Application of RNF122 in the preparation of anti-tumor drugs

Abstract

The present invention provides an application of RNF122 in the preparation of anti-tumor drugs, belonging to the field of biological drug technology. The present invention provides a new use of the RNF122 gene, which is used in the preparation of a detection kit for early diagnosis of cancer, a small molecule drug for inhibiting cancer progression, and a drug for inhibiting signal pathways related to cancer progression, in order to help achieve clinical treatment and early detection of cancer.

Description

Technical Field

[0001] The present invention belongs to the technical field of biological medicines, and specifically relates to the application of RNF122 in the preparation of anti-tumor drugs. Background Art

[0002] At present, cancer has become one of the major diseases that threaten human life and health. The latest research reports show that breast cancer still ranks first in the incidence of female cancers, and the mortality rate has also jumped to the first place. Therefore, breast cancer has become an important killer threatening women's life and health. Breast cancer is highly metastatic, which is also one of the main causes of death from breast cancer. Hypoxia is an extremely critical microenvironmental regulatory factor in controlling the progression of cancer, especially in the occurrence and development of breast cancer. There is a lot of evidence that the hypoxic microenvironment, especially the activation of the hypoxia-inducible factor (HIF-1) signaling pathway, plays a vital role in driving breast cancer invasiveness, treatment resistance and poor prognosis. In order to resist the hypoxic stress caused by the rapid proliferation of breast cancer cells, breast cancer cells will adapt to hypoxic stress by activating various survival-related pathways, promoting tumor metastasis, and tumor angiogenesis. Clinically, metastasis is the main challenge affecting the treatment of breast cancer.

[0003] RNF122 (RING finger protein 122) belongs to the RING family of E3 ubiquitin ligases. Its main characteristic structures include the N-terminal transmembrane domain (TM) and the C-terminal RING-finger domain. At present, there are few reports on the function of RNF122, and its function in tumors is even less clear. Some literatures have shown that mouse RNF122 can promote the degradation of RIG-Ⅰ through K48 polyubiquitination modification, thereby inhibiting the production of type I interferon caused by RNA virus infection. In other words, RNF122 can participate in the negative regulation of viral innate immune response. However, it is not clear whether RNF122 functions in human tumors and whether it is related to the hypoxic microenvironment of the tumor, and its mechanism of action. Therefore, the study of the function and mechanism of RNF122 in human breast cancer is of great scientific significance. Summary of the invention

[0004] In view of this, the object of the present invention is to provide a new use of the RNF122 gene or its protein, namely, the use of the RNF122 gene as a target in the preparation of tumor diagnostic reagents, anti-tumor drugs and anti-tumor metastasis drugs.

[0005] The present invention provides an application of a reagent for detecting the expression amount of RNF122 in preparing a reagent for diagnosing tumor occurrence or evaluating tumor prognosis.

[0006] Preferably, the RNF122 includes the RNF122 gene and / or the RNF122 protein.

[0007] Preferably, the reagent for detecting the expression amount of the RNF122 gene includes qPCR amplification primers;

[0008] The qPCR amplification primers include a forward primer whose nucleotide sequence is shown in SEQ ID NO: 2 and a reverse primer whose nucleotide sequence is shown in SEQ ID NO: 3.

[0009] Preferably, the reagent for detecting the expression amount of RNF122 protein includes an anti-RNF122 protein antibody.

[0010] The present invention provides an application of a reagent for improving the expression level of RNF122 gene or protein in the preparation of an anti-tumor drug and / or an anti-tumor metastasis drug.

[0011] Preferably, the anti-tumor effect includes the growth and / or cloning of tumor cells.

[0012] Preferably, the anti-tumor metastasis includes inhibiting the migration and invasion ability of tumor cells, inhibiting the uptake of glucose by tumor cells and inhibiting angiogenesis.

[0013] Preferably, the drug has the effect of negatively regulating the expression of HIF-1α.

[0014] Preferably, the tumor comprises breast cancer.

[0015] The present invention provides the use of an agent for inhibiting HIF-1α transcriptional activity in preparing a kit for inhibiting transcription of target genes related to proliferation, metastasis, metabolism and angiogenesis. The agent for inhibiting HIF-1α transcriptional activity comprises RNF122 gene or protein.

[0016] The present invention provides an application of a reagent for detecting the expression amount of RNF122 in the preparation of a reagent for diagnosing tumor occurrence or tumor prognosis evaluation. The present invention uses protein immunoblot analysis and breast cancer tissue chip immunohistochemistry experiments to show that RNF122 is lowly expressed in breast cancer tissue compared with normal breast tissue; at the same time, TCGA database analysis also shows that RNF122 is lowly expressed in breast cancer tissue, and at the same time, high expression of RNF122 is significantly positively correlated with the prognosis of breast cancer patients. Therefore, RNF122 is used as a detection target in tumor occurrence and tumor prognosis evaluation, and the significantly low expression of RNF122 is used to assist in judging the risk of tumor occurrence, and the significantly high expression of RNF122 is used to assist in judging the tumor prognosis evaluation.

[0017] The present invention provides an application of a reagent for improving the expression level of RNF122 gene or protein in the preparation of anti-tumor drugs and / or anti-tumor metastasis drugs. The present invention uses a human breast cancer cell line with stable high expression or knockdown of RNF122 as an experimental subject, evaluates the effect of RNF122 expression on cells by growth curve, and the plate cloning experiment shows that high expression of RNF122 under normoxic and hypoxic conditions can significantly inhibit the growth and cloning ability of breast cancer cells, and knocking down RNF122 can promote cell growth and cloning ability; at the same time, the transwell experiment results show that high expression of RNF122 under normoxic and hypoxic conditions inhibits the migration and invasion ability of MDA-MB-231 breast cancer cells, and knocking down RNF122 promotes cell migration and invasion ability. It can be seen that high expression of RNF122 gene or protein is beneficial to inhibiting the growth, proliferation and metastasis ability of tumor cells. BRIEF DESCRIPTION OF THE DRAWINGS

[0018] Figure 1 The expression of RNF122 in breast cancer patient tissues, wherein a is the expression of RNF122 in human breast cancer tissues and adjacent normal tissues detected by immunohistochemistry and the statistical results (breast cancer tissue n=41, adjacent normal tissue n=41); b is the expression of RNF122 in adjacent and cancerous tissues of breast cancer patients detected by western blot and the quantitative graph; c is the TCGA database; d is the analysis of RNF122 expression in breast cancer samples by the TCGA database; e is the correlation between RNF122 expression level and overall survival of breast cancer patients;

[0019] Figure 2 RNF122 inhibits the proliferation of MCF7 cells. a is the result of the plate cloning experiment of overexpressing RNF122, the left side is the morphological diagram, and the right side is the statistical result of ImageJ software; b is the result of the growth curve experiment of overexpressing RNF122, c is the result of the plate cloning experiment of knocking down RNF122, the left side is the morphological diagram, and the right side bar graph is the statistical diagram of the clones using ImageJ software; d is the result of the growth curve experiment of knocking down RNF122, the bar graph represents the data of 3 independent experiments, the error bars represent the standard error of the mean (SD), and ****p represents p<0.0001;

[0020] Figure 3RNF122 inhibits the proliferation of MDA-MB-231 cells. a is the result of the plate cloning experiment, b is the result of the growth curve experiment, c is the MDA-MB-231 cell knockdown RNF122 plate cloning experiment to detect the cell clone formation ability, the right bar graph is the clone statistics result, which was statistically analyzed using ImageJ software, d is the result of the growth curve experiment, one group was cultured under normoxic conditions, and the other group was cultured under hypoxic conditions. Cell proliferation was counted every other day. The bar graphs represent the data of 3 independent experiments, and the error bars represent the standard error of the mean (SD). ****p represents p<0.0001.

[0021] Figure 4 Overexpression of RNF122 inhibits the growth of xenograft tumors. a is the final tumor size, b is the statistical result of tumor weight, c is the process of tumor growth volume change, which is measured every other day, d is the final tumor size, e is the statistical result of tumor weight, and f is the process of tumor volume growth. The bar graph represents the data of 3 independent experiments, and the error bars represent the standard error of the mean (SD). **p, ***p, ****p represent p<0.01, p<0.001, and p<0.0001, respectively. The line graph is statistically analyzed by Two-way ANOVA.

[0022] Figure 5 The results of RNF122 inhibiting the migration and invasion of MDA-MB-231 cells. a and c are cell scratch experiments to verify the effect of RNF122 on the migration of MDA-MB-231. b and d are the statistics of wound healing using ImageJ. e and f are Transwell experiments without matrix gel to verify the effect of RNF122 on the migration of MDA-MB-231. g and h are Transwell experiments with matrix gel to verify the effect of RNF122 on the invasion of MDA-MB-231. Figure h is the statistical result of cell counting using ImageJ. The bar graphs represent the data of three independent experiments. The error bars represent the standard error of the mean (SD). **p, ***p, ****p represent p<0.01, p<0.001, p<0.0001, respectively.

[0023] Figure 6The results of RNF122 inhibiting the expression of HIF-1α, a is MCF7 cells exogenously transfected with pCDNA3.1-Flag-RNF122 and control plasmids, 24 hours after transfection, the cells were placed in hypoxia (1% O2) for 0, 1, 3, 6, 9, 12 hours, western blot verification of HIF-1α expression, b is MDA-MB-231 cells exogenously transfected with pCDNA3.1-Flag-RNF122 and control plasmids, 24 hours after transfection, the cells were placed in hypoxia (1% O2) for 0, 1, 3, 6, 9, 12 hours, western blot verification of HIF-1α expression. Blot verification of HIF-1α expression, c: control plasmid and pCDNA3.1-3×Flag-RNF122 plasmid were co-transfected with pCDNA3.1-HA-HIF-1α into HEK293T cells, and then IP experiments were performed using Flag or HA as bait proteins, d: control and 3×Flag-RNF122 plasmids were transfected into HEK293T cells, and then treated with hypoxia for 6 h, and then IP treatment was performed, using Flag and HIF-1α as bait proteins, respectively;

[0024] Figure 7 RNF122 in breast cancer cells degrades HIF-1α through the ubiquitin proteasome pathway, where a is the result of CHX stability experiment, the right side is the quantitative graph of HIF-1α expression, b is the protein expression result after MCF7 cells were transfected with control and Flag-RNF122 plasmids and treated with proteasome inhibitor PS341 for 6 hours, c is 3×Flag-RNF122 and 3×Flag-RNF122C93 / 96A mutants were co-transfected with HA-HIF-1α and His-Ub in HEK293T cells, and 24 hours after transfection, they were treated with 200nM PS341 for 6 hours, and HA was used as bait protein; protein gray value statistics were performed using ImageJ;

[0025] Figure 8RNF122 inhibits HIF1α transcriptional activity under hypoxic conditions, inhibiting glucose uptake and angiogenesis ability of breast cancer cells; a is a dual luciferase reporter experiment. PGL3-HRE reporter, renila and 0, 200, 400 and 500 ng Flag-RNF122 were co-transfected into MCF7 cells, and PGL3-HRE reporter was transfected into RNF122 knockdown stable cells. After 24 hours of transfection, one group was treated with normoxia and the other group was treated with hypoxia (1% O2) for 6 hours; b is a glucose uptake experiment, RNF122 overexpression or knockdown MCF7 stable cells were treated with hypoxia for 6 hours, and the cells were treated according to the instructions of the glucose uptake detection kit to detect the effect of RNF122 on the glucose uptake ability of MCF7; c is the culture medium collected after 12 hours of hypoxia (1% O2) treatment of MDA-MB-231CTL RNF122 stable cells as conditioned medium to culture HUVEC cells; the bar graph is the statistical results analyzed by ImageJ angiogenesis software, the bar graph represents the data of 3 independent experiments, the error bars represent the standard error of the mean (SD), ***p, ****p represent p<0.001, p<0.0001, respectively;

[0026] Fig. 9 RNF122 inhibits the proliferation of MDA-MB-231 cells through HIF-1α under normoxic or hypoxic conditions. a and b are growth curve experiments verifying the effects of CTL1+CTL2, CTL1+HA-HIF-1α, RNF122+CTL2, and RNF122+HA-HIF-1α on the proliferation of MDA-MB-231 cells under normoxic and hypoxic (1% O2) treatment conditions; c and d are plate cloning experiments verifying the effects of CTL1+CTL2, CTL1+HA-HIF-1α, RNF122+CTL2, and RNF122+HA-HIF-1α on the proliferation of MDA-MB-231 cells under normoxic and hypoxic treatment conditions. Effects of CTL1+HA-HIF-1α, RNF122+CTL2, and RNF122+HA-HIF-1α on the clone-forming ability of MDA-MB-231. 2,000 cells were plated in each well for 15 days. The number of clones was counted using ImageJ. The bar graphs represent the data of three independent experiments. Error bars represent the standard error of the mean (SD). **p, ***p, and ****p represent p<0.01, p<0.001, and p<0.0001, respectively. a, b Two-way ANOVA analysis, c, d One-way ANOVA with Tukey's multiple comparisons).

[0027] Fig.10RNF122 inhibits the migration and invasion of MDA-MB-231 cells through HIF1α under hypoxic and normoxic conditions, where a and b are Transwell experiments to verify the effects of CTL1+CTL2, CTL1+HA-HIF-1α, RNF122+CTL2, and RNF122+HA-HIF-1α on the migration of MDA-MB-231 cells under normoxic and hypoxic (1% O2) conditions; c and d are Transwell experiments to verify the effects of CTL1+CTL2, CTL1+HA-HIF-1α, RNF122+CTL2, and RNF122+HA-HIF-1α on the migration of MDA-MB-231 cells under normoxic and hypoxic conditions. Effects of CTL1+CTL2, CTL1+HA-HIF-1α, RNF122+CTL2, and RNF122+HA-HIF-1α on the invasion of MDA-MB-231 cells; the number of migrating and invading cells was counted using ImageJ; the bar graphs represent the data of three independent experiments, the error bars represent the standard error of the mean (SD), ***p, ****p represent p<0.01, p<0.001, and p<0.0001, respectively, One-way ANOVA with Tukey's multiple comparisons). DETAILED DESCRIPTION

[0028] The present invention provides an application of a reagent for detecting the expression amount of RNF122 in preparing a reagent for diagnosing tumor occurrence or evaluating tumor prognosis.

[0029] In the present invention, the RNF122 preferably includes the RNF122 gene and / or the RNF122 protein. The reagent for detecting the expression of the RNF122 gene preferably includes a qPCR amplification primer. The qPCR amplification primer preferably includes a forward primer having a nucleotide sequence such as SEQ ID NO:9 (TGCTCAGCCTTATCTTCT) and a reverse primer having a nucleotide sequence such as SEQ ID NO:10 (TAACTCATCCTTCCCCTT). The reagent preferably also includes a qPCR amplification mixture and a reverse transcription reagent. The method for diagnosing tumor occurrence or evaluating tumor prognosis preferably extracts RNA from the tissue to be tested, reverse transcribes it, obtains cDNA as a template, and performs qPCR amplification and analysis with the primers. When the result is significantly reduced compared with the expression of RNF122 mRNA in healthy human breast tissue, it is predicted that there may be a risk of tumor occurrence, and a comprehensive judgment is made in combination with other diagnostic measures.

[0030] In the present invention, the reagent for detecting the expression of RNF122 protein preferably includes an anti-RNF122 protein antibody. Preferably, the expression of RNF122 protein is detected by protein immunoblotting analysis or immunohistochemistry. The present invention has no particular restrictions on the specific detection method, and the corresponding analysis method known in the art can be used. The anti-RNF122 protein antibody is purchased from Sigma, and the company's article number SAB2106624 and the NOVUS company's article number are NBP1-74191 and NBP-82295, respectively.

[0031] In an embodiment of the present invention, the tumor preferably includes breast cancer. By protein immunoblot analysis, RNF122 was lowly expressed in breast cancer tissue compared with normal breast tissue, and tissue chip immunohistochemistry found that RNF122 was lowly expressed in breast cancer patient tissue (p=0.0023). Analysis of the TCGA database found that RNF122 was not only lowly expressed in breast cancer (p=0.000129), but also had deletion mutations. At the same time, the survival analysis of breast cancer patients showed that breast cancer patients with high expression of RNF122 had a longer overall survival (p=0.0244). It can be seen that low expression of RNF122 can be used for the diagnosis of early tumors, and high expression of RNF122 can be used for tumor prognosis effect evaluation.

[0032] The present invention provides an application of a reagent for improving the expression level of RNF122 gene or protein in the preparation of an anti-tumor drug and / or an anti-tumor metastasis drug.

[0033] In the present invention, the anti-tumor effect preferably includes the growth and / or cloning of tumor cells. The anti-tumor metastasis effect preferably includes inhibiting the migration and invasion ability of tumor cells, inhibiting the uptake of glucose by tumor cells and inhibiting angiogenesis.

[0034] In the present invention, the tumor preferably includes breast cancer. In the embodiment of the present invention, it is verified that the high expression of RNF122 gene or protein can effectively inhibit the growth, cloning and proliferation of tumor cells at the cellular level through growth curve experiments. At the same time, xenograft tumor experiments at the animal level prove that the tumor size and weight of tumor cells overexpressing RNF122 in nude mice are suppressed, and the growth rate is also very slow; transwell experiments explore the effect of RNF122 on the migration and invasion of breast cancer cells, and overexpression of RNF122 inhibits the metastasis and invasion of MDA-MB-231 breast cancer cells. Under hypoxic conditions, the RNF122 gene or protein negatively regulates HIF-1α expression, so the drug has the effect of negatively regulating HIF-1α expression.

[0035] The present invention provides the use of an agent for inhibiting HIF-1α transcriptional activity in preparing a kit for inhibiting transcription of target genes related to proliferation, metastasis, metabolism and angiogenesis. The agent for inhibiting HIF-1α transcriptional activity comprises RNF122 gene or protein.

[0036] In the present invention, the RNF122 gene is preferably present in the kit in the form of a recombinant vector overexpressing the RNF122 gene. The recombinant vector overexpressing the RNF122 gene infects a human or animal by lentivirus-mediated infection, so that the RNF122 gene is overexpressed in the animal, thereby inhibiting the transcriptional activity of HIF-1α. The RNF122 protein is preferably added to the kit in the form of a recombinant protein. The recombinant protein increases its expression in the animal by injection.

[0037] The application of RNF122 provided by the present invention in the preparation of anti-tumor drugs is described in detail below in conjunction with the examples, but they should not be construed as limiting the scope of protection of the present invention.

[0038] Source of materials and preparation instructions

[0039] 1. Materials

[0040] Cell lines

[0041] HEK293T cells were purchased from ATCC cell bank, culture conditions: DMEM containing 10% FBS, cultured in a constant temperature 37°C, 5% CO2 incubator. MCF7 cells were purchased from ATCC cell bank, culture conditions: 90% MEM containing 10% FBS and 0.01 mg / ml human insulin, cultured in a constant temperature 37°C, 5% CO2 incubator. MDA-MB-231 cells were purchased from ATCC cell bank, culture conditions: 90% L15 containing 10% FBS, cultured in a constant temperature 37°C, CO2-free incubator.

[0042] 1.2 Reagents and consumables

[0043] 1.2.1 Plasmid construction related reagents:

[0044] Max DNA Polymerase (Takara), T4 DNA ligase (Takara), PCR primers, AxyPrep Plasmid DNA Miniprep Kit (Axygen), AxyPrep DNA Gel Recovery Kit (Axygen), AxyPrep Plasmid Midi Preparation Kit (Axygen), Reverse-transscribed with SuperScript III Kit (Takara), TRIzol (Invitrogen), Agarose (Coolaber), restriction endonuclease (Takara), DH5α competent cells (Shanghai Sangon Biotechnology Co., Ltd.), DNA marker (Takara), GelStain (Shanghai Yishen Biotechnology Co., Ltd.).

[0045] 1.2.2 Cell culture and virus packaging related reagents:

[0046] DMEM medium (ThermoFisher), MEM medium (Hyclone), L15 medium (Macgene), fetal bovine serum (Gibco), cell freezing solution (New Saimei Biotechnology Co., Ltd.), 0.25% trypsin (Gibco), Puromycin (Invivogen), Polybrene (sigma), PAX2, pMD2 (plasmid stored in the laboratory), Lipo2000 (ThermoFisher), filter (0.45μm Millipore), cell culture dishes and culture bottles of various specifications, centrifuge tubes, and cryopreservation tubes (Thermo).

[0047] 1.2.3 Western blot related reagents:

[0048] RIPA cell / tissue lysis buffer (Biyuntian), PMSF (Takara), Na3VO4 phosphatase inhibitor (Sigma), Cocktail proteasome inhibitor (Sigma), BCA protein concentration kit (Biyuntian), 5×SDS-PAGE protein loading buffer (New Saimei), 30% Acr-Bis (29:1) (Biyuntian), ammonium persulfate (Amresco), TEMED (Biyuntian), 10% SDS (Biyuntian), 1M Tris-HCl, pH 6.8 (Biyuntian), 1.5M Tris-HCl, pH 8.8 (Biyuntian), Triton-x100 (Amresco), Tween-20 (Amresco), prestained protein marker (ThermoFisher), 10×PBS (Takara), primary antibody diluent (Biyuntian), skim milk (BD), rabbit secondary antibody (Thermo Fisher), mouse secondary antibody (Thermo Fisher), centrifuge tubes of various specifications (Eppendorf), glass plates with glue, combs, filter paper (Bio-rad), PVDF membranes, chemiluminescent substrates (Millipore), NaCl, KCl, Na2HPO4·12H2O, KH2PO4 (Sinopharm).

[0049] 1.3 Instruments and equipment

[0050] Gradient PCR instrument (AB Veriti 96well Thermal Cycler), constant temperature cell culture incubator (ThermoFisher), microplate reader (TECAN), high-speed refrigerated centrifuge (Eppendorf), biological safety cabinet (ThermoFisher), gel imager (Tanon), vertical electrophoresis tank (Bio-Rad), transfer tank (Bio-rad), chemiluminescence imaging system (SAGECREATION), Nanodrop 2000c (Thermo Scientific), micropipette (Eppendorf), normal temperature centrifuge (Anhui Zhongke Zhongjia), multifunctional microplate reader (Perkin Elmer), flow cytometer (BD), -80℃ ultra-low temperature refrigerator (Thermo Scientific), microwave oven (Midea), decolorization shaker (Dalian Jingmai Biotechnology Co., Ltd.), constant temperature metal bath (Shanghai Yiheng).

[0051] 1.4 Preparation of common solutions

[0052] 1.4.1 10× SDS-PAGE electrophoresis buffer (1L): weigh 30.3 g Tris-base, 144 g Glycine, and 10 g SDS, dissolve in ddH2O, stir thoroughly to dissolve, and adjust the volume to 1000 mL.

[0053] 1.4.2 10× transfer buffer: weigh 30.3g Tris-base and 144g glycine and dissolve them in 800mL distilled water. Dissolve them fully on a magnetic stirrer, dilute to 1L, and place at room temperature for use. Dilute to 1× and add 20% methanol during use, and store at 4°C for use.

[0054] 1.4.3LB liquid medium: Weigh 10g tryptone, 5g yeast extract, and 10g sodium chloride, dissolve in 800mL distilled water, add NaOH to adjust the pH to 7.0 after fully dissolved, and make up to 1L. Sterilize with high temperature and high pressure steam and store at 4℃ for later use.

[0055] 1.4.4 Amp solid culture plate: Weigh 10g tryptone, 5g yeast extract, 10g sodium chloride, and 7.5g Agar and dissolve them in 800mL distilled water. After fully dissolving, add NaOH to adjust the pH to 7.0 and dilute to 1L. Sterilize with high-temperature and high-pressure steam. When the temperature drops to 50℃, add 1mL Amp, mix well and pour into the plate. After condensation, store at 4℃ for later use.

[0056] Example 1

[0057] 1. Construction methods of RNF122 gene overexpression recombinant vector, knockdown CRISPR Cas9 vector and HIF-1α overexpression recombinant vector

[0058] 1.1 Primer design and amplification method

[0059] The primer designs for RNF122 gene overexpression, knockdown CRISPR Cas9 cloning, and HIF-1α overexpression cloning are shown in Tables 1 and 2, and the empty plasmid was used as a control. Primer synthesis was completed by Genewise Biotechnology Co., Ltd.

[0060] Table 1 Primers designed for the construction of RNF122 gene overexpression vector

[0061]

[0062]

[0063] Table 2 Primers designed for the construction of HIF-1α overexpression recombinant vector

[0064]

[0065] 1.2 Vector digestion and ligation

[0066] 1) Construction of pCDH vector

[0067] a) The RNF122 target gene was amplified according to the following system:

[0068]

[0069] PCR reaction conditions:

[0070] The PCR products were subjected to agarose gel electrophoresis, and the molecular weight of the target gene was determined, and then the gel was cut and recovered.

[0071] b) Enzyme digestion of vector and gene fragment

[0072] First, the RNF122 gene amplification product was digested with NheⅠ, and the reaction system was as shown in Table 3:

[0073] Table 3 Enzyme digestion reaction system

[0074]

[0075]

[0076] The above products were recovered by PCR and then further digested with BamHI. The system is shown in Table 4:

[0077] Table 4 Enzyme digestion reaction system

[0078]

[0079] After enzyme digestion, agarose gel electrophoresis is performed, and the gel is cut, recovered and purified to obtain the final ligation product.

[0080] c) Ligation: Ligate the digested vector and fragments at 16°C for 3 h according to the ligation system described above.

[0081] 1.3 Plasmid transformation and amplification

[0082] Mixed incubation: Add 5 μL of target ligation product to 50 μL Trans5a competent medium, mix well by pipetting, and place on ice for 30 min.

[0083] Heat shock: heat shock in 42℃ water bath for 45 seconds, then put on ice for 2 minutes.

[0084] Culture: Add 500 μl of LB liquid medium without antibiotics and culture at 37°C in a shaking incubator for 1 h.

[0085] Plate coating: Centrifuge briefly at room temperature, discard the supernatant, mix the precipitate with a pipette, add it to the LB solid agar plate containing ampicillin, mix the bacterial solution with sterilized glass beads, and after 20 minutes, culture it upside down in a 37°C incubator overnight.

[0086] Pick single colonies: Put an appropriate amount of sterile water in 8 rows of PCR tubes. Add the mixed sample of another 8 rows into the water. After 12 to 14 hours, take out the bacterial plate and pick a single colony of appropriate size with a sterile pipette tip and dip it into the above 8 rows respectively.

[0087] Positive clone identification:

[0088] Mix the samples according to the previous gene amplification system, reduce the number of reaction cycles to 25 cycles, and after amplification, perform agarose gel electrophoresis on the PCR product, and select the corresponding positive bacterial solution according to the molecular weight of the target gene for plasmid extraction. The positive colony can be placed in a 15mL centrifuge tube, add LB culture medium and antibiotics, and put it on a 37℃ shaker to amplify the colony, and extract the plasmid for 12-16 hours. After the enzyme digestion is correct, it is sent for sequencing to confirm whether the sequence is correct.

[0089] 2. Construction of Stable Cell Lines

[0090] 1. Lentivirus Preparation

[0091] 1) Prepare cells: 24 hours before transfection, seed an appropriate amount of HEK-293T cells into a 10 cm culture dish, ensuring that the cell density reaches 80-90% on the next day of transfection, and culture with fresh DMEM complete medium containing 10% FBS.

[0092] 2) Transfection: Mix 1.5 mL Opti-MEM culture medium with 7.5 μg psPAX2 plasmid, 2.5 μg pMD2 plasmid and 10 μg target plasmid (the recombinant plasmid overexpressing RNF122 gene or HIF-1α overexpression prepared above) in a clean and sterile 15 mL centrifuge tube. At the same time, take 60 μL transfection reagent lipoplus and 1.5 mL Opti-MEM, let stand at room temperature for 5 minutes, add to a 15 mL centrifuge tube, mix gently, and let stand at room temperature for 20 minutes. Add the above mixture to the culture dish and shake gently.

[0093] 3) Collecting viruses: After 12-16 hours, the transfected HEK293T cells were transferred to a 15 cm cell culture dish and cultured with fresh DMEM complete medium containing 10% FBS. After 48 hours of culture, the culture medium in the culture dish was collected into a 15 mL centrifuge tube and centrifuged at 1500 rpm for 5 minutes. The supernatant obtained by centrifugation in the centrifuge tube was filtered through a 0.45 μm filter membrane, which was the culture medium containing virus particles. It was dispensed into sterile EP tubes and stored at -80°C.

[0094] 2 Lentiviral infection and screening

[0095] 1) Prepare cells: 24 hours before infection, seed the test cells into 6-well plates to ensure that the cell density reaches 70-80% during transfection.

[0096] 2) Medium change: During transfection, discard the original culture medium and add 1 mL of MEM medium / L15 medium.

[0097] 3) Add virus solution: Add 1 mL of virus solution to the culture medium in the six-well plate, add the transfection-promoting agent polybrene (final concentration 8 μg / mL), mix well and place in the incubator for culture. 24 hours after transfection, pour the culture solution containing the virus into the waste liquid bucket containing 84, and transfer the cells to a 10 cm dish for culture.

[0098] 4) Screening: After about 24 hours of passage, when the cell density reaches 70-80%, culture the cells in 10% FBS MEM / L15 medium containing 2 μg / mL puromycin. Maintain puromycin at 2 μg / mL and continue culturing for 5 days.

[0099] 5) Verification and freezing: Collect an appropriate amount of cells to extract protein, verify the knockdown efficiency of the target gene in the stably transfected cell line by western blot, and freeze the stably expressing cells.

[0100] Example 2

[0101] Western blot analysis of RNF122 expression in normal tissues and tumor tissues of lung cancer patients

[0102] The normal tissues and tumor tissues of 14 lung cancer patients were used as materials for the following operations:

[0103] 1 Extraction of total cell protein and concentration quantification

[0104] Take the cells in logarithmic growth phase and place them on ice, wash them with PBS three times, add an appropriate amount of RIPA lysis buffer (add phosphatase inhibitors and protease inhibitors in advance), collect the cells with a cell scraper and transfer them to a 1.5mL centrifuge tube, lyse on ice for 30 minutes, and shake them several times during the period to make them fully lysed. Then centrifuge at 4℃12000rpm for 15 minutes, take the supernatant for protein quantification or store at -80℃ for later use. Protein quantification uses the BCA method and operates according to the instructions of the kit.

[0105] 2 Polyacrylamide gel electrophoresis

[0106] Gel preparation: Prepare 10% lower separation gel (30% polyacrylamide, pH8.8 Tris-HCl, 10% APS, 10% SDS, TEMED) and 5% upper concentration gel (30% polyacrylamide, pH6.8 Tris-HCl, 10% APS, 10% SDS, TEMED). After solidification, remove the gel glass plate, pull out the comb, and rinse the gel holes with distilled water to remove residual gel particles. Fix the glass plate in the electrophoresis device, add electrophoresis buffer, and blow each gel hole again with a pipette. Take 20-30μg of total cell protein, add loading buffer, mix well, and boil at 95℃ for 5min to fully denature it. Cool and centrifuge, and slowly add to the loading well. After 80V electrophoresis for 30min in the concentration gel stage, adjust the voltage to 100V until bromophenol blue moves to the bottom of the glass plate, and the electrophoresis is over.

[0107] 3. Protein transfer to NC membrane

[0108] A Bio-rad wet transfer device was used, and the order from bottom to top in the trough was two layers of grid plates, a negative electrode plate, a layer of grid plates, three layers of sponges, filter paper, SDS-PAGE gel, NC membrane, filter paper, two layers of sponges, a layer of grid plates, a positive electrode plate, and a plastic plate was placed in the transfer trough. The voltage was 0.8A and the transfer was performed for 90 minutes.

[0109] 4. Blocking, antibody incubation, color development

[0110] Place the transferred NC membrane in blocking solution (PBS solution containing 5% skim milk powder) and block at room temperature for 1 hour. Dilute the primary antibody with 3% BSA in PBST solution according to the antibody instructions and incubate overnight at 4°C. Wash 3 times with PBST (0.1% Tween-20 added to 1×PBS), 5 minutes each time. Dilute the corresponding secondary antibody with 3% BSA in PBST solution according to the antibody instructions and incubate at room temperature for 1 hour. Wash the membrane 3 times with TBST, 5 minutes each time. Mix equal amounts of A solution and B solution in the ECL luminescence kit, and evenly add the mixture to the PVDF membrane. Act at room temperature for 2 minutes, and detect specific bands using the chemiluminescence imaging system (SAGECREATION).

[0111] At the same time, immunohistochemical staining was used to analyze the expression of RNF122 in normal tissues and tumor tissues of lung cancer patients.

[0112] The normal tissues and tumor tissues of 14 lung cancer patients were used as materials for the following operations:

[0113] 1 Dewaxing and hydration: Immerse in xylene I and II for 5 minutes each. Take out the slices and place them in 100% anhydrous ethanol I, II → 95% ethanol → 70% ethanol → 50% ethanol for 2 minutes each. Rinse with PBS three times, 3 minutes each time

[0114] 2 Antigen repair: (1) Place the antigen in a 0.01 M sodium citrate medium-high microwave for 5 min, remove from the oven and place at room temperature for 20 min without opening the lid. Place the repair solution in a medium-high microwave for 3 min, place at room temperature for 15 min without opening the lid, and rinse with PBS three times, 3 min each time.

[0115] 3. Elimination of endogenous catalase: 3% H2O2 (PBS) at room temperature for 30 min, rinse with PBS three times, 5 min each time.

[0116] 4. Wet box closed for 1 hour:

[0117]

[0118] 5. Primary antibody incubation: dilute the primary antibody with blocking buffer and incubate in a 4°C wet box overnight (covered with sealing film). Dilute the blocking buffer with PBS 1:10 and wash three times, 10 min each time.

[0119] 6. Secondary antibody incubation: add 1 drop of secondary antibody solution B to the tissue, incubate at room temperature for 1 hour, and then wash three times with PBS, 5 minutes each time.

[0120] For incubation with 7III antibody, add 1 drop of 7III antibody reagent kit C solution to the tissue, incubate at room temperature for 1 hour, and then wash three times with PBS, each time for 5 minutes.

[0121] 8DAB color development, add the prepared fresh DAB working solution, incubate at room temperature, display for 3-5 minutes, observe under a light microscope to control the color development time, and after complete color development, rinse with distilled water to terminate the display.

[0122] 9 Hematoxylin nuclear staining: Hematoxylin staining for 3 minutes, rinse with tap water, then rinse with PBS, dehydrate with 50%-100% alcohol at different levels, each level for 3 minutes, and finally put in xylene for transparency twice, each time for 3 minutes. Add neutral resin to seal the slide and dry in a fume hood.

[0123] result

[0124] Through breast cancer tissue chip immunohistochemistry, it was found that RNF122 was lowly expressed in breast cancer patient tissues ( Figure 1 Western blot analysis of RNF122 expression in normal and tumor tissues of 14 lung cancer patients showed that RNF122 was lowly expressed in breast cancer tissues ( Figure 1 (b)

[0125] The present invention uses the TCGA database to analyze and find that RNF122 not only has deletion mutations, but is also lowly expressed in breast cancer samples (p=0.000129), and breast cancer patients with high expression of RNF122 have a longer overall survival (p=0.0244) ( Figure 1 (ce).

[0126] Example 3

[0127] RNF122 inhibits breast cancer cell proliferation in vitro and in vivo

[0128] 1. In order to explore the role of RNF122 in breast cancer cells, stable cell lines with high and low expression of RNF122 were constructed in MCF7 and MDA-MB-231 breast cancer cells (see Example 1 for the method), and plate cloning experiments were performed. The specific methods are as follows:

[0129] Take logarithmic phase MDA-MB-231CTL and RNF122 stable cells, enzymatically hydrolyze, count, and plate 2000 cells in each medium dish. Plate two groups and three replicates. After attaching to the wall, one group is cultured in a normoxic incubator, and the other group is cultured in a culture room containing 1% O2 (hypoxia). Harvest after about 15 days, and replace fresh culture medium every 3 days during this period. Observe the cells. When visible clones appear in the culture dish, discard the culture medium and wash twice with PBS. Add 4% paraformaldehyde and fix at room temperature for 15 minutes. Discard the fixative, wash once with PBS, and add 0.1% crystal violet to stain for 15 minutes. Slowly wash away the staining solution with running water, and turn the culture dish upside down to dry at room temperature. Take pictures and count the number of clones.

[0130] Plate cloning experiments showed that overexpression of RNF122 could inhibit breast cancer cell proliferation under both normoxic and hypoxic conditions ( Figure 2 A and Figure 3 a), while knocking down RNF122 can promote breast cancer cell proliferation ( Figure 2 Medium c and Figure 3 (c).

[0131] 2. The effect of overexpression of RNF122 on breast cancer cell proliferation under normoxic or hypoxic conditions was verified by growth curve experiment. The specific method for determining cell growth curve is as follows:

[0132] Take the cells in the logarithmic growth phase, digest them with trypsin, centrifuge them, resuspend them in culture medium, and count the cells. Inoculate them in a 24-well plate at a concentration of 5000 cells per well. Inoculate 3 replicates of each cell type, inoculate two groups separately, and place them in a 37°C, 5% CO2 incubator overnight. Counting began on the second day. After the first count, a group of cells was placed in a 37°C, 5% CO2, 1% O2 hypoxic culture room. Cell counts were performed every other day, and finally a growth curve was made for the number of cells. Specifically, 2000 cells were plated in each well of a 24-well plate with MDA-MB-231CTL and RNF122 stably transfected cells. One group was cultured under normoxic conditions, and the other group was cultured under hypoxic conditions. Cell proliferation was counted every other day.

[0133] The results showed that overexpression of RNF122 could inhibit breast cancer cell proliferation under both normoxic and hypoxic conditions ( Figure 2 Medium b and Figure 3 b), while knocking down RNF122 can promote breast cancer cell proliferation ( Figure 2 Medium D and Figure 3 (d)

[0134] 3. In vivo transplant tumor experiment in nude mice, MCF7 and MDA-MB-231RNF122 overexpressing and control stable cells (lentivirus-infected cells without RNF122 gene) were injected into the subcutaneous tissue of nude mice to observe the ability of cells to form tumors. For MCF7 stable cells, we injected 5 million cells into each mouse, and we applied estrogen to the nude mice every day after injection until the tumor grew to promote the growth of the tumor. After the tumor grew, it was applied every other day. The specific method is as follows: 4-6 week old nude mice were selected and randomly divided into groups. RNF122 overexpression in vivo verification experiment: The MCF7 stable cell line with RNF122 overexpression was injected at 5×10 6 / 100μL / cell was inoculated under the epidermis of the armpit of nude mice. After injection, 0.1M β-estrogen was applied to the neck of nude mice every day. After tumor growth was observed, it could be applied every other day. Tumor size was measured every 2 days, and the longest diameter (L) and the maximum horizontal diameter (W) of the subcutaneous tumor were measured with a vernier caliper. The RNF122-overexpressing MDA-MB-231 stable cells were digested and counted, and then resuspended in serum-free medium and 1×10 6 The cells were inoculated into the subcutaneous epidermis of the axilla of nude mice at a volume of 100 μl / mouse. The subcutaneous tumor formation was observed two weeks after the inoculation of the cells. The tumor size was measured every 2 days using a vernier caliper to measure the longest diameter (L) and the maximum horizontal diameter (W) of the subcutaneous tumor.

[0135] The results are as follows Figure 4As shown in a to c. By observing the final size and growth curve of the tumor, the tumor in the RNF122 group was lighter than that in the control group, and the tumor growth rate was also significantly slower than that in the control group. We injected 1 million cells into each mouse for the stable overexpression of MDA-MB-231. Figure 4 As shown in Figures d to f, both the analysis of tumor weight and tumor growth volume curves demonstrated that RNF122 overexpression significantly inhibited the tumor-forming ability of nude mice.

[0136] Example 4

[0137] RNF122 inhibits breast cancer cell migration and invasion

[0138] Using a stably transfected cell line overexpressing RNF122, we conducted cell scratch assays and transwell (without or with Matrigel) experiments to investigate the effect of RNF122 on the migration and invasion of breast cancer cells under normoxic or hypoxic conditions.

[0139] 1. Transwell cell migration and invasion assay

[0140] Place a Transwell chamber in a 24-well plate (place a chamber pre-coated with Matrigel for invasion experiments), slowly add 600 μL of culture medium containing 20% ​​serum, digest the cells in the logarithmic growth phase into a cell suspension, add serum-free culture medium to resuspend, and count with a cell counter. For migration experiments and invasion experiments, add a suspension containing 50,000 cells evenly to each well. Prepare two groups of three replicate wells in each group, one group is placed in a 37°C, 5% CO2 incubator, and the other group is placed in a 37°C, 5% CO2, 1% O2 hypoxic culture room. The migration experiment was cultured in a 37°C incubator for 24 hours, and the invasion experiment was cultured in a 37°C incubator for 48 hours. Stain with crystal violet, remove the unmigrated cells in the upper layer with a cotton swab, and finally observe and take pictures under a microscope, and use ImageJ software to calculate the number of migrated cells.

[0141] 2. Cell scratch test verifies the effect of RNF122 on the migration of MDA-MB-231. MDA-MB-231RNF122 stably transfected cells were plated with 500,000 cells per well of a six-well plate. When the cells covered the scratch, one group of cells was placed in a hypoxic (1% O2) culture chamber for growth, and the other group of cells was placed in a normoxic culture chamber for growth.

[0142] The results showed that overexpression of RNF122 inhibited the metastasis of MDA-MB-231 breast cancer cells ( Figure 5 a~e) and invasive ability ( Figure 5 (g~h)

[0143] Example 5

[0144] RNF122 downregulates HIF-1α under hypoxic conditions

[0145] In order to explore the relationship between RNF122 and HIF-1α, two breast cancer cell lines, MCF7 and MDA-MB-231MCF7 cells, were exogenously transfected with pCDNA3.1-Flag-RNF122 and control plasmids, respectively. 24 hours after transfection, the cells were placed in hypoxia (1% O2) for 0, 1, 3, 6, 9, and 12 hours, and the expression of HIF-1α was verified by western blot.

[0146] The results are as follows Figure 6 As shown in a and b, within a certain hypoxia time range, regardless of the number of hours of hypoxia treatment, RNF122 overexpression can significantly inhibit the protein expression of HIF-1α.

[0147] In order to study how RNF122 affects the level of HIF-1α from a mechanistic perspective, we tested whether RNF122 interacts with HIF-1α. First, Flag-RNF122 and HA-HIF-1α were co-transfected into HEK293T cells for Co-IP experiments, and then Flag beads and beads incubated with HA antibodies were used as bait proteins to explore whether they interacted with another protein.

[0148] The results are as follows Figure 6 As shown in c and d. Flag-RNF122 can interact with HA-HIF-1α. At the same time, we performed a set of Co-IP experiments in which Flag-RNF122 was transfected for 24 hours and then treated with hypoxia for 6 hours, and then incubated with Flag beads and HIF-1α beads, respectively, to further prove that Flag-RNF122 can interact with endogenous HIF-1α.

[0149] Example 6

[0150] RNF122 degrades HIF-1α via the ubiquitin-proteasome pathway

[0151] In order to verify the specific pathway of RNF122 downregulating HIF-1α, protein stability experiments were performed in MCF7 cells. MCF7 and MDA-MB-231 cells were transfected with control and pCDNA3.1-3×Flag-RNF22 plasmids, respectively, and treated with 200μΜ COCl2 for 6h 24h after transfection, and then treated with 50μg / ml CHX for 0, 30, 60, and 120min, respectively.

[0152] The results showed that overexpression of RNF122 could inhibit the half-life of HIF-1α ( Figure 7 Meanwhile, RNF122 no longer inhibited HIF-1α expression after cells were treated with proteasome inhibitors ( Figure 7 (b)

[0153] Next, we also conducted ubiquitination experiments, where the control, Flag-RNF122, and RNF122 mutant plasmids were co-transfected with HA-HIF-1α and His-Ub into HEK293T cells, and then treated with 200 nM PS341 for 6 h after 24 h of transfection, using Flag as bait protein. The results showed that RNF122 could promote HIF-1α ubiquitination ( Figure 7 (c).

[0154] Example 7

[0155] RNF122 negatively regulates HIF-1α transcriptional activity under hypoxic conditions

[0156] It is known that HIF-1α is an important transcription factor that can promote the transcriptional activity of many genes related to tumor proliferation, metastasis, metabolism and angiogenesis. The luciferase reporter system was used to verify the effect of RNF122 overexpression on the inhibition of HIF-1α transcriptional activity under hypoxic conditions. Specifically, PGL3-HRE reporter, renila and 0, 200, 400 and 500ng Flag-RNF122 were co-transfected into MCF7 cells. After 24h of transfection, one group was treated with normoxia and the other group with hypoxia (1% O2) for 6h.

[0157] Under hypoxic conditions, RNF122 overexpression inhibits HIF-1α transcriptional activity, while knockdown of RNF122 promotes HIF-1α transcriptional activity ( Figure 8 a).

[0158] The glucose uptake kit was used for further verification. RNF122 overexpression or knockdown MCF7 stable transfected cells were treated with hypoxia for 6 h, and the cells were treated according to the instructions of the glucose uptake detection kit to detect the effect of RNF122 on the glucose uptake ability of MCF7. The specific method was to detect the glucose uptake level using the Glucose uptake colorimetricAssay kit (Biovision). 3×10 4 The next day, the culture medium was removed, the cells were washed twice with PBS, and serum-free culture medium was added for starvation overnight to increase glucose uptake. The cells were then treated and reacted according to the instructions. The absorbance at 412 nm was detected using a multifunctional microplate reader, and the detection was performed every 5 minutes until the absorbance value of the standard reached 1.5-2.0 OD.

[0159] Under hypoxic conditions, overexpression of RNF122 inhibited the glucose uptake ability of MCF7 cells, while knockdown of RNF122 promoted the glucose uptake of MCF7 cells. Figure 8 (b)

[0160] Further, angiogenesis experiments were conducted using human umbilical vein epithelial cells. The specific method is as follows: 1) Prepare conditioned medium: MCF7 and MDA-MB-231RNF122 overexpression and control stable transfection cells were plated in six-well plates, cultured in a 37°C, 5% CO2 incubator for 48 hours, and then placed in a hypoxic culture chamber for 12 hours. Finally, the culture medium was collected as conditioned medium.

[0161] 2) Prepare HUVEC (human umbilical vein epithelial cells): Place the 24-well plate with matrix gel at least half an hour in advance, and then place the 24-well plate in a 37°C, 5% CO2 incubator. Digest the HUVEC cells and count the cells. Place 6×10 4 The cells are then placed back into a 37°C, 5% CO2 incubator for about 1 hour to allow them to adhere to the wall. After the cells adhere, the conditioned medium is replaced and continued to be cultured. The cell network is observed at any time, generally within 12 hours.

[0162] 3) Staining: Prepare 2 μg / ml calcein AM with PBS, add 1 ml to each well and culture in a 37°C, 5% CO2 incubator for 30 min before taking pictures.

[0163] MDA-MB-231CTLRNF122 stably transfected cells were treated with hypoxia (1% O2) for 12 hours, and then the culture medium was collected and used as conditioned medium to culture HUVEC cells. The results showed that under hypoxic conditions, RNF122 overexpression inhibited angiogenesis ( Figure 8 (c).

[0164] Example 8

[0165] RNF122 inhibits breast cancer proliferation, migration and invasion by regulating the expression of HIF-1α

[0166] In order to further verify the relationship between RNF122 and HIF-1α, growth curve experiments were used to verify the effects of CTL1+CTL2, CTL1+HA-HIF-1α, RNF122+CTL2, and RNF122+HA-HIF-1α on the proliferation of MDA-MB-231 cells under normoxic and hypoxic (1% O2) treatment conditions. Restoring the expression of HIF-1α in cells overexpressing RNF122 can restore the inhibitory effect of RNF122 on the growth of breast cancer cells ( Fig. 9 (a, b).

[0167] The plate cloning experiment was used to verify the effects of CTL1+CTL2, CTL1+HA-HIF-1α, RNF122+CTL2, and RNF122+HA-HIF-1α on the cloning ability of MDA-MB-231 under normoxic and hypoxic conditions. 2,000 cells were plated per well for 15 days. The results showed that the inhibitory effect of plate cloning ability ( Fig. 9 (c, d).

[0168] Transwell assay was used to verify the effects of CTL1+CTL2, CTL1+HA-HIF-1α, RNF122+CTL2, and RNF122+HA-HIF-1α on the migration of MDA-MB-231 cells under normoxic and hypoxic (1% O2) conditions. Transwell assay was used to verify the effects of CTL1+CTL2, CTL1+HA-HIF-1α, RNF122+CTL2, and RNF122+HA-HIF-1α on the invasion of MDA-MB-231 cells under normoxic and hypoxic conditions.

[0169] The results showed that restoring HIF-1α expression in cells overexpressing RNF122 could restore the effect of RNF122 on breast cancer cell migration ( Fig.10 a, b) and inhibition of invasion ( Fig.10 (c, d).

[0170] The above is only a preferred embodiment of the present invention. It should be pointed out that for ordinary technicians in this technical field, several improvements and modifications can be made without departing from the principle of the present invention. These improvements and modifications should also be regarded as the scope of protection of the present invention. Sequence Listing <110> Dalian Medical University <120> Application of RNF122 in the preparation of anti-tumor drugs <160> 10 <170> SIPOSequenceListing 1.0 <210> 1 <211> 30 <212> DNA <213> Artificial Sequence <400> 1 cacgctagca tgcacccattccagtggtgt 30 <210> 2 <211> 27 <212> DNA <213> Artificial Sequence <400> 2 ccaggatccc accagctcat ccaatag 27 <210> 3 <211> 25 <212> DNA <213> Artificial Sequence <400> 3 caccgctcaa catctatatg gtcat 25 <210> 4 <211> 25 <212> DNA <213> Artificial Sequence <400> 4 aaacatgacc atatagatgt tgagc 25 <210> 5 <211> 25 <212> DNA <213> Artificial Sequence <400> 5 caccgtctgt ctggaagact tcaag 25 <210> 6 <211> 25 <212> DNA <213> Artificial Sequence <400> 6 aaaccttgaa gtcttccagacagac 25 <210> 7 <211> 27 <212> DNA <213> Artificial Sequence <400> 7 cacggatccg agggcgccgg cggcgcg 27 <210> 8 <211> 32 <212> DNA <213> Artificial Sequence <400> 8 cacgcggccg ctcagttaac ttgatccaaa gc 32 <210> 9 <211> 18 <212> DNA <213> Artificial Sequence <400> 9 tgctcagcct tatcttct 18 <210> 10 <211> 18 <212> DNA <213> Artificial Sequence <400> 10 taactcatcc ttcccctt 18

Claims

1. Use of a reagent for detecting low expression of RNF122 in the preparation of a reagent for diagnosing tumor occurrence or evaluating tumor prognosis, wherein the tumor is breast cancer.

2. The application according to claim 1, characterized in that: The RNF122 includes the RNF122 gene and / or the RNF122 protein.

3. The application according to claim 2, characterized in that: Reagents for detecting the expression of the RNF122 gene include qPCR amplification primers; The qPCR amplification primers include a forward primer whose nucleotide sequence is shown in SEQ ID NO: 2 and a reverse primer whose nucleotide sequence is shown in SEQ ID NO:

3.

4. The application according to claim 2, characterized in that: The reagent for detecting the expression amount of RNF122 protein includes an anti-RNF122 protein antibody.

5. Use of a reagent for increasing the expression level of RNF122 gene or protein in the preparation of an anti-tumor drug and / or an anti-tumor metastasis drug, wherein the tumor in the anti-tumor drug is breast cancer; The reagent for increasing the expression level of the RNF122 gene or protein is a recombinant vector for overexpressing the RNF122 gene mediated by a lentivirus.

6. The use according to claim 5, characterized in that: The anti-tumor effect includes the growth and / or cloning of tumor cells.

7. The use according to claim 5, characterized in that: The anti-tumor metastasis includes inhibiting the migration and invasion ability of tumor cells, inhibiting the uptake of glucose by tumor cells and inhibiting angiogenesis.

8. Use of an agent that inhibits HIF-1α transcriptional activity in the preparation of a drug that inhibits the proliferation, metastasis, metabolism and angiogenesis of breast cancer, wherein the agent that inhibits HIF-1α transcriptional activity is an agent that overexpresses the RNF122 gene or protein under hypoxic conditions; The reagent is a recombinant vector for overexpressing the RNF122 gene mediated by a lentivirus.

Images