Kit for detecting familial hypercholesterolemia and statin gene

Abstract

A kit and method for detecting familial hypercholesterolemia and statin drug genes. The kit includes primers for amplifying a single nucleotide polymorphism (SNP) site located in at least one of a familial hypercholesterolemia-related gene and a drug-directed gene; the kit also includes an extension primer for extending the SNP site in the PCR amplified product by one base; the familial hypercholesterolemia-related gene includes at least one of the LDLR gene and the APOB gene; the drug includes a statin; and the drug-directed gene includes at least one of the APOE gene and the SLCO1B1 gene. The present invention develops a detection kit for common mutation hotspots and statin-directed sites in the Chinese population with familial hypercholesterolemia, enabling large-scale screening of high-risk populations and achieving zero delay between screening and medication, enabling early screening, diagnosis, and treatment.

Description

Technical Field

[0001] The present invention relates to the field of medicine, and in particular to a kit and method for detecting familial hypercholesterolemia and statin drug genes. Background Art

[0002] Familial hypercholesterolemia (FH) is a lipid metabolism disorder characterized clinically by elevated serum low-density lipoprotein cholesterol (LDL-C) levels, a risk of premature cardiovascular disease, xanthomas on the skin and tendons, and arcus corneae. It is caused by a genetic mutation that leads to elevated serum LDL-C, which deposits in blood vessels and forms plaques, significantly increasing the risk of cardiovascular disease. Epidemiological surveys indicate that approximately 34 million people worldwide suffer from FH, with an estimated 6.91 million in China. The prevalence of FH is 1 in 200 to 1 in 500 people, and the risk of premature coronary heart disease is 6-22 times higher than the average person. It is also associated with a wide range of cardiovascular events, including coronary heart disease, hypertension, and diabetes. Recent studies have shown that the median age of diagnosis of FH globally is 44.4 years. In patients with Heterozygous FH (familial hypercholesterolemia) who are not receiving medication, the risk of coronary heart disease increases with increasing LDL-C levels. Over 2,000 FH-associated gene mutations have been discovered, including approximately 1,000 pathogenic or potentially pathogenic, the vast majority of which are concentrated in the LDLR gene. Furthermore, the vast majority (80.6%) of geographically relevant mutations are confined to a specific region. Although genetic testing is recognized as the "gold standard" for FH diagnosis, less than 1% of patients in China currently utilize genetic diagnosis. Clinicians have reported that many FH patients are diagnosed only after a major cardiovascular event, making early detection crucial.

[0003] Common methods for SNP genotyping include fluorescent quantitative PCR (i.e., QPCR, including Taqman probe method and melting curve method), Sanger sequencing method, target region capture, gene chip method and other methods.

[0004] Quantitative PCR (qPCR) is a technique that introduces a fluorescent substance into the PCR reaction system and monitors the fluorescence signal of each product during the PCR amplification cycle in real time, thereby quantitatively analyzing the initial template. The qPCR TaqMan probe method uses TaqMan fluorescent probes for fluorescence detection. Its basic principle is that a specific fluorescent probe is added to the PCR amplification system along with a pair of primers. The probe is labeled with a reporter fluorescent group and a quencher fluorescent group at each end. Initially, the probe binds completely to any single strand of DNA, and the fluorescent signal emitted by the reporter fluorescent group is absorbed by the quencher, making the fluorescent signal undetectable. During PCR amplification, the 5'-3' exonuclease activity of the Taq enzyme cleaves and degrades the probe, separating the reporter fluorescent group from the quencher fluorescent group, thereby emitting fluorescence. The number of fluorescent molecules cleaved is proportional to the amount of PCR product. Therefore, the amount of PCR product amplification can be determined by measuring the fluorescence intensity in the PCR reaction system. A fluorescent PCR dissociation curve is a curve that shows the degree of degradation of the double helix structure of DNA as temperature increases. The temperature at which half of the DNA double helix structure is degraded is called the melting temperature (Tm). Different DNA sequences have different Tm values. Genetic mutations can lead to different Tm values ​​in DNA sequences, allowing for the detection and differentiation of wild-type and mutant forms. Using QPCR for SNP typing is cost-effective for testing multiple samples (over 100 samples) at a single or small number of loci, and can quickly and automatically determine SNP locus information.

[0005] The Sanger sequencing method uses a DNA polymerase to extend a primer bound to a template of the sequence to be determined until a chain-terminating nucleotide is incorporated. Each sequence determination consists of a set of four separate reactions, each containing all four deoxynucleotide triphosphates (dNTPs) mixed with a limited amount of a different dideoxynucleoside triphosphate (ddNTP). Because ddNTPs lack the 3-OH group required for extension, the extended oligonucleotide selectively terminates at G, A, T, or C. The termination point is determined by the corresponding dideoxy in the reaction. The relative concentrations of each dNTP and ddNTP can be adjusted so that the reaction produces a set of chain-termination products ranging from several hundred to several thousand bases in length. They share a common starting point, and the termination point is determined by the corresponding dideoxy in the reaction. Sanger sequencing can directly obtain the target gene sequence and is the gold standard technology for SNP typing detection.

[0006] Target region sequencing (NGS sequencing), also known as targeted gene sequencing, refers to a genomic analysis method that uses special probes to obtain a specific DNA sequence of interest to the customer, and then performs high-throughput sequencing. There are two main methods to obtain a specified target DNA sequence: one is the capture method, which designs a series of oligonucleotide probes for a specific genomic region of interest, and enriches the specific genomic region by hybridizing the probes with whole-genome DNA fragments. The second is the PCR amplification method, which designs primers for the region of interest, and then PCR amplifies the DNA sequence of the region to be tested. Target region sequencing has great advantages in its high throughput and high accuracy, and can effectively solve the current need for multi-target and multi-gene testing based on clinical samples.

[0007] Gene chips, also known as DNA chips or biochips, are based on hybridization sequencing, a method for determining nucleic acid sequences by hybridization with a set of nucleic acid probes of known sequence. Probes with known target nucleotide sequences are immobilized on the surface of a substrate. When a fluorescently labeled nucleic acid sequence, TATGCAATCTAG, in solution, produces a complementary match with nucleic acid probes at corresponding positions on the gene chip, a set of fully complementary probe sequences is obtained by determining the position of the probe with the strongest fluorescence intensity. Based on this, the sequence of the target nucleic acid can be reconstructed.

[0008] The defects of the above-mentioned prior art are shown in Table 1.

[0009] Table 1

[0010] Summary of the Invention

[0011] According to the first aspect, in one embodiment, a kit for detecting familial hypercholesterolemia and statin gene is provided, the kit comprising primers for amplifying the SNP site, wherein the SNP site is located in at least one of a familial hypercholesterolemia-related gene and a drug administration guide gene;

[0012] The kit also includes an extension primer for extending one base at the SNP site of the PCR amplification product;

[0013] The familial hypercholesterolemia-related gene includes at least one of the LDLR gene and the APOB gene;

[0014] Said medications include statins;

[0015] The drug guidance gene includes at least one of the APOE gene and the SLCO1B1 gene.

[0016] According to the second aspect, in one embodiment, a method for detecting familial hypercholesterolemia and statin gene is provided, comprising:

[0017] An amplification step includes performing PCR amplification on the SNP site in the sample to be tested to obtain an amplified product;

[0018] a single base extension step, comprising performing single base extension on the amplified product to obtain an extended product;

[0019] A detection step, comprising performing mass spectrometry detection on the extension product to obtain the genotype of the SNP site;

[0020] The SNP site is located in at least one of a familial hypercholesterolemia-related gene and a drug guidance gene;

[0021] The familial hypercholesterolemia-related gene includes at least one of the LDLR gene and the APOB gene;

[0022] Said medications include statins;

[0023] The drug guidance gene includes at least one of the APOE gene and the SLCO1B1 gene.

[0024] Based on the kit and method for detecting SNP sites in the above embodiment, the present invention has developed a detection kit for common mutation hotspots and statin medication guidance sites in the Chinese population with familial hypercholesterolemia, which can be used for large-scale screening of high-risk populations, and can also achieve zero delay in screening and medication, realizing early screening, early diagnosis and early treatment.

[0025] In one embodiment, the present invention has the characteristics of low detection cost, short cycle, high throughput, no need for professional bioinformatics analysis, and automated data analysis. BRIEF DESCRIPTION OF THE DRAWINGS

[0026] Figure 1 An experimental flow chart of an embodiment;

[0027] Figure 2 The results of the mutant plasmid sample detection in Example 1 (mass spectrometry peaks of some sites). DETAILED DESCRIPTION

[0028] The present invention is further described in detail below by specific embodiments in conjunction with the accompanying drawings. In the following embodiments, many detailed descriptions are intended to enable the present application to be better understood. However, those skilled in the art can readily appreciate that some of the features may be omitted in different circumstances, or may be replaced by other materials or methods. In some cases, some operations related to the present application are not shown or described in the specification. This is to avoid the core of the present application being overwhelmed by excessive descriptions, and for those skilled in the art, it is not necessary to describe these related operations in detail. They can fully understand the related operations based on the description in the specification and the general technical knowledge in the art.

[0029] In addition, the features, operations, or characteristics described in the specification may be combined in any appropriate manner to form various embodiments. Furthermore, the steps or actions in the method description may be reordered or adjusted in a manner readily apparent to those skilled in the art. Therefore, the various sequences in the specification and drawings are provided solely for the purpose of clearly describing a particular embodiment and are not intended to be mandatory, unless otherwise specified.

[0030] The serial numbers assigned to the components in this document, such as "first", "second", etc., are only used to distinguish the objects described and do not have any order or technical meaning.

[0031] Familial hypercholesterolemia (FH) is a hereditary disease characterized by high blood cholesterol levels (LDL-c), leading to premature heart attacks. It is the most severe inherited metabolic disease, characterized by three major clinical features: significantly elevated LDL-c concentrations, skin / tendon xanthomas, and premature onset of ascorbic acid (CVD). FH is primarily caused by mutations in the LDL receptor, apolipoprotein B, or PCSK9, which lead to defective liver LDL receptor function. This elevated plasma low-density lipoprotein (LDL) levels triggers premature atherosclerosis / coronary heart disease, and ultimately, angina pectoris and myocardial infarction in severe cases. FH has four key characteristics: 1) High incidence, with a reported global prevalence of 1 / 250-1 / 500. 2) Low FH diagnosis rates. With the exception of the Netherlands and several Nordic countries in Europe, the diagnosis rate in other countries is below 10%, and in China, the FH diagnosis rate is 1%-2%. 3) FH is a significant risk factor for premature coronary artery disease (CAD). Patients with genetically determined FH have a 6-20-fold increased risk of CAD compared to those without FH, and the risk of adverse cardiovascular events is highest in patients with monogenic FH. 4) The disease is treatable and controllable. Generally, untreated, a heterozygous FH patient will develop CAD by age 35. If low-dose medication is initiated in childhood, at ages 11 or 12, the onset of CAD approaches that of a normal individual. Even if high-dose medication is initiated in adolescence, the age of CAD onset is delayed compared to no medication at all. Studies have shown that early intervention for FH patients significantly extends their lifespan, even to a similar average lifespan to that of a healthy individual, and significantly improves their quality of life. Therefore, early screening, diagnosis, and treatment of FH are crucial.

[0032] Currently, over 2,000 mutations have been reported in clinical FH patients worldwide, 90% of which are LDLR mutations. According to the ACMG guidelines, 65% of these mutations are pathogenic or suspected pathogenic. Of the reported LDLR mutations, the vast majority with geographic information are confined to a specific region, with only seven LDLR mutations found across five continents. This suggests that FH mutations vary significantly across different populations. Our research on FH mutations in the Chinese population has revealed approximately 150 LDLR mutations, and mutation hotspots vary across different regions of China. Preliminary research has revealed FH mutation hotspots in both southern and northern China.

[0033] Statins are the most commonly used lipid-lowering medications. However, their efficacy varies significantly between individuals, and some individuals may even experience severe toxic side effects. Studies both domestically and internationally have shown that testing for SLCO1B1 and ApoE gene polymorphisms can predict a patient's metabolic rate and sensitivity to statins.

[0034] Currently, there are many patients with FH in China, but awareness is low and diagnosis is generally late, resulting in a high risk of cardiovascular disease. Statins, as mainstream treatments, have varying efficacy and adverse reactions, with this variation primarily attributable to genetics. In particular, genetic polymorphisms in key transporters involved in statin hepatic metabolism, such as the anion transporting polypeptide 1B1 (OATP1B1) (encoded by the SLCO1B1 gene) and apolipoprotein E (ApoE), can affect statin plasma and liver concentrations, thereby influencing statin efficacy and safety. Organic anion transporting polypeptide 1B1 (OATP1B1, also known as OATP-C, OATP2, or LST1), is specifically expressed on the basement membrane of hepatocytes and plays a crucial role in the uptake and clearance of endogenous and exogenous substances, such as bile acids, statins, repaglinide, and enalaprilat. OATP1B1 is encoded by the SLCO1B1 gene. The 521T>C (Val174Ala) polymorphism in exon 5 of this gene is a predominant genetic variant in Asian populations, with an allele frequency of 10–15%. This polymorphism significantly reduces the ability of OATP1B1 to uptake its substrates, leading to elevated plasma concentrations of statins such as pravastatin, atorvastatin, and rosuvastatin. Serious adverse reactions to statins include decreased liver function and rhabdomyolysis. Patients with the 521C allele have a significantly increased risk of myopathy when taking simvastatin and cerivastatin. To reduce the risk of serious adverse reactions to statins, it is recommended that statin therapy be selected based on SLCO1B1 genotype. Apolipoprotein E (APOE) is an apolipoprotein present in chylomicrons and intermediate-density lipoproteins. It is primarily produced by the liver and macrophages and is involved in the transport, storage, and excretion of lipids. The human APOE gene is located on chromosome 19, at 19q13.2. Two functional SNPs within this gene, rs429358 (c.388T>C) and rs7412 (c.526C>T), form three haplotypes, which in turn form six distinct genotypes (E2 / E2, E3 / E3, E4 / E4, E2 / E3, E2 / E4, and E3 / E4). E3 / E3 is the most common genotype, with a frequency of approximately 60% in the population. The lipid-lowering drug pravastatin competitively inhibits 3-hydroxy-3-methylglutaryl coenzyme A reductase (HMG-CoA reductase), thereby inhibiting cholesterol synthesis in the liver. This leads to a feedback loop increase in low-density lipoprotein (LDL) receptor expression on the hepatocyte surface, enhancing receptor-mediated LDL catabolism and clearance from the blood. The FDA (Food and Drug Administration) has designated APOE2 as a biomarker associated with pravastatin response. Pravastatin has a greater lipid-lowering effect in patients with hyperlipidemia whose genotype is APOE E2 / E2.

[0035] Statins, as mainstream treatments, have varying efficacy and adverse reactions, driven by genetic differences. Therefore, technologies and products that simultaneously detect common genetic loci for familial hypercholesterolemia in Chinese individuals and those that guide statin use, while offering rapid testing cycles and low cost, could benefit more people and families with high blood lipids.

[0036] Currently available testing technologies for dyslipidemia primarily utilize NGS and Sanger assays. NGS testing is costly and time-consuming, while Sanger assays have low throughput, making them inadequate for FH screening. 23andMe, a global company, offers a test that uses qualitative genotyping to detect 24 FH hotspots. However, these mutation hotspots are primarily concentrated in European and Lebanese populations, making it unsuitable for testing in the Chinese population. Therefore, existing technologies are unable to rapidly detect FH mutation hotspots and statin-guided gene loci in the Chinese population.

[0037] According to the first aspect, in one embodiment, a kit for detecting familial hypercholesterolemia and statin drug genes is provided, the kit including primers for amplifying SNP sites, the SNP sites being located in at least one of familial hypercholesterolemia-related genes and drug medication guidance genes; the kit also includes extension primers for extending one base at the SNP site of the PCR amplification product, where the base is the SNP to be detected.

[0038] In one embodiment, the familial hypercholesterolemia-related genes include but are not limited to at least one of the LDLR gene and the APOB gene.

[0039] In one embodiment, drugs include but are not limited to statins.

[0040] In one embodiment, the drug guidance gene includes but is not limited to at least one of the APOE gene and the SLCO1B1 gene.

[0041] In one embodiment, the SNP sites located in the LDLR gene include but are not limited to at least one of the following sites:

[0042] c.12G>A c.760C>T c.1216C>A c.1757C>A c.97C>T c.817+1G>A c.1241T>G c.1783C>T c.101G>C [[ID=] ​ ​ ​ ​ ​ ​ ​ ​ ​ ​ ​ ​ ​ ​ ​ ​ ​ ​ ​ ​ ​ ​ ​ ​ ​ ​ ​ ​ ​ ​ ​ ​ ​ ​ ​ ​ ​ ​ ​ / ​ ​

[0043] In one embodiment, the SNP site located in the LDLR gene further includes at least one of the following sites: c.769C>T, c.1765G>A;

[0044] In one embodiment, the SNP site located in the APOB gene includes but is not limited to c.10579C>T.

[0045] In one embodiment, the SNP sites located in the APOE gene include but are not limited to at least one of the following sites: c.388T>C, c.526C>T.

[0046] In one embodiment, the SNP sites located in the SLCO1B1 gene include but are not limited to at least one of the following sites: c.388A>G, c.521T>C.

[0047] In one embodiment, SNP sites are used to genotype a sample from a subject.

[0048] In one embodiment, the sample includes a sample comprising a human genome.

[0049] In one embodiment, the sample includes but is not limited to a whole blood sample, a buccal swab sample, a saliva sample, and a dried blood spot sample.

[0050] In one embodiment, the kit is used to diagnose a disease and / or guide medication.

[0051] In one embodiment, the disease includes but is not limited to at least one of familial hypercholesterolemia and hyperlipidemia.

[0052] In one embodiment, the primers used to amplify the SNP site include at least one of a first amplification primer and a second amplification primer, and the first amplification primer includes at least one of the primers shown in SEQ ID Nos. 1 to 15 and SEQ ID Nos. 18 to 32;

[0053] The second amplification primer includes at least one of the primers shown in SEQ ID No. 63 to 102.

[0054] In one embodiment, the first amplification primer further comprises at least one of the primers shown in SEQ ID No. 16, 17, 33, and 34.

[0055] In one embodiment, the primers used to amplify the SNP site include all of the first amplification primer and the second amplification primer.

[0056] In one embodiment, the first amplification primer and the second amplification primer are used in the same PCR amplification reaction system.

[0057] In one embodiment, the first amplification primer and the second amplification primer are used in different PCR amplification reaction systems.

[0058] In one embodiment, the extension primer includes at least one of a first extension primer and a second extension primer, and the first extension primer includes at least one of the primers shown in SEQ ID Nos. 37 to 62;

[0059] The second extension primer includes at least one of the primers shown as SEQ ID Nos. 103 to 128.

[0060] In one embodiment, the first extension primer further comprises at least one of the primers shown in SEQ ID No. 35 and 36.

[0061] In one embodiment, the extension primer includes all of the first extension primer and the second extension primer.

[0062] In one embodiment, the first extension primer and the second extension primer are used in the same extension reaction system.

[0063] In one embodiment, the first extension primer and the second extension primer are used in different extension reaction systems.

[0064] In one embodiment, the kit further includes reagents for PCR amplification and / or extension reactions. Each reagent is packaged separately and then mixed upon use. The reagents include, but are not limited to, buffers, enzymes, dNTPs, nuclease-free water, and the like required for the reaction.

[0065] In one embodiment, the kit further includes instructions for use to guide users.

[0066] In one embodiment, the kit further includes containers for containing each reagent.

[0067] According to the second aspect, in one embodiment, a method for detecting familial hypercholesterolemia and statin gene is provided, comprising:

[0068] An amplification step includes performing PCR amplification on the SNP site in the sample to be tested to obtain an amplified product;

[0069] a single base extension step, comprising performing single base extension on the amplified product to obtain an extended product;

[0070] A detection step includes performing mass spectrometry on the extension product to obtain the genotype of the SNP site;

[0071] The SNP site is located in at least one of a familial hypercholesterolemia-related gene and a drug guidance gene.

[0072] The genotype of the SNP site obtained by this method is an intermediate result. Clinically, the genotype result is used to further determine which drug or other treatment method to use for the patient. For example, if the genotype of the sample of a patient with hyperlipidemia is APOE E2 / E2, pravastatin will be considered for lipid-lowering. In addition, the patient's hyperlipidemia is also the result of a comprehensive diagnosis based on clinical symptoms, medical history, and other test results. The SNP site results of the present invention cannot directly determine what disease the patient has. The SNP site genotype detected by this method is only used as a basis for selecting statins for treatment. Therefore, this method does not belong to the diagnosis method of the disease.

[0073] In one embodiment, the familial hypercholesterolemia-related genes include but are not limited to at least one of the LDLR gene and the APOB gene.

[0074] In one embodiment, drugs include but are not limited to statins.

[0075] In one embodiment, the drug guidance gene includes but is not limited to at least one of the APOE gene and the SLCO1B1 gene.

[0076] In one embodiment, the SNP sites located in the LDLR gene include but are not limited to at least one of the following sites:

[0077] ​ ​ ​ ​ ​ ​ ​ ​ ​ ​ ​ ​ ​ ​ ​ ​ ​ ​ ​ ​ ​ ​ ​ ​ ​ ​ ​ ​ ​ ​ ​ ​ ​ ​ ​ ​ ​ ​ ​ ​ ​ ​ ​ ​ ​ ​ ​ ​ ​ / ​ ​ .

[0078] In one embodiment, the SNP site located in the LDLR gene further includes at least one of the following sites: c.769C>T, c.1765G>A.

[0079] In one embodiment, the SNP site located in the APOB gene includes but is not limited to c.10579C>T.

[0080] In one embodiment, the SNP sites located in the APOE gene include but are not limited to at least one of the following sites: c.388T>C, c.526C>T.

[0081] In one embodiment, the SNP sites located in the SLCO1B1 gene include but are not limited to at least one of the following sites: c.388A>G, c.521T>C.

[0082] In one embodiment, the sample to be tested includes a sample containing a human genome.

[0083] In one embodiment, the sample to be tested includes but is not limited to a whole blood sample, an oral swab sample, a saliva sample, and a dried blood spot sample.

[0084] In one embodiment, the disease includes but is not limited to at least one of familial hypercholesterolemia and hyperlipidemia.

[0085] In one embodiment, the primers used to amplify the SNP site include at least one of a first amplification primer and a second amplification primer, and the first amplification primer includes at least one of the primers shown in SEQ ID Nos. 1 to 15 and SEQ ID Nos. 18 to 32;

[0086] The second amplification primer includes at least one of the primers shown in SEQ ID No. 63 to 102.

[0087] In one embodiment, the first amplification primer further comprises at least one of the primers shown in SEQ ID No. 16, 17, 33, and 34.

[0088] In one embodiment, in the amplification step, the primers used to amplify the SNP site include all of the first amplification primer and the second amplification primer.

[0089] In one embodiment, the first amplification primer and the second amplification primer are used in the same PCR amplification reaction system.

[0090] In one embodiment, the first amplification primer and the second amplification primer are used in different PCR amplification reaction systems.

[0091] In one embodiment, the single primer extension step includes using an extension primer to extend one base at the SNP site of the amplification product.

[0092] In one embodiment, the extension primer includes at least one of a first extension primer and a second extension primer, and the first extension primer includes at least one of the primers shown in SEQ ID Nos. 37 to 62;

[0093] The second extension primer includes at least one of the primers shown as SEQ ID Nos. 103 to 128.

[0094] In one embodiment, the first extension primer further comprises at least one of the primers shown in SEQ ID No. 35 and 36.

[0095] In one embodiment, the extension primer includes all of the first extension primer and the second extension primer.

[0096] In one embodiment, the first extension primer and the second extension primer are used in the same extension reaction system. If the mass spectrometer supports simultaneous detection of 60 or more targets, the first amplification primer and the second amplification primer can be added to the same amplification reaction system for amplification, and the first extension primer and the second extension primer can be added to the same extension reaction system for extension during the amplification step.

[0097] In one embodiment, the first extension primer and the second extension primer are used in different extension reaction systems.

[0098] In one embodiment, the mass spectrometry comprises matrix-assisted laser desorption ionization time-of-flight mass spectrometry.

[0099] In one embodiment, in the detection step, a matrix-assisted laser desorption ionization time-of-flight mass spectrometer (MAL DI-TOF MS) is specifically used. The instrument ionizes the bound molecules with the aid of a matrix, and the generated ions are accelerated through the flight pipeline under the action of an electric field. Their mass and the charge they carry can affect their flight time. Therefore, the objects to be detected are separated according to the difference in their flight time to the detector. The greatest advantage of MALDI-TOF-MS is that the flux is high, and one tube can detect multiple gene loci. The SNP detection based on time-of-flight mass spectrometry is high in accuracy, strong in flexibility, large in flux, and short in detection cycle, and is suitable for developing screening products.

[0100] Example 1

[0101] The nucleic acid mass spectrometry (MALDI-TOF MS) detection platform can detect 30 to 40 targets per well, offering low testing costs, short turnaround times, high throughput, no need for specialized bioinformatics analysis, and automated data analysis. This example, based on the MALDI-TOF MS platform, develops detection technology for common mutation hotspots and statin-guided sites in the Chinese population with familial hypercholesterolemia. This technology enables large-scale screening of high-risk populations, with zero delay between screening and medication administration, enabling early screening, diagnosis, and treatment.

[0102] 1. Technical Principle

[0103] 1) Site selection

[0104] Based on relevant literature reports, this example investigates 54 common FH mutation hotspots in the Chinese population and 4 statin medication guidance sites. According to a review of studies on Chinese populations, 295 probands have been reported in studies of 63 existing Chinese LDLR mutation sites, including more than 130 LDLR mutations, and the mutation hotspots vary in different regions of China. Among the 131 mutations, C308Y (c.986G>A, p.Cys329Tyr), H562Y (c.1747C>T, His583Tyr), and A606T (c.1879G>A, p.Ala627thr) mutations have a higher reported frequency, accounting for 23% of probands. In addition, based on their different geographical locations in China, different mutation hotspots were determined in three regions (Northern China, Southern China (excluding Taiwan), and Taiwan). The three most common mutations in northern China are A606T (c.1879G>A, p.Ala627Thr), D601Y (c.1864G>T, p.Asp622Tyr), and 313+1G>A, accounting for 18.5%, 14.8%, and 7.4% of probands in northern China, respectively. The predominant mutations in southern China (excluding Taiwan) differ from those in northern China: W462X (c.1448G>A, p.Trp483X), A606T (c.1879G>A, p.Ala627Thr), and L393R (c.1241T>G, p.Leu414Arg), accounting for 10.7%, 7.5%, and 5.4% of probands in southern China (excluding Taiwan), respectively. However, there are significant differences between Taiwan and other provinces. The three most common mutations in Taiwan are C308Y (c.986G>A, p.Cys329Tyr), H562Y (c.1747C>T, His583Tyr), and D69N (c.268G>A, p.Asp90Asn), accounting for 12%, 11.4%, and 7.4% of probands in Taiwan, respectively. Through literature review, 54 common FH mutations in the Chinese population and four mutations that guide statin use were selected, as shown in Table 2.

[0105] Table 2 Common FH mutation sites and statin-related sites in the Chinese population

[0106]

[0107] 2) Nucleic acid mass spectrometry MALDI-TOF MS platform detection

[0108] The principle of MALDI-TOF MS genotyping is to perform a single gene extension reaction on the target sequence amplified by PCR. The reaction is to design a probe next to the SNP site, replace dNTP with ddNTP in the reaction system, so that the probe is extended by one base at the SNP site and terminated. In the reaction system, the probe will combine with different ddNTPs according to the difference of the SNP site to generate products of different molecular weights. The extended product is combined with the chip matrix to form a compound and then subjected to genotyping analysis by flight mass spectrometry. In this embodiment, primer design software (ASSAY DESIGN SUITE) is used to design primers for 54 common FH mutation sites and 4 statin medication guidance gene sites in the Chinese population. According to the SNP sequence information to be tested, a set of primer combinations including PrePCR and extension primers is designed by adjusting the hairpin / dimer of the PrePCR primer and the extension primer, the frequency of adjacent SNP sites, the detection population and other parameters. After experimental testing, the primer combination designed by the software can successfully detect all candidate SNP sites, the corresponding product peak is obvious, and the mass spectrometry software has a high degree of automated interpretation. This embodiment has high sensitivity and can detect low concentrations of samples as low as 1 ng / μL in blood samples and oral swab samples, allowing for simultaneous multi-locus typing of a large number of samples. The primer combinations are shown in Tables 3 and 4.

[0109] Table 3well1 PrePCR & extension primer combinations

[0110]

[0111]

[0112] Table 4well2 PrePCR & extension primer combinations

[0113]

[0114]

[0115] 2. Testing process

[0116] 2.1 Testing process ​ As shown, it mainly includes the following steps:

[0117] 1) Preparation of primer mix

[0118] Order amplification primers (upstream primer, downstream primer) and extension primer powder according to the primer sequence. Centrifuge at 8000 rpm for 5 minutes and dilute to 100 μM with Nuclease-Free water. Prepare two sets of amplification primer and extension primer mixtures (well 1 and well 2). Use each tube of mixture no more than 5 times. Stop using if primer degradation is found.

[0119] 2) Enrich the target fragment by amplification using PrePCR primers.

[0120] A two-reaction multiplex PCR amplified the target DNA sequence. One reaction (well 1) detected 28 target sites, and the other reaction (well 2) detected 30 target sites. Since a single nucleic acid mass spectrometry reaction in this example can typically detect 30-40 target sites, and this example detected a total of 58 sites, two reactions were required.

[0121] 3) SAP digestion

[0122] After PCR amplification, SAP digestion was performed to remove excess enzyme, buffer, and Mg 2+ , dNTP and other reagents.

[0123] 4) Single base extension reaction

[0124] After PCR amplification, add SNP sequence-specific extension primers to extend the product by 1 base at the SNP site.

[0125] 5) Chip spotting and mass spectrometry detection

[0126] The prepared sample analyte is co-crystallized with the chip matrix and placed in the vacuum tube of a mass spectrometer. Then, with a transient nanosecond (10-9s) intense laser excitation, the nucleic acid molecules desorb and transform into metastable ions, most of which are singly charged. Due to the difference in molecular mass between different bases, their journey through the mass spectrometer varies, and the base type is determined based on the peak position.

[0127] 2.2 The specific method of this embodiment is as follows:

[0128] 2.2.1 DNA extraction from whole blood (MagPure Buffy Coat DNA Midi KF kit)

[0129] 1) Reagent preparation: Prepare Proteinase K, Buffer MBD, Buffer AW1, and Buffer AW2 according to the instructions.

[0130] 2) Take five 96-well square-conical-bottom deep-well plates and label them with a marker pen: Sample, Wash1, Wash2, Wash3, and Elute.

[0131] 3) According to Table 5, transfer each reagent to the corresponding 96-well plate and centrifuge briefly at 3000 rpm.

[0132] Table 5 Preparation of nucleic acid extraction reagents for whole blood samples

[0133]

[0134] 4) Mix 200 μL of whole blood sample and transfer it to the sample plate. Centrifuge briefly at 3000 rpm.

[0135] 5) Place the five centrifuged deep-well plates and magnetic sleeves in the designated locations on the nucleic acid extraction instrument. Select the Whole Blood-200 extraction program and start the program according to the instrument prompts.

[0136] 6) After 15 minutes, pause the instrument, remove the sample plate, and add 400 μL of Buffer MBD to each empty space. Return the sample plate to the instrument and run the program.

[0137] 7) After the instrument operation is completed, remove the Elute plate, mix the DNA sample, centrifuge it, and then aliquot it.

[0138] 8) Add 1 μL of extracted DNA to a microplate containing 99 μL of 1× TE solution, followed by 100 μL of BMG solution. Measure the nucleic acid concentration using a microplate reader to ensure it is ≥ 5 ng / μL. If not, re-extraction is required.

[0139] 2.2.2 DNA extraction from oral swab (MagPure Buffy Coat DNA Midi KF kit)

[0140] 1) Reagent preparation: Prepare Proteinase K, Buffer MBD, Buffer AW1, and Buffer AW2 according to the instructions.

[0141] 2) Take five 96-well square-conical-bottom deep-well plates and label them with a marker pen: Sample, Wash1, Wash2, Wash3, and Elute.

[0142] 3) According to Table 6, transfer each reagent to the corresponding 96-well plate and centrifuge briefly at 3000 rpm.

[0143] Table 6 Preparation of nucleic acid extraction reagents for oral swab samples

[0144]

[0145] 4) Mix 500 μL of oral swab sample and transfer it to the sample plate. Centrifuge briefly at 3000 rpm.

[0146] 5) Place the five centrifuged deep-well plates and magnetic sleeves in the designated locations on the nucleic acid extraction instrument. Select the multi-sample extraction program and start the program according to the instrument prompts.

[0147] 6) After 30 minutes, pause the instrument, remove the sample plate, and add 400 μL of Buffer MBD to each empty space. Return the sample plate to the instrument and run the program.

[0148] 7) After the instrument operation is completed, remove the Elute plate, mix the DNA sample, centrifuge it, and then aliquot it.

[0149] 8) Add 1 μL of extracted DNA to a microplate containing 99 μL of 1× TE solution, followed by 100 μL of BMG solution. Measure the nucleic acid concentration using a microplate reader to ensure it is ≥ 5 ng / μL. If not, re-extraction is required.

[0150] 2.2.3 PCR amplification reaction (one sample requires two reactions)

[0151] 1) Open Gold, PCR Reagents & SpectroC Kit: Remove Nuclease-Free Water, 10× PCR Buffer, 25 mM MgCl₂, Well 1 Amplification Primer Mix, and Well 2 Amplification Primer Mix from -20°C. Thaw, then vortex to mix thoroughly. Centrifuge and set aside. Place 5 U / μL PCR Enzymez on ice until ready to use.

[0152] 2) Prepare the reaction system: prepare the PCR amplification reaction system according to the table below.

[0153] Table 7 Well 1 PCR amplification reaction solution system

[0154]

[0155] Table 8 Well 2 PCR amplification reaction solution system

[0156]

[0157] 3) Prepare a 384-well plate and add the above reaction mixture into the 384-well plate in an array pattern, with 4 μL per well.

[0158] 4) Add the corresponding samples, positive control (YH DNA solution), and negative control (Nuclease-Freewater) to the corresponding 384-well tubes, 1 μL per well, seal the tube, and centrifuge at 3000 rpm for 5 seconds.

[0159] 5) Place the 384-well plate containing the reagents into the PCR instrument and run the reaction program according to the program in the table below:

[0160] Table 9 PCR amplification reaction program

[0161]

[0162] 2.2.4SAP digestion reaction

[0163] 1) Open For Gold, PCR Reagents & SpetroC kits, remove Nuclease-Free Water and SAP Buffer from -20°C, thaw, vortex, and centrifuge until ready to use. Store SAP Enzyme on ice until ready to use.

[0164] 2) Preparation of reaction system: Prepare the SAP digestion reaction system according to the table below.

[0165] Table 10SAP digestion reaction liquid system

[0166]

[0167] 3) Add the above SAP reaction mixture to a 384-well plate in a plate array, 2 μL per well. Seal the plate and centrifuge at 3000 rpm for 5 seconds.

[0168] 4) Place the 384-well plate containing the reagents into the PCR instrument and run the reaction program according to the program in the table below:

[0169] Table 11SAP digestion reaction program

[0170]

[0171]

[0172] 2.2.5 Extension reaction

[0173] 1) Open For the Gold PCR Reagents & SpetroC kit, remove Nuclease-Free Water, iPLEX Buffer, iPLEX Termination Mix, and the extension primer mix in Wells 1 and 2 from -20°C. Thaw and vortex to mix thoroughly. Centrifuge and set aside. Keep iPLEX Enzyme on ice until ready to use.

[0174] 2) Preparation of reaction system: prepare the extension reaction system according to the table below.

[0175] Table 12 Well 1 extension reaction system

[0176]

[0177] Table 13 Well 2 extension reaction system

[0178]

[0179] 3) Add the extension reaction mixture to a 384-well plate in a plate array, 2 μL per well. Seal the plate and centrifuge at 3000 rpm for 5 seconds.

[0180] 4) Place the 384-well plate containing the reagents into the PCR instrument and run the reaction program according to the program in the table below:

[0181] Table 14 Extension reaction program

[0182]

[0183] 2.2.6 Resin purification

[0184] 1) After the extension reaction, the 384-well plate was centrifuged at 3000 rpm for 5 seconds, 20 μL of Nuclease-Free Water was added, the membrane was sealed, and the plate was centrifuged at 4000 rpm for 5 minutes.

[0185] 2) Fill the mold with resin and blow dry the resin with a blower for about 5-6 minutes. Attach the 384-well plate symmetrically to the mold, flip it over, fill the sample with resin, and seal the plate.

[0186] 3) Mix the above 384 plates using a silent mixer for 45 minutes and centrifuge at 4000 rpm for 5 minutes.

[0187] 2.2.7 Sample

[0188] Open the chip and 384-well plate, place them on the sample spotter, write the program, and start the sample spotting program.

[0189] 2.2.8 Nucleic acid mass spectrometry detection and result analysis

[0190] The test results are as follows:

[0191] 126 whole blood samples were tested, including varying numbers of wild-type and mutant FH and drug-specific sites. Using Sanger assay results as the gold standard, the accuracy of the method of this example for each site was calculated. The test results are shown in Tables 15 and 16.

[0192] Table 15FH site typing results

[0193] ​ ​ ​ ​ ​ ​ 1 100％ ​ ​ 1 100％ ​ ​ 1 100％ ​ ​ 1 100％ ​ ​ 1 100％ ​ ​ 1 100％ c.2344A>T AT 1 100％ c.2389G>A GA 2 100％ c.268G>A GA 4 100％ c.313+1G>A GA 1 100％ c.682G>A GA 1 100％ c.682G>T GT 1 100％ c.97C>T CT 3 100％ c.986G>A GA 4 100％ FH negative - 103 100％ total - 126 100％

[0194] Table 16 Drug site typing results

[0195]

[0196] If the test results are consistent with the Sanger test, the accuracy is 100%. As shown in Table 15, all selected FH loci were accurately typed for both wild-type and mutant forms, with a sensitivity of 100% and a specificity of 100%. As shown in Table 16, both wild-type and mutant forms of the drug locus were accurately typed, with both sensitivity and specificity of 100%.

[0197] 3. Detection results of known FH mutant plasmids

[0198] Using a known FH mutant plasmid, the mutant sites were all correctly typed using the method of this example. The test results are shown in Table 17. The mass spectrometry peaks of some sites are shown in Table 17. Figure 2 .

[0199] Table 17 Homozygous mutation site detection results

[0200]

[0201]

[0202] As can be seen from Table 17, this example achieves accurate typing of 54 FH homozygous mutation sites.

[0203] In one embodiment, the present invention targets 54 common mutation hotspots and 4 statin guidance sites in the Chinese population with familial hypercholesterolemia, and develops a SNP site combination, primer set, and kit for early screening of familial hypercholesterolemia and guidance of statin use. The method has the advantages of low detection cost, short cycle, high throughput, no need for professional bioinformatics analysis, and automation of data and reporting. It can conduct large-scale screening of high-risk populations (such as those with hyperlipidemia), and can also achieve zero delay in screening and medication, realizing early screening, early diagnosis, and early treatment.

[0204] In one embodiment, the test samples of the present invention are not limited to whole blood and oral swabs, but also include saliva, dried blood spots and other samples containing human genomes.

[0205] In one embodiment, other mass spectrometry sequencers used in the present invention can achieve the same effect.

[0206] The above examples are used to illustrate the present invention, which are only used to help understand the present invention and are not intended to limit the present invention. Those skilled in the art can make several simple deductions, modifications or substitutions based on the concept of the present invention. SEQUENCE LISTING <110> Shenzhen BGI Genomics Co., Ltd. <120> Kit for detecting familial hypercholesterolemia and statin gene <130> 22I33831 <160> 128 <170> PatentIn version 3.3 <210> 1 <211> 30 <212> DNA <213> Artificial sequence <400> 1 acgttggatg ctgactccgc ttcttctgcc 30 <210> 2 <211> 30 <212> DNA <213> Artificial sequence <400> 2 acgttggatg gacttcagct gtgggggccc 30 <210> 3 <211> 30 <212> DNA <213> Artificial sequence <400> 3 acgttggatg tgggaagtgc atctctcggc 30 <210> 4 <211> 30 <212> DNA <213> Artificial sequence <400> 4 acgttggatg cccacggcgt ctcttcctat 30 <210> 5 <211> 30 <212> DNA <213> Artificial sequence <400> 5 acgttggatg ggccctgcgc agggaccaac 30 <210> 6 <211> 30 <212> DNA <213> Artificial sequence <400> 6 acgttggatg ctcggccttc gagttccact 30 <210> 7 <211> 30 <212> DNA <213> Artificial sequence <400> 7 acgttggatg gttggagtgt ggcttctcca 30 <210> 8 <211> 30 <212> DNA <213> Artificial sequence <400> 8 acgttggatg aggaagatga cgctggaccg 30 <210> 9 <211> 30 <212> DNA <213> Artificial sequence <400> 9 acgttggatg cactctctta tctacatagg 30 <210> 10 <211> 30 <212> DNA <213> Artificial sequence <400> 10 acgttggatg ttgcttctct cctgcagctc 30 <210> 11 <211> 30 <212> DNA <213> Artificial sequence <400> 11 acgttggatg tgcctcctct ggctcagccg 30 <210> 12 <211> 30 <212> DNA <213> Artificial sequence <400> 12 acgttggatg atcccagtgt ttaacgggat 30 <210> 13 <211> 30 <212> DNA <213> Artificial sequence <400> 13 acgttggatg cgcctcgcctcccacctgcg 30 <210> 14 <211> 30 <212> DNA <213> Artificial sequence <400> 14 acgttggatg tctttagttg gcaggaaata 30 <210> 15 <211> 30 <212> DNA <213> Artificial sequence <400> 15 acgttggatg ggaatatttc tctgtatttc 30 <210> 16 <211> 30 <212> DNA <213> Artificial sequence <400> 16 acgttggatg aacacactct gtcctgtttt 30 <210> 17 <211> 30 <212> DNA <213> Artificial sequence <400> 17 acgttggatg ggaccctctg ggactggcat 30 <210> 18 <211> 30 <212> DNA <213> Artificial sequence <400> 18 acgttggatg gcatgccgtc cgggcaggcg 30 <210> 19 <211> 30 <212> DNA <213> Artificial sequence <400> 19 acgttggatg agagacaaag tcagaccact 30 <210> 20 <211> 30 <212> DNA <213> Artificial sequence <400> 20 acgttggatgggcccacagc tgggggatgc 30 <210> twenty one <211> 30 <212> DNA <213> Artificial sequence <400> twenty one acgttggatg tggcttggag ccgttctccc 30 <210> twenty two <211> 30 <212> DNA <213> Artificial sequence <400> twenty two acgttggatg gaaactgagg catgaggggt 30 <210> twenty three <211> 30 <212> DNA <213> Artificial sequence <400> twenty three acgttggatg tgaaatggga atactttctt 30 <210> twenty four <211> 30 <212> DNA <213> Artificial sequence <400> twenty four acgttggatg ttgagtcatc taccaaagga 30 <210> 25 <211> 30 <212> DNA <213> Artificial sequence <400> 25 acgttggatg tctcacctgc gggccaaggc 30 <210> 26 <211> 30 <212> DNA <213> The snowstorm <400> 26 acgttggatg tcaatgtaag aaagccccaa <210> 27 <211> 30 <212> DNA <213> The snowstorm <400> 27 acgttggatg gccccaagcc aggagaggcc 30 <210> 28 <211> 30 <212> DNA <213> The snowstorm <400> 28 30. acgttggatg gattctattg ctggccacct <210> 29 <211> 30 <212> DNA <213> The snowstorm <400> 29 acgttggatg ggtggggctg acccaccctt 30 <210> 30 <211> 30 <212> DNA <213> The snowstorm <400> 30 acgttggatg ggcgctcgcg gatggcgctg <210> 31 <211> 30 <212> DNA <213> The snowstorm <400> 31 30. acgttggatg cgtctcctgg gactcatcag <210> 32 <211> 30 <212> DNA <213> Artificial sequence <400> 32 acgttggatg gctaatgaat atcacaacat 30 <210> 33 <211> 30 <212> DNA <213> Artificial sequence <400> 33 acgttggatg acaaatcatt tgcaagcagc 30 <210> 34 <211> 30 <212> DNA <213> Artificial sequence <400> 34 acgttggatg acctcaaaga cggccaagga 30 <210> 35 <211> 13 <212> DNA <213> Artificial sequence <400> 35 ccggcagtgt gac 13 <210> 36 <211> 17 <212> DNA <213> Artificial sequence <400> 36 tcaccatctc aagcatc 17 <210> 37 <211> 15 <212> DNA <213> Artificial sequence <400> 37 tgtgcctccc tgccc 15 <210> 38 <211> 15 <212> DNA <213> Artificial sequence <400> 38 ggcaggccac actta 15 <210> 39 <211> 16 <212> DNA <213> Artificial sequence <400> 39 actgagccgt ccaagc 16 <210> 40 <211> 14 <212> DNA <213> Artificial sequence <400> 40 tcccaggaca gagt 14 <210> 41 <211> 15 <212> DNA <213> Artificial sequence <400> 41 caccttcgca tcttc 15 <210> 42 <211> 16 <212> DNA <213> Artificial sequence <400> 42 ggttgactcc aaactt 16 <210> 43 <211> 15 <212> DNA <213> Artificial sequence <400> 43 gtggctgcgt taatg 15 <210> 44 <211> 18 <212> DNA <213> Artificial sequence <400> 44 ttataccgca gttttcct 18 <210> 45 <211> 18 <212> DNA <213> Artificial sequence <400> 45 aacggtccac ttggccat 18 <210> 46 <211> 18 <212> DNA <213> Artificial sequence <400> 46 cgtaattcca agagcaca 18 <210> 47 <211> 18 <212> DNA <213> Artificial sequence <400> 47 tggaggccag caatagaa 18 <210> 48 <211> 17 <212> DNA <213> Artificial sequence <400> 48 gcatattacc catgaac 17 <210> 49 <211> 18 <212> DNA <213> Artificial sequence <400> 49 gggccggccc gcgcttac 18 <210> 50 <211> 19 <212> DNA <213> Artificial sequence <400> 50 tatgatgttg ctgtggatc 19 <210> 51 <211> 19 <212> DNA <213> Artificial sequence <400> 51 aacactgacc tcgctcccc 19 <210> 52 <211> 18 <212> DNA <213> Artificial sequence <400> 52 cagctccagg cccccgac 18 <210> 53 <211> 20 <212> DNA <213> Artificial sequence <400> 53 gtctcctgtc cccagaggat 20 <210> 54 <211> 20 <212> DNA <213> Artificial sequence <400> 54 gaccgatctt aaggtcattg 20 <210> 55 <211> 18 <212> DNA <213> Artificial sequence <400> 55 attaatgacc tgcagaag 18 <210> 56 <211> 18 <212> DNA <213> Artificial sequence <400> 56 gattggcact gaaaatgg 18 <210> 57 <211> 19 <212> DNA <213> Artificial sequence <400> 57 ggacaaagta ttttggaca 19 <210> 58 <211> twenty one <212> DNA <213> Artificial sequence <400> 58 agaggcgaaa gaaacgagtt c 21 <210> 59 <211> twenty three <212> DNA <213> Artificial sequence <400> 59 tagtgttgaa ttttctgatg aat 23 <210> 60 <211> 26 <212> DNA <213> Artificial sequence <400> 60 ccatcgccta cctcttcttc accaac 26 <210> 61 <211> 19 <212> DNA <213> Artificial sequence <400> 61 ggtgtactcg ctccggtcc 19 <210> 62 <211> twenty one <212> DNA <213> Artificial sequence <400> 62 ttgccacagg tgagcaccgg g 21 <210> 63 <211> 30 <212> DNA <213> Artificial sequence <400> 63 acgttggatg cgggaagcca gggtttccag 30 <210> 64 <211> 30 <212> DNA <213> Artificial sequence <400> 64 acgttggatg aatcaacaca ctctgtcctg 30 <210> 65 <211> 30 <212> DNA <213> Artificial sequence <400> 65 acgttggatg atccggggac ttcagctgtg 30 <210> 66 <211> 30 <212> DNA <213> Artificial sequence <400> 66 acgttggatg ctgacctcgc tccccggacc 30 <210> 67 <211> 30 <212> DNA <213> Artificial sequence <400> 67 acgttggatg gatgacacaa ggggatgggg 30 <210> 68 <211> 30 <212> DNA <213> Artificial sequence <400> 68 acgttggatg accgtcctct gcctgctcca 30 <210> 69 <211> 30 <212> DNA <213> Artificial sequence <400> 69 acgttggatg atcccgacac ctgcagccag 30 <210> 70 <211> 30 <212> DNA <213> Artificial sequence <400> 70 acgttggatg gacgaggcct cctgcccggt 30 <210> 71 <211> 30 <212> DNA <213> Artificial sequence <400> 71 acgttggatg ggctcggatg agtggccgca 30 <210> 72 <211> 30 <212> DNA <213> Artificial sequence <400> 72 acgttggatg ccctctggga ctggcatcag 30 <210> 73 <211> 30 <212> DNA <213> Artificial sequence <400> 73 acgttggatg gcattggctg ggatcctccc 30 <210> 74 <211> 30 <212> DNA <213> Artificial sequence <400> 74 acgttggatg gctcagacac acctgacctt 30 <210> 75 <211> 30 <212> DNA <213> Artificial sequence <400> 75 acgttggatg gccgcctggt gcagtaccgc 30 <210> 76 <211> 30 <212> DNA <213> Artificial sequence <400> 76 acgttggatg tcatcccagt gtttaacggg 30 <210> 77 <211> 30 <212> DNA <213> Artificial sequence <400> 77 acgttggatg ccaaggttgg cggcgaaggg 30 <210> 78 <211> 30 <212> DNA <213> Artificial sequence <400> 78 acgttggatg cttctggtat agctgatgat 30 <210> 79 <211> 30 <212> DNA <213> Artificial sequence <400> 79 acgttggatg ctgcctcagc acccagcttg 30 <210> 80 <211> 30 <212> DNA <213> Artificial sequence <400> 80 acgttggatg ctgttcctga tcggatgaca 30 <210> 81 <211> 30 <212> DNA <213> Artificial sequence <400> 81 acgttggatg gctgtgtgac agagcgtgcc 30 <210> 82 <211> 30 <212> DNA <213> Artificial sequence <400> 82 acgttggatg ctcccgccaagatcaagaaa 30 <210> 83 <211> 30 <212> DNA <213> Artificial sequence <400> 83 acgttggatg tccctctcaa cctattctgg 30 <210> 84 <211> 30 <212> DNA <213> Artificial sequence <400> 84 acgttggatg atttgcaagc agcaaggcac 30 <210> 85 <211> 30 <212> DNA <213> Artificial sequence <400> 85 acgttggatg gtcagaccac tccccaggac 30 <210> 86 <211> 30 <212> DNA <213> Artificial sequence <400> 86 acgttggatg cctgcgggcc aaggctgcag 30 <210> 87 <211> 30 <212> DNA <213> Artificial sequence <400> 87 acgttggatg tcaggttggggatgaggctg 30 <210> 88 <211> 30 <212> DNA <213> Artificial sequence <400> 88 acgttggatg ctgtgacctg ggggacgctg 30 <210> 89 <211> 30 <212> DNA <213> Artificial sequence <400> 89 acgttggatg gtgcaaagtt cagaggatga 30 <210> 90 <211> 30 <212> DNA <213> Artificial sequence <400> 90 acgttggatg aactcgaagg ccgagcaggg 30 <210> 91 <211> 30 <212> DNA <213> Artificial sequence <400> 91 acgttggatg acctaaatca ctgcatgtcc 30 <210> 92 <211> 30 <212> DNA <213> Artificial sequence <400> 92 acgttggatg tcaaagacgg ccaaggagaa 30 <210> 93 <211> 30 <212> DNA <213> Artificial sequence <400> 93 acgttggatg cctgtgcccg gccctggctg 30 <210> 94 <211> 30 <212> DNA <213> Artificial sequence <400> 94 acgttggatg actcaccgca ctctttgatg 30 <210> 95 <211> 30 <212> DNA <213> Artificial sequence <400> 95 acgttggatg gtcagttgtt cctccagttc 30 <210> 96 <211> 30 <212> DNA <213> Artificial sequence <400> 96 acgttggatg aatttccaga acattccaga 30 <210> 97 <211> 30 <212> DNA <213> Artificial sequence <400> 97 acgttggatg tgggccacca gctggaagcc 30 <210> 98 <211> 30 <212> DNA <213> Artificial sequence <400> 98 acgttggatg gggcagttgg aggacacagg 30 <210> 99 <211> 30 <212> DNA <213> Artificial sequence <400> 99 acgttggatg gagccgttct ccctgaataa 30 <210> 100 <211> 30 <212> DNA <213> Artificial sequence <400> 100 acgttggatg gtctcctggg actcatcaga 30 <210> 101 <211> 30 <212> DNA <213> Artificial sequence <400> 101 acgttggatg tgtggacctc atcctctgtg 30 <210> 102 <211> 30 <212> DNA <213> Artificial sequence <400> 102 acgttggatg agcagcttgg gcttgtccca 30 <210> 103 <211> 14 <212> DNA <213> Artificial sequence <400> 103 ttcccggtca cact 14 <210> 104 <211> 15 <212> DNA <213> Artificial sequence <400> 104 ctgctcaggt tgggg 15 <210> 105 <211> 19 <212> DNA <213> Artificial sequence <400> 105 tatggacatg gaggacgtg 19 <210> 106 <211> 15 <212> DNA <213> Artificial sequence <400> 106 gatcgcctac ctctt 15 <210> 107 <211> 16 <212> DNA <213> Artificial sequence <400> 107 cgagcaattt ccagcc 16 <210> 108 <211> 15 <212> DNA <213> Artificial sequence <400> 108 accaacctga ggaac 15 <210> 109 <211> 16 <212> DNA <213> Artificial sequence <400> 109 gagcagagga aatgag 16 <210> 110 <211> 15 <212> DNA <213> Artificial sequence <400> 110 acctcgtgcc ggttg 15 <210> 111 <211> 19 <212> DNA <213> Artificial sequence <400> 111 agccattttc agtgccaac 19 <210> 112 <211> 18 <212> DNA <213> Artificial sequence <400> 112 tgaagccttc ctcacact 18 <210> 113 <211> 16 <212> DNA <213> Artificial sequence <400> 113 acgacaacga ccccga 16 <210> 114 <211> 20 <212> DNA <213> Artificial sequence <400> 114 aataagtggc gagtgcatcc 20 <210> 115 <211> twenty one <212> DNA <213> Artificial sequence <400> 115 cgtccaaact tcactccatc t 21 <210> 116 <211> 18 <212> DNA <213> Artificial sequence <400> 116 aatacccaca gccttgca 18 <210> 117 <211> twenty four <212> DNA <213> Artificial sequence <400> 117 ggaaggtcat tgcagacgtg ggaa 24 <210> 118 <211> twenty one <212> DNA <213> Artificial sequence <400> 118 ctgtcgtcag atttgtcctt g 21 <210> 119 <211> 19 <212> DNA <213> Artificial sequence <400> 119 aaaccagctt catgtactg 19 <210> 120 <211> 19 <212> DNA <213> Artificial sequence <400> 120 tgaacttgtt gggtccctc 19 <210> 121 <211> 20 <212> DNA <213> Artificial sequence <400> 121 atcctccaag atggtcttcc 20 <210> 122 <211> twenty one <212> DNA <213> Artificial sequence <400> 122 ctgtcacctc cgtgtccaga g 21 <210> 123 <211> twenty three <212> DNA <213> Artificial sequence <400> 123 ttggatccac agcaacatct act 23 <210> 124 <211> twenty two <212> DNA <213> Artificial sequence <400> 124 tgccgggagg cacagatact gg 22 <210> 125 <211> twenty three <212> DNA <213> Artificial sequence <400> 125 aagggatgca tttcccgtct tgg 23 <210> 126 <211> twenty two <212> DNA <213> Artificial sequence <400> 126 gaacatacct agggtgatgc ca 22 <210> 127 <211> twenty one <212> DNA <213> Artificial sequence <400> 127 gctgttgatg ttcttaagcc g 21 <210> 128 <211> 14 <212> DNA <213> Artificial sequence <400> 128 cgcgcactta cgac 14

Claims

1. A kit for detecting familial hypercholesterolemia and statin gene, characterized in that: The kit includes primers for amplifying SNP sites, wherein the SNP sites are located in genes related to familial hypercholesterolemia and medication guidance genes; the kit also includes extension primers for extending one base at the SNP site of the PCR amplified product; The familial hypercholesterolemia-related genes include LDLR gene and APOB gene; Said medications include statins; The SNP sites located in the LDLR gene include the following sites: ； The SNP sites located in the APOB gene include c.10579C>T; The medication guidance genes of the drug include APOE gene and SLCO1B1 gene; The SNP sites located in the APOE gene include the following sites: c.388T>C, c.526C>T; The SNP sites located in the SLCO1B1 gene include the following sites: c.388A>G, c.521T>C; The primers for amplifying the SNP site include a first amplification primer and a second amplification primer, the first amplification primer includes primers shown as SEQ ID No. 1 to 34, and the second amplification primer includes primers shown as SEQ ID No. 63 to 102; The extension primers include a first extension primer and a second extension primer, wherein the first extension primer includes primers shown in SEQ ID No. 35 to 62; The second extension primers include primers shown as SEQ ID No. 103 to 128.

2. The kit according to claim 1, wherein The first amplification primer and the second amplification primer are used in different PCR amplification reaction systems.

3. The kit according to claim 1, wherein The first extension primer and the second extension primer are used in different extension reaction systems.

Images