compound. In addition, a pharmaceutically acceptable salt may have more than one charged atom in its structure. In instances where multiple charged atoms are part of a pharmaceutically acceptable salt, the salt may have multiple counterions. Thus, a pharmaceutically acceptable salt may have one or more charged atoms and / or one or more counterions.
[0061] As used herein, a "carrier" comprises a pharmaceutically acceptable carrier, excipient, or stabilizer that is non-toxic to the cells or mammals exposed thereto at the dosages and concentrations employed. Physiologically acceptable carriers are typically aqueous pH buffered solutions. Non-limiting examples of physiologically acceptable carriers include buffers such as phosphate, citrate, and other organic acids; antioxidants including ascorbic acid; low molecular weight (less than about 10 residues) polypeptides; proteins such as serum albumin, gelatin, or immunoglobulins; hydrophilic polymers such as polyvinylpyrrolidone; amino acids such as glycine, glutamine, asparagine, arginine, or lysine; monosaccharides, disaccharides, and other carbohydrates including glucose, mannose, or dextrins; chelating agents such as EDTA; sugar alcohols such as mannitol or sorbitol; salt-forming counterions such as sodium; and / or chelating agents such as TWEEN®. TM , polyethylene glycol (PEG) and PLURONICS TM In certain embodiments, the pharmaceutically acceptable carrier is a non-naturally occurring pharmaceutically acceptable carrier.
[0062] The terms "treat" and "treatment" refer to therapeutic treatments and prophylactic or preventative measures, wherein the goal is to prevent or slow down (mitigate) undesirable physiological changes or conditions, such as the development or spread of cancer. For purposes of the present invention, beneficial or desired clinical outcomes include, but are not limited to, alleviation of symptoms, alleviation of the extent of the disease, a stable state of the disease (i.e., no worsening), a delay or slowing of disease progression, an improvement or slowing down of the disease state, and alleviation (whether partial or overall), whether detectable or undetectable. "Treatment" can also mean that survival is prolonged compared to the expected survival when not receiving treatment. Those in need of treatment include those already suffering from a condition or condition and those susceptible to a condition or condition or those to be prevented.
[0063] The term "administration" or "administering" includes routes of introducing a compound into a subject to perform its intended function. Examples of routes of administration that can be used include injection (including but not limited to subcutaneous, intravenous, parenteral, intraperitoneal, intrathecal), topical, oral, inhalation, rectal, and transdermal.
[0064] The term "effective amount" encompasses an amount effective to achieve the desired result, measured in dosages and for the required period of time. The effective amount of a compound can vary depending on factors such as the disease state, age, and weight of the subject, as well as the ability of the compound to elicit the desired response in the subject. Dosage regimens can be adjusted to provide the optimal therapeutic response.
[0065] As used herein, the phrases "systemic administration" and "administered systemically" and "peripheral administration" and "administered peripherally" mean administering a compound, drug, or other material so that it enters the patient's system and thereby undergoes metabolism and other similar processes.
[0066] The phrase "therapeutically effective amount" refers to an amount of a compound of the invention that (i) treats or prevents a specific disease, condition, or disorder, (ii) alleviates, ameliorates, or eliminates one or more symptoms of a specific disease, condition, or disorder, or (iii) prevents or delays the onset of one or more symptoms of a specific disease, condition, or disorder described herein. In the case of cancer, a therapeutically effective amount of a drug can reduce the number of cancer cells; reduce tumor size; inhibit (i.e., slow down to some extent and preferably stop) cancer cell infiltration into peripheral organs; inhibit (i.e., slow down to some extent and preferably stop) tumor metastasis; inhibit tumor growth to some extent; and / or alleviate one or more of the symptoms associated with cancer to some extent. To the extent that a drug can prevent growth and / or kill existing cancer cells, the drug can be cytostatic and / or cytotoxic. For cancer therapy, efficacy can be measured, for example, by assessing time to disease progression (TTP) and / or determining a response rate (RR).
[0067] The term "subject" refers to an animal such as a mammal, including but not limited to primates (e.g., humans), cows, sheep, goats, horses, dogs, cats, rabbits, rats, mice, etc. In certain embodiments, the subject is a human.
[0068] The present disclosure relates to a fragment-based ligand discovery strategy suitable for identifying small molecules that bind to specific RNA regions with high affinity. In general, fragment-based ligand discovery allows the identification of one or more small molecule "fragments" that bind to a target of interest with low to moderate affinity. These fragments are then refined or conjugated to produce more potent ligands. 13,14 Typically, these fragments exhibit a molecular weight below 300 Da and, in order to bind detectably, must establish substantial high-mass contacts with the target of interest.
[0069] Fragment-based ligand discovery has so far only been successful in identifying initial hit compounds that bind to a single fragment of a given RNA. 15–19 The identification of multiple fragments that bind to the same RNA will allow the exploitation of potential additive and cooperative interactions between fragments within the binding notch. 20,21 However, it has recently been demonstrated that many RNAs bind their ligands through multiple "subsites," which are regions of the binding notch that contact the ligand either independently or cooperatively. 22 Furthermore, we have demonstrated that high-affinity RNA binding can occur even when subsite binding exhibits only modest cooperative effects. These features bode well for the effectiveness of fragment-based ligand discovery applied to RNA targets.
[0070] Thus, based on the above, the present disclosure relates to methods for identifying fragments that bind to an RNA of interest, such as a TPP riboswitch. Second, the disclosed methods relate to establishing the localization of the bound fragments in the RNA at approximately nucleotide resolution. Third, the disclosed methods relate to identifying a second site fragment that binds near the site of the initial fragment hit. The disclosed methods combine a fragment-based ligand discovery approach with SHAPE-MaP RNA structure probing for identifying RNA-binding fragments and establishing individual sites of fragment binding. 23,24 The ligand ultimately generated by joining the two fragments bears no resemblance to natural riboswitch ligands and binds the structurally complex TPP riboswitch RNA with high affinity.
[0071] The disclosed methods and identification of ligands are described in more detail below.
[0072] A. Compounds
[0073] A first aspect of the presently disclosed subject matter is a compound having the structure of Formula (I):
[0074]
[0075] in
[0076] X1, X2 and X3 are independently selected from CR1, CHR1, N, NH, O and S in each instance, wherein adjacent X1, X2 and X3 are not simultaneously selected to be O or S;
[0077] Dashed lines represent optional double bonds;
[0078] Y1, Y2 and Y3 are independently selected from CR2 and N in each instance;
[0079] n is 1 or 2, wherein when n is 1, only one of the dashed lines is a double bond;
[0080] L is selected from
[0081]
[0082] wherein k, p, q, r, and v are independently selected from the integers 0, 1, 2, 3, 4, 5, 6, 7, 8, 9, and 10, and z is selected from the integers 1, 2, 3, 4, and 5; and
[0083] A is selected from
[0084]
[0085] wherein X4, X5, X6 and X7 are independently selected from CR3 and N;
[0086] wherein R1, R2 and R3 are independently selected from -H, -Cl, -Br, -I, -F, -CF3, -OH, -CN, -NO2, -NH2, -NH(C1-C6 alkyl), -N(C1-C6 alkyl), -COOH, -COO(C1-C6 alkyl), -CO(C1-C6 alkyl), -O(C1-C6 alkyl), -OCO(C1-C6 alkyl), -NCO(C1-C6 alkyl), -CONH(C1-C6 alkyl) and substituted or unsubstituted C1-C6 alkyl;
[0087] m is 1 or 2; and
[0088] W is -O or -NR4, wherein R4 is selected from -H, -CO(C1-C6 alkyl), substituted or unsubstituted C1-C6 alkyl, substituted or unsubstituted aryl, substituted or unsubstituted heteroaryl, substituted or unsubstituted cycloalkyl, -CO(aryl), -CO(heteroaryl), and -CO(cycloalkyl);
[0089] Provided that at least two of X1, X2, X3, X4, X5, X6 and X7 are N;
[0090] or a pharmaceutically acceptable salt thereof.
[0091] As in any of the above embodiments, a compound wherein at least one of X1, X2, or X3 is N.
[0092] As in any of the above embodiments, a compound wherein X1 is N.
[0093] As in any of the above embodiments, a compound wherein X2 is N.
[0094] As in any of the above embodiments, a compound wherein X3 is N.
[0095] As in any of the above embodiments, a compound wherein in each instance, two of X1, X2, and X3 are N.
[0096] As in any of the above embodiments, a compound wherein X1 and X3 are N.
[0097] As in any of the above embodiments, a compound wherein at least one of Y1, Y2, and Y3 is N.
[0098] As in any of the above embodiments, a compound wherein Y1 is N.
[0099] As in any of the above embodiments, a compound wherein Y2 is N.
[0100] As in any of the above embodiments, a compound wherein Y3 is N.
[0101] As in any of the above embodiments, a compound wherein at least one of Y1, Y2, and Y3 is CR2.
[0102] As in any of the above embodiments, a compound wherein Y1 is CR2.
[0103] As in any of the above embodiments, a compound wherein Y2 is CR2.
[0104] As in any of the above embodiments, a compound wherein Y3 is CR2.
[0105] As in any of the above embodiments, a compound wherein n is 2.
[0106] As in any of the above embodiments, a compound having the structure of Formula (II):
[0107]
[0108] in
[0109] X 2a and X 2b are independently selected from CR1 and N;
[0110] X1 and X3 are independently selected from CR1 and N;
[0111] L and A are as specified for formula (I); and
[0112] X1, X 2a 、X 2b And two of X3 are N.
[0113] As in any of the above embodiments, a compound having the structure of formula (III):
[0114]
[0115] in
[0116] L and A are as defined for formula (I).
[0117] As in any of the above embodiments, a compound wherein p, q, r, and v are independently selected from the integers 0, 1, 2, and 3.
[0118] As in any of the above embodiments, a compound wherein L is selected from
[0119]
[0120] As in any of the above embodiments, a compound wherein L is
[0121]
[0122] As in any of the above embodiments, a compound wherein q and r are 0 or 1.
[0123] As in any of the above embodiments, a compound wherein q is 1.
[0124] As in any of the above embodiments, a compound wherein r is 1.
[0125] As in any of the above embodiments, a compound wherein r is 0.
[0126] As in any of the above embodiments, a compound wherein q and r are 1.
[0127] As in any of the above embodiments, a compound wherein q is 1 and r is 0.
[0128] As in any of the above embodiments, a compound wherein m is 1.
[0129] As in any of the above embodiments, a compound wherein W is selected from -NH, -O, and -N(C1-C6 alkyl)2.
[0130] As in any of the above embodiments, a compound wherein W is -NH.
[0131] As in any of the above embodiments, a compound wherein at least one of X4, X5, X6, and X7 is N.
[0132] As in any of the above embodiments, a compound wherein X4 is N.
[0133] As in any of the above embodiments, a compound wherein X5 is N.
[0134] As in any of the above embodiments, a compound wherein X6 is N.
[0135] As in any of the above embodiments, a compound wherein X7 is N.
[0136] As in any of the above embodiments, a compound wherein X4 and X6 are N.
[0137] As in any of the above embodiments, a compound wherein X5 and X7 are N.
[0138] As in any of the above embodiments, a compound wherein X5 or X6 is N, and X4 and X7 are both independently CR2.
[0139] As in any of the above embodiments, a compound wherein A is
[0140]
[0141] As in any of the above embodiments, a compound having the structure:
[0142]
[0143] As in any of the above embodiments, a compound wherein L is
[0144]
[0145] As in any of the above embodiments, a compound wherein Y1, Y2, and Y3 are in each instance independently selected from CR2 and N, wherein R1 is selected from -H, -Cl, -Br, -I, -F, -OH, and -NH2.
[0146] As in any of the above embodiments, a compound wherein z is 2.
[0147] As in any of the above embodiments, a compound wherein Y2 is N.
[0148] As in any of the above embodiments, a compound wherein Y2 is CR2 and R1 is selected from -H, -F, -OH, and -NH2.
[0149] As in any of the above embodiments, a compound wherein A is
[0150]
[0151] As in any of the above embodiments, a compound, wherein the compound has the structure:
[0152]
[0153] As in any of the above embodiments, a compound, wherein the compound has the structure:
[0154]
[0155]
[0156] B. Screening Methods
[0157] This disclosure relates to the development and validation of a fragment screening method based on flexible selective 2'-hydroxyl acylation assayed by primer extension (SHAPE). Fragment-based ligand discovery has been demonstrated to be an effective method for identifying compounds that form substantial close contacts with macromolecules, including RNA. 13,14,17The success of this discovery strategy requires adaptive, high-quality biophysical assays for detecting ligand binding. Therefore, in some embodiments, SHAPE RNA structure probing is used to detect ligand binding. 23–25 The SHAPE RNA structure probe measures local nucleotide flexibility as the relative reactivity of the ribose 2'-hydroxyl group to electrophiles. SHAPE can be used against any RNA and provides data on nearly all nucleotides in the RNA in a single experiment, thereby generating per-nucleotide structural information in addition to simply detecting binding, and is described in detail below. In addition, the present disclosure also relates to the application of SHAPE-Mutational Spectrum (MaP) 23,24 , which combines SHAPE with high-throughput sequencing readout, enabling multiplexing of thousands of samples and efficient high-throughput analysis.
[0158] Therefore, in some embodiments, the present disclosure relates to a screening method for using SHAPE and / or SHAPE-MaP to identify small molecule fragments and / or compounds that bind and / or associate with RNA molecules of interest. The method disclosed herein further includes using SHAPE and / or SHAPE-MaP to identify small molecule fragments (e.g., fragment 2) that bind and / or associate with RNA molecules that have been pre-incubated with another small molecule fragment (e.g., fragment 1). Without being bound by theory, it is believed that fragment 1 binds to a first binding site and fragment 2 binds to a second binding site (e.g., subsite) in the same RNA molecule. Therefore, combining the structural features of fragment 1 and fragment 2 (e.g., connecting the two fragments with a linker L) to produce a compound as disclosed herein is believed to cause the connected fragment ligand to exhibit increased RNA binding affinity compared to separate fragment 1 and / or fragment 2.
[0159] The screening methods SHAPE and SHAPE-MaP are described in more detail below.
[0160] I.SHAPE Chemistry
[0161] SHAPE chemistry is based at least in part on the observation that the nucleophilicity of the 2′-position of RNA ribose is sensitive to the electronic influence of the adjacent 3′-phosphodiester group. Compared with base pairing or otherwise constrained nucleotides, unconstrained nucleotides more often adopt a configuration that enhances the nucleophilicity of the 2′-hydroxyl. Therefore, hydroxyl-selective electrophilic reagents such as, but not limited to, N-methylisatoic anhydride (NMIA) form stable 2′-O-adducts with flexible RNA nucleotides more quickly. Local nucleotide flexibility can be queried at all positions in the RNA molecule in a single experiment simultaneously because all RNA nucleotides (except for a few cellular RNAs that carry post-transcriptional modifications) have 2′-hydroxyl. Absolute SHAPE reactivity can be compared in all positions in the RNA because 2′-hydroxyl reactivity is insensitive to base identity. It is also possible that nucleotides may be reactive because the nucleotides are constrained in a configuration that enhances the nucleophilicity of a specific 2′-hydroxyl. Such nucleotides are expected to be rare, will involve atypical local geometric structures, and will be correctly scored according to the unpaired position.
[0162] The presently disclosed subject matter, in some embodiments, provides a method for detecting structural data in RNA molecules by querying structural constraints in RNA molecules of arbitrary length and structural complexity. In some embodiments, the method comprises: annealing an RNA molecule containing a 2'-O-adduct with a (labeled) primer; annealing an RNA molecule that does not contain a 2'-O-adduct with a (labeled) primer as a negative control; extending the primer to generate a library of cDNAs; analyzing the cDNAs; and generating an output file comprising the structural data of the RNA.
[0163] RNA molecules can be present in biological samples. In certain embodiments, RNA molecules can be modified in the presence of proteins or other small and large biological ligands and / or compounds. Primers can optionally be labeled with radioisotopes, fluorescent labels, heavy atoms, enzyme labels, chemiluminescent groups, biotin groups, predetermined polypeptide epitopes identified by secondary reporter genes, or a combination thereof. Analysis can include separation, quantitative, classification, or a combination thereof. Analysis can include extracting fluorescence or dye amount data as a function of elution time data, which are referred to as traces. For example, cDNA can be analyzed in a single column or microfluidic device of a capillary electrophoresis instrument.
[0164] In some embodiments, the peak areas in the traces for the nucleotide sequences of RNA molecules containing 2'-O-adducts and RNA molecules without 2'-O-adducts can be calculated. The traces can be compared and aligned with the sequence of the RNA. It is observed and taken into account that the traces of the cDNAs generated by sequencing are one nucleotide longer than the corresponding positions in the traces for RNA molecules containing 2'-O-adducts and RNA molecules without 2'-O-adducts. The area under each peak can be determined by performing a Gaussian fit integration of the entire trace.
[0165] Thus, in some embodiments, provided herein are methods for forming covalent ribose 2'-O-adducts with RNA molecules in complex biological solutions. In some embodiments, the methods comprise contacting an electrophilic reagent with an RNA molecule, wherein the electrophilic reagent selectively modifies unconstrained nucleotides in the RNA molecule to form covalent ribose 1'-O-adducts.
[0166] In some embodiments, an electrophilic reagent such as, but not limited to, N-methyl isatoic anhydride (NMIA) is dissolved in an anhydrous, polar, aprotic solvent such as DMSO. The reagent-solvent solution is added to a complex biological solution containing an RNA molecule. The solution can contain proteins, cells, viruses, lipids, monosaccharides and polysaccharides, amino acids, nucleotides, DNA, and different salts and metabolites in varying concentrations and quantities. The concentration of the electrophilic reagent can be adjusted to achieve the desired degree of modification in the RNA molecule. The electrophilic reagent has the potential to react with any free hydroxyl groups in the solution, thereby producing ribose 2'-O-adducts on the RNA molecule. Further, the electrophilic reagent can selectively modify unpaired or otherwise unconstrained nucleotides in the RNA molecule.
[0167] RNA molecules can be exposed to electrophiles at concentrations that produce small amounts of RNA modification to form 2′-O-adducts, which can be detected by their ability to inhibit primer extension by reverse transcriptase. All RNA sites can be interrogated in a single experiment because the chemistry targets the universal reactivity of the 2′-hydroxyl group. In some embodiments, control extension reactions that remove the electrophile to assess background and dideoxy sequencing extensions for assigning nucleotide positions can be performed in parallel. These combined steps are referred to as selective 2′-hydroxyl acylation assayed by primer extension, or SHAPE.
[0168] In some embodiments, the method further comprises: contacting an RNA molecule containing a 1′-O-adduct with a (labeled) primer, and contacting an RNA that does not contain a 2′-O-adduct with a (labeled) primer as a negative control; extending the primers to generate a linear array of cDNAs, analyzing the cDNAs, and generating an output file comprising structural data of the RNA.
[0169] The number of nucleotides queried in a single SHAPE experiment depends not only on the detection and resolution of the separation technology used, but also on the nature of the RNA modification. Under given reaction conditions, there is a length in which almost all RNA molecules have at least one modification. When primer extension reaches these lengths, the number of extended cDNAs decreases, which weakens the experimental signal. Adjusting conditions to reduce modification yields can increase read lengths. However, reducing reagent yields can also reduce the measured signal for each cDNA length. In view of these considerations, the preferred maximum length of a single SHAPE read is approximately about 1 kilobase of RNA, but should not be limited thereto.
[0170] II.SHAPE-MaP
[0171] In SHAPE-MaP, SHAPE adducts are detected by mutation profiling (MaP), which exploits the ability of reverse transcriptase to incorporate non-complementary nucleotides or create deletions at the site of the SHAPE chemical adduct. In some embodiments, SHAPE-MaP can be used for library construction and sequencing. In some embodiments, multiplexing techniques can be employed in SHAPE-MaP.
[0172] Typically, RNA is treated with the SHAPE reagents that react at the dynamic nucleotides of the configuration. During reverse transcription, polymerase reads the chemical adducts in the RNA and incorporates nucleotides that are not complementary to the original sequence into the cDNA. Any large-scale parallel method is used to sequence the obtained cDNA to produce a mutation spectrum (MaP). Sequencing reads are compared with the reference sequence and the nucleotide resolution mutation rate is calculated, which is corrected and normalized for background, thereby producing a standard SHAPE reactivity spectrum. SHAPE reactivity can then be used to model the secondary structure, visualize competitive and alternative structures, or quantify any process or function regulating local nucleotide RNA dynamics. After the SHAPE modification of the RNA molecule, reverse transcriptase is used to produce a mutation spectrum. This step encodes the position and relative frequency of the SHAPE adducts as mutations in the cDNA. Using methods known in the art (e.g., PCR reactions), cDNA is converted into dsDNA, and dsDNA is further amplified in the second PCR reaction, thereby adding sequencing for multiplexing. After purification, the size of the sequencing library is uniform and each DNA molecule contains the entire sequence of interest.
[0173] Thus, according to some embodiments of the presently disclosed subject matter, methods for detecting one or more chemical modifications in a nucleic acid are provided. In some embodiments, the methods include: providing a nucleic acid suspected of having a chemical modification; synthesizing the nucleic acid using a polymerase and the provided nucleic acid as a template, wherein the synthesis occurs under conditions in which the polymerase reads the chemical modification of the provided nucleic acid, thereby producing an incorrect nucleotide at the site of the chemical modification in the resulting nucleic acid; and detecting the incorrect nucleotide.
[0174] According to some embodiments of the presently disclosed subject matter, a method for detecting structural data in a nucleic acid is provided. In some embodiments, the method comprises: providing a nucleic acid suspected of having a chemical modification; synthesizing the nucleic acid using a polymerase and the provided nucleic acid as a template, wherein the synthesis occurs under conditions in which the polymerase reads the chemical modification of the provided nucleic acid, thereby generating an incorrect nucleotide at the site of the chemical modification in the resulting nucleic acid; detecting the incorrect nucleotide; and generating an output file comprising the structural data of the provided nucleic acid.
[0175] In some embodiments of the presently disclosed subject matter, the nucleic acid provided is an RNA molecule (e.g., a coding RNA and / or a non-coding RNA molecule). In some embodiments, the method includes detecting two or more chemical modifications. In some embodiments, a polymerase reads multiple chemical modifications to produce multiple incorrect nucleotides and the method includes detecting each incorrect nucleotide.
[0176] In some embodiments, the nucleic acid (e.g., RNA molecule) has been exposed to an agent that provides a chemical modification, or the chemical modification pre-exists in the nucleic acid (e.g., RNA molecule). In some embodiments, the pre-existing modification is a 2'-O-methyl and / or is caused by the cell from which the nucleic acid is derived, such as, but not limited to, an epigenetic modification, and / or the modification is 1-methyladenosine, 3-methylcytosine, 6-methyladenosine, 3-methyluridine, and / or 2-methylguanosine. In some embodiments, nucleic acids such as RNA molecules can be modified in the presence of proteins or other small and large biological ligands and / or compounds.
[0177] In some embodiments, the reagent comprises an electrophilic reagent. In some embodiments, the electrophilic reagent selectively modifies unconstrained nucleotides in the RNA molecule to form covalent ribose 2'-O-adducts. In some embodiments, the reagent is 1M7, 1M6, NMIA, DMS, or a combination thereof. In some embodiments, the nucleic acid is present in or derived from a biological sample.
[0178] In some embodiments, the polymerase is a reverse transcriptase. In some embodiments, the polymerase is a native polymerase or a mutant polymerase. In some embodiments, the synthesized nucleic acid is a cDNA.
[0179] In some embodiments, detecting incorrect nucleotides comprises sequencing the nucleic acid. In some embodiments, the sequence information is compared with the sequence of the provided nucleic acid. In some embodiments, detecting incorrect nucleotides comprises using large-scale parallel sequencing to the nucleic acid. In some embodiments, the method comprises amplifying the nucleic acid. In some embodiments, the method comprises amplifying the nucleic acid by a fixed-point method using specific primers, a full genome using a random primer method, a full transcriptome using a random primer method, or a combination thereof.
[0180] According to some embodiments of the presently disclosed subject matter, there is provided a computer program product comprising computer-executable instructions embodied in a computer-readable medium in the form of execution steps, the execution steps comprising any method steps of any embodiment of the presently disclosed subject matter. According to some embodiments of the presently disclosed subject matter, there is provided a nucleic acid library produced by any method of the presently disclosed subject matter.
[0181] III. SHAPE Electrophiles
[0182] As disclosed above, SHAPE chemistry utilizes the following discovery: the nucleophilic reactivity of ribose 2'-hydroxyl is gated by local nucleotide flexibility. At the nucleotides constrained by base pairing or tertiary interactions, 3'-phosphodiester anions and other interactions reduce the reactivity of 2'-hydroxyl. In contrast, flexible positions preferentially adopt electrophilic reagents including but not limited to NMIA to react to form a 2'-O-adduct configuration. For example, NMIA generally reacts with all four nucleotides and the reagent undergoes parallel, self-inactivation, hydrolysis reaction. In fact, the currently disclosed subject matter provides any molecule that can be used to react with nucleic acids as disclosed herein according to some embodiments of the currently disclosed subject matter. In certain embodiments, electrophilic reagents (also referred to as SHAPE reagents) can be selected from but not limited to isatoic anhydride derivatives, benzoyl cyanide derivatives, benzoyl chloride derivatives, phthalic anhydride derivatives, benzyl isocyanate derivatives and combinations thereof. Isatoic anhydride derivatives can include 1-methyl-7-nitroisatoic anhydride (1M7). Benzoyl cyanide derivatives can be selected from the group including but not limited to: benzoyl cyanide (BC), 3-carboxybenzoyl cyanide (3-CBC), 4-carboxybenzoyl cyanide (4-CBC), 3-aminomethylbenzoyl cyanide (3-AMBC), 4-aminomethylbenzoyl cyanide and combinations thereof. Benzoyl chloride derivatives can include benzoyl chloride (BCl). Phthalic anhydride derivatives can include 4-nitrophthalic anhydride (4NPA). Benzyl isocyanate derivatives can include benzyl isocyanate (BIC).
[0183] IV. RNA Molecular Design
[0184] Because SHAPE reactivity can be assessed in one or more primer extension reactions, information may be lost at the 5' end of the RNA molecule and near the primer binding site. Typically, adduct formation at 10-20 nucleotides adjacent to the primer binding site is difficult to quantify due to the presence of cDNA fragments reflecting pauses or non-modular extension by reverse transcriptase (RT) during the initiation phase of primer extension. 8-10 positions at the 5' end of the RNA can be difficult to visualize due to the abundance of full-length extension products.
[0185] In order to monitor the SHAPE reactivity at the 5' and 3' ends of the sequence of interest, the RNA molecule can be embedded in a large fragment of the native sequence or placed between strongly folded RNA sequences containing unique primer binding sites. In certain embodiments, the structural box can be designed to contain 5' and 3' flanking sequences of nucleotides to allow all positions in the RNA molecule of interest to be evaluated in any separation technology that provides nucleotide resolution, such as but not limited to sequencing gels, capillary electrophoresis, etc. In certain embodiments, both 5' and 3' extensions can be folded into a stable hairpin structure that does not interfere with the folding of various internal RNAs. The primer binding site of the box can effectively bind to a cDNA primer. The sequence of any 5' and 3' structural box elements can be checked to ensure that the elements are not prone to forming stable base pairing reactions with internal sequences.
[0186] In some embodiments, the RNA molecule of interest includes two different target motifs connected to a nucleotide linker. The target motif can be any nucleotide sequence of interest. Exemplary target motifs include, but are not limited to, structured regions, multi-helical knots, pseudoknots, and / or aptamers in riboswitches, viral regulatory elements, and mRNAs. In some embodiments, the first target motif is a pseudoknot, such as a pseudoknot from the 5'UTR of the dengue virus genome. In some embodiments, the second target motif is an aptamer domain, such as a TPP riboswitch aptamer domain. For nucleotide linkers, the number of nucleotides can vary. For example, in some embodiments, the number of nucleotides in the linker is in the range of about 1 to about 20 nucleotides, about 1 to about 15 nucleotides, about 1 to about 10 nucleotides, or about 5 to about 10 nucleotides (or about 1, 2, 3, 4, 5, 6, 7, 8, 9, 10 nucleotides).
[0187] In certain embodiments, the RNA molecule further includes an RNA barcode region. The RNA barcode region is a unique barcode that allows identification of a specific RNA molecule in a mixture of RNA molecules (e.g., during multiplexing). The position of the RNA barcode region can vary, but is typically found adjacent to one of the boxes present in the RNA molecule. In certain embodiments, the RNA barcode is designed to fold into an independent structure that does not interact with any other part of the RNA molecule. The structure of the RNA barcode region can vary. In certain embodiments, the structure of the RNA barcode region includes a base pair helix, which includes about 1 to about 10 base pairs (or about 1, 2, 3, 4, 5, 6, 7, 8, 9 or 10 base pairs). In certain embodiments, the RNA barcode region includes 7 base pairs. In certain embodiments, the base pair is capped with four rings anchored to the terminal base pairs of the base pair helix. The capping of the base pair helix maintains the overall hairpin stability of the RNA barcode region. In certain embodiments, the four rings include the nucleotide sequence GNRA, but are not intended to be limited thereto. In some embodiments, RNA barcode regions are designed such that any individual barcode undergoes at least two mutations to be misinterpreted as another barcode.
[0188] V. Folding of RNA molecules
[0189] The subject matter disclosed herein can be performed with RNA molecules generated by methods including but not limited to in vitro transcription and RNA molecules generated in cells and viruses. In certain embodiments, RNA molecules can be purified and renatured to realize biologically relevant configurations by denaturing gel electrophoresis. Further, any program of folding RNA molecules to desired configurations under desired pH (e.g., about pH 8) can be replaced. RNA molecules can first be heated and rapidly cooled to eliminate polymeric forms in low ionic strength buffers. Folding solutions can then be added to enable RNA molecules to realize appropriate configurations and to prepare them for structural sensitivity detection with electrophilic reagents. In certain embodiments, RNA can be folded in a single reaction and then separated into (+) and (-) electrophilic reagent reactions. In certain embodiments, RNA molecules are not naturally folded before modification. Modification can be carried out when RNA molecules are denatured by heat and / or low salt conditions.
[0190] VI. RNA Molecular Modification
[0191] Electrophilic reagents can be added to RNA to produce 2'-O-adducts at flexible nucleotide positions. The reaction can then be incubated until almost all of the electrophilic reagent has reacted with the RNA or has been degraded due to hydrolysis with water. No specific quenching step is required. Modification can be carried out in the presence of complex ligands and biomolecules and in the presence of various salts. RNA can also be modified in cells and viruses. These salts and complex ligands can include salts of magnesium, sodium, manganese, iron and / or cobalt. Complex ligands can include but are not limited to proteins, lipids, other RNA molecules, DNA or small organic molecules. In some embodiments, the complex ligand is a small molecule fragment as disclosed herein. In some embodiments, the complex ligand is a compound as disclosed herein. The modified RNA can be purified from the reaction products and buffer components that may be harmful to the primer extension reaction by, for example, ethanol precipitation.
[0192] VII. Primer Extension and Polymerization
[0193] Analysis of RNA adducts by primer extension according to the presently disclosed subject matter can, in various embodiments, comprise the use of optimized primer binding sites, a thermostable reverse transcriptase, a low MgCl concentration, an elevated temperature, a shorter extension time, and combinations of any of the foregoing. Intact, undegraded RNA free of reaction byproducts and other small molecule contaminants can also be used as a template for reverse transcription. The RNA component of the resulting RNA-cDNA hybrid can be degraded by treatment with alkali. The cDNA fragments can then be resolved using, for example, polyacrylamide sequencing gels, capillary electrophoresis, or other separation techniques that will be apparent to one of ordinary skill in the art upon review of this disclosure.
[0194] Deoxyribonucleotide triphosphates dATP, dCTP, dGTP and dTTP and / or deoxyribonucleotide triphosphates (dNTP) can be added to the synthesis mixture individually or together with primers in sufficient amounts, and the resulting solution can be heated to approximately 50-100°C for approximately 1 to 10 minutes. After the heating period, the solution can be cooled. In certain embodiments, the appropriate medicament for causing the primer extension reaction can be added to the cooling mixture, and the reaction is carried out under conditions known in the art. In certain embodiments, in the case of heat-stabilized, the medicament for polymerization can be added together with other reagents. In certain embodiments, synthesis (or amplification) reaction can be carried out at room temperature. In certain embodiments, synthesis (or amplification) reaction can be carried out at a certain temperature at most, and the medicament for polymerization no longer works above the temperature.
[0195] The medicament for polymerization can be any compound or system for completing the synthesis of the primer extension product comprising, for example, an enzyme. Suitable enzymes for this purpose include, but are not limited to, Klenow fragment (Klenow fragment), polymerase mutants, reverse transcriptase and other enzymes of Escherichia coli (E.coli) DNA polymerase I, E. coli DNA polymerase, other enzymes comprising thermostable enzymes (i.e., those enzymes that carry out primer extension after being subjected to a temperature that is high enough to cause denaturation), such as mouse or bird reverse transcriptase. Suitable enzymes can promote nucleotides to be combined in an appropriate manner to form primer extension products that are complementary to each polymorphic locus nucleic acid chain. In certain embodiments, synthesis can begin at the 5' end of each primer and proceed on the 3' direction, until synthesis terminates at the end of template by being incorporated to dideoxynucleotide triphosphates or terminates at 2'-O-adducts, thereby producing molecules of varying lengths.
[0196] The newly synthesized strand and its complementary nucleic acid strand can form a double-stranded molecule under hybridization conditions described herein, and this hybrid can be used in subsequent steps, such as the methods disclosed in U.S. Patent No. 10,240,188 and U.S. Patent No. 8,318,424, which are incorporated herein by reference in their entirety. In some embodiments, the newly synthesized double-stranded molecule can also be subjected to denaturing conditions to provide a single-stranded molecule using any procedure known in the art.
[0197] VII. Raw Data Processing
[0198] This paper can use computer program product to implement for the theme described for nucleic acid such as RNA molecule, chemical modification analysis and / or nucleic acid structure analysis, and described computer program product comprises the computer executable instruction embodied in computer-readable medium.The exemplary computer-readable medium that is suitable for implementing theme as herein described comprises chip memory device, disk memory device, programmable logic device and application specific integrated circuit.In addition, the computer program product that implements theme as herein described can be positioned at single device or computing platform or can distribute across multiple devices or computing platform.Therefore, theme described herein can comprise computer instruction set, and described computer instruction set performs the specific function for nucleic acid when being executed by computer, such as RNA structure analysis.
[0199] Taking into account the above-mentioned items I-VII, a modular RNA screening construct was designed to implement SHAPE as a high-throughput assay for ligand binding readout ( Figure 1 , top). The construct was designed to contain two target motifs, such as a pseudoknot from the 5'UTR of the dengue virus genome, which, when disrupted, reduces viral fitness. 26 ; and TPP riboswitch aptamer domain 27–29The inclusion of two different structural motifs in a single construct allows each motif to serve as an internal specificity control for the other. Fragments that bind to both RNA structures can be easily identified as nonspecific binders. The two structures are connected by a hexanucleotide linker, designed to be single-stranded, to keep the two RNA structures structurally independent. The structural core of the construct is flanked by structural cassettes. 25 These stem-loop forming regions serve as primer binding sites for the required steps in the screening workflow and are designed not to interact with other structures in the construct ( Figure 7A 、 Figure 7B ).
[0200] Another component of the screening construct is the RNA barcode; barcoding enables multiplexing, which significantly reduces downstream workload. Each well in the 96-well plate used to screen the fragment library contains RNA with a unique barcode in the context of an otherwise identical construct; the barcode sequence thus identifies the well position and the fragment (or fragments) present after multiplexing. Figure 1 The RNA barcode region was designed as an independent structure that does not interact with any other part of the construct. The barcode structure is a seven-base pair helix capped with a GNRA tetraloop and anchored with GC base pairs to maintain hairpin stability ( Figure 7A 、 Figure 7B ). Each set of 96 barcodes was designed so that any individual barcode undergoes two or more mutations to be misinterpreted as another barcode.
[0201] This structure provides flexibility in selecting RNA structures for ligand binding screening and supports simple, straightforward screening experiments ( Figure 1 ). Each well in a 96-well plate containing otherwise identical RNA constructs with unique RNA barcodes is incubated with one or several small molecule fragments or a no-fragment control (solvent) and then exposed to SHAPE reagent. The resulting SHAPE adducts chemically encode per-nucleotide structural information. After SHAPE probing, the information required to determine fragment identity (RNA barcode) and fragment binding (SHAPE adduct pattern) is permanently encoded into each RNA strand, so RNA from all 96 wells of the plate can be pooled into a single sample. Fragment screening experiments are handled very similarly to the standard MaP structure probing workflow 24 For example, in some embodiments, a specialized relaxed-fidelity reverse transcription reaction is used to prepare cDNA containing non-template coding sequence changes at the position of any SHAPE adduct on the RNA. 30 These cDNAs are then used to prepare DNA libraries for high-throughput sequencing. Multiple plates of an experiment can be barcoded at the DNA library level. 24, to collect data on thousands of compounds in a single sequencing run ( Figure 1 The resulting sequencing data contains millions of individual reads, each corresponding to a specific RNA strand. These reads are sorted by barcode to allow analysis of the data for each small molecule fragment or combination of fragments. The determination and identification of small molecule fragments (e.g., Fragment 1 and / or Fragment 2) using methods such as SHAPE and / or SHAPE-MaP described above will be described in more detail in the next section.
[0202] C. Ligand Identification and Selection
[0203] As mentioned above, SHAPE and SHAPE-MaP are used to identify small molecule fragments that bind or associate with RNA molecules of interest. Specifically, when testing small molecule fragments using SHAPE-Map, detecting binding fragment characteristics based on the per-nucleotide SHAPE-MaP mutation rate involves multiple steps to normalize the data and ensure statistical rigor on large experimental screens. Key features of the SHAPE-based hit analysis strategy include: (i) comparison of each fragment-exposed RNA or "experimental sample" with five negative, non-fragment-exposed control samples to account for plate-to-plate and well-to-well variability; (ii) separate hit detection for each of the two structural motifs in the construct (in this disclosure, the pseudoknot and the TPP riboswitch); (iii) masking of individual nucleotides with low reactivity across all samples because these nucleotides are less likely to show fragment-induced changes; and (iv) calculation of the difference in per-nucleotide mutation rate between the fragment-exposed experimental samples and the non-fragment-exposed negative control samples. Nucleotides with a mutation rate difference of 20% or greater between one of the motifs and the non-fragment-exposed control were selected for Z-score analysis. However, the skilled artisan will be able to adjust for the difference in mutation rates accordingly, recognizing that mutation rates can vary. For example, in some embodiments, the difference in mutation rates can be 25%, 30%, 35%, 45%, or 50% or more. In some embodiments, the difference in mutation rates can be 15%, 10%, or 5% or more. If the Z-score of three or more nucleotides in one of the two motifs is greater than 2.7 (as determined by comparing the Poisson counts of the two motifs), the difference in mutation rates can be adjusted accordingly. 31, see Example 2), then the fragment is determined to have a significantly altered SHAPE reactivity pattern. However, the Z-value can be different, and the skilled person will be able to adjust it accordingly. For example, in some embodiments, the Z-value is greater than 2.8, 2.9, 3.0, 3.1, 3.2, 3.3, 3.4, 3.5, 3.6, 3.7, 3.8, or 3.9. In some embodiments, the Z-value is greater than 1.0, 1.1, 1.2, 1.3, 1.4, 1.5, 1.6, 1.7, 1.8, 1.9, 2.0, 2.1, 2.2, 2.3, 2.4, 2.5, or 2.6.
[0204] In order to identify the small molecule fragments that are subsequently connected together to produce compounds disclosed herein with SHAPE and / or SHAPE-MaP, a series of steps are performed. First, primary screening is performed, and the primary screening screens a large number of compounds, for example, at least 100 compounds, to identify any initial leader or hit compound that shows suitable binding activity to the target RNA molecule. In step 2, these hit compounds are then further examined in structure-activity relationship (SAR) research, where the change in target RNA binding affinity is determined as the structure of the hit compound is modified. When multiple small molecule fragments are identified as suitable binding partners for target RNA molecules, additional binding studies can be performed to further study the binding site (i.e., step 3) of each small molecule fragment. For example, in some embodiments, target RNA can be pre-incubated with the first fragment (identified as target RNA binding partners according to the SAR research in step 2), and then target RNA is exposed to the second fragment (also identified as RNA binding partners in the SAR research in step 2) to identify whether the second fragment can be combined with target RNA when the first fragment has been combined. Once the second fragment has been identified as having suitable binding activity with the RNA of interest, the second fragment can be connected to the first fragment using a linker to produce a compound disclosed herein (ie, step 4). Each of the above-mentioned steps is described in more detail below.
[0205] Step 1: Primary Screening
[0206] In the primary screen, 1,500 fragments were tested and 41 fragments were detected as hits, with an initial hit rate of 2.7%. Hit validation was performed by triplicate SHAPE analysis ( Figure 2 、 Figure 8), and only if a compound was detected as a binder in all three replicates was it accepted as a true hit. These replicate hit compounds were then analyzed by isothermal titration calorimetry (ITC) to determine their binding affinity to RNA corresponding only to the target motif (omitting the flanking sequences in the screening construct). Of these initial hits, eight hits were validated by replicate analysis and ITC (Table 1). Seven of the hits bound to the TPP riboswitch based on mutational signatures that were mostly or entirely located within the TPP riboswitch region of the test construct. The remaining hits were nonspecific because the fragment affected nucleotides in all parts of the RNA construct. No compounds were detected that specifically bound to the dengue pseudoknot region of the test construct.
[0207] Table 1: Fragments binding to TPP riboswitches as detected by SHAPE probing.
[0208]
[0209] Hits were detected by SHAPE structure probing and validated by replicate analysis and ITC. Dissociation constants were determined by ITC; The error values represent the standard error derived from ≥3 replicates, and other error estimates are calculated based on 95% confidence intervals from least squares regression of the binding curves. The native TPP ligand was included for comparison.
[0210] The seven fragments that were validated by ITC to bind to the TPP riboswitch had different chemotypes; most showed little resemblance to the natural TPP ligand (Table 1). Overall, heteroaromatic nitrogen-containing rings predominated; these are likely involved in hydrogen bonding interactions. Three compounds had pyridine rings and two had pyrazine rings. An azole ring moiety was present in three compounds: two thiadiazoles and one imidazole. Thiazole rings are present in the natural TPP ligand, but this moiety is not involved in binding interactions with RNA. 28 ,29 ,33 In addition, many of the identified fragments contain primary amine, ester, and ether, as well as fluorine groups that can serve as hydrogen bond acceptors or donors.
[0211] Step 2: Structure-activity relationship (SAR) of the riboswitch binding fragment
[0212] Next, some of the initial hit analogs were checked, with the aim of increasing binding affinity and identifying fragment hits that can be modified with a linker without hindering the position of binding. Specifically, analogs of compounds 2 and 5 were considered, because these two fragments are structurally different and analogs are commercially available. By ITC, analog-RNA binding was assessed. Sixteen analogs of 2 were tested. The core quinoxaline structure of 2 was changed by removing one or two ring nitrogens to cause a change in binding activity (Table 2A).
[0213] Table 2A: SAR of Fragment 2 analogs.
[0214]
[0215]
[0216] Modifications to the quinoxaline core were examined and dissociation constants were obtained by ITC.
[0217] The improvement in binding affinity is due to the introduction of hydrogen bond donors or acceptors connected by methylene groups (Table 2B, compounds 16 and 17). Substituent changes at other positions on the quinoxaline ring core cause a decrease in binding activity. Compound 2 is a good candidate for further development based on high flexibility, and after the substituent at the C-6 position is modified, it is even observed that the binding is improved.
[0218] Table 2B: Structure-activity relationships of analogs of fragment 2 that bind to TPP riboswitch RNA. Modifications to side groups of the quinoxaline core. Dissociation constants obtained by ITC.
[0219]
[0220]
[0221] Next, examination of 18 analogs of fragment 5 indicated that the core pyridine functionality of the molecule appeared to be important for binding, as changing the position, adding, or removing ring nitrogens reduced or abolished binding (Table 3).
[0222] Table 3: Structure-activity relationships of analogs of fragment 5 that bind to TPP riboswitch RNA. Modifications to the pyridine core and dissociation constants were obtained by ITC.
[0223]
[0224]
[0225] Modifications to the ring substituents generally resulted in a significant loss of binding activity (Table 4). The only analog that increased affinity, S12, featured a chlorine at the C-4 position, resulting in a compound with approximately threefold higher affinity for the TPP riboswitch than fragment 5.
[0226] Table 4: Structure-activity relationships of analogs of fragment 5 that bind to TPP riboswitch RNA. Modifications to side groups of the pyridine core. Dissociation constants obtained by ITC.
[0227]
[0228]
[0229] Step 3: Identify fragments that bind to the second site on the TPP riboswitch
[0230] A second round of screening was performed to identify fragments that bind to the TPP riboswitch region of screening constructs pre-bound to compounds 2 or S12. This screen identified fragments that preferentially interacted with the TPP riboswitch when 2 or S12 was already bound, either due to synergistic effects or due to structural changes that occur upon primary ligand binding, making new binding modes available (Figure 3). Of the 1,500 fragments screened, five were verified to bind simultaneously to either 2 or S12 (Table 5).
[0231] Table 5: Fragments binding to TPP riboswitch in the presence of pre-bound fragment partners as detected by SHAPE. Hits were validated by repeating SHAPE analysis. Primary binding partners (2, 6) are shown in Table 1.
[0232]
[0233] A second screen hit, 29, induced a very strong change in the SHAPE reactivity signal and appeared to cause a significant change in RNA structure, including the unfolding of the P1 helix. This fragment caused changes in other regions of the RNA consistent with nonspecific interactions, and therefore this fragment was not further considered as a candidate for fragment ligation. Fragment 28 was insoluble at the concentrations required for ITC analysis; therefore, related analogs containing a pyridine rather than a quinoline ring were examined by ITC (Table 6). These compounds bound with weak affinity, however, 31 and 32 showed significant but modest binding cooperativity with 2.
[0234] Table 6: Structure-activity relationships of analogs of Fragment 28 binding to TPP riboswitch RNA in the presence and absence of pre-bound Fragment 2.*
[0235]
[0236]
[0237] *und (undetermined): due to inability to fit the ITC binding curve; insoluble: the compound is insoluble at the concentration required for ITC.
[0238] Table 7: Detailed comparison of representative protein and RNA fragment-linker-fragment ligands developed by fragment-based approaches. RNA examples are highlighted with asterisks. Each entry details the two component fragments and their individual K values. d Values, connected compounds and their corresponding K d values, as well as the ligand efficiency (LE) and connection coefficient (E) of the connected compounds 22,38,53,54,45–52 .
[0239]
[0240]
[0241] Step 4: Cooperativity and fragment ligation
[0242] The cooperative binding interaction between 2 and 31 was quantified by ITC. Individually, 2 d binds, and 31 has a much higher K of 10 mM d As in the secondary screen, the affinity of fragment 31 was also examined when 2 was pre-bound to the TPP riboswitch RNA, thereby forming a 2-RNA complex. Under these conditions, fragment 31 binds with a K of approximately 3 mM. d Binds to 2-TPP RNA complex ( Figure 4A 、 Figure 4B This experiment also showed that when binding of 2 reached saturation, 31 bound to the TPP RNA, suggesting that the two fragments do not bind at the same location. Because 2 and 31 each bind to different regions of the TPP RNA with excellent and reasonable affinities, the two fragments associate with the target, generating high-affinity ligands.
[0243] Based on the SAR analysis of fragment hits 2 (Table 2B) and 28 (Table 4), the most promising SAR fragment linker analogs were prepared, focusing on the aminomethyl position of 17 and two sites in the pyridine ring of fragment 31 ( Figure 5 First, the affinity of the fragments conjugated with amide or amine linkers was compared. The compound with a flexible amine linker (compound 36) had a higher binding affinity than the amide-linked version (compound 35, Figure 5 ) with a five-fold higher binding affinity. These linkages were introduced in the context of hydroxamic acids, which can chelate magnesium ions. 35 , as occurs in the case of the pyrophosphate moiety with the natural TPP ligand 27,28 . However, amine-linked hydroxamic acid compound 36 bound with an affinity similar to that of the parent fragment 17, suggesting that the hydroxamic acid moiety does not confer additional binding affinity by chelating ions. Linked compound 37 bound with 625 nM affinity, indicating that linking two modest affinity fragments can achieve high nanomolar binders given the correct approximation. Replacing the fragment 31 entity with a tertiary amine (compound 38) reduced affinity relative to compound 37, suggesting that the interaction of fragment 31 with RNA is not solely mediated by charge-based effects. Finally, altering the linkage between the 17 and 31 moieties by length (compound 39) or site of pyridine ring attachment (compound 40) reduced affinity relative to compound 37 ( Figure 5 Finally, by linking compounds that individually bound to the TPP riboswitch with affinities of 5.0 μM (compound 19) and ≥10 mM (compound 31), a riboswitch with a K of 625 nM was generated. d Compounds that bind to RNA (37).
[0244] The skilled artisan will appreciate that steps I-IV above are not meant to be limiting, but rather serve merely as exemplary embodiments. It will be readily appreciated that the skilled artisan will be able to apply steps I-IV above to identify alternative fragments that can be linked together to generate the compounds disclosed herein with suitable binding affinity for TPP riboswitches. Further, it will be readily appreciated that the skilled artisan will be able to apply steps I-IV above to identify fragments that can be linked together to generate the compounds disclosed herein that bind to other RNA molecules of interest.
[0245] D. Summary and Additional Considerations
[0246] Since both coding (mRNA) and noncoding RNA can potentially be manipulated to alter cellular regulation and disease processes, an efficient strategy to identify small molecule ligands of structured RNA has been sought. The studies disclosed herein demonstrate the promise of using SHAPE screening readouts fused to a fragment-based strategy to detect ligands bound to RNA. Here, this strategy was used to generate a 5-mer ligand with a K of 625 nM. d Ligands that are structurally unrelated to the natural ligand bind to the TPP riboswitch. The combined SHAPE and fragment-based screening approach is universal in terms of the RNA structures that can be targeted and the ligand chemotypes that can be developed. The described strategy is particularly well-suited for finding ligands for RNAs with complex structures, which may be crucial for identifying RNA motifs that bind within three-dimensional notches. 4 Furthermore, due to the use of the MaP approach and multiplexing via RNA and DNA barcoding, the workload required to screen libraries of more than a thousand members is modest, enabling efficient screening of many structurally diverse targets.
[0247] Many of the ligands obtained were similar to those previously reported for a single round of screening also performed against the TPP riboswitch. 15,17. The hits in the primary screen appeared to be modestly biased towards higher affinities, with the majority of ligands detected by SHAPE binding at 10-300 μM. The hit detection assay used may be biased towards detecting the tightest fragment binders and those that induce the most significant changes in SHAPE reactivity. Lower affinity fragments may be missed. It is believed that this bias towards tightly binding fragments is an advantage overall. No fragments were identified that bound to the dengue pseudoknot with the affinity and specificity required to meet the above screening criteria. The dengue pseudoknot RNA is highly structured, and the likelihood that a fragment can perturb this structure may be low. Another possibility is that this particular pseudoknot structure may not contain a ligandable notch.
[0248] A fragment pair identification strategy in which fragment hits from the primary screen are pre-bound to RNA and screened against additional fragment binding partners specifically exploits the per-nucleotide information available through SHAPE and was successfully used here to discover induced-fit fragment pairs ( Figure 4A 、 Figure 4B A core principle of fragment-based ligand development is that cooperativity between two fragments can be achieved through proximal binding and that this additive binding can be exploited by linking the cooperating fragments together with minimally invasive covalent linkers. 20 ,21,36 ,37 . The linked compound 37, developed from primary and secondary fragment hits, demonstrates that fragment-based ligand discovery can be efficiently applied to RNA targets. There was modest cooperativity between 2 and 31: binding of compound 31 was enhanced 3- to 10-fold when 2 was pre-bound to RNA. Moderate additivity in their binding energies was observed upon linking the two fragments: 37 had an affinity of 625 nM. No superadditive effect was observed from linking fragments 2 and 31. 36 , which may be because perfect positioning of the fragments is not achieved. Small changes in the length or geometry of the linker lead to large changes in the affinity of the attached ligand ( Figure 5 ), which means that the precise orientation of the linker is very important for optimally orienting the two fragments. The successful development of compound 37 reveals that it is not necessary to achieve perfection in the degree of cooperativity between the fragments or the construction of the covalent linker connecting them to efficiently develop submicromolar ligands.
[0249] While there have been numerous efforts aimed at exploiting the cooperativity between fragments to obtain tight-binding ligands for targeting proteins, targeting RNA is still in its infancy. We explored the extent to which the disclosed SHAPE-based screening strategy correlates with the ligation of fragments compared to previous (protein-focused) efforts. We ranked compounds previously discovered using fragment-based strategies according to the ligation coefficient (E), which is a measure of how well the entire system works together when ligated. 21,38 ( Figure 6 ; detailed in Table 7). In the absence of positive or negative influencing factors, the binding energies of the two fragments are exactly additive, the linker is inert, and E equals 1.0. Synergistic effects, or favorable linker interactions, reduce E, and anti-synergistic effects, or negative linker interactions, increase E. Crucially, E values in protein systems can vary by orders of magnitude. The linking coefficient for 37 is 2.5, which is slightly higher than the average for linker (protein-targeting) ligands in the academic literature. The ligand efficiency (LE) of 37, which is the free energy of binding divided by the number of non-hydrogen atoms, compares favorably to examples of linker fragment ligands targeting proteins ( Figure 6 By these metrics, 37 performs almost as well as TPPc, a ligand closely related to the natural TPP riboswitch ligand. 22 Therefore, fragment-based ligand discovery, especially when efficiently implemented via SHAPE-enabled multiplexed screening, holds great promise for enabling the rapid development of unique ligands targeting diverse RNA structures.
[0250] E. Preparation Method
[0251] The present disclosure also relates to any method for preparing the compounds disclosed herein. A skilled artisan will appreciate that such methods of preparation may vary. For example, in some embodiments, the method for preparing the disclosed compounds comprises:
[0252] The fragment of formula IV is:
[0253]
[0254] in
[0255] X1, X2 and X3 are independently selected from CHR1, CR1 and heteroatoms N, NH, O and S, wherein adjacent X1, X2 and X3 are not selected as O or S at the same time;
[0256] Dashed lines represent optional double bonds;
[0257] Y1, Y2 and Y3 are independently selected from CR2 and N;
[0258] R1 and R2 are independently selected from -H, -Cl, -Br, -I, -F, -CF3, -OH, -CN, -NO2, -NH2, -NH(C1-C6 alkyl), -N(C1-C6 alkyl), -COOH, -COO(C1-C6 alkyl), -CO(C1-C6 alkyl), -O(C1-C6 alkyl), -OCO(C1-C6 alkyl), -NCO(C1-C6 alkyl), -CONHC1-C6(alkyl), and substituted or unsubstituted C1-C6 alkyl; and
[0259] n is selected from the integers 1 and 2, wherein when n is 1, only one of the dashed lines is a double bond;
[0260] With a fragment of formula V-1 or V-2:
[0261]
[0262] wherein X is a halogen selected from F, Br, Cl and I;
[0263] X4, X5, X6 and X7 are independently selected from CR3 and N;
[0264] R3 is selected from -H, -Cl, -Br, -I, -F, -CF3, -OH, -CN, -NO2, -NH2, -NH(C1-C6 alkyl), -N(C1-C6 alkyl)2, -COOH, -COO(C1-C6 alkyl), -CO(C1-C6 alkyl), -O(C1-C6 alkyl), -OCO(C1-C6 alkyl), -NCO(C1-C6 alkyl), -CONHC1-C6(alkyl), and substituted or unsubstituted C1-C6 alkyl;
[0265] m is 1 or 2; and
[0266] W is -O or -NR4, wherein R4 is selected from -CO(C1-C6 alkyl), substituted or unsubstituted C1-C6 alkyl, substituted or unsubstituted aryl, substituted or unsubstituted heteroaryl, substituted or unsubstituted cycloalkyl, -CO(aryl), -CO(heteroaryl) and -CO(cycloalkyl),
[0267] The contacting is carried out in the presence of a Pd catalyst.
[0268] In some embodiments, the Pd catalyst is selected from (DPPF)PdCl2, Pd2(dba)3, PdCl2[P(o-tolyl)3]2, Pd(dba)2 and Pd(OAc)2. In some embodiments, the contacting step further comprises a phosphine ligand. In some embodiments, the phosphine ligand is monodentate. In some embodiments, the phosphine ligand is bidentate. Exemplary phosphine ligands include, but are not limited to DPPF, BINAP and rac-BINAP. In some embodiments, the contacting step further comprises a base. In some embodiments, the base is inorganic. In some embodiments, the base is NaOtBu. In some embodiments, the contacting step is carried out neat (i.e., in the absence of a solvent). In some embodiments, the contacting step is carried out in the presence of a solvent. In some embodiments, the solvent is a non-polar solvent. Exemplary solvents include, but are not limited to, toluene, benzene, dioxane and tetrahydrofuran. In some embodiments, the contacting step is carried out at an elevated temperature. In some embodiments, the contacting step is performed at 50°C, 55°C, 60°C, 65°C, 70°C, 75°C, 80°C, 85°C, 90°C, 95°C, 100°C, 105°C, or 100°C.
[0269] In some embodiments, the method for preparing the disclosed compounds comprises:
[0270] The fragment of formula IV is:
[0271]
[0272] With a fragment of formula VI-1 or VI-2:
[0273]
[0274] wherein X1, X2, X3, X4, X5, X6, X7, Y1, Y2, Y3, n, m and W are as defined above,
[0275] contacting in the presence of a reducing agent.
[0276] In some embodiments, the reducing agent can be any reducing agent suitable for reductive amination chemistry. Exemplary reducing agents include, but are not limited to, borohydrides and / or aluminum hydrides. In some embodiments, the reducing agent is a borohydride. In some embodiments, the reducing agent is sodium borohydride. In some embodiments, the contacting step is performed neat. In some embodiments, the contacting step is performed in a solvent. Exemplary solvents include, but are not limited to, alcoholic solvents (e.g., methanol, ethanol, isopropanol), chlorinated solvents (e.g., dichloromethane), and / or ethereal solvents (e.g., tetrahydrofuran). In some embodiments, the contacting step is performed below room temperature. In some embodiments, the contacting step is performed at an elevated temperature.
[0277] In some embodiments, the method for preparing the disclosed compounds comprises:
[0278] The fragment of formula IV is:
[0279]
[0280] With a fragment of formula VII-1 or VII-2:
[0281]
[0282] wherein X1, X2, X3, X4, X5, X6, X7, Y1, Y2, Y3, n, m and W are as defined above; and
[0283] G is -F, -Cl, -Br, -OH, -OCH3 or -OCH2CH3;
[0284] The contacting is carried out in the presence of a base.
[0285] In some embodiments, the base is organic (pyridine and / or trimethylamine). In some embodiments, the base is inorganic (e.g., potassium carbonate / sodium carbonate and / or potassium bicarbonate / sodium bicarbonate). In some embodiments, the method further comprises a coupling agent such as DCC and / or EDCI, but is not limited thereto. In some embodiments, the contacting step is performed neat. In some embodiments, the contacting step is performed in the presence of a solvent. Exemplary solvents include but are not limited to THF, DCM, ACN and / or DMSO. In some embodiments, the contacting step is performed at room temperature. In some embodiments, the contacting step is performed at an elevated temperature.
[0286] F. Composition
[0287] The presently disclosed compounds can be formulated into pharmaceutical compositions together with pharmaceutically acceptable carriers.
[0288] The compounds disclosed herein can be formulated as pharmaceutical compositions according to standard pharmaceutical practice.According to this aspect, there is provided a pharmaceutical composition comprising a compound disclosed herein in association with a pharmaceutically acceptable diluent or carrier.
[0289] Typical formulations are prepared by mixing the compounds disclosed herein with carriers, diluents or excipients. Suitable carriers, diluents and excipients are well known to those skilled in the art and include materials such as carbohydrates, waxes, water-soluble and / or swellable polymers, hydrophilic or hydrophobic materials, gelatin, oils, solvents, water, etc. The specific carrier, diluent or excipient used will depend on the application mode and purpose of the compound. Solvents are generally selected based on solvents that are considered safe (GRAS) for administration to mammals by those skilled in the art. In general, safe solvents are non-toxic aqueous solvents, such as water and other non-toxic solvents that are soluble in or miscible in water. Suitable aqueous solvents include water, ethanol, propylene glycol, polyethylene glycol (e.g., PEG 400, PEG 300) and the like and mixtures thereof. The formulations may also contain one or more buffers, stabilizers, surfactants, wetting agents, lubricants, emulsifiers, suspending agents, preservatives, antioxidants, light shielding agents, glidants, processing aids, colorants, sweeteners, aromas, flavorings, and other known additives that provide for the elegant presentation of the drug (i.e., a compound disclosed herein or a pharmaceutical composition thereof) or aid in the manufacture of the drug product (i.e., a medicament).
[0290] The formulations can be prepared using conventional dissolution and mixing procedures. For example, the bulk drug substance (i.e., a compound disclosed herein or a stable form of the compound (e.g., a complex with a cyclodextrin derivative or other known complexing agent)) is dissolved in a suitable solvent in the presence of one or more of the above-mentioned excipients. The compound is typically formulated into a pharmaceutical dosage form to provide an easily controlled drug dosage and enable the patient to adhere to a prescribed regimen.
[0291] The pharmaceutical composition (or formulation) for use can be packaged in a variety of ways depending on the method used to administer the drug. Typically, the articles for distribution include containers in which the pharmaceutical formulation in an appropriate form has been placed. Suitable containers are well known to those skilled in the art and include materials such as bottles (plastic and glass), sachets, ampoules, plastic bags, metal cylinders, etc. The container may also include a tamper-evident assembly to prevent easy access to the contents of the package. In addition, the container may have a label placed thereon describing the contents of the container. The label may also include appropriate warnings.
[0292] Pharmaceutical formulations can be prepared for use in various approaches and types. For example, compounds with desired purity as disclosed herein can optionally be mixed with a pharmaceutically acceptable diluent, carrier, excipient or stabilizer (" Remington's Pharmaceutical Sciences " (1980) 16th edition, Osol, A. ed.) in the form of a lyophilized formulation, a milled powder or an aqueous solution. The formulation can be completed by mixing with a physiologically acceptable carrier, i.e., a nontoxic carrier for the recipient at an appropriate pH and a desired purity at ambient temperature. The pH of the formulation depends primarily on the concentration of the specific application and the compound, but can range from about 3 to about 8. A formulation in an acetate buffer having a pH of 5 is a suitable embodiment.
[0293] The compound can be sterile. Specifically, formulations for in vivo administration should be sterile. Such sterility is easily accomplished by filtration through a sterile filtration membrane.
[0294] Typically the compound can be stored as a solid composition, a lyophilized formulation or an aqueous solution.
[0295] The formulation, dosing and administration of the pharmaceutical compositions comprising the compounds disclosed herein, i.e., the amount, concentration, schedule, course of treatment, vehicle and route of administration, can be consistent with good medical practice. Factors considered in this context include the specific condition being treated, the specific mammal being treated, the clinical condition of the individual patient, the cause of the condition, the delivery site of the agent, the method of administration, the administration schedule and other factors known to medical practitioners. The "therapeutically effective amount" of the compound to be administered will depend on such considerations and is the minimum amount necessary to prevent, improve or treat a coagulation factor-mediated condition. This amount is preferably less than an amount that is toxic to the host or that makes the host significantly more susceptible to bleeding.
[0296] Acceptable diluents, carriers, excipients, and stabilizers are nontoxic to recipients at the dosages and concentrations employed, and include buffers such as phosphate, citrate, and other organic acids; antioxidants including ascorbic acid and methionine; preservatives (such as octadecyldimethylbenzyl ammonium chloride; hexamethonium chloride; benzalkonium chloride, benzethonium chloride; phenolic, butyl, or benzyl alcohol; alkyl parabens such as methyl or propyl paraben; catechol; resorcinol; cyclohexanol; 3-pentanol; and m-cresol); low molecular weight (less than about 10 residues) polypeptides; proteins such as serum albumin, gelatin, or immunoglobulins; hydrophilic polymers such as polyvinylpyrrolidone; amino acids such as glycine, glutamine, asparagine, histidine, arginine, or lysine; monosaccharides, disaccharides, and other carbohydrates including glucose, mannose, or dextrin; chelating agents such as EDTA; sugars such as sucrose, mannitol, trehalose, or sorbitol; salt-forming counterions such as sodium; metal complexes (e.g., zinc-protein complexes); and / or nonionic surfactants such as TWEEN®. TM 、PLURONICS TM Or polyethylene glycol (PEG). Active pharmaceutical ingredients can also be encapsulated in microcapsules prepared, for example, by coacervation techniques or by interfacial polymerization, such as hydroxymethylcellulose or gelatin microcapsules and poly(methyl methacrylate) microcapsules in colloidal drug delivery systems (e.g., liposomes, albumin microspheres, microemulsions, nanoparticles, and nanocapsules) or in macroemulsions. Such techniques are disclosed in Remington's Pharmaceutical Sciences, 16th edition, Osol, A. ed. (1980).
[0297] Sustained release formulations of the compound can be prepared. Suitable examples of sustained release formulations include semipermeable matrices of solid hydrophobic polymers containing the compounds disclosed herein, in the form of shaped articles, such as films or microcapsules. Examples of sustained release matrices include polyesters, hydrogels (e.g., poly(2-hydroxyethyl-methacrylate), or poly(vinyl alcohol)), polylactides (U.S. Patent No. 3,773,919), copolymers of L-glutamic acid and γ-ethyl-L-glutamate, non-degradable ethylene-vinyl acetate, degradable lactic acid-glycolic acid copolymers, such as LUPRON DEPOT®. TM (injectable microspheres composed of lactic acid-glycolic acid copolymer and leuprolide acetate) and poly-D-(-)-3-hydroxybutyric acid.
[0298] The formulations include those suitable for the routes of administration described herein. The formulations can be conveniently presented in unit dosage form and can be prepared by any method well known in the pharmaceutical field. Techniques and formulations can generally be found in Remington's Pharmaceutical Sciences (Mack Publishing Co., Easton, Pa., Pennsylvania). Such methods include the step of associating the active ingredient with a carrier constituting one or more auxiliary ingredients. In general, the formulations are prepared by uniformly and fully associating the active ingredient with a liquid carrier or a fine solid carrier or both and then shaping the product as necessary.
[0299] Formulations of compounds suitable for oral administration as disclosed herein can be prepared as discrete units such as tablets, capsules, cachets, or tablets, each containing a predetermined amount of the compound;
[0300] Compressed tablets can be prepared by compressing an active ingredient (such as a powder or granules) in a free-flowing form optionally mixed with a binding agent, lubricant, inert diluent, preservative, surfactant or dispersant in a suitable machine. Molded tablets can be manufactured by molding a mixture of powdered active ingredients moistened with an inert liquid diluent in a suitable machine. Tablets can be optionally coated or scored and are optionally formulated to provide slow or controlled release of the active ingredient.
[0301] Tablets, troches, lozenges, aqueous or oily suspensions, dispersible powders or granules, emulsions, hard or soft capsules (e.g., gelatin capsules), syrups, or elixirs can be prepared for oral use. Formulations of compounds intended for oral use as disclosed herein can be prepared according to any method known in the art for making pharmaceutical compositions, and such compositions can contain one or more agents including sweeteners, flavorings, colorants, and preservatives to provide a palatable preparation. Tablets containing the active ingredient mixed with non-toxic pharmaceutically acceptable excipients suitable for making tablets are acceptable. For example, these excipients can be inert diluents such as calcium carbonate or sodium carbonate, lactose, calcium phosphate, or sodium phosphate; granulating agents and disintegrants such as corn starch or alginic acid; binders such as starch, gelatin, or gum arabic; and lubricants such as magnesium stearate, stearic acid, or talc. Tablets can be uncoated or can be coated by known techniques including microencapsulation to delay disintegration and adsorption in the gastrointestinal tract and thus provide a sustained effect over a longer period of time. For example, a time delay material such as glyceryl monostearate or glyceryl distearate alone or with a wax may be employed.
[0302] For treatment of the eye or other external tissues, such as the mouth and skin, the formulation may be applied as a topical ointment or cream containing the active ingredient in an amount of, for example, 0.075 to 20% w / w. When formulated in an ointment, the active ingredient may be used with a paraffinic ointment base or a water-miscible ointment base. Alternatively, the active ingredient may be formulated in a cream with an oil-in-water cream base.
[0303] If desired, the aqueous phase of the cream base may contain a polyol, i.e., an alcohol having two or more hydroxyl groups, such as propylene glycol, butane 1,3-diol, mannitol, sorbitol, glycerol, and polyethylene glycol (including PEG 400), and mixtures thereof. These topical formulations may desirably contain compounds that enhance the absorption or penetration of the active ingredient through the skin or other affected area. Examples of such transdermal penetration enhancers include dimethyl sulfoxide and related analogs.
[0304] The oil phase of the emulsion can be composed of known ingredients in a known manner. Although the phase can include only an emulsifier, it can also include a mixture of at least one emulsifier with a fat or an oil or with both a fat and an oil. A hydrophilic emulsifier included together with a lipophilic emulsifier can act as a stabilizer. The emulsifier with or without a stabilizer together constitutes the so-called emulsifying wax, and the wax together with the oil and fat constitutes the so-called emulsifying ointment base, which forms the oily dispersed phase of the cream formulation. Emulsifiers and emulsion stabilizers suitable for the formulation include 60. 80, cetostearyl alcohol, benzyl alcohol, myristyl alcohol, glyceryl monostearate and sodium lauryl sulfate.
[0305] Aqueous suspensions of the compound contain the active material mixed with excipients suitable for the manufacture of aqueous suspensions. Such excipients include: suspending agents such as sodium carboxymethylcellulose, cross-linked carboxymethylcellulose, povidone, methylcellulose, hydroxypropyl methylcellulose, sodium alginate, polyvinylpyrrolidone, gum tragacanth, and gum arabic; and dispersants or wetting agents such as naturally occurring phospholipids (e.g., lecithin), condensation products of alkylene oxides with fatty acids (e.g., polyoxyethylene stearate), condensation products of ethylene oxide with long-chain fatty alcohols (e.g., heptadecaethyleneoxycetanol), condensation products of ethylene oxide with partial esters derived from fatty acids and hexitol anhydrides (e.g., polyoxyethylene sorbitan monooleate). Aqueous suspensions may also contain: one or more preservatives such as ethyl or n-propyl p-hydroxybenzoate; one or more coloring agents; one or more flavoring agents; and one or more sweeteners such as sucrose or saccharin.
[0306] Pharmaceutical compositions of the compound may be in the form of sterile injectable preparations such as sterile injectable aqueous or oily suspensions. Such suspensions may be formulated according to known techniques using suitable dispersants or wetting agents and suspending agents such as those mentioned above. Sterile injectable preparations may also be sterile injectable solutions or suspensions in non-toxic, parenterally acceptable diluents or solvents such as 1,3-butanediol. Sterile injectable preparations may also be prepared as lyophilized powders. Acceptable vehicles and solvents that may be used are water, Ringer's solution, and isotonic sodium chloride solution. In addition, sterile fixed oils may be conventionally used as solvents or suspending media. For this purpose, any bland fixed oil, including synthetic mono- or diglycerides, may be used. In addition, fatty acids such as oleic acid may also be used to prepare injectables.
[0307] The amount of active ingredient that can be combined with carrier material to produce single dosage form will change according to the main body being treated and specific mode of administration.For example, the sustained-release formulation for oral administration to people can contain about 1 to 1000mg of active material compounded with appropriate and convenient amount of carrier material, and described appropriate and convenient amount can change in the scope of about 5% to about 95% (weight: weight) of total composition.Pharmaceutical composition can be prepared to provide the amount that can be easily measured for administration.For example, the aqueous solution that is intended to be used for intravenous infusion can contain about 1 μ g to 500 μ g of active ingredient of every milliliter of solution, and purpose is that can occur with the volume that the rate infusion of about 10 milliliters / hour to about 50 milliliters / hour is suitable for.
[0308] Formulations suitable for parenteral administration include aqueous and non-aqueous sterile injection solutions which may contain antioxidants, buffers, bacteriostats and solutes that render the formulation isotonic with the blood of the intended recipient; and aqueous and non-aqueous sterile suspensions which may contain suspending agents and thickening agents.
[0309] Formulations suitable for topical administration to the eye also include eye drops in which the active ingredient is dissolved or suspended in a suitable carrier, especially an aqueous solvent for the active ingredient. The active ingredient is preferably present in such formulations at a concentration of about 0.5 to 20% w / w, for example about 0.5 to 10% w / w, for example about 1.5% w / w.
[0310] Formulations suitable for topical administration in the mouth include lozenges comprising the active ingredient in a flavored basis, usually sucrose and acacia or tragacanth; pastilles comprising the active ingredient in an inert basis such as gelatin and glycerin, or sucrose and acacia; and mouthwashes comprising the active ingredient in a suitable liquid carrier.
[0311] Formulations for rectal administration may be presented as a suppository with a suitable base comprising, for example, cocoa butter or a salicylate.
[0312] Formulations suitable for intrapulmonary or nasal administration have, for example, a particle size in the range of 0.1 to 500 microns (including particle sizes in the range of 0.1 to 500 microns in increments such as 0.5, 1, 30 microns, 35 microns, etc.) and are administered by rapid inhalation through the nasal passages or by oral inhalation to reach the alveolar sacs. Suitable formulations comprise aqueous or oily solutions of the active ingredient. Formulations suitable for aerosol or dry powder administration can be prepared according to conventional methods and can be delivered with other therapeutic agents, such as compounds heretofore used to treat or prevent the conditions described below.
[0313] Formulations suitable for vaginal administration may be presented as pessaries, tampons, creams, gels, pastes, foams or spray formulations containing in addition to the active ingredient such carriers as are known in the art to be appropriate.
[0314] The formulations can be packaged in unit dose or multidose containers (e.g., sealed ampoules and vials) and can be stored under freeze drying (lyophilization) conditions requiring only the addition of a sterile liquid carrier (e.g., water for injection) just before use. Ready-to-use injection solutions and suspensions are prepared from sterile powders, granules, and tablets of the types described above. Preferred unit dose formulations are those containing daily doses or unit daily subdoses, or appropriate portions thereof, of the active ingredient as described above.
[0315] The subject matter further provides veterinary compositions comprising at least one active ingredient as defined above and a veterinary carrier therefor. A veterinary carrier is a material suitable for the purpose of administering the composition and may be a solid, liquid or gaseous material that is inert or acceptable in the veterinary field and is compatible with the active ingredient. These veterinary compositions may be administered parenterally, orally or by any other desired route.
[0316] In certain embodiments, the pharmaceutical composition comprising the presently disclosed compounds further comprises a chemotherapeutic agent. In some of these embodiments, the chemotherapeutic agent is an immunotherapeutic agent.
[0317] G. Treatment methods
[0318] Compounds and compositions disclosed herein can also be used in methods for treating various diseases and / or conditions, which have been identified as being related to the dysfunction of RNA expression and / or function, or to the expression and / or function of the protein produced by mRNA, or to the useful effects of using small molecules to switch RNA configurations, or to changing the natural function of riboswitches as a way to inhibit the growth of infectious organisms. Thus, the methods disclosed herein are directed to treating diseases or conditions related to the dysfunction of RNA expression and / or function, or to creating new switchable therapies. See, for example, U.S. Patent Application Publication No. 2018 / 010146, which is hereby incorporated by reference in its entirety. Thus, in some embodiments, the method for treating a disease or condition disclosed herein (e.g., related to the dysfunction of RNA expression and / or function) includes administering a compound and / or composition disclosed herein to a subject in need thereof for a therapeutically effective amount of a dosage.
[0319] The dysfunction of RNA expression is characterized by overexpression or underexpression of one or more RNA molecules. In some embodiments, the one or more RNA molecules are related to promoting the disease and / or condition to be treated. In some embodiments, the RNA molecule is characterized by a part of a healthy cell mechanism, and therefore can prevent and / or improve the disease and / or condition to be treated. In some embodiments, the disease or condition to be treated is related to the dysfunction of RNA function related to transcription, processing and / or translation. In some embodiments, the disease or condition to be treated is related to inaccurate protein expression caused by the dysfunction of RNA molecule function. In some embodiments, the disease or condition to be treated is related to the dysfunction of RNA function related to gene expression. In some embodiments, the disease or condition is a disease or condition that is expected to reduce protein expression by combining a molecule with mRNA. In some embodiments, the disease is advantageously treated by a therapy that can be turned on or off using a small molecule. For example, in some embodiments, the disease or condition is a genetic disease, wherein it is desired to have the ability to turn on or off the expression of a therapeutic gene.
[0320] The diseases and disorders to be treated include, but are not limited to, degenerative disorders, cancer, diabetes, autoimmune disorders, cardiovascular disorders, coagulation disorders, ocular diseases, infectious diseases, and diseases caused by mutations in one or more genes.
[0321] Typical degenerative diseases include, but are not limited to, Alzheimer's disease (AD), amyotrophic lateral sclerosis (ALS, Lou Gehrig's disease), cancer, Charcot–Marie–Tooth disease (CMT), chronic traumatic encephalopathy, cystic fibrosis, some cytochrome c oxidase deficiencies (often the cause of degenerative Leigh syndrome), Ehlers–Danlos syndrome, fibrosus dysplasia sclerostivus, Friedreich's ataxia, frontotemporal dementia (FTD), some cardiovascular diseases (e.g., atherosclerotic cardiovascular diseases such as coronary artery disease, aortic stenosis, etc.), Huntington's disease, and disease), infantile axonal dystrophy, keratoconus (KC), globular keratoconus, leukodystrophy, macular degeneration (AMD), Marfan's syndrome (MFS), some mitochondrial myopathies, mitochondrial DNA depletion syndrome, multiple sclerosis (MS), multiple system atrophy, muscular dystrophy (MD), neuronal ceroid lipofuscinosis, Niemann–Pick disease, osteoarthritis, osteoporosis, Parkinson's disease, pulmonary hypertension, all prion diseases (Creutzfeldt-Jakob disease, fatal familial insomnia, etc.), progressive supranuclear palsy, retinitis pigmentosa (RP), rheumatoid arthritis, Sandhoff disease, spinal muscular atrophy (SMA, motor neuron disease), subacute sclerosing panencephalitis, Tay–Sachs disease disease) and vascular dementia (which may not be a neurodegenerative dementia in itself but often occurs together with other forms of degenerative dementia).
[0322] Exemplary cancers include, but are not limited to, all forms of carcinoma, melanoma, blastoma, sarcoma, lymphoma, and leukemia, including, but not limited to, bladder cancer, bladder carcinoma, brain tumors, breast cancer, cervical cancer, colorectal cancer, esophageal cancer, endometrial cancer, hepatocellular carcinoma, laryngeal cancer, lung cancer, osteosarcoma, ovarian cancer, pancreatic cancer, prostate cancer, kidney cancer, and thyroid cancer, acute lymphoblastic leukemia, acute myeloid leukemia, ependymoma, Ewing's sarcoma, glioblastoma, medulloblastoma, neuroblastoma, osteosarcoma, rhabdoid carcinoma, and Wilms' tumor.
[0323] Exemplary autoimmune disorders include, but are not limited to, Adult Still's disease, agammaglobulinemia, alopecia areata, amyloidosis, ankylosing spondylitis, anti-GBM / anti-TBM nephritis, antiphospholipid syndrome, autoimmune angioedema, autoimmune familial dysautonomia, autoimmune encephalomyelitis, autoimmune hepatitis, autoimmune inner ear disease (AIED), autoimmune myocarditis, autoimmune oophoritis, autoimmune orchitis, autoimmune pancreatitis, autoimmune retinopathy, autoimmune urticaria, axonal and neuronal neuropathy (AMAN), Baló disease, Behçet's disease, benign mucous membrane pemphigoid, bullous pemphigoid, Castleman disease, and inflammatory bowel disease. disease (CD), celiac disease, Chagas disease, chronic inflammatory demyelinating polyneuropathy (CIDP), chronic relapsing multifocal osteomyelitis (CRMO), Churg-Strauss syndrome (CSS) or eosinophilic granulomatosis (EGPA), pemphigus vulgaris, Cogan's syndrome, cold agglutinin disease, congenital heart block, Coxsackie myocarditis, CREST syndrome, Crohn's disease, dermatitis herpetiformis, dermatomyositis, Devic's disease (neuromyelitis optica), discoid lupus, Dressler's syndrome, endometriosis, eosinophilic esophagitis (EoE), eosinophilic fasciitis, erythema nodosum, mixed cryoglobulinemia, Evans syndrome syndrome), fibromyalgia, fibrosing alveolitis, giant cell arteritis (temporal arteritis), giant cell myocarditis, glomerulonephritis, Goodpasture's syndrome, granulomatosis with polyangiitis, Graves' disease, Guillain-Barré syndrome, Hashimoto's thyroiditis, hemolytic anemia, Henoch-Schonlein purpura,HSP), herpes gestationis or pemphigoid gestationis (PG), hidradenitis suppurativa (HS) (acne), hypogammaglobulinemia, IgA nephropathy, IgG4-related sclerosing disease, immune thrombocytopenic purpura (ITP), inclusion body myositis (IBM), interstitial cystitis (IC), juvenile arthritis, juvenile diabetes mellitus (type 1 diabetes), juvenile myositis (JM), Kawasaki disease, Lambert-Eaton syndrome, leukocytoclastic vasculitis, lichen planus, lichen sclerosus, woody conjunctivitis, linear IgA disease (LAD), lupus, chronic Lyme disease, Meniere's disease, microscopic polyangiitis (MPA), mixed connective tissue disease (MCTD), Mooren's ulcer, Mucha-Habermann disease disease), multifocal motor neuropathy (MMN) or MMNCB, multiple sclerosis, myasthenia gravis, myositis, narcolepsy, neonatal lupus, neuromyelitis optica, neutropenia, ocular cicatricial pemphigus, optic neuritis, relapsing rheumatic syndrome (PR), PANDAS, paraneoplastic cerebellar degeneration (PCD), paroxysmal nocturnal hemoglobinuria (PNH), Parry Romberg syndrome, pars planitis (peripheral uveitis), Parsonage-Turner syndrome syndrome), pemphigus, peripheral neuropathy, perivenous encephalomyelitis, pernicious anemia (PA), POEMS syndrome, polyarteritis nodosa, polyglandular syndromes types I, II, and III, polymyalgia rheumatica, polymyositis, post-myocardial infarction syndrome, postpericardiotomy syndrome, primary biliary cirrhosis, primary sclerosing cholangitis, progesterone dermatitis, psoriasis, psoriatic arthritis, pure red cell aplasia (PRCA), pyoderma gangrenosum, Raynaud's phenomenon, reactive arthritis, reflex sympathetic dystrophy, relapsing polychondritis, restless legs syndrome (RLS), retroperitoneal fibrosis, rheumatic fever, rheumatoid arthritis, sarcoidosis, Schmidt syndrome, scleroderma, Sjögren's syndrome (, syndrome), sperm and testicular autoimmunity, stiff-person syndrome (SPS), subacute bacterial endocarditis (SBE), Susac's syndrome, sympathetic ophthalmia (SO), Takayasu's arteritis, temporal arteritis / giant cell arteritis, thrombocytopenic purpura (TTP), Tolosa-Hunt syndrome (THS), transverse myelitis, type 1 diabetes mellitus, ulcerative colitis (UC), undifferentiated connective tissue disease (UCTD), uveitis, vasculitis, vitiligo, and Vogt-Koyanagi-Harada disease.
[0324] Exemplary cardiovascular disorders include, but are not limited to, coronary artery disease (CAD), angina, myocardial infarction, stroke, heart attack, heart failure, hypertensive heart disease, rheumatic heart disease, cardiomyopathy, arrhythmias, congenital heart disease, valvular heart disease, carditis, aortic aneurysm, peripheral arterial disease, thromboembolic disease, and venous thrombosis.
[0325] Exemplary coagulation disorders include, but are not limited to, hemophilia, von Willebrand disease, disseminated intravascular coagulation, liver disease, overdevelopment of circulating anticoagulants, vitamin K deficiency, platelet dysfunction, and other coagulation defects.
[0326] Exemplary ocular diseases include, but are not limited to, macular degeneration, proptosis, cataracts, CMV retinitis, diabetic macular edema, glaucoma, keratoconus, ocular hypertension, ocular migraine, retinoblastoma, subconjunctival hemorrhage, pterygium, keratitis, dry eye, and corneal abrasions.
[0327] Exemplary infectious diseases include, but are not limited to, acute flaccid myelitis (AFM), anaplasmosis, anthrax, babesiosis, botulism, brucellosis, campylobacteriosis, carbapenem-resistant infections (CRE / CRPA), chancroid, chikungunya virus infection (chikungunya fever), chlamydia, fish poisoning (harmful algal blooms (HAB)), Clostridium difficile infection, Clostridium perfringens (epsilon toxin), coccidioidomycosis fungal infection (valley fever), COVID-19 (coronavirus disease 2019), Creutzfeldt-Jacob disease (Creutzfeldt-Jacob disease), and Disease), transmissible spongiform encephalopathy (CJD), cryptosporidiosis (cryptic), cyclosporiasis, dengue fever, 1, 2, 3, 4 (dengue fever), diphtheria, Escherichia coli infection, Shiga toxin-producing bacteria (STEC), Eastern equine encephalitis (EEE), Ebola hemorrhagic fever (Ebola), ehrlichiosis, encephalitis, arbovirus or similar infections, enterovirus infections, non-polio (non-polio enterovirus), enterovirus infections, D68 (EV-D68), giardiasis (Giardia lamblia), glanders, gonococcal infection (gonorrhea), granuloma inguinale, Haemophilus influenzae type b disease (Hib or H-influenza), Hantavirus pulmonary syndrome (HPS), hemolytic uremic syndrome (HUS), hepatitis A (Hep A), hepatitis B (Hep B), hepatitis C (Hep C), hepatitis D (Hep D), hepatitis E (Hep E), herpes, herpes zoster, herpes zoster VZV (Shingles), histoplasmosis infection (Histoplasmosis), human immunodeficiency virus / AIDS (HIV / AIDS), human papillomavirus (HPV), influenza (flu), lead poisoning, Legionnaires' disease (Legionnaires' disease), leprosy (Hansens Disease), leptospirosis, listeriosis (Listeria), Lyme disease (Lyme Disease), Lymphogranulomatosis (LGV), Malaria, Measles, Melioidosis, Meningitis, Viral (Meningitis, Virus), Meningococcal Disease, Bacterial (Meningitis, Bacterial), Middle East Respiratory Syndrome Coronavirus (MERS-CoV), Mumps, Norovirus, Paralytic Shellfish Poisoning (Paralytic Shellfish Poisoning, Fish Poisoning), Pediculosis (Lice, Head Lice, and Body Lice), Pelvic Inflammatory Disease (PID), Pertussis (Whooping Cough), Plague; Buboes, Septicemia, Pneumonia (Plague), Pneumococcal Disease (Pneumonia), Poliomyelitis (Poliomyelitis), Powassan, Psittacosis (Psittacosis), Pediculosis (Crab;Pubic lice infestation), impetigo (smallpox, monkeypox, cowpox), Q fever, rabies, ricin poisoning, rickettsial diseases (Rocky Mountain spotted fever), rubella, including congenital (German measles), salmonellosis (gastroenteritis) (Salmonella), scabies (scabies), scombroid toxins (Scombroid), septic shock (septicemia), severe acute respiratory syndrome (SARS), shigellosis (gastroenteritis) (Shigella), smallpox, methicillin-resistant Staphylococcus aureus (MRSA), Staphylococcal food poisoning, enterotoxin-B poisoning (Staphylococcal food poisoning), Staphylococcal infection (VISA), Staphylococcal infection (Vancomycin-resistant) (VRSA), group A (invasive) Streptococcal disease (Streptococcus A (invasive)), group B Streptococcal disease (Streptococcus-B), Streptococcal toxic shock syndrome (STSS), toxic shock (STSS, TSS), Syphilis (primary, secondary, early latent, late latent, congenital), Tetanus infection, Tetanus (lockjaw), Trichomonas infection (Trichinosis), Trichinosis infection (Trichinosis), Tuberculosis (TB), Tuberculosis (latent) (LTBI), Tularemia (rabbit fever), Typhus (Group D), Typhus, Vaginosis, Bacteria (yeast infection), Vaping-associated lung injury (e-cigarette-associated lung injury), Varicella (Chickenpox), Vibrio cholerae (Cholera), Vibrio (Vibrio), Viral hemorrhagic fever (Ebola, Lassa, Marburg), West Nile virus (West Nile Virus), yellow fever, Yersinia (Yersinia), and Zika virus infection (Zika virus).
[0328] Examples
[0329] Example 1 : RNA construct design and preparation
[0330] The screening construct was designed to allow for the incorporation of a variety of one or more internal target RNA motifs. Two motifs were present in the construct: the TPP riboswitch domain 27 and a pseudoknot from the 5'-UTR of dengue virus 26 RNA structures were used to evaluate the design of a complete construct sequence comprising the structural cassette, the RNA barcode helix, and two test RNA structures separated by a hexanucleotide linker. 39 To reduce the likelihood of interaction between the two tested structures, small sequence changes were made to prevent misfolded structures predicted by RNA structure while preserving the native fold ( Figure 7A 、 Figure 7B). The structure of the final construct was confirmed by SHAPE-MaP.
[0331] RNA barcodes are designed to fold into independent hairpins ( Figure 7A 、 Figure 7B All possible permutations of the RNA barcodes were calculated and folded in the context of the complete construct sequence, and any barcodes that could interact with another part of the RNA construct were removed from the set. The barcoded constructs were probed with SHAPE-MaP using the "ligand-free" protocol and folded using RNA structures with SHAPE-reactive restraints to confirm that the barcode helices folded into the expected independent hairpins.
[0332] RNA preparation
[0333] DNA templates for in vitro transcription (Integrated DNA Technologies) encoding the target construct sequence (containing the dengue pseudoknot sequence, single-stranded linker, and TPP riboswitch sequence) and flanking structural cassettes 25 :5'- GTGGG CACTT CGGTG TC CAC ACGCG AAGGA AACCG CGTGT CAACT GTGCA ACAGC TGACA AAGAGATTCC TAAAA CTCAG TACTC GGGGT GCCCT TCTGC GTGAA GGCTG AGAAA TACCC GTATC ACCTGATCTG GATAA TGCCA GCGTA GGGAA GTGCT GGATC CGGTT CGCCG GATCA AT CGG GCTTC GGTCC GGTTC -3' (SEQ ID NO: 1). The primer binding site is underlined. RNA barcodes were added to each of the 96 constructs in separate PCR reactions using forward PCR primers containing a unique RNA barcode and a T7 promoter sequence. The sample forward primer sequence with the barcode nucleotides shown in bold and the primer binding site underlined is: 5'-GAAAT TACGA CTCAC TATAG GTCGC GAGTA ATCGC GACCG GCGCT AGAGA TAGTGCC GTGGGCACTTCGGTGTC -3' (SEQ ID NO: 2).
[0334] DNA was amplified by PCR using 200 μM dNTP mix (New England Biolabs), 500 nM forward primer, 500 nM reverse primer, 1 ng DNA template, 20% (v / v) Q5 reaction buffer, and 0.02 U / μL Q5 hot start high-fidelity polymerase (New England Biolabs) to create a template for in vitro transcription. DNA was purified (PureLink Pro 96 PCR purification kit; Invitrogen) and quantified on a Tecan Infinite M1000 Pro microplate reader (Quant-iT dsDNA high sensitivity assay kit; Invitrogen).
[0335] In vitro transcription was performed in a 96-well plate format, with each well containing a total reaction volume of 100 μL. Each well contained 5 mM NTP (New England Biolabs), 0.02 U / μL inorganic pyrophosphatase (yeast, New England Biolabs), 25 mM MgCl2, 40 mM Tris, pH 8.0, 2.5 mM spermidine, 0.01% Triton, 10 mM DTT, and 200-800 nM of a unique barcoded DNA template (generated by PCR) containing 0.05 mg / mL T7 polymerase. The reaction was incubated at 37°C for 4 hours; then treated with Turbo DNase (RNase-free, Invitrogen) at a final concentration of 0.04 U / μL; incubated at 37°C for 30 minutes; then DNase was added a second time to a total final concentration of 0.08 U / μL and incubated at 37°C for another 30 minutes. The enzymatic reaction was stopped by adding EDTA to a final concentration of 50 mM and placing on ice. RNA was purified in a 96-well format (Agencourt RNAclean XP magnetic beads; Beckman Coulter) and resuspended in 10 mM Tris pH 8.0, 1 mM EDTA. RNA concentration was quantified on a Tecan Infinite M1000 Pro microplate reader (Quant-iT RNA Broad Range Assay Kit; Invitrogen), and RNA in each well was diluted individually to 1 pmol / μL. RNA was stored at -80°C.
[0336] Example 2: Chemical modification and screening of small molecule fragments
[0337] Fragments were obtained from Maybridge in the form of a fragment screening library that is a subset of its Ro3 diversity fragment library and contains 1500 compounds dissolved at 50 mM in DMSO. Most of these compounds follow the "rule of three" for fragment compounds; they have a molecular weight of <300 Da, contain ≤3 hydrogen bond donors and ≤3 hydrogen bond acceptors, and a ClogP ≤3.0. Except for the compounds listed in Example 5, all compounds used for ITC were purchased from Millipore-Sigma and used without further purification. Screening experiments were performed in 25 μL in a 96-well plate format on a Tecan Freedom Evo-150 liquid handler equipped with an 8-channel air displacement pipetting arm, a disposable filter tip, a robotic manipulator arm, and an EchoTherm RIC20 remote heating / cooling dry bath (Torrey Pines Scientific). Liquid handler programs for screening are available upon request.
[0338] For the first fragment ligand screening, 5 pmol of RNA per well was diluted to 19.6 μL in RNase-free water on a 4°C cooling block. The plate was then heated at 95°C for 2 minutes, followed by immediate rapid cooling at 4°C for 5 minutes. 19.6 μL of 2× folding buffer (final concentration 50 mM, HEPES pH 8.0, 200 mM potassium acetate, and 10 mM MgCl2) was added to each well and the plate was incubated at 37°C for 30 minutes. For the second fragment ligand screening, 24.3 μL of folded RNA per well was added to 2.7 μL of DMSO containing the primary binding fragment to a concentration of 10×K for the fragment. d To a final concentration of 100 μL, the samples were incubated at 37°C for 10 minutes. To combine the target RNA with the fragments, 24.3 μL of RNA solution or RNA plus primary binding fragment was added to the wells containing 2.7 μL of 10× screening fragment (in DMSO to produce a final fragment concentration of 1 mM). The solution was thoroughly mixed by pipetting and incubated at 37°C for 10 minutes. For SHAPE probing, 22.5 μL of RNA-fragment solution from each well of the screening plate was added to 2.5 μL of 10× SHAPE reagent in DMSO on a 37°C heating block and mixed quickly by pipetting to achieve uniform distribution of the SHAPE reagent and the RNA. After the appropriate reaction time, the samples were placed on ice. For the first fragment screening, 1-methyl-7-nitroisatoic anhydride (1M7) was used as the SHAPE reagent at a final concentration of 10 mM for 5 minutes. For the second fragment screening, 5-nitroisatoic anhydride (5NIA) was used. 40As SHAPE reagent, the final concentration was 25mM and the reaction was carried out for 15 minutes. Excess fragments, solvents and hydrolyzed SHAPE reagent were removed using an AutoScreen-A 96-well plate (GE Healthcare Life Sciences), and 5 μL of modified RNA from each well of the 96-well plate was pooled into a single sample per plate for sequencing library preparation.
[0339] Each screen consisted of a 19-fragment test plate, two plates containing distributions of positive (fragment 2, final concentration 1 mM) and negative (solvent, DMSO) controls, and a negative SHAPE control plate treated with solvent (DMSO) instead of SHAPE reagent. For hit validation experiments, the well position of each hit fragment was varied to control well position and RNA barcode effects. Plate maps for primary and secondary screens were also available.
[0340] Once screening of the test fragments is complete, statistical tests are performed to identify differences in the modification rates of a given nucleotide. Specifically, the screening assay requires a statistical comparison of the modification rates of a given nucleotide in the presence of the fragment versus in its absence. For each nucleotide, the number of modifications in a given reaction is a Poisson process with a known variance; therefore, the statistical significance of the observed difference in modification rates between two samples can be determined by performing two Poisson count comparison tests. 31 That is, if m1 modifications of a test nucleotide are counted in n1 reads in sample 1 and m2 modifications are counted in n2 reads in sample 2, then the null hypothesis being tested predicts that, among all counted modifications (m1+m2), the proportion of modifications in sample 1 will be p1=n1 / (n1+n2). The Z-test for this hypothesis is:
[0341]
[0342] Z=min(|Z p |,|Z n |)
[0343] If the Z value exceeds the specified significance threshold, the tested nucleotide is considered to be statistically significantly affected by the presence of the tested fragment.
[0344] Next, for each fragment, a Z test must be performed on a large number of nucleotides comprising the RNA sequence, increasing the likelihood of false positives. Although the number of false positive assignments of SHAPE reactivity for each nucleotide can be minimized by raising the Z significance threshold, this approach reduces the sensitivity of the screening (meaning it reduces the ability to detect weaker binding ligands). To reduce the number of Z tests performed, such tests are only applied to nucleotides in the region of interest, rather than all nucleotides in the RNA screening construct. For the dengue motif of RNA, the region of interest is positions 59-110; for the TPP motif, the region of interest is positions 100-199. The number of Z tests is further reduced by omitting nucleotides with low modification rates in both samples. The threshold for considering nucleotides with low modification rates is set to 25% of the plate average modification rate, which is calculated over all nucleotides in all 96 wells of a given plate. The Z test is performed only on nucleotides whose modification rate exceeds this 25% threshold in at least one of the two compared samples.
[0345] Ideally, the only difference between the conditions in the two compared samples is the presence of a fragment in one sample but not in the other. Testing negative control samples against each other can be used to measure the prevalence of uncontrolled factors that may introduce cross-sample variability in nucleotide modification rates. For example, if the Z significance threshold is set to 2.7, then in the absence of any such factors, a Z test applied to a pair of negative control (no fragment) samples should theoretically identify differentially reactive nucleotides with a probability of P = 0.0035. However, when the Z test was applied to pairs of negative control samples randomly selected from the 587 negative control samples tested in the primary screen, the actual probability was 90 times higher, with P = 0.32. Therefore, in the absence of fragments, there is statistically significant variability in SHAPE reactivity at individual nucleotides.
[0346] While most replicates had essentially identical profiles, a significant number had different profiles; some had coefficients of determination as low as 0.85. Applying the Z-test to different negative control samples yielded numerous instances in which nucleotides were incorrectly classified as differentially reactive. To avoid this outcome, each sample was compared to the five most highly correlated negative control samples. Applying the Z-test to such selective pairs of negative controls with a Z significance threshold of 2.7 identified differentially reactive nucleotides with a probability of P = 0.067.
[0347] This probability is approximately 20 times higher than the theoretical P = 0.0035, indicating that there is variability in sample processing. Some of this variability is scaled equally across the reactivity of all nucleotides in all RNAs in the sample. This variability can be removed by reducing the overall reactivity in the more reactive samples to match the overall reactivity in the less reactive samples. Such scaling is performed by (i) calculating, for each nucleotide in the RNA sequence, the ratio of its modification rate in the more reactive sample to the modification rate in the less reactive sample, and (ii) dividing the modification rate of all nucleotides in the more reactive sample by the median of the ratios obtained in step (i). Such scaling of the negative control well pairs that maximized the correlation reduced the probability of finding a nucleotide hit to P = 0.030, 9 times higher than the theoretical probability. Therefore, false positive identification of fragments will occur, as occurs in virtually all high-throughput screening assays, and actual fragment hits from non-ligand variants will be distinguished by repeated SHAPE validation and direct ligand binding measurements using ITC.
[0348] Since effective ligands are expected to affect the modification rates of multiple nucleotides in the target RNA, a fragment is considered a hit only if the number of nucleotides whose reactivity differs from that in the negative control exceeds a defined threshold set to 2. Second, when looking for a relatively robust effect of the fragment on the RNA, small relative differences in nucleotide reactivity, even if statistically significant, are excluded from the total count of differentially reactive nucleotides. In practice, the minimum acceptable difference is set to 20% of the mean:
[0349] |r1–r2| / (r1+r2) / 2=0.2,
[0350] Where r1 and r2 are the nucleotide modification rates in the two samples. Third, a given sample is tested against the five negative control samples to which it is most highly correlated. All five tests need to find a change in the test sample relative to the negative control sample.
[0351] Finally, the sensitivity and specificity of the screening were controlled by selecting a Z significance threshold. The evaluation of samples containing fragments and all negative control samples was performed under multiple Z significance threshold settings. For each such setting, the false positive fraction (FPF) was calculated as the score of the negative control sample found to be altered, and the ligand fraction (LF) was estimated by subtracting the FPF from the score of the altered sample containing the fragment. The balance between LF and FPF was quantified by their ratio LF / FPF. The optimal balance (LF / FPF≈1.3) for TPP riboswitch RNA was achieved under a Z significance threshold ranging from 2.5 to 2.7, and at the Z significance threshold, 0.022>FPF>0.014. For dengue pseudoknot, the optimal balance (LF / FPF≈4) was achieved under a Z significance threshold ranging from 2.5 to 2.65, and at the Z significance threshold, 0.007>FPF>0.005.
[0352] Example 3: Library preparation and sequencing
[0353] The modified RNA pooled in a 100 μL volume was reverse transcribed. 6 μL of reverse transcription primer was added to 71 μL of pooled RNA to reach a final concentration of 150 nM primer, and the sample was incubated at 65°C for 5 minutes and then placed on ice. To this solution, 6 μL of 10× first-strand buffer (500 mM Tris pH 8.0, 750 mM KCl), 4 μL of 0.4 M DTT, 8 μL of dNTP mix (10 mM each), and 15 μL of 500 mM MnCl2 were added, and the solution was incubated at 42°C for 2 minutes, followed by the addition of 8 μL of SuperScript II reverse transcriptase (Invitrogen). The reaction was incubated at 42°C for 3 hours, then heat-inactivated at 70°C for 10 minutes, and then placed on ice. The resulting cDNA product was purified (Agencourt RNAClean magnetic beads; Beckman Coulter), eluted into RNase-free water, and stored at -20°C. The sequence of the reverse transcription primer was 5′-CGGGC TTCGGTCCGG TTC-3′ (SEQ ID NO: 3).
[0354] Prepare DNA libraries for sequencing using a two-step PCR reaction to amplify DNA and add necessary TruSeq adapters 24DNA was amplified by PCR using 200 μM dNTP mix (New England Biolabs), 500 nM forward primer, 500 nM reverse primer, 1 ng cDNA or double-stranded DNA template, 20% (v / v) Q5 reaction buffer (New England Biolabs) and 0.02 U / μL Q5 hot start high-fidelity polymerase (New England Biolabs). Excess unincorporated dNTPs and primers were removed by affinity purification (Agencourt AmpureXP magnetic beads; Beckman Coulter; sample to bead ratio of 0.7:1). DNA libraries were quantified on a Qubit fluorometer (Invitrogen) (Qubit dsDNA High Sensitivity Assay Kit; Invitrogen), the quality of the DNA libraries was checked (Bioanalyzer 2100 on-chip electrophoresis instrument; Agilent), and the DNA libraries were sequenced on an Illumina NextSeq 550 high-throughput sequencer.
[0355] The amplicon-specific forward primer for SHAPE-MaP library preparation was 5′-CCCTA CACGA CGCTC TTCCGATCTN NNNN GGCCTTCGGGCCAAGGA -3′ (SEQ ID NO: 4). The SHAPE-MaP library preparation amplicon-specific reverse primer is 5′-GACTG GAGTT CAGAC GTGTG CTCTT CCGAT CTNNNNNTT GAACCGGACCGAAGCCCGATTT -3' (SEQ ID NO: 5). Sequences overlapping with the RNA screening construct are underlined.
[0356] Example 4: Isothermal Titration Calorimetry
[0357] ITC experiments were performed under RNase-free conditions using a Microcal PEAQ-ITC automated instrument (Malvern Analytical). 41 In vitro transcribed RNA was exchanged into folding buffer containing 100 mM CHES, pH 8.0, 200 mM potassium acetate, and 3 mM MgCl2 using a centrifugal concentrator (Amicon Ultra centrifugal filter, 10K MWCO, Millipore-Sigma). The ligand was dissolved in the same buffer at a concentration 10-20 times the desired RNA experimental concentration (to minimize the heat of mixing when the ligand is added to the RNA). The RNA concentration was quantified (Nanodrop UV-VIS spectrophotometer; ThermoFisher Scientific) and the RNA concentration was diluted in buffer to the expected K dThe diluted RNA was diluted to 1-10 times the concentration of the final experimental RNA and re-quantified to confirm the final experimental RNA concentration. The RNA diluted in the folding buffer was heated at 65°C for 5 minutes, placed on ice for 5 minutes, and folded at 37°C for 15 minutes. If necessary, the primary binding ligand (e.g., 2) was pre-bound to the RNA by adding 0.1 volume at 10 times the desired final concentration of the binding ligand and then incubated at room temperature for 10 minutes.
[0358] Each ITC experiment involved two runs: one in which the ligand was titrated into the RNA (experimental trace), and another in which the same ligand was titrated into the buffer (control trace). The ITC experiments were performed using the following parameters: 25°C cell temperature, 8 μcal / s reference power, 750 RPM stirring speed, high feedback mode, 0.2 μL initial injection, followed by 19 2 μL injections. Each injection took 4 seconds to complete, and there was a 180-second interval between injections.
[0359] ITC data were analyzed using MicroCal PEAQ-ITC analysis software (Malvern Analytical). First, the baseline of each injection peak was manually adjusted to account for any incorrectly selected injection endpoints. Second, the control trace was subtracted from the experimental trace by point-to-point subtraction. Third, a least-squares regression line was fit to the data using the Levenberg-Marquardt algorithm. In the case of weakly binding ligands (>500 μM), N was manually set to 1.0 to enable fitting of low c-value curves.
[0360] Example 5: Chemical synthesis of test compounds 35, 36, 37, 38, 39 and 40.
[0361]
[0362] Compound 35: 3-C linked hydroxamic acid 35 was prepared from carboxylic acid S19 via reaction of a mixed anhydride intermediate with aqueous hydroxylamine. Acid S19 was obtained by treating quinoxaline-6-amine with the cyclized anhydride dihydrofuran-2,5-dione.
[0363]
[0364] Compound 36: The 2-C linked analog 36 was obtained from the corresponding ester S20 by reaction with in situ formed hydroxylamine. Ester S20 was prepared by Michael addition of quinoxalin-6-amine to ethyl acrylate.
[0365]
[0366] Compound 37: Buchwald-Hartwig reaction was used to synthesize intermediates S21 and S22. Removal of the protecting group (Boc) with HCl in ether followed by further treatment with Na2CO3 afforded 37.
[0367]
[0368] Compound 38: Imine formation and subsequent sodium borohydride reduction of quinoxaline-6-carboxaldehyde and diamine to give 38.
[0369]
[0370] Compound 39: Using S N Imine formation of quinoxalin-6-ylmethylamine hydrochloride prepared by Ar reaction and aldehyde S23 and subsequent sodium borohydride reduction gave intermediate S24 which, after (Boc) deprotection with HCl, gave 39.
[0371]
[0372] Compound 40: The less constrained analog 40 was prepared by two Buchwald-Hartwig reactions with 3,5-dibromopyridine followed by (Boc) deprotection with HCl.
[0373] Example 6: X-ray crystallography
[0374] To evaluate whether structural variants of 2 are good binding candidates for the TPP riboswitch, compound 17 was investigated in X-ray crystallography studies. TPP riboswitch RNA was prepared by in vitro transcription as described 27 . TPP riboswitch RNA (0.2 mM) and 17 (2 mM) were heated at 60°C for 3 min in a buffer containing 50 mM potassium acetate (pH 6.8) and 5 mM MgCl2, quickly cooled in crushed ice, and incubated at 4°C for 30 min before crystallization. For crystallization, 1.0 μL of the RNA-17 complex was mixed with 1.0 μL of a reservoir solution containing 0.1 M sodium acetate (pH 4.8), 0.35 M ammonium acetate, and 28% (v / v) PEG4000. Crystallization was performed by hanging drop vapor diffusion at 291 K over a period of 2 weeks. Crystals were cryoprotected in mother liquor supplemented with 15% glycerol before being snap-frozen in liquid nitrogen. Data were acquired at NSLS-II (Brookhaven National Laboratory). The data were collected on the 17-ID-2 (FMX) beamline at 40 nm wavelength. The data were processed using HKL200043. The structure was solved by molecular replacement using Phenix44 and the 2GDI riboswitch RNA structure. 27 The structure was refined in Phenix. In the later stages of the refinement, organic ligands, water molecules, and ions were added based on the Fo-Fc and 2Fo-Fc electron density maps.
[0375] The results indicate that compound 17 binds to the TPP riboswitch in a manner similar to the thiamine moiety of the TPP ligand, thereby stacking between G42 and A43 in the J3 / 2 junction (Figure 3). 27,28 17 forms three hydrogen bonds with RNA: one each to the ribose and Watson-Crick face of G40 and one to the ribose of G19. There are significant changes in the local RNA structure relative to RNA in complex with the native TPP ligand. In the 17-bound structure, G72 is flipped into the binding site where the pyrophosphate portion of the TPP ligand resides. This binding mode is consistent with previous work that visualized the inverted G72 orientation of the fragment bound in the thiamine subsite of the riboswitch binding notch. 17,34 Consistent with the SAR analysis, the orientation of the C-6 substituent appears relatively unhindered for interaction with RNA, suggesting that this vector would be a good candidate for fragment refinement.
[0376] References
[0377] 1. Hajduk, PJ, Huth, JR and Tse, C. Predicting protein druggability. Drug Discov. Today 10, 1675–1682 (2005).
[0378] 2. Vukovic, S. and Huggins, DJ. Quantitative metrics for drug–target ligandability. Drug Discovery Today 23, 1258–1266 (2018).
[0379] 3. Batey, RT, Rambo, RP and Doudna, J.A. Tertiary Motifs in RNA Structure and Folding. Angew. Chem. Int. Ed. 38, 2326–2343 (1999).
[0380] 4. Warner, KD, Hajdin, CE and Weeks, KM. Principles for targeting RNA with drug-like small molecules. Nat. Rev. Drug Discov. 17, 547–558 (2018).
[0381] 5. Sharp, The centrality of RNA. Cell 136, 577–580 (2009).
[0382] 6. Kozak, M. Regulation of translation via mRNA structure in prokaryotes and eukaryotes. Gene 361, 13–37 (2005).
[0383] 7. Corbino, KA, Sherlock, ME, McCown, PJ, Breaker, RR and Stav, S. Riboswitch diversity and distribution. RNA 23, 995–1011 (2017).
[0384] 8. Cech, TR and Steitz, JA The noncoding RNA revolution—Trashing old rules to forge new ones. Cell 157, 77–94 (2014).
[0385] 9. Parsons, C., Slack, FJ, Zhang, WC, Adams, BD, and Walker, L. Targeting noncoding RNAs in disease. J. Clin. Invest. 127, 761–771 (2017).
[0386] 10. Matsui, M. and Corey, DR. Non-coding RNAs as drug targets. Nature Reviews Drug Discovery 16, 167–179 (2017).
[0387] 11. Guan, L. and Disney, MD. Recent advances in developing small molecules targeting RNA. ACS Chem. Biol. 7, 73–86 (2012).
[0388] 12. Connelly, CM, Moon, MH and Schneekloth, JS. The Emerging Role of RNA as a Therapeutic Target for Small Molecules. Cell Chem. Biol. 23, 1077–1090 (2016).
[0389] 13. Murray, CW and Rees, DC The rise offragment-based drug discovery. Nat. Chem. 1, 187–92 (2009).
[0390] 14. Doak, BC, Norton, RS, and Scanlon, MJ. The ways and means of fragment-based drug design. Pharmacol. Ther. 167, 28–37 (2016).
[0391] 15. Cressina, E., Chen, L., Abell, C., Leeper, FJ and Smith, AG. Fragment screening against the thiaminepyrophosphate riboswitch thiM. Chem. Sci. 2, 157–165 (2011).
[0392] 16. Moumné, R., Catala, M., Larue, V., Micouin, L. & Tisné, C. Fragment-based design of small RNAbinders: Promising developments and contribution of NMR. Biochimie 94, 1607–1619 (2012).
[0393] 17.Warner, KD, et al. Validating fragment-based drug discovery for biological RNAs: Lead fragments bind and remodel the TPP riboswitch specifically. J Chem Biol 21, 591–595 (2014).
[0394] 18. Zeiger, M. et al. Fragment-based search for small molecule inhibitors of HIV-1 Tat-TAR. Bioorganic Med. Chem. Lett. 24, 5576–5580 (2014).
[0395] 19. Bottini, A. et al. Targeting Influenza A Virus RNA Promoter. Chem. Biol. Drug Des. 86, 663–673 (2015).
[0396] 20. Hunter, CA and Anderson, HL. What is cooperativity? Angewandte Chemie International Edition 48, 7488–7499 (2009).
[0397] 21. Ichihara, O., Barker, J., Law, RJ and Whittaker, M. Compound design by fragment-linking. Mol. Inform. 30, 298–306 (2011).
[0398] 22. Zeller, M.J., Li, K., Aubé, J., and Weeks, Multisite ligand recognition and cooperativity in the TPPriboswitch RNA. Prep. (2019).
[0399] 23. Siegfried, NA, Busan, S., Rice, GM, Nelson, JAE, and Weeks, KM. RNA motif discovery by SHAPE and mutational profiling (SHAPE-MaP). Nat. Methods 11, 959–65 (2014).
[0400] 24. Smola, MJ, Rice, GM, Busan, S., Siegfried, NA and Weeks, KM. Selective 2'-hydroxyl acylation analyzed by primer extension and mutational profiling (SHAPE-MaP) for direct, versatile and accurate RNA structure analysis. Nat. Protoc. 10, 1643–1669 (2015).
[0401] 25. Merino, EJ, Wilkinson, KA, Coughlan, JL and Weeks, KM. RNA structure analysis at single nucleotide resolution by selective 2'-hydroxyl acylation and primer extension (SHAPE). J. Am. Chem. Soc. 127, 4223–4231 (2005).
[0402] 26. Liu, Z.-Y. et al. Novel cis-acting element within the capsid-coding region enhances flavivirus viral-RNA replication by regulating genome cyclization. J. Virol. 87, 6804–18 (2013).
[0403] 27. Serganov, A., Polonskaia, A., Phan, AT, Breaker, RR, and Patel, DJ. Structural basis for gene regulation by athiamine pyrophosphate-sensing riboswitch. Nature 441, 1167–1171 (2006).
[0404] 28. Edwards, TE and Ferré-D'Amaré, AR Crystal structures of the thi-box riboswitch bound to thiamine pyrophosphate analogs reveal adaptive RNA-small molecule recognition. Structure 14, 1459–68 (2006).
[0405] 29. Thore, S., Frick, C. and Ban, N. Structural basis of thiamine pyrophosphate analogues binding to the eukaryotic riboswitch. Journal of the American Chemical Society 130, 8116–8117 (2008).
[0406] 30. Busan, S. and Weeks, KM. Accurate detection of chemical modifications in RNA by mutational profiling (MaP) with ShapeMapper 2. RNA, 24, 143–148 (2018).
[0407] 31. Woolson, R. Statistical Methods for the Analysis of Biomedical Data. (John Wiley & Sons, 1987).
[0408] 32. Jhoti, H., Williams, G., Rees, DC, and Murray, CW. The 'rule of three' for fragment-based drug discovery: Where are we now? Nature Reviews Drug Discovery 12, 644 (2013).
[0409] 33. Chen, L. et al. Probing riboswitch–ligand interactions using thiamine pyrophosphate analogues. Org. Biomol. Chem. 10, 5924–5931 (2012).
[0410] 34. Warner, KD and Ferré-D'Amaré, AR. Crystallographic analysis of TPPriboswitch binding by small-molecule ligands discovered through fragment-based drug discovery approaches. Methods Enzymol. 549, 221–233 (2014).
[0411] 35. Codd, R. Traversing the coordination chemistry and chemical biology of hydroxamic acids. Coord. Chem. Rev. 252, 1387–1408 (2008).
[0412] 36. Jencks, WP. On the attribution and additivity of binding energies. Proc. Natl. Acad. Sci. USA 78, 4046–4050 (1981).
[0413] 37. Olejniczak, ET, et al. Stromelysin inhibitors designed from weakly bound fragments: Effects of linking and cooperativity. J Am Chem Soc 119, 5828–5832 (1997).
[0414] 38. Borsi, V., Calderone, V., Fragai, M., Luchinat, C. and Sarti, N. Entropic contribution to the linking coefficient in fragment based drug design: A case study. J. Med. Chem. 53, 4285–4289 (2010).
[0415] 39. Reuter, JS and Mathews, DH. RNA structure: software for RNA secondary structure prediction and analysis. BMC Bioinformatics 11, 129 (2010).
[0416] 40. Busan, S., Weidmann, C.A., Sengupta, A. and Weeks, K.M. Guidelines for SHAPE Reagent Choice and Detection Strategy for RNA Structure Probing Studies. Biochemistry 58, 2655–2664 (2019).
[0417] 41. Gilbert, SD and Batey, RT Monitoring RNA-ligand interactions using isothermal titration calorimetry. Methods Mol. Biol. 540, 97–114 (2009).
[0418] 42. Turnbull, WB. Divided We Fall? Studying low affinity fragments of ligands by ITC. Microcal Application Notes (2005).
[0419] 43. Otwinowski, Z. and Minor, W. Processing of X-ray diffraction data collected in oscillation mode. Methods in Enzymology (1997). doi:10.1016 / S0076-6879(97)76066-X.
[0420] 44. Liebschner, D. et al. Macromolecular structure determination using X-rays, neutrons and electrons: recent developments in Phenix. Acta Crystallogr. 75, 861–877 (2019).
[0421] 45. Hajduk, PJ et al. Discovery of potent nonpeptide inhibitors of stromelysin using SAR by NMR. J Am Chem Soc 119, 5818–5827 (1997).
[0422] 46. Howard, N. et al. Application of fragment screening and fragment linking to the discovery of novel thrombin inhibitors. Journal of Medicinal Chemistry 49, 1346–1355 (2006).
[0423] 47. Barker, JJ, et al. Discovery of a novel Hsp90 inhibitor by fragment linking. ChemMedChem, 5, 1697-1700 (2010).
[0424] 48. H. et al. Discovery of Potent, Selective, and Structurally Novel Dot1L Inhibitors by a Fragment Linking Approach. ACSMed. Chem. Lett. 8, 338–343 (2017).
[0425] 49. Hung, AW et al. Application of fragment growing and fragment linking to the discovery of inhibitors of mycobacterium tuberculosis pantothenate synthetase. Angewandte Chemie Int ed 48, 8452–8456 (2009).
[0426] 50. Jordan, JB, et al. Fragment-Linking Approach Using 19F NMR Spectroscopy to Obtain Highly Potent and Selective Inhibitors of β-Secretase. Journal of Medicinal Chemistry 59, 3732–3749 (2016).
[0427] 51. Maly, DJ, Choong, IC and Ellman, JA. Combinatorial target-guided ligand assembly: Identification of potent subtype-selective c-Src inhibitors. Proc. Natl. Acad. Sci. 97, 2419–2424 (2000).
[0428] 52. Shuker, SB, Hajduk, PJ, Meadows, RP and Fesik, SW. Discovering High-Affinity Ligands for Proteins: SAR by NMR. Science (80-). 274, 1531–1534 (1996).
[0429] 53. Mondal, M. et al. Fragment Linking and Optimization of Inhibitors of the Aspartic Protease Endothiapepsin: Fragment-Based Drug Design Facilitated by Dynamic Combinatorial Chemistry. Angewandte Chemie Int ed 55, 9422–9426 (2016).
[0430] 54. Swayze, EE, et al. SAR by MS: A ligand based technique for drug lead discovery against structured RNA targets. J Medicinal Chem 45, 3816–3819 (2002). Sequence Listing <110> The University of North Carolina Atchapel Hill <120> RNA targeting ligands, compositions thereof, and methods of making and using the same <130> LHB2267524P <150> 62 / 883,370 <151> 2019-08-06 <150> 63 / 031,944 <151> 2020-05-29 <160> 12 <170> SIPOSequenceListing 1.0 <210> 1 <211> 200 <212> DNA <213> Artificial Sequence <220> <223> Structure cassette flanking target sequence <400> 1 gtgggcactt cggtgtccac acgcgaagga aaccgcgtgt caactgtgca acagctgaca 60 aagagattcc taaaactcag tactcggggt gcccttctgc gtgaaggctg agaaataccc 120 gtatcacctg atctggataa tgccagcgta gggaagtgct ggatccggtt cgccggatca 180 atcgggcttc ggtccggttc 200 <210> 2 <211> 74 <212> DNA <213> Artificial Sequence <220> <223> Forward primer sequence <400> 2 gaaattacga ctcactatag gtcgcgagta atcgcgaccg gcgctagaga tagtgccgtg 60 ggcacttcgg tgtc 74 <210> 3 <211> 18 <212> DNA <213> Artificial Sequence <220> <223> Reverse transcription primer <400> 3 cgggcttcgg tccggttc 18 <210> 4 <211> 46 <212> DNA <213> Artificial Sequence <220> <223> Amplicon-specific forward primer <220> <221> misc_feature <222> (25)..(29) <223> n is a, c, g, t or u <400> 4 ccctacacga cgctcttccg atctnnnnng gccttcgggc caagga 46 <210> 5 <211> 61 <212> DNA <213> Artificial Sequence <220> <223> Amplicon-specific reverse primer <220> <221> misc_feature <222> (33)..(37) <223> n is a, c, g, t or u <400> 5 gactggagtt cagacgtgtg ctcttccgat ctnnnnnttg aaccggaccg aagcccgatt 60 t 61 <210> 6 <211> 238 <212> DNA <213> Artificial Sequence <220> <223> target sequence <400> 6 ggucgcgagu aaucgcgacc gcugcaagag auuguagcgu gggcacuucg guguccacac 60 gcgaaggaaa ccgcguguca acugugcaac agcugacaaa gagauuccua aaacucagua 120 cucggggugc ccuucugcgu gaaggcugag aaauacccgu aucaccugau cuggauaaug 180 ccagcguagg gaagugcugg auccgguucg ccggaucaau cgggcuucgg uccgguuc 238 <210> 7 <211> 20 <212> DNA <213> Artificial Sequence <220> <223> portion of structure cassette <400> 7 ggucgcgagu aaucgcgacc 20 <210> 8 <211> 18 <212> DNA <213> Artificial Sequence <220> <223> RNA barcode <400> 8 gcugcaagag auuguagc 18 <210> 9 <211> 20 <212> DNA <213> Artificial Sequence <220> <223> structure cassette <400> 9 gugggcacuu cgguguccac 20 <210> 10 <211> 51 <212> DNA <213> Artificial Sequence <220> <223> DENV pseudoknot <400> 10 acgcgaagga aaccgcgugu caacugugca acagcugaca aagagauucc u 51 <210> 11 <211> 84 <212> DNA <213> Artificial Sequence <220> <223> TPP riboswitch <400> 11 caguacucgg ggugcccuuc ugcgugaagg cugagaaaua cccguaucac cugaucugga 60 uaaugccagc guagggaagu gcug 84 <210> 12 <211> 39 <212> DNA <213> Artificial Sequence <220> <223> structure cassette <400> 12 gauccgguuc gccggaucaa ucgggcuucg guccgguuc 39
Claims
1. A compound having the structure of formula (III): in L is selected from wherein q and r are independently selected from the integers 0, 1, 2, and 3, and z is selected from the integers 1, 2, and 3; and A is selected from wherein X5 is N, and X4, X6 and X7 are CR3, wherein R3 is -H; m is 1 or 2; and W is -O or -NR4, wherein R4 is C1-C6 alkyl or -H; or a pharmaceutically acceptable salt thereof.
2. The compound according to claim 1, wherein q and r are independently selected from the integers 0, 1 and 2.
3. The compound according to claim 1 or 2, wherein L is The compound according to claim 3 , wherein q and r are 0 or 1. The compound according to claim 4 , wherein q and r are 1. The compound according to claim 4 , wherein q is 1 and r is 0. The compound according to claim 1 , wherein m is 1.
8. The compound according to claim 7, wherein W is -NH or -O.
9. The compound of claim 8, wherein W is -NH.
10. The compound according to claim 9, wherein A is 11. The compound according to claim 9, wherein A is 12. The compound of claim 1, wherein the compound has the structure: or a pharmaceutically acceptable salt thereof.
13. The compound of claim 3, wherein q is 0 and r is 2.
14. The compound according to claim 1, wherein z is 2, L is 15. The compound according to claim 13 or 14, wherein A is 16. The compound according to claim 1, wherein the compound has the structure 17. A composition comprising a compound according to any one of claims 1 to 16; said compound being included in a pharmaceutically acceptable carrier.
18. A medicament for treating a disease or condition associated with a dysfunction of RNA expression, comprising a therapeutically effective amount of the compound according to any one of claims 1 to 16 or the composition according to claim 17; wherein administration of the drug reduces protein expression due to binding of the compound to the RNA; wherein the disease or disorder is selected from the group consisting of a genetic disease, a degenerative disorder, cancer, diabetes, an autoimmune disorder, a cardiovascular disorder, a coagulation disorder, an eye disease, an infectious disease, and a disease caused by a mutation in one or more genes.
19. A method for preparing a compound according to any one of claims 1 to 16, the method comprising: a) contacting a fragment of formula IV' with a fragment of formula V-1 or V-2 in the presence of a Pd catalyst; or b) contacting the fragment of formula IV' with the fragment of formula VI-1 or VI-2 in the presence of a reducing agent; or c) contacting the fragment of formula IV' with the fragment of formula VII-1 or VII-2 in the presence of a base; wherein Formula IV' is Formula V-1 is wherein X is a halogen selected from F, Br, Cl and I; X5 is N, and X4, X6 and X7 are CR3, wherein R3 is -H; m is 1 or 2; and W is -O or -NR4, wherein R4 is (C1-C6)alkyl or -H; Formula V-2 is wherein X is a halogen selected from F, Br, Cl and I; X5 is N, and X4, X6 and X7 are CR3, wherein R3 is -H; m is 1 or 2; and W is -O or -NR4, wherein R4 is (C1-C6)alkyl or -H; Formula VI-1 is wherein X5 is N, and X4, X6 and X7 are CR3, wherein R3 is -H; m is 1 or 2; and W is -O or -NR4, wherein R4 is (C1-C6)alkyl or -H; Formula VI-2 is wherein X5 is N, and X4, X6 and X7 are CR3, wherein R3 is -H; m is 1 or 2; and W is -O or -NR4, wherein R4 is (C1-C6)alkyl or -H; Formula VII-1 is wherein X5 is N, and X4, X6 and X7 are CR3, wherein R3 is -H; m is 1 or 2; W is -O or -NR4, wherein R4 is (C1-C6)alkyl or -H, and G is -F, -Cl, -Br, -OH, -OCH3 or -OCH2CH3; And formula VII-2 is wherein X5 is N, and X4, X6 and X7 are CR3, wherein R3 is -H; m is 1 or 2; W is -O or -NR4, wherein R4 is (C1-C6)alkyl or -H; and G is -F, -Cl, -Br, -OH, -OCH3 or -OCH2CH3.
Citation Information
Patent Citations
Detection of chemical modifications in nucleic acids
US10240188B2
Regulation of gene expression by aptamer-mediated modulation of alternative splicing
US20180010146A1
Polylactide-drug mixtures
US3773919A
Aptamer-mediated regulation of gene expression
US6949379B2
High-throughput RNA structure analysis
US8318424B2