Primers and rapid detection method for detecting FCR disease resistance gene

By designing new primers InFrl-F and InFrl-R, combined with electrophoresis technology, the problem of difficult identification of tomato root crown root rot disease resistance gene Frl in the existing technology has been solved, and efficient and accurate detection results have been achieved, and tomato breeding process has been promoted.

CN114921584BActive Publication Date: 2025-08-19SUQIAN LVGANG MODERN AGRI RES INST CO LTD +1
View PDF 0 Cites 0 Cited by

Patent Information

Application Number
CN202210588190.8
Authority / Receiving Office
CN · China
Patent Type
Patents(China)
Current Assignee / Owner
Filing Date
2022-05-26
Publication Date
2025-08-19
Estimated Expiration
2042-05-26

AI Technical Summary

Technical Problem

The prior art lacks molecular markers that can effectively identify the disease-resistant gene Frl of tomato root crown root rot, resulting in limited to tomato breeding process. The existing marker amplification fragments are large and have poor polymorphisms, making it difficult to accurately distinguish disease-resistant and sensory materials.

Method used

New primers InFrl-F and InFrl-R were designed for PCR amplification and combined with agarose gel and polyacrylamide gel electrophoresis to develop Indel markers with smaller fragments and stronger polymorphisms, which can amplify 177bp in disease-resistant varieties and 243bp in sensory varieties.

Benefits of technology

It has achieved efficient and accurate detection of tomato root crown root rot disease-resistant genes, shortened breeding time, improved identification accuracy, and was suitable for agarose gel and polyacrylamide gel electrophoresis, with higher amplification efficiency and better specificity.

✦ Generated by Eureka AI based on patent content.

Smart Images

  • Figure FT_1
    Figure FT_1
  • Figure FT_2
    Figure FT_2
  • Figure FT_3
    Figure FT_3
Patent Text Reader

Abstract

The present invention provides a primer for detecting the FCR disease resistance gene and a rapid detection method, wherein the primers include an upstream primer InFrl-F and a downstream primer InFrl-R, wherein the sequence of the upstream primer InFrl-F is CAAGTGAAGTTAAAAATGCTAAT, and the sequence of the downstream primer InFrl-F is AACTCCAAATGTAGTACGCTTAC, which amplifies a fragment of 177 bp in disease-resistant varieties and a fragment of 243 bp in susceptible varieties. The sequence of the tomato resistance gene Frl-related marker in the present invention is based on the reported SCAR Frl The Indel markers developed based on the primer sequences have smaller fragments and stronger polymorphism, and are characterized by strong specificity and high accuracy.
Need to check novelty before this filing date? Find Prior Art

Description

Technical Field

[0001] The present invention belongs to the field of agricultural biotechnology, and specifically relates to a rapid detection of a tomato crown rot resistance gene FCR based on different electrophoretic media. The invention has important practical value for the rapid detection of diseases caused by tomato crown rot pathogens in agricultural production. Background Art

[0002] Tomato crown and root rot (FCR) is a significant soilborne disease caused by the specialized form of Fusarium oxysporum f.sp. radicis-lycopersici (FORL). FCR primarily affects the roots of tomato plants. Symptoms include distinct dark brown lesions at the soil-plant interface. In the early stages of the disease, the top stems and leaves wilt, followed by discoloration of the leaflets and dehydration of the leaf margins. The leaves then turn brown and dry. In severe cases, the roots become noticeably swollen and thickened, with brown lesions forming in the vascular bundles of the stems. The stems become hollow and dead, and the roots gradually turn brown and rot. The disease was first discovered in Japan in 1974 and subsequently appeared in California, USA, in 1976. It has subsequently spread to many countries, causing significant losses to tomato production (Yamamoto et al., 1974).

[0003] Tomato crown rot is a fungal disease that can survive in the soil for up to six years. Continuous tomato cropping can lead to the accumulation of fungi in the soil, gradually exacerbating the damage to crops and causing significant economic losses to farmers. Currently, there is no effective pharmaceutical control method for tomato crown rot on the market. Therefore, breeding new varieties resistant to crown rot is the most scientific and effective approach to controlling the disease. Previous studies have shown that the resistance gene to tomato crown root rot is controlled by a single dominant gene, Frl, and that three resistant accessions carry the same Frl allele. Furthermore, the resistance gene Frl has been mapped to chromosome 9. Vakalounakis et al. (1997) demonstrated a tight linkage between the resistance genes Frl and Tm-2. Fazio et al. (1999) developed three RAPD molecular markers (UBC-116, 194, and 655) linked to the tomato crown root rot resistance gene by combining different resistant accessions and near-isogenic lines. Although UBC-116 was converted to a codominant SCAR marker, it could not be used for resistance assessment because it was 7 cm away from the resistance gene Frl (Truong et al., 2011). In 2014, Staniaszek et al. developed the CAPS marker C2-25 from the conserved sequence site C2_At2g38025 in the F2 population, approximately 3 cm away from the disease resistance gene Frl. However, the CAPS marker requires enzyme digestion, which is costly, cumbersome, and has low detection efficiency (Staniaszek et al., 2014). Nedim et al. hybridized the tomato crown root rot-resistant material "Fla.7781" with the susceptible material "B560". The F1 was self-pollinated and backcrossed to "B560" to produce segregating F2 and BC1 populations, and developed the co-dominant SCAR marker SCAR. Frl However, the detection efficiency of this marker is not high, and it amplifies 950bp and 1000bp bands in disease-resistant and susceptible varieties, respectively.

[0004] In summary, to date, there is a lack of molecular markers that can effectively identify the Frl gene in tomato breeding, which has restricted the breeding process of tomato varieties resistant to crown rot. Frl Although the marker can also detect whether it is resistant to crown and root rot, its amplified fragment is too large, the difference between resistant and susceptible materials is small, and it is difficult to distinguish. Therefore, the development of Frl gene molecular markers with high polymorphism, easy operation and short fragments is of great significance for the breeding of excellent tomato varieties resistant to crown and root rot. Summary of the Invention

[0005] The present invention uses the tomato backbone line independently bred by Jiangsu Green Harbor Modern Agriculture Development Co., Ltd. as the experimental material, and uses the reported primer SCAR related to the disease resistance gene (Frl) of tomato crown root rot FrlPCR amplification and agarose gel electrophoresis were performed, and the PCR products were cloned and sequenced. Primer 5 software was used to design a highly efficient marker InFrl linked to the tomato crown and root rot resistance gene. The present invention aims to design more specific primers based on the reported conserved sequence of the tomato crown and root rot resistance gene Frl, allowing for more accurate and efficient detection of the tomato crown and root rot resistance gene (Frl). The primers are short and highly polymorphic, and can be used for both agarose gel electrophoresis and polyacrylamide gel electrophoresis detection, with higher amplification efficiency and better specificity.

[0006] The technical solution adopted by the present invention is:

[0007] A primer for detecting an FCR disease resistance gene, comprising an upstream primer InFrl-F and a downstream primer InFrl-R, wherein the sequence of the upstream primer InFrl-F is CAAGTGAAGTTAAAAATGCTAAT, and the sequence of the downstream primer InFrl-R is AACTCCAAATGTAGTACGCTTAC.

[0008] A method for rapidly detecting FCR disease resistance genes using the above primers comprises the following steps:

[0009] (1) Extracting genomic DNA from leaves of tomato crown root rot-resistant and susceptible materials;

[0010] (2) performing PCR amplification on the tomato material extracted in step (1) using the above primers;

[0011] (3) The product amplified in step (2) was subjected to 2% agarose gel electrophoresis and 8% polyacrylamide gel electrophoresis, and then developed and stained.

[0012] (4) Make a judgment based on the result of step (3).

[0013] Furthermore, the tomato leaf genomic DNA is extracted in step (1) using a modified CTAB method.

[0014] Furthermore, the reaction system used for PCR amplification in step (2) is a 20 μL system, wherein 1 μL of tomato leaf genomic DNA, 0.2 μL of dNTP (10 mM), 2 μL of 10*Buffer (Mg+), 0.4 μL of Taq enzyme, 1 μL of forward and reverse primers, and sterilized ultrapure water are added to 20 μL; the reaction procedure for PCR amplification is: pre-denaturation at 94°C for 2 minutes; then 35 cycles are performed, each cycle including denaturation at 94°C for 30 seconds, annealing at 58°C for 30 seconds, and extension at 72°C for 45 seconds; finally extension for 2 minutes, and storage at 4°C.

[0015] Furthermore, in step (4), a fragment of 177 bp was amplified in the disease-resistant variety, and its nucleotide sequence is shown in SEQ ID NO.5. A fragment of 243 bp was amplified in the disease-susceptible variety, and its nucleotide sequence is shown in SEQ ID NO.6.

[0016] Beneficial effects of the present invention:

[0017] 1. The sequence of the tomato resistance gene Frl related marker in the present invention is the reported SCAR Frl The Indel markers developed based on the primer sequences have smaller fragments and stronger polymorphism, and are characterized by strong specificity and high accuracy.

[0018] 2. The primers and method of the tomato resistance gene-related markers of the present invention can be used to detect whether tomato materials have the tomato crown root rot resistance gene Frl.

[0019] 3. The primers and method for tomato disease resistance gene-related markers of the present invention can detect PCR products by both polyacrylamide gel electrophoresis and agarose gel electrophoresis, and the amplified bands are clear and more accurate.

[0020] 4. The present invention avoids the traditional tomato breeding that mainly relies on plant performance selection. Multiple factors such as environmental conditions, gene interactions, and genotype-environment interactions can affect the efficiency of phenotypic selection. It greatly shortens the identification time, improves the identification accuracy, and has strong commercial application value. BRIEF DESCRIPTION OF THE DRAWINGS

[0021] Figure 1-2 SCAR, a marker associated with the reported tomato crown root rot resistance gene (Frl), is used Frl Agarose gel electrophoresis diagram of 48 amplified tomato materials, among which the sequence fragment size of susceptible materials is 1000bp and the sequence fragment size of resistant materials is 950bp.

[0022] Figure 3 It shows the polyacrylamide gel electrophoresis of 48 tomato materials amplified with the tomato crown root rot resistance gene (Frl) related marker InFrl developed in this paper, among which the sequence fragment size of the susceptible material is 243bp and the sequence fragment size of the resistant material is 177bp.

[0023] Figure 4-5 The figure shows the agarose gel electrophoresis of 48 tomato materials amplified with the tomato crown root rot resistance gene (Frl) related marker InFrl developed in this paper, wherein the sequence fragment size of the susceptible material is 243 bp and the sequence fragment size of the resistant material is 177 bp. DETAILED DESCRIPTION

[0024] The high-efficiency marker InFrl-F / InFrl-R of the tomato crown root rot resistance gene (Frl) of the present invention is characterized by: a 177 bp fragment is amplified in the disease-resistant variety, and its nucleotide sequence is shown in SEQ ID NO.5; a 243 bp fragment is amplified in the disease-susceptible variety, and its nucleotide sequence is shown in SEQ ID NO.6.

[0025] The above-mentioned tomato crown root rot resistance gene (Frl) related marker primer sequence is:

[0026] SCARFrl-F:CACATTCATCATCTGTTTTTAGTCTATTC(SEQ ID NO.1)

[0027] SCARFrl-R: CACAATCGTTGGCCATTGAATGAAGAAC (SEQ ID NO. 2)

[0028] InFrl-F:CAAGTGAAGTTAAAATGCTAAT(SEQ ID NO.3)

[0029] InFrl-R:AACTCCAAATGTAGTACGCTTAC(SEQ ID NO.4)

[0030] The method for developing InDel marker primer sequences related to tomato crown root rot resistance genes comprises the following steps:

[0031] (1) Extract genomic DNA from leaves of tomato crown root rot-resistant / susceptible parental materials, selecting 12 materials for each;

[0032] (2) Using the reported tomato crown root rot resistance gene marker Frl related marker SCAR Frl Performing PCR amplification on the leaf genomic DNA of the tomato resistant / susceptible material extracted in step (1);

[0033] (3) performing 2% agarose gel electrophoresis on the PCR amplification product of step (2);

[0034] (4) cloning and sequencing the electrophoresis product of the resistant and susceptible tomato material in step (3);

[0035] (5) Design primers based on the sequencing results of the tomato resistant and susceptible materials in step (4) using the Primer5 software;

[0036] (6) Extraction of leaf genomic DNA from 48 tomato crown root rot-resistant and susceptible materials;

[0037] (7) Using the reported primer SCAR FrlPCR amplification was performed on the 48 tomato materials extracted in step (6).

[0038] (8) PCR amplification was performed on the 48 tomato materials extracted in step (6) using the primer InFrl developed by our company.

[0039] (9) Primer SCAR in step (7) Frl The PCR product of step (8) was subjected to 2% agarose gel electrophoresis; the PCR product of primer InFrl in step (8) was subjected to 2% agarose gel electrophoresis and 8% polyacrylamide gel electrophoresis, and the color was developed and stained;

[0040] (10) Compare and analyze the electrophoresis results of step (9).

[0041] The genomic DNA of tomato leaves in steps (1) and (6) was extracted using a modified CTAB method: ① 30 mg of fresh leaves were placed in a 2 ml centrifuge tube, a 4 mm diameter steel ball was added, the tube was tightly covered, and the tube was placed in liquid nitrogen for 60 s, and then the sample was ground using a tissue grinder;

[0042] ② Add 600 μl of 2% CTAB extract to the ground sample and incubate in a 55°C water bath for 20 min, shaking every 5 min.

[0043] ③ Centrifuge at 12000 rpm for 5 minutes, aspirate 350 μl of the supernatant into a clean 1.5 ml centrifuge tube, add 250 μl of a mixture of chloroform and isoamyl alcohol, and mix thoroughly; the volume ratio of chloroform to isoamyl alcohol in the mixture is 24:1;

[0044] ④ Centrifuge at 13000 rpm for 2 min, take 250 μl of the supernatant into another 1.5 ml centrifuge tube, add 550 μl of anhydrous ethanol, and place in a -20°C refrigerator for 2 h; the anhydrous ethanol should be pre-cooled at -20°C in advance;

[0045] ⑤ Centrifuge at 12000 rpm for 10 minutes, discard the supernatant, and place at room temperature;

[0046] ⑥ When there is no alcohol smell in the centrifuge tube, add 100 μl ddH2O to dissolve the DNA; place in a 4℃ refrigerator;

[0047] The reaction system used for PCR amplification in step (2) is a 25 μL system, wherein 2 μL of extracted tomato leaf genomic DNA, 12.5 μL of 2*Taq MasterMix (Dye), 1 μL of forward and reverse primers, and sterilized ultrapure water are added to 25 μL;

[0048] The reaction procedure for PCR amplification in steps (2) and (7) is as follows: pre-denaturation at 94°C for 2 minutes; then 35 cycles, each cycle including denaturation at 94°C for 30 seconds, annealing at 58°C for 30 seconds, and extension at 72°C for 45 seconds; finally extension for 2 minutes, and storage at 4°C.

[0049] During the electrophoresis detection in step (3), electrophoresis was performed on a 2% agarose gel containing 10 μl of red gel, using 1×TAE buffer at a voltage of 150 V. After the electrophoresis, the electrophoresis bands were observed using a gel imaging analyzer. The size of the DNA electrophoresis bands was analyzed at a wavelength of 365 nm, and the image was scanned and saved.

[0050] In step (4), the PCR product of the resistant / susceptible tomato material from step (3) was cut into an agarose gel containing the target DNA under ultraviolet light. The PCR product was purified and recovered using a PCR product purification kit, ligated with the pMD-19-T vector, and the ligated product was transformed into Escherichia coli DH5α competent cells. Positive clones were screened, and PCR was used to identify whether they contained the exogenous target insert. Transformants containing the target DNA were sequenced. The sequencing work was performed by Hangzhou Shangyasai Biotechnology Co., Ltd.

[0051] In the step (5), the primer sequence sequenced according to the step (4) is controlled to be between 90 bp and 300 bp using Primer5 software.

[0052] The method of step (6) is the same as step (1).

[0053] In step (7), PCR amplification is performed using the reported primer SCARFrl, and the method is as described in step (2);

[0054] In the step (8), the reaction system used for PCR amplification using the primer InFrl independently developed by the company is a 20 μL system, wherein 1 μL of tomato leaf genomic DNA is extracted, 0.2 μL of dNTP (10 mM), 2 μL of 10*Buffer (Mg+), 0.4 μL of Taq enzyme, 1 μL of each of forward and reverse primers, and sterilized ultrapure water is added to 20 μL; the reaction procedure for PCR amplification is: pre-denaturation at 94°C for 2 minutes; then 35 cycles are performed, each cycle including denaturation at 94°C for 30 seconds, annealing at 58°C for 30 seconds, and extension at 72°C for 45 seconds; finally extension for 2 minutes, and storage at 4°C.

[0055] The 2% agarose gel electrophoresis method in step (9) is the same as that in step (3), and the amplified PCR is separated on 8% polyacrylamide gel electrophoresis, the electrophoresis buffer is 0.5*TBE buffer, the voltage is 150V, and the electrophoresis time is about 120min. After the electrophoresis, the sample is first stained in a silver nitrate solution, and then developed in a sodium hydroxide solution with formaldehyde. After rinsing with clean water, the sample is placed on a white light plate and photographed for analysis and processing.

[0056] In step (10), the size of the anti-susceptibility fragments of the reported primers in step (9) and the polyacrylamide gel electrophoresis of the primers developed in this paper are compared and analyzed. The degree of consistency between the resistant and susceptible plants reaches 100%. The anti-susceptibility fragments of the primers developed in this paper are smaller than the reported primer fragments, and the band pattern is clearer. In addition, the marker can also be used for agarose gel electrophoresis detection, with a wider selectivity.

[0057] SEQ ID NO.5:

[0058] caagtgaagttaaaaatgctaattttacccttgatcttaatttaaaatgatttatagcaaaacaaacattttcaaacctgtttcttatg

[0059] aaaggaaaagtattgaaaaaagggtttattatacactgggaattgaacccaaatccacacctatagtaagcgtactacatttg

[0060] gagtt

[0061] SEQ ID NO.6:

[0062] caagtgaacttaaaaatgctaattttaccttgattttaattttaaaatgatttatatagcaaaacaaacatgacttatttcagatcac

[0063] aagtttcaaaacctggtttttagtttcttaaactccgtgtccgtgtcaaaaggaaaagtattgaaaaaaggtttcttatacaatgg

[0064] gaattgaacccaaatccacacctattgtttcgaagactctgagatagtaagcgtactacatttcgagtt

[0065] (1) Materials and methods

[0066] 1. Plant Materials

[0067] This study used 48 tomato stem accessions with known disease resistance (Table 1), provided by Jiangsu Green Harbor Modern Agricultural Development Co., Ltd. (Green Harbor). These varieties can be ordered from the company. Sowing, planting, and field management were performed according to Green Harbor's experimental methods.

[0068] 2. DNA Extraction and Detection

[0069] Tomato genomic DNA was extracted from fresh leaves of approximately 21-day-old plants using a modified CTAB method. The steps are as follows: ① Place 30 mg of fresh leaves into a 2-ml centrifuge tube, add a 4-mm diameter steel ball, secure the lid, and immerse in liquid nitrogen for 2 minutes. Grind the sample using a tissue grinder. ② Add 600 μl of CTAB (preheated CTAB) to the ground sample and incubate in a 55°C water bath for 15 minutes. ③ Centrifuge at 12,000 rpm for 5 minutes, transfer 500 μl of the supernatant to a clean 1.5-ml centrifuge tube, add 250 μl of chloroform:isoamyl alcohol (24:1), and mix thoroughly. ④ Centrifuge at 13,000 rpm for 90 seconds, transfer 350 μl of the supernatant to another 1.5-ml centrifuge tube, add 600 μl of anhydrous ethanol (precooled to -20°C) and 60 μl of ammonium acetate, mix thoroughly, and refrigerate at -20°C for 1 hour. ⑤ Centrifuge at 13,000 rpm for 5 minutes, discard the supernatant, and let it stand at room temperature. ⑥ When the alcohol smell is gone from the centrifuge tube, add 100 μl of ddH2O to dissolve the DNA.

[0070] The quality and concentration of DNA were detected by electrophoresis and spectrophotometry.

[0071] 3. Primer Design

[0072] Using the reported primer SCAR related to the tomato crown root rot resistance gene (Frl) Frl PCR amplification and agarose gel electrophoresis were performed, and the PCR products were cloned and sequenced. Using Primer 5 software, a highly effective marker, InFrl, linked to a gene resistant to tomato crown root rot was designed. This marker amplified a 177-bp fragment in resistant varieties and a 243-bp fragment in susceptible varieties.

[0073] Forward primer sequence InFrl-F: 5'-CAAGTGAAGTTAAAAATGCTAAT-3'

[0074] Reverse primer sequence InFrl-R: 5'-AACTCCAAATGTAGTACGCTTAC-3'

[0075] 4. PCR amplification and detection

[0076] (1) PCR amplification of 48 tomato stem materials was performed using the reported primer SCARFrl and the lysine was detected by LY96G Thermocycler from Huasheng Company in China. TM The reaction was performed on a thermal amplification instrument. The reaction volume was 25 μL, consisting of 2 μL of extracted tomato leaf genomic DNA, 12.5 μL of 2*Taq MasterMix (Dye), and 1 μL each of forward and reverse primers. Sterile ultrapure water was added to bring the volume up to 25 μL. The PCR amplification protocol was as follows: initial denaturation at 94°C for 2 minutes, followed by 35 cycles of denaturation at 94°C for 30 seconds, annealing at 58°C for 30 seconds, and extension at 72°C for 45 seconds. Finally, the reaction was extended for 2 minutes and stored at 4°C. Electrophoresis was performed on a 2% agarose gel supplemented with 10 μL of red gel using 1*TAE buffer at 150 V. After electrophoresis, the electrophoretic bands were visualized using a gel imaging analyzer. DNA band size was analyzed at a wavelength of 365 nm, and the image was scanned and saved.

[0077] (2) PCR amplification of 48 tomato stem materials was performed using the newly developed marker InFrl and the LY96G Thermocycler was used in Huasheng Company, China. TM On the amplification instrument,

[0078] The reaction consisted of 12.5 μL of 2× Taq Master Mix, 1 μL of DNA extract, 1 μL each of 10 μM forward and reverse primers, and 9.5 μL of ddH2O. The reaction procedure was 94°C denaturation for 2 minutes, followed by 35 cycles of denaturation at 94°C for 30 seconds, annealing at 55°C for 30 seconds, and extension at 72°C for 30 seconds, followed by extension at 72°C for 2 minutes, followed by a 4°C hold. PCR-amplified fragments were separated on 8% polyacrylamide gel electrophoresis, silver-stained, and visualized under white light.

[0079] (2) Results and Analysis

[0080] 1. Detection and Analysis of Genomic DNA of Selected Materials

[0081] Using an ultra-micro UV-visible spectrophotometer (DeNovix DS-11), the concentration of genomic DNA extracted from 48 tomato leaves in this study was measured. The results showed that the extracted DNA concentrations were all above 100 ng / μl, and the OD260 / OD280 ratio was generally between 1.8 and 2.0. Electrophoresis of DNA at different concentrations on 2% agarose gel electrophoresis revealed clear, bright patterns with no noticeable tailing, indicating good quality of the extracted DNA. Therefore, the high-quality genomic DNA extracted from tomato leaves is suitable for biological experiments using PCR amplification and SSR markers.

[0082] 2. PCR Amplification and Electrophoresis

[0083] (1) Application of the reported tomato crown root rot marker SCARFrl-F:

[0084] CACATTCATCATCTGTTTTTAGTCTAT TC, SCARFrl-R:

[0085] CACAATCGTTGGCCATTGAATGAAGAAC was used to amplify 48 tomato backbone materials by PCR and tested by agarose gel electrophoresis. Figure 1-2 .

[0086] (2) Application of the new marker InFrl-F for tomato crown root rot of the present invention:

[0087] 5'-CAAGTGAAGTTAAAAATGCTAAT-3', InFrl-R: 5'-AACTCCAAATGTAGTACGCTTAC-3' PCR amplification was performed on 48 tomato backbone materials, and the amplified products were detected by agarose gel electrophoresis and polyacrylamide gel electrophoresis, respectively. Figure 3-4 ,It can be clearly seen in the figure that a 243bp band was amplified in the susceptible variety, and a 177bp fragment was amplified in the resistant variety, and the detection results were completely consistent with the sequencing results.

[0088] Table 1. 48 tomato stem materials

[0089]

[0090]

[0091] Figure 1-5 This is a test of the root crown rot resistance gene (Frl) in 48 tomato materials. Figure 1-2 It is known that the reported primer SCAR Frl 36 susceptible tomato materials and 12 resistant materials were detected. Figure 3-5 It can be seen that 36 susceptible tomato materials and 12 resistant materials were detected using the primers InFrl developed in this paper.

[0092] As can be seen from the figure, the markers developed in this paper have the same detection results as those reported, and the markers developed in this paper are more polymorphic and have clearer band patterns. They can be detected by both agarose gel electrophoresis and polyacrylamide gel electrophoresis, and the detection results are more accurate than those of the reported primer sequence results.

[0093] While embodiments of the present invention have been shown and described, it will be appreciated by those skilled in the art that various changes, modifications, substitutions, and variations may be made to these embodiments without departing from the principles and spirit of the invention, and that the scope of the invention is defined by the appended claims and their equivalents. Sequence Listing <110> Suqian Green Harbor Modern Agriculture Research Institute Co., Ltd. Jiangsu Green Harbor Modern Agriculture Development Co., Ltd. <120> Primers and rapid detection method for detecting FCR disease resistance gene <141> 2022-05-26 <160> 6 <170> SIPOSequenceListing 1.0 <210> 1 <211> 29 <212> DNA <213> Artificial Sequence <400> 1 cacattcatc atctgttttt agtctattc 29 <210> 2 <211> 28 <212> DNA <213> Artificial Sequence <400> 2 cacaatcgtt ggccattgaa tgaagaac 28 <210> 3 <211> twenty three <212> DNA <213> Artificial Sequence <400> 3 caagtgaagt taaaaatgct aat 23 <210> 4 <211> twenty three <212> DNA <213> Artificial Sequence <400> 4 aactccaaat gtagtacgct tac 23 <210> 5 <211> 177 <212> DNA <213> Artificial Sequence <400> 5 caagtgaagt taaaaatgct aattttaccc ttgatcttaa tttaaaatga tttatagcaa 60 aacaaacatt ttcaaacctg tttcttatga aaggaaaagt attgaaaaaa gggtttatta 120 tacactggga attgaaccca aatccacacc tatagtaagc gtactacatt tggagtt 177 <210> 6 <211> 243 <212> DNA <213> Artificial Sequence <400> 6 caagtgaact taaaaatgct aattttacct tgattttaat ttaaaaatga tttatatagc 60 aaaacaaaca tgacttattt cagatcacaa gtttcaaaac ctggttttta gtttcttaaa 120 ctccgtgtcc gtgtcaaaag gaaaagtatt gaaaaaaggt ttcttataca atgggaattg 180 aacccaaatc cacacctatt gtttcgaaga ctctgagata gtaagcgtac tacatttcga 240 gtt 243

Claims

1. A primer for detecting FCR disease resistance gene, characterized in that: The primers include an upstream primer InFrl-F and a downstream primer InFrl-R, wherein the sequence of the upstream primer InFrl-F is CAAGTGAAGTTAAAAATGCTAAT, and the sequence of the downstream primer InFrl-R is AACTCCAAATGTAGTACGCTTAC. The primers amplify a 177bp fragment in disease-resistant varieties and a 243bp fragment in susceptible varieties.

2. A method for rapidly detecting FCR disease resistance genes using the primers of claim 1, characterized in that: The following steps are involved: (1) Extraction of leaf genomic DNA from tomato crown root rot-resistant and susceptible materials; (2) performing PCR amplification on the tomato material extracted in step (1) using the primers of claim 1; (3) The product amplified in step (2) was subjected to 2% agarose gel electrophoresis and 8% polyacrylamide gel electrophoresis, and then developed and stained; (4) According to the results of step (3), a 177 bp fragment was amplified in the disease-resistant variety, and its nucleotide sequence is shown in SEQ ID NO.

5. A 243 bp fragment was amplified in the disease-susceptible variety, and its nucleotide sequence is shown in SEQ ID NO.

6.

3. The method for rapid detection of FCR disease resistance genes according to claim 2, characterized in that: In step (1), the genomic DNA of tomato leaves is extracted using a modified CTAB method.