A method for constructing an artificial small promoter library of Saccharomyces cerevisiae and its application

Abstract

The present invention discloses a method for constructing an artificial small promoter library of Saccharomyces cerevisiae and its application. The present invention provides a method for constructing a mutant library of artificial promoters of Saccharomyces cerevisiae, which includes: randomly mutating all or part of the nucleotides at positions 1-6 from the 3'-end of the nucleotide sequence of the artificial promoter UASF-E-C-core1 of Saccharomyces cerevisiae to obtain a mutant library of artificial promoters of Saccharomyces cerevisiae. The present invention uses the strongest small synthetic promoter obtained by Alper as a scaffold and the green fluorescent protein (GFP) as a reporter gene to construct a kozak library. And it is applied to the metabolic regulation of the endogenous pathway of Saccharomyces cerevisiae to make the genes in the metabolic pathway match the appropriate expression level, avoiding problems such as the inhibition of cell growth caused by the large accumulation of toxic intermediate metabolites or the low yield of target products caused by insufficient expression intensity of key genes.

Description

Technical Field

[0001] The present invention relates to the field of biotechnology, and particularly relates to a method for constructing an artificial small promoter library of Saccharomyces cerevisiae and its application. Background Art

[0002] With the development of synthetic biology, it has become possible to heterologously produce bulk chemicals and high-value-added products using microorganisms with fast growth rates and simple culture conditions. As the most intensively studied single-celled lower eukaryote at present, Saccharomyces cerevisiae is often used as a cell factory for producing a variety of fuels, chemicals, food ingredients, and pharmaceuticals because of its simple genetic manipulation and perfect fermentation and engineering technologies. Since the Keasling team successfully heterologously synthesized artemisinic acid, a precursor of the antimalarial drug artemisinin, in Saccharomyces cerevisiae in 2013, this artemisinic acid "brewed" from the fermenter has enabled people to achieve the freedom of creating substances. Since then, the synthetic pathways of more complex and high-value-added compounds have been opened up in Saccharomyces cerevisiae, such as ginsenosides, morphine, and the more complex scopolamine, etc. However, introducing exogenous synthetic pathways often disrupts the metabolic balance within the cell, thereby affecting the synthesis of target metabolites. Therefore, how to coordinate the expression of each gene in the metabolic pathway has become an important content of synthetic biology research.

[0003] Researchers have developed a series of control elements to regulate the expression intensity of genes in the metabolic pathway, such as promoter elements, terminator elements, and 3'UTRs, etc. Escherichia coli also commonly uses an RBS (ribosome bind site) library to regulate the genes in the pathway. RBS is a non-translated region upstream of the start codon AUG in prokaryotes, which contains a SD (Shine-Dalg-arno) sequence, about 5 nucleotides in length, responsible for complementary pairing with the 3' end of ribosomal 16S rRNA, promoting the binding of ribosomes to mRNA and facilitating the initiation of translation. The Kozak region in eukaryotes plays a similar function to the SD sequence in prokaryotes. It is a nucleic acid sequence located after the 5' cap structure of eukaryotic mRNA. It can bind to the translation initiation factor and mediate the translation initiation of mRNA containing the 5' cap structure, affecting the translation initiation rate by ribosome scanning and recognizing the start codon. The length and nucleotide composition of the Kozak region vary among different species, and one or more point mutations will affect gene expression. Although the mechanism by which the Kozak region affects gene expression has been analyzed, there is no report on the study of constructing a library of the Kozak region to regulate the gene expression in the pathway. Summary of the Invention

[0004] The purpose of the present invention is to provide a method for constructing an artificial small promoter library of Saccharomyces cerevisiae and its application.

[0005] In a first aspect, the present invention claims a method for constructing a mutant library of artificial promoters of Saccharomyces cerevisiae.

[0006] The method for constructing a mutant library of artificial promoters of Saccharomyces cerevisiae claimed by the present invention may include the following steps: randomly mutating all or part of the 1st to 6th positions from the 3'-end of the nucleotide sequence of the artificial promoter UASF-E-C-core1 of Saccharomyces cerevisiae to obtain a mutant library of artificial promoters of Saccharomyces cerevisiae.

[0007] Among them, the nucleotide sequence of the artificial promoter UASF-E-C-core1 of Saccharomyces cerevisiae is shown as positions 29-153 of SEQ ID No. 4.

[0008] In a specific embodiment of the present invention, specifically, PCR is used to randomly mutate all of the 1st to 6th positions from the 3'-end of the nucleotide sequence of the artificial promoter UASF-E-C-core1 of Saccharomyces cerevisiae (positions 29-153 of SEQ ID No. 4). At the 1st to 6th positions corresponding to the nucleotide sequence of the artificial promoter UASF-E-C-core1 of Saccharomyces cerevisiae (positions 29-153 of SEQ ID No. 4) in the primer, it is NNNNNN, where N is A or T or C or G.

[0009] In a second aspect, the present invention claims a recombinant vector library for screening mutant artificial promoters of Saccharomyces cerevisiae of interest.

[0010] Each recombinant vector in the recombinant vector library for screening mutant artificial promoters of Saccharomyces cerevisiae of interest claimed by the present invention is a double-stranded circular DNA formed by ligating a backbone vector fragment and a DNA fragment with a specific structure; the DNA fragment with a specific structure consists of, from upstream to downstream, a mutant of the artificial promoter UASF-E-C-core1 of Saccharomyces cerevisiae, a fragment to be transcribed, and a terminator; and, the 1st to 6th nucleotide sequences from the 3'-end of the mutant sequence of the artificial promoter UASF-E-C-core1 of Saccharomyces cerevisiae on different recombinant vectors in the recombinant vector library are different (including all 6 bases being different and also including partial differences); and, the sequences of the fragment to be transcribed and the terminator on different recombinant vectors in the recombinant vector library are the same.

[0011] Among them, the fragment to be transcribed may be a gene of interest.

[0012] Preferably, on different recombinant vectors in the recombinant vector library, except for the 1st to 6th nucleotide sequences from the 3'-end of the mutant sequence of the artificial promoter UASF-E-C-core1 of Saccharomyces cerevisiae being different, all other sequences are the same.

[0013] Furthermore, the nucleotide sequence of the Saccharomyces cerevisiae artificial promoter UASF-E-C-core1 is shown as positions 29 - 153 of SEQ ID No.4.

[0014] In a specific embodiment of the present invention, the terminator is specifically the SPG5 terminator.

[0015] Furthermore, the nucleotide sequence of the SPG5 terminator is shown as positions 23 - 213 of SEQ ID No.2.

[0016] In a specific embodiment of the present invention, the backbone vector is the Saccharomyces cerevisiae general expression vector pRS313.

[0017] In a specific embodiment of the present invention, the backbone vector is the Saccharomyces cerevisiae general expression vector pRS313, and the fragment to be transcribed is specifically the GFP gene. Correspondingly, the nucleotide sequence of the recombinant vector in the recombinant vector library is shown as SEQ ID No.9, where N is A or T or C or G.

[0018] In another embodiment of the present invention, the fragment to be transcribed is the in - situ truncated HMG1 gene (achieved by CRISPR - Cas9 technology).

[0019] In a third aspect, the present invention claims to protect a recombinant Saccharomyces cerevisiae library for screening mutant Saccharomyces cerevisiae artificial promoters for a purpose.

[0020] The recombinant Saccharomyces cerevisiae library for screening mutant Saccharomyces cerevisiae artificial promoters for a purpose claimed by the present invention is obtained by introducing the recombinant vector library described in the second aspect above into recipient Saccharomyces cerevisiae.

[0021] In a specific embodiment of the present invention, the recipient Saccharomyces cerevisiae is specifically BY4742. Of course, it is theoretically feasible for other Saccharomyces cerevisiae.

[0022] In a fourth aspect, the present invention claims to protect the application of the method, the recombinant vector library, or the recombinant Saccharomyces cerevisiae library described in the first aspect above in screening mutant Saccharomyces cerevisiae artificial promoters for a purpose.

[0023] Among them, the target Saccharomyces cerevisiae artificial promoter mutant can be a mutant with stronger promoter activity than the standard promoter in Saccharomyces cerevisiae. The standard promoter can be the Saccharomyces cerevisiae artificial promoter UASF-E-C-core1 (positions 29-153 of SEQ ID No. 4) or the Saccharomyces cerevisiae endogenous promoter pTDH3 or pTEF1. Of course, the target Saccharomyces cerevisiae artificial promoter mutant can also be a mutant meeting other requirements, and the specific requirements can be formulated according to actual needs. The greatest feature of the present invention is to obtain a promoter library with a wide range of strengths through six-base changes.

[0024] In the fifth aspect, the present invention claims to protect a method for screening a target Saccharomyces cerevisiae artificial promoter mutant.

[0025] The method for screening a target Saccharomyces cerevisiae artificial promoter mutant claimed by the present invention may include the following steps: culturing the recombinant Saccharomyces cerevisiae library described in the third aspect above, and screening from it a recombinant Saccharomyces cerevisiae strain meeting the predetermined conditions, which is the target recombinant Saccharomyces cerevisiae; the Saccharomyces cerevisiae artificial promoter UASF-E-C-core1 mutant carried by the target recombinant Saccharomyces cerevisiae is the target Saccharomyces cerevisiae artificial promoter mutant.

[0026] Among them, the predetermined conditions may be: the amount of the expression product of the target gene in the target recombinant Saccharomyces cerevisiae is higher than the amount of the expression product of the target gene in the control yeast. The control yeast is a recombinant yeast obtained by introducing a control vector into the recipient Saccharomyces cerevisiae; the difference between the control vector and the recombinant vectors in the recombinant vector library described in the second aspect above is only that the promoter is replaced with the standard promoter. Of course, the predetermined conditions can also be other conditions, which can be specifically formulated according to actual needs. Especially for the regulation of multi-gene pathway genes, it is relatively complex, and it is not that the stronger the promoter strength, the better. The purpose of constructing the library is to find a promoter with appropriate strength, and the small promoter library of the present invention can conveniently and quickly achieve this purpose.

[0027] Correspondingly, the target Saccharomyces cerevisiae artificial promoter mutant can be a mutant with stronger promoter activity than the standard promoter in Saccharomyces cerevisiae. Among them, the standard promoter can be the Saccharomyces cerevisiae artificial promoter UASF-E-C-core1 (positions 29-153 of SEQ ID No. 4) or the Saccharomyces cerevisiae endogenous promoter pTDH3 (positions 21-820 of SEQ ID No. 6) or pTEF1 (positions 21-450 of SEQ ID No. 7). Of course, the target Saccharomyces cerevisiae artificial promoter mutant can also be a mutant meeting other requirements, and the specific requirements can be formulated according to actual needs. The greatest feature of the present invention is to obtain a promoter library with a wide range of strengths through six-base changes.

[0028] In a sixth aspect, the present invention claims the use of the method described in the first aspect above, or the recombinant vector library described in the second aspect above, or the recombinant Saccharomyces cerevisiae library described in the third aspect above, in the regulation of gene expression in the metabolic pathway of Saccharomyces cerevisiae.

[0029] In a seventh aspect, the present invention claims a method for constructing a promoter mutant library.

[0030] The method for constructing a promoter mutant library claimed by the present invention may include the following steps: randomly mutating all or part of the sequence in the Kozak region of the promoter to obtain a promoter mutant library.

[0031] Among them, the Kozak region of the promoter generally refers to the last six bases at the 3' end of the promoter.

[0032] The present invention provides a method for rapidly constructing a Saccharomyces cerevisiae artificial small promoter library. Using the strongest small synthetic promoter obtained by Alper as a scaffold and green fluorescent protein (GFP) as a reporter gene, a kozak library is constructed. And it is applied to the metabolic regulation of the Saccharomyces cerevisiae endogenous pathway, so that the genes in the metabolic pathway match the appropriate expression level, avoiding problems such as the inhibition of cell growth caused by the large accumulation of toxic intermediate metabolites or the low yield of target products caused by insufficient expression intensity of key genes. BRIEF DESCRIPTION OF THE DRAWINGS

[0033] Figure 1 Comparison of the strength between the high-intensity artificial small promoter and the yeast endogenous strong promoter.

[0034] Figure 2 GC detection and analysis of the fermentation products of BY4742-tHMG1 and mut1-mut10 strains. DETAILED DESCRIPTION OF THE EMBODIMENTS

[0035] The present invention will be further described in detail below in conjunction with the specific embodiments. The examples given are only for clarifying the present invention, rather than limiting the scope of the present invention. The following examples can be used as a guide for those of ordinary skill in the art to make further improvements, and do not limit the present invention in any way.

[0036] The experimental methods in the following examples are all conventional methods unless otherwise specified, and are carried out according to the techniques or conditions described in the literature in this field or according to the product instructions. The materials, reagents, etc. used in the following examples can be obtained from commercial channels unless otherwise specified.

[0037] Example 1: Construction of the YPL001 plasmid as a blank control

[0038] 1. Amplification of the GFP gene and the SPG5 terminator

[0039] The GFP gene was synthesized by GenScript. Using the synthetic plasmid (obtained by inserting the GFP gene shown at positions 25 - 741 of SEQ ID No.1 into pUC57) as a template, PCR amplification was performed with primers GFPzeo-up2 / GFPzeo-down2 (see Table 1). The amplification system was TAKARA HS DNA polymerase 5× Buffer 10 μl, Dntp mix 4 μl, each primer (see Table 1) 1 μl, cDNA, template 0.5 μl, PrimerSTAR HS polymerase (2.5 U / μL) 0.5 μl, and distilled water was added to make the total volume 50 μl. The amplification conditions were: pre-denaturation at 98 °C for 2 minutes (1 cycle); denaturation at 98 °C for 10 seconds, annealing at 56 °C for 15 seconds, extension at 72 °C for 1 minute (30 cycles); extension at 72 °C for 8 minutes (1 cycle). The obtained amplification product was named GFP (SEQ ID No.1, this fragment contains a 24 bp plasmid pRS313 homologous region, a 20 bp SPG5 homologous region, and the GFP gene sequence). The obtained PCR amplification product was purified using the PCR product purification kit from Sangon Biotech (Shanghai) Co., Ltd., and the purified product was reserved for use. Using the Saccharomyces cerevisiae BY4742 genome as a template, the terminator SPG5 was amplified with primers SPG5-up2 / SPG5-down2 (see Table 1) (the method was the same as above), and the amplification product was named SPG5 (SEQ ID No.2, this fragment contains a 22 bp GFP homologous region, a 22 bp plasmid pRS313 homologous region, and the SPG5 terminator sequence). The obtained PCR amplification product was purified using the PCR product purification kit from Sangon Biotech (Shanghai) Co., Ltd., and the purified product was reserved for use.

[0040] 2. PCR Amplification of the Expression Vector

[0041] Using the Saccharomyces cerevisiae general expression vector pRS313 (from Addgene, containing the His3 marker) as a template, the target expression vector was amplified with primers 313-up2 / 313-down2 (see Table 1). The amplification system and conditions were the same as in step 1 of Example 1. The obtained amplification product was named pRS313-His-vector (SEQ ID No.3, this fragment is the pRS313 vector backbone, with a 24 bp GFP homologous region and a 22 bp SPG5 homologous region). The obtained PCR amplification product was recovered and purified using the PCR gel extraction kit from Sangon Biotech (Shanghai) Co., Ltd., and the purified product was reserved for use.

[0042] 3. Construction of the YPL001 Plasmid Using the CPEC Method

[0043] CPEC system: Add 5 μl of Phusion High-Fidelity DNA polymerase 5× Buffer, 1 μl of Dntp mix, 0.75 μl of DMSO, equimolar amounts of two purified fragments (the GFP gene obtained in step 1 and the purified fragment after amplification of the SPG5 terminator), and the pRS313-His-vector obtained in step 2. Then add 0.5 μl of Phusion High-Fidelity DNA polymerase (2 U / μL), and supplement with distilled water to a total volume of 25 μl. The amplification conditions are as follows: 98°C for 30 seconds (1 cycle); 98°C for 10 seconds, 55°C for 30 seconds, 72°C for 15 seconds (15 cycles); 72°C for 10 minutes for extension (1 cycle). Pipette 5 μl of the PCR product into Trans1-T1 competent cells and incubate on ice for 30 minutes, then heat shock at 42°C for 30 seconds, and immediately place on ice for 2 minutes. Add 800 μl of LB medium, incubate at 37°C with shaking at 250 rpm for 1 hour. Spread the bacterial solution on an LB plate containing ampicillin and culture overnight. Then perform PCR screening using the primers YpL001-YZ-up / YpL001-YZ-down (see Table 1). The size of the positive clone band is 1504 bp. Culture the positive clone in liquid, extract the plasmid of the positive clone for sequencing verification. The sequencing results show that the target fragment is inserted into the vector pRS313-His, and plasmid YPL001 is obtained. Use the plasmid extraction kit from Axygen to extract the target plasmid YPL001 for standby.

[0044] Table 1. Primers for constructing plasmids YPL001 and YPL002

[0045] Primer Name Sequence (5’-3’) GFPzeo-up2 GTAAGGAGAAAATACCGCATCAGGatgagtaaaggagaagaacttttc GFPzeo-down2 GCGATGAAACAACGTCTTTGctatttgtatagttcatccatg SPG5-up2 catggatgaactatacaaatagCAAAGACGTTGTTTCATCGC SPG5-down2 CAAAATATTAACGTTTACAATTTGCTTATTTTCTGCCGAATTTTC 313-up2 gaaaagttcttctcctttactcatCCTGATGCGGTATTTTCTCCTTAC 313-down2 GAAAATTCGGCAGAAAATAAGCAAATTGTAAACGTTAATATTTTG YpL001-YZ-up CCAAAGGTGTTCTTATGTAGTG YpL001-YZ-down CTTTAGGGTTCCGATTTAGTGC Core11-up GGAGAAAATACCGCATCAGGGGCGCGCCCCTCCTTGAAACTG Core11-down GAAAAGTTCTTCTCCTTTACTCATTTTTCTAGATTTTTTCGATGC YpL001-up CATCGAAAAAATCTAGAAAAatgagtaaaggagaagaacttttc YpL001-down GTTTCAAGGAGGGGCGCGCCCCTGATGCGGTATTTTCTCCTTAC

[0046] Example 2. Construct plasmid YPL002 as a positive control

[0047] The strongest artificial small promoter UASF-E-C-core1 (positions 29 - 153 of SEQ ID No. 4) reported by the Alper team was synthesized by GenScript. It was amplified using primers Core11-up / Core11-down (see Table 1) in the same manner as in step 1 of Example 1, and the obtained PCR product was named UASF-E-C-core1 (SEQ ID No. 4, this fragment contains a 20 bp plasmid pRS313 homologous region, a 24 bp GFP homologous region, and UASF-E-C-core1). Using the YPL001 plasmid constructed in Example 1 as a template, PCR amplification was performed with primers YpL001-up / YpL001-down (see Table 1), and the obtained amplification product was named pRS313-His-GFP-SPG5 (SEQ ID No. 5, this fragment contains the pRS313 vector backbone, the GFP gene, and the SPG5 terminator). The obtained PCR amplification product was recovered and purified using the PCR Gel Extraction Kit from Sangon Biotech (Shanghai) Co., Ltd., and the purified product was reserved for use. The above two fragments were ligated using the CPEC method (the method is the same as in step 3 of Example 1). 5 μl of the PCR product was transferred into Trans1-T1 competent cells and incubated on ice for 30 minutes, heat-shocked at 42 °C for 30 seconds, and immediately placed on ice for 2 minutes. 800 μl of LB medium was added, and the cells were incubated at 37 °C with shaking at 250 rpm for 1 hour. The bacterial solution was spread on an LB plate containing ampicillin and cultured overnight. Then, PCR screening was performed using primers Core11-up / GFPzeo-down2 (see Table 1), and the size of the positive clone band was 890 bp. The positive clone was cultured in liquid, and the plasmid of the positive clone was extracted for sequencing verification. The sequencing results showed that the target fragment was inserted into the vector pRS313, and plasmid YPL002 was obtained. The target plasmid YPL002 was extracted using the plasmid extraction kit from Axygen and reserved for use.

[0048] Example 3: Construction of strains Ypl001, Ypl002, Ypl007, and Ypl008

[0049] I. Construction of plasmids YPL007 and YPL008

[0050] 1. Amplification of pGPD / pTDH3 and pTEF1 promoters

[0051] Using the genome of Saccharomyces cerevisiae BY4742 as a template, PCR amplification was performed respectively with primers GPD-Dai-up / GPD-Dai-down and TEF1-Dai-up / TEF1-Dai-down (see Table 2). The amplification system was TAKARA 10 μl of HS DNA polymerase 5× Buffer, 4 μl of Dntp mix, 1 μl of each primer, 0.5 μl of cDNA as template, 0.5 μl of PrimerSTAR HS polymerase (2.5 U / μL), and distilled water was added to make the total volume up to 50 μl. The amplification conditions were as follows: pre-denaturation at 98 °C for 2 minutes (1 cycle); denaturation at 98 °C for 10 seconds, annealing at 56 °C for 15 seconds, extension at 72 °C for 1 minute (30 cycles); extension at 72 °C for 8 minutes (1 cycle). The amplified products were named pTDH3 (SEQ ID No. 6, this fragment contains a 20-bp homologous region of plasmid pRS313, a 24-bp GFP homologous region, and the TDH3 promoter sequence), and pTEF1 (SEQ ID No. 7, this fragment contains a 20-bp homologous region of plasmid pRS313, a 24-bp GFP homologous region, and the TEF1 promoter). The obtained PCR amplification products were purified using the PCR product purification kit from Shanghai Sangon Biotech Co., Ltd., and the purified products were reserved for use.

[0052] Table 2. Primers for constructing plasmids YPL007 and YPL008

[0053]

[0054]

[0055] 2. Amplify the expression vector

[0056] Using the YPL001 constructed in Example 1 as the template, PCR amplification was performed with primers YpL001-YZ-up / YpL001-YZ-down (see Table 1). The obtained amplified product was named pRS313-His-GFP-SPG5 (SEQ ID No. 5, this fragment contains the pRS313 vector backbone, the GFP gene, and the SPG5 terminator). The obtained PCR amplification product was recovered and purified using the PCR gel extraction kit from Shanghai Sangon Biotech Co., Ltd., and the purified product was reserved for use.

[0057] 3. Construct plasmids YPL007 and YPL008 using the CPEC method

[0058] CPEC system: 5 μl of Phusion High-Fidelity DNA polymerase 5× Buffer, 1 μl of Dntp mix, 0.75 μl of DMSO, equimolar addition of purified fragment (pTDH3 or pTEF1 obtained in step 1) and pRS313-His-GFP-SPG5, 0.5 μl of Phusion High-Fidelity DNA polymerase (2 U / μL), supplemented with distilled water to a total volume of 25 μl. The amplification conditions are: 98 °C for 30 seconds (1 cycle); 98 °C for 10 seconds, 55 °C for 30 seconds, 72 °C for 15 seconds (15 cycles); 72 °C for 10 minutes for extension (1 cycle). Pipette 5 μl of the PCR product into Trans1-T1 competent cells and incubate on ice for 30 minutes, heat shock at 42 °C for 30 seconds, and immediately place on ice for 2 minutes. Add 800 μl of LB medium, incubate at 250 rpm and 37 °C for 1 hour, spread the bacterial solution on an LB plate containing ampicillin, and after overnight culture, perform PCR screening with primers GPD-Dai-up or TEF1-Dai-up / GFPzeo-down2 (see Tables 1 and 2). The size of the positive clone band is 1557 bp or 1187 bp. Carry out liquid culture of the positive clone, extract the plasmid of the positive clone for sequencing verification. The sequencing results show that the target fragment is inserted into the vector pRS313-His-GFP-SPG5 to obtain plasmids YPL007 (corresponding to pTDH3) and YPL008 (corresponding to pTEF1). Use the plasmid extraction kit of Axygen Biosciences to extract the target plasmid for standby.

[0059] II. Construction of Ypl001, Ypl002, Ypl007, and Ypl008 strains

[0060] Starting from the Saccharomyces cerevisiae BY4742 strain (Saccharomyces cerevisiae BY4742, described in Carrie bakerbrachmann et al., 1998, Yeast, 14: 115 - 132, publicly available from Tianjin Institute of Industrial Biotechnology), SD - Ura - His - Leu - Trp (Beijing PanGenome (Functional Genomics) Technology Co., Ltd.), 2% glucose, 0.005% His., 0.01% Leu., 0.01% Ura., 0.01% Trp. (each percentage represents g / 100 mL). Take 1 mL (OD about 0.6 - 1.0) and aliquot it into 1.5 mL EP tubes, centrifuge at 4°C and 10000 g for 1 min, discard the supernatant, wash the pellet with sterile water (4°C), centrifuge under the same conditions, and discard the supernatant. Add 1 mL of treatment solution (10 mM LiAc; 10 mM DTT; 0.6 M sorbitol; 10 mM Tris - HCl (pH 7.5), add DTT to the treatment solution immediately before use) to the cells, and place them at 25°C for 20 min. Centrifuge and discard the supernatant. Resuspend the cells in 1 mL of 1 M sorbitol (sterilized by passing through a 0.22 μm water - based membrane), centrifuge and discard the supernatant (resuspend twice with 1 M sorbitol) until the final volume is approximately 80 μL. Add 1 μL of plasmids YPL001, YPL002, YPL007, and YPL008 respectively, mix well and transfer to an electroporation cuvette, apply a 2.7 kV electric shock for 5.6 ms, add 1 mL of 1 M sorbitol, recover at 30°C for 1 h, and spread on a screening medium plate (formula: 0.8% yeast selection medium SD - Ura - His - Leu - Trp, 2% glucose, 0.01% Leu., 0.01% Ura., 0.01% Trp. (each percentage represents g / 100 mL). The screening culture conditions are: 30°C, culture for more than 36 h, and name each strain Ypl001, Ypl002, Ypl007, and Ypl008 according to the different plasmids transferred.

[0061] Example 4: Construction of an artificial small promoter Kozak library and screening for a high - strength artificial small promoter

[0062] I. Construction of an artificial promoter Kozak library for Saccharomyces cerevisiae

[0063] 1. Amplify the YPL - Kozak - mut fragment

[0064] The strongest artificial small promoter UASF-E-C-core1 reported by the Alper team (positions 29-153 of SEQ ID No. 4) was synthesized by GenScript and amplified by PCR using primers CoreKM-up / Core11 KM-down (see Table 3). The amplification system and conditions were the same as those in Step 1 of Example 1. The obtained amplification product was named YPL-Kozak-mut (SEQ ID No. 8, which includes a 50-bp plasmid pRS313 homologous arm, UASF-E-C-core1, and Kozakmut). The obtained PCR amplification product was recovered and purified using the PCR Gel Extraction Kit of Sangon Biotech (Shanghai) Co., Ltd., and the purified product was reserved for use.

[0065] 2. Homologous recombination in Saccharomyces cerevisiae to construct a Saccharomyces cerevisiae artificial promoter Kozak library

[0066] Saccharomyces cerevisiae BY4742 was prepared into competent cells (the method was the same as that in Step 2 of Example 3). 2 μL of each of the YPL-Kozak-mut fragment and the pRS313-His-GFP-SPG5 vector fragment were added, mixed well and transferred into an electroporation cuvette, electroporated at 2.7 kV for 5.6 ms, 1 mL of 1 M sorbitol was added, and the cells were resuscitated at 30 °C for 1 h and then spread on a screening medium plate (formula: 0.8% yeast selection medium SD-Ura-His-Leu-Trp, 2% glucose, 0.01% Leu., 0.01% Ura., 0.01% Trp. (each percentage represents g / 100 mL)). The screening culture conditions were: 30 °C for more than 36 h.

[0067] Among the screened recombinant Saccharomyces cerevisiae, there was a recombinant vector formed by homologous recombination of the YPL-Kozak-mut fragment and the pRS313-His-GFP-SPG5 vector fragment. The nucleotide sequence of the recombinant vector was as shown in SEQ ID No. 9, where N was A or C or T or G.

[0068] Table 3. Primers for constructing the Kozak library

[0069]

[0070] Note: N represents A or T or C or G.

[0071] II. Screening of the Saccharomyces cerevisiae artificial promoter Kozak library

[0072] 1. Preliminary screening of the Saccharomyces cerevisiae artificial promoter Kozak library by flow cytometry

[0073] Collect the strains obtained in the above steps into a 1.5 ml centrifuge tube, wash them twice with sterile PBS buffer, sort them by a flow cytometer, and collect 2% of the strains with higher fluorescence intensity into a 96-deep well plate (added with the corresponding liquid medium) for culture. The screening culture conditions are: temperature 30 °C, humidity 80%, rotation speed 800 rpm for more than 24 h.

[0074] 2. Rescreening with 96-well plates

[0075] Transfer the bacterial liquid in the 96-deep well plate to a 96-well plate with a white bottom and black edges using a 200 μL multi-channel pipette. Subsequently, perform fluorescence measurement. The measurement conditions are excitation light 395 nm, absorption light 507 nm, and OD measurement with a wavelength of 600 nm. Calculate the fluorescence / OD600 ratio, and perform tube rescreening on 38 clones with significantly enhanced fluorescence.

[0076] 3. Tube rescreening

[0077] Prepare seed solutions (30 °C, 250 rpm, 12 h) for the 38 clones screened above in the corresponding liquid selection medium (formula: liquid yeast screening medium SD-Ura-His-Leu-Trp, 2% glucose; each percentage represents g / 100 mL). Subsequently, transfer and continue the culture according to the initial OD 600nm = 0.1 (30 °C, 250 rpm, 12 h). Subsequently, perform fluorescence measurement. The measurement conditions are excitation light 395 nm, absorption light 507 nm, and OD measurement with a wavelength of 600 nm. Calculate the fluorescence / OD600 ratio, and finally retain fourteen small promoters. The corresponding strains are named 501, 503, 507, 510, 512, 514, 517, 523, 525, 528, 532, 536, 540, 545 (SEQ ID No. 10 - SEQ ID No. 23)

[0078] III. Comparison of the strength between the high-strength artificial small promoters and the yeast endogenous strong promoters

[0079] Fluorescence assay experiment: Activate 4 strains of Saccharomyces cerevisiae, namely Ypl001, Ypl002, Ypl007, and Ypl008, and 14 strains obtained by screening in the second step, a total of 18 Saccharomyces cerevisiae strains, in the corresponding solid selection medium (formula: solid yeast screening medium SD-Ura-His-Leu-Trp, 2% glucose, 1.5% agar; each percentage represents g / 100 mL). Prepare the seed solution (30 °C, 250 rpm, 12 h) in the corresponding liquid selection medium (formula: liquid yeast screening medium SD-Ura-His-Leu-Trp, 2% glucose; each percentage represents g / 100 mL). Then transfer and continue culturing according to the initial OD600nm = 0.1 (30 °C, 250 rpm, 12 h). Subsequently, perform fluorescence measurement. The measurement conditions are excitation light at 395 nm, absorption light at 507 nm, and OD measurement at a wavelength of 600 nm. The results are shown in Figure 1 .

[0080] The above measurement results show that through the construction of a library of the Kozak region of the artificial small promoter and multiple rounds of screening, 14 high-strength artificial small promoters were finally obtained. Except that the activity of 545 is slightly lower than that of the endogenous strong promoters pTDH3 and pTEF1 of Saccharomyces cerevisiae, the activities of the remaining 13 artificial small promoters are higher than those of pTDH3 and pTEF1. Among them, the strength of the strongest artificial small promoter 528 is 3.3 times that of pTDH3 and pTEF1, and 7 times that of the strongest small promoter reported by Alper, significantly broadening the dynamic range of the artificial small promoter of Saccharomyces cerevisiae.

[0081] Example 5: Regulating the key rate-limiting enzyme tHMG1 of the MVA pathway using the Kozak library of the artificial promoter

[0082] I. Truncate HMG1 in situ to relieve feedback inhibition and obtain the control strain BY4742-tHMG1

[0083] 1. Construction of the gRNA plasmid of the endogenous HMG1 gene of Saccharomyces cerevisiae

[0084] First, using plasmid p426-SNR52p-gRNA.CAN1.Y-SUP4t (#43803, from Addgene) as a template, PCR amplification was performed using primers 43803-up and 43803-HMG1gRNA-down1 (see Table 4). The method is described in Step 1 of Example 1. The obtained PCR product was digested with Dpn1. The Dpn1 digestion system was as follows: 10 μL of 10× Dpn1 Buffer (Thermo), 5 μL of Dpn1 (Therom, 400,000 cohesive end units / ml), 80 μL of PCR amplification product, and distilled water was added to make up to 100 μL. The digestion was carried out for 4 hours. Subsequently, the treated product was subjected to gel extraction for standby. The digested product obtained after gel extraction was transferred into Trans1-T1 competent cells and incubated on ice for 30 minutes, heat-shocked at 42 °C for 30 seconds, and immediately placed on ice for 2 minutes. 800 μl of LB medium was added, and the cells were incubated at 250 rpm and 37 °C for 1 hour. The bacterial solution was spread on an LB plate containing ampicillin and cultured overnight. Two single clone plasmids were directly selected for sequencing verification. The plasmid with the correct sequencing result (N20: GTCATTGAAGAGGCCGAATAG) was named pHMG1-gRNA. This plasmid contains the N20 sequence corresponding to the HMG1 gene.

[0085] Table 4. Primers for constructing gRNA plasmid at the HMG1 locus

[0086]

[0087] 2. Transformation of Cas9 plasmid

[0088] Prepare the competent cells of BY4742 strain, SD-Ura-His-Leu-Trp (Beijing Panji Nuo (Functional Genomics) Technology Co., Ltd.), 2% glucose, 0.005% His., 0.01% Leu., 0.01% Ura., 0.01% Trp. (each percentage represents g / 100 mL). Take 1 mL (OD about 0.6 - 1.0) and aliquot it into 1.5 mL EP tubes, centrifuge at 4°C and 10,000 g for 1 min, discard the supernatant, wash the pellet with sterile water (4°C), centrifuge under the same conditions, and discard the supernatant. Add 1 mL of treatment solution (10 mM LiAc; 10 mM DTT; 0.6 M sorbitol; 10 mM Tris-HCl (pH 7.5), add DTT only when using the treatment solution) to the bacterial cells, and place them at 25°C for 20 min. Centrifuge and discard the supernatant. Resuspend the bacterial cells in 1 mL of 1 M sorbitol (sterilized by passing through a 0.22 μm water-based membrane), centrifuge, and discard the supernatant (resuspend twice with 1 M sorbitol) until the final volume is approximately 80 μL. Add 1 μL of Cas9 plasmid p414-TEF1p-Cas9-CYC1t (#43802, from Addgene), mix well and transfer it to an electroporation cuvette, perform electroporation at 2.7 kV for 5.6 ms, add 1 mL of 1 M sorbitol, recover at 30°C for 1 h, and spread it on a selection medium plate (formula: 0.8% yeast selection medium SD-Ura-His-Leu-Trp, 2% glucose, 0.005% His., 0.01% Leu., 0.01% Ura., 1.5% agar; each percentage represents g / 100 mL). The screening culture conditions are: 30°C, culture for more than 36 h. Randomly select one monoclonal and name it strain BY4742 (Cas9).

[0089] 3. Truncate HMG1 in situ using CRISPR-Cas9 technology

[0090] Prepare the competent cells of BY4742 (Cas9) strain, and the specific method is shown in Step 2 of Example 3. Add 2 μL each of pHMG1-gRNA plasmid and tHMG1-oligo (Table 4), mix well and transfer it to an electroporation cuvette, perform electroporation at 2.7 kV for 5.6 ms, add 1 mL of 1 M sorbitol, recover at 30°C for 1 h, and spread it on a selection medium plate (formula: 0.8% yeast selection medium SD-Ura-His-Leu-Trp, 2% glucose, 0.005% His., 0.01% Leu., 1.5% agar; each percentage represents g / 100 mL). The screening culture conditions are: 30°C, culture for more than 36 h. Randomly select 8 monoclonals and perform PCR verification using primers pHMG1-up-F / tHMG1-middle-R (see Table 4). Identify the correct positive clones with a positive clone band size of 518 bp and name them strain BY4742-tHMG1.

[0091] II. In-situ truncation and regulation of HMG1 expression using an artificial small promoter Kozak library

[0092] 1. Obtaining a small promoter Kozak library

[0093] Using the YPL002 plasmid as a template, PCR amplification was performed using primers pHMG1-528-F / pHMG1-528mut-R (see Table 5), and the method is described in Step 1 of Example 1. A small promoter Kozak library with homologous arms upstream and downstream of the HMG1 gene promoter region was obtained and named Kozakmut (SEQ ID No. 24, this fragment contains a 50bp upstream homologous arm, a 54bp downstream homologous arm, UASF-E-C-core1, and Kozakmut of the HMG1 gene promoter region).

[0094] Table 5. Primers for constructing the gRNA plasmid at the HMG1 locus

[0095]

[0096] Note: n is A or C or T or G.

[0097] 2. Combining CRISPR-Cas9 technology to regulate tHMG1 expression

[0098] Competent cells of the BY4742 strain were prepared, and the specific method is described in Step 2 of Example 3. Add 2 μL each of the pHMG1-gRNA plasmid and the small promoter Kozak library with the HMG1 gene homologous arm, mix well and transfer to an electroporation cuvette, electroporate at 2.7 kv for 5.6 ms, add 1 mL of 1 M sorbitol, resuscitate at 30 °C for 1 h, and spread on a screening medium plate (formula: 0.8% yeast selection medium SD-Ura-His-Leu-Trp, 2% glucose, 0.005% His., 0.01% Leu., 1.5% agar; each percentage represents g / 100 mL). The screening culture conditions were: 30 °C, culture for more than 36 h. Arbitrarily select 16 monoclonal colonies, and perform PCR verification using primers pHMG1-up-F / tHMG1-middle-R (see Table 4). The size of the positive clone band is 522 bp, and the correct positive clones were identified. Randomly select 10 correct strains and name them strains mut1-mut10.

[0099] 3. Squalene yield detection

[0100] According to literature reports, HMG1 is the main rate-limiting step in the entire MVA pathway, and many literatures have reported that increasing the production of downstream products by relieving feedback inhibition and increasing the expression level of HMG1 through overexpression of tHMG1 [Zhang Xueli, Shi Liu Wanglu Huang Dai. Construction of a Saccharomyces cerevisiae cell factory for the production of lycopene [J]. China Journal of Chinese Materia Medica, 2014.10. Srisawat P, Yasumoto S, Fukushima E O, et al. Production of the Bioactive Plant-Derived Triterpenoid Morolic Acid in Engineered Saccharomyces Cerevisiae [J]. Biotechnol Bioeng, 2020, 117(7): 2198-208.]. Here, we regulated the expression of tHMG1 to obtain a promoter with appropriate strength, thereby increasing the yield of squalene.

[0101] Flask fermentation catalysis: Activate the Saccharomyces cerevisiae BY4742-tHMG1 and mut1-mut10 strains in the corresponding solid selection medium (formula: solid yeast screening medium SD-Ura-His-Leu-Trp, 2% glucose, 1.5% agar; each percentage represents g / 100 mL). Prepare seed liquid (30 °C, 250 rpm, 16 h) in the corresponding liquid selection medium (formula: liquid yeast screening medium SD-Ura-His-Leu-Trp, 2% glucose; each percentage represents g / 100 mL). Inoculate 3 bottles of 100 mL Erlenmeyer flasks containing 15 mL of the corresponding liquid medium with an initial inoculum of OD0.1 respectively, and culture them at 30 °C with shaking at 250 rpm for 5 days. Take 2 mL of the fermentation broth and put it into a crushing tube, centrifuge at 13,000 r / min for 2 min, remove the medium, wash with sterile water, add an appropriate amount of glass beads (diameter 0.5 mm) and 1 mL of methanol:acetone = 1:1 (volume ratio), shake and crush for 5 min, twice, sonicate for 30 min, centrifuge at 13,000 r / min for 2 min, take the supernatant, filter it with a 0.22 μm organic nylon filter membrane and wait for detection and standby. Use an Agilent Technologies 5975C gas chromatograph to detect the product. The squalene yield is shown in Figure 2 .

[0102] The above data show that the control strain BY4742-tHMG1 can produce 1.57 mg / L of squalene. By using the small promoter Kozak library to regulate the tHMG1 gene in situ, the strain mut2 with the lowest detected production only produces 0.9 mg / L of squalene, which is half of that of the control strain BY4742-tHMG1; the strain mut10 with the highest squalene accumulation can produce 15 mg / L, which is 9.56 times that of the control strain BY4742-tHMG1 and 19.12 times that of the lowest. This also shows that the Kozak library has a large regulation range. The small promoter Kozak library can quickly regulate the expression of tHMG1, and this artificially constructed small promoter Kozak library that can be quickly built provides a good method for regulating the expression of genes in the regulatory pathway.

[0103] The present invention has been described in detail above. For those skilled in the art, without departing from the spirit and scope of the present invention and without unnecessary experiments, the present invention can be implemented within a relatively wide range under equivalent parameters, concentrations and conditions. Although specific embodiments of the present invention are given, it should be understood that the present invention can be further improved. In short, according to the principle of the present invention, this application intends to cover any changes, uses or improvements of the present invention, including those that depart from the scope disclosed in this application and are made by conventional techniques known in the art. Some basic features can be applied according to the scope of the following appended claims. <110> Tianjin Institute of Industrial Biotechnology, Chinese Academy of Sciences <120> Method for constructing artificial small promoter library of Saccharomyces cerevisiae and its application <130> GNCLN210180 <160> 24 <170> PatentIn version 3.5 <210> 1 <211> 761 <212> DNA <213> Artificial sequence <400> 1 gtaaggagaa aataccgcat caggatgagt aaaggagaag aacttttcac tggagttgtc 60 ccaattcttg ttgaattaga tggtgatgtt aatgggcaca aattttctgt cagtggagag 120 ggtgaaggtg atgcaacata cggaaaactt acccttaaat ttatttgcac tactggaaaa 180 ctacctgttc catggccaac acttgtcact actttctctt atggtgttca atgcttttca 240 agatacccag atcatatgaa acggcatgac tttttcaaga gtgccatgcc cgaaggttat 300 gtacaggaaa gaactatatt tttcaaagat gacgggaact acaagacacg tgctgaagtc 360 aagtttgaag gtgataccct tgttaataga atcgagttaa aaggtattga ttttaaagaa 420 gatggaaaca ttcttggaca caaattggaa tacaactata actcacacaa tgtatacatc 480 atggcagaca aacaaaagaa tggaatcaaa gttaacttca aaattagaca caacattgaa 540 gatggaagcg ttcaactagc agaccattat caacaaaata ctccaattgg cgatggccct 600 gtccttttac cagacaacca ttacctgtcc acacaatctg ccctttcgaa agatcccaac 660 gaaaagagag accacatggt ccttcttgag tttgtaacag ctgctgggat tacacatggc 720 atggatgaac tatacaaata gcaaagacgt tgtttcatcg c 761 <210> 2 <211> 258 <212> DNA <213> Artificial sequence <400> 2 catggatgaa ctatacaaat agcaaagacg ttgtttcatc gcgctattac caagaaggtt 60 actttacttg ttcttgcaca tggacgcacg ttgtgtgttc atatatatat atatatatat 120 atatatatat ttgtgcttgt tttcattgtc tctatagtta atacattcta tttttatcgt 180 tatatttgca ttctcttcgc ataaaaactt catgaaaatt cggcagaaaa taagcaaatt 240 gtaaacgtta atattttg 258 <210> 3 <211> 5013 <212> DNA <213> Artificial sequence <400> 3 gaaaattcgg cagaaaataa gcaaattgta aacgttaata ttttgttaaa attcgcgtta 60 aatttttgtt aaatcagctc attttttaac caataggccg aaatcggcaa aatcccttat 120 aaatcaaaag aatagaccga gatagggttg agtgttgttc cagtttggaa caagagtcca 180 ctattaaaga acgtggactc caacgtcaaa gggcgaaaaa ccgtctatca gggcgatggc 240 ccactacgtg aaccatcacc ctaatcaagt tttttggggt cgaggtgccg taaagcacta 300 aatcggaacc ctaaagggag cccccgattt agagcttgac ggggaaagcc ggcgaacgtg 360 gcgagaaagg aagggaagaa agcgaaagga gcgggcgcta gggcgctggc aagtgtagcg 420 gtcacgctgc gcgtaaccac cacacccgcc gcgcttaatg cgccgctaca gggcgcgtcg 480 cgccattcgc cattcaggct gcgcaactgt tgggaagggc gatcggtgcg ggcctcttcg 540 ctattacgcc agctggcgaa ggggggatgt gctgcaaggc gattaagttg ggtaacgcca 600 gggttttccc agtcacgacg ttgtaaaacg acggccagtg aattgtaata cgactcacta 660 tagggcgaat tggagctcca ccgcggtggc ggccgctcta gaactagtgg atcccccggg 720 ctgcaggaat tcgatatcaa gcttatcgat accgtcgacc tcgagggggg gcccggtacc 780 cagcttttgt tccctttagt gagggttaat tccgagcttg gcgtaatcat ggtcatagct 840 gtttcctgtg tgaaattgtt atccgctcac aattccacac aacataggag ccggaagcat 900 aaagtgtaaa gcctggggtg cctaatgagt gaggtaactc acattaattg cgttgcgctc 960 actgcccgct ttccagtcgg gaaacctgtc gtgccagctg cattaatgaa tcggccaacg 1020 cgcggggaga ggcggtttgc gtattgggcg ctcttccgct tcctcgctca ctgactcgct 1080 gcgctcggtc gttcggctgc ggcgagcggt atcagctcac tcaaaggcgg taatacggtt 1140 atccacagaa tcaggggata acgcaggaaa gaacatgtga gcaaaaggcc agcaaaaggc 1200 caggaaccgt aaaaaggccg cgttgctggc gtttttccat aggctcggcc cccctgacga 1260 gcatcacaaa aatcgacgct caagtcagag gtggcgaaac ccgacaggac tataaagata 1320 ccaggcgttc ccccctggaa gctccctcgt gcgctctcct gttccgaccc tgccgcttac 1380 cggatacctg tccgcctttc tcccttcggg aagcgtggcg ctttctcaat gctcacgctg 1440 taggtatctc agttcggtgt aggtcgttcg ctccaagctg ggctgtgtgc acgaaccccc 1500 cgttcagccc gaccgctgcg ccttatccgg taactatcgt cttgagtcca acccggtaag 1560 acacgactta tcgccactgg cagcagccac tggtaacagg attagcagag cgaggtatgt 1620 aggcggtgct acagagttct tgaagtggtg gcctaactac ggctacacta gaaggacagt 1680 atttggtatc tgcgctctgc tgaagccagt taccttcgga aaaagagttg gtagctcttg 1740 atccggcaaa caaaccaccg ctggtagcgg tggttttttt gtttgcaagc agcagattac 1800 gcgcagaaaa aaaggatctc aagaagatcc tttgatcttt tctacggggt ctgacgctca 1860 gtggaacgaa aactcacgtt aagggatttt ggtcatgaga ttatcaaaaa ggatcttcac 1920 ctagatcctt ttaaattaaa aatgaagttt taaatcaatc taaagtatat atgagtaaac 1980 ttggtctgac agttaccaat gcttaatcag tgaggcacct atctcagcga tctgtctatt 2040 tcgttcatcc atagttgcct gactgcccgt cgtgtagata actacgatac gggagggctt 2100 accatctggc cccagtgctg caatgatacc gcgagaccca cgctcaccgg ctccagattt 2160 atcagcaata aaccagccag ccggaagggc cgagcgcaga agtggtcctg caactttatc 2220 cgcctccatc cagtctatta attgttgccg ggaagctaga gtaagtagtt cgccagttaa 2280 tagtttgcgc aacgttgttg ccattgctac aggcatcgtg gtgtcacgct cgtcgtttgg 2340 tatggcttca ttcagctccg gttcccaacg atcaaggcga gttacatgat cccccatgtt 2400 gtgaaaaaaa gcggttagct ccttcggtcc tccgatcgtt gtcagaagta agttggccgc 2460 agtgttatca ctcatggtta tggcagcact gcataattct cttactgtca tgccatccgt 2520 aagatgcttt tctgtgactg gtgagtactc aaccaagtca ttctgagaat agtgtatgcg 2580 gcgaccgagt tgctcttgcc cggcgtcaat acgggataat accgcgccac atagcagaac 2640 tttaaaagtg ctcatcattg gaaaacgttc ttcggggcga aaactctcaa ggatcttacc 2700 gctgttgaga tccagttcga tgtaacccac tcgtgcaccc aactgatctt cagcatcttt 2760 tactttcacc agcgtttctg ggtgagcaaa aacaggaagg caaaatgccg caaaaaaggg 2820 aataagggcg acacggaaat gttgaatact catactcttc ctttttcaat attattgaag 2880 catttatcag ggttattgtc tcatgagcgg atacatattt gaatgtattt agaaaaataa 2940 acaaataggg gttccgcgca catttccccg aaaagtgcca cctgggtcct tttcatcacg 3000 tgctataaaa ataattataa tttaaatttt ttaatataaa tatataaatt aaaaatagaa 3060 agtaaaaaaa gaaattaaag aaaaaatagt ttttgttttc cgaagatgta aaagactcta 3120 gggggatcgc caacaaatac taccttttat cttgctcttc ctgctctcag gtattaatgc 3180 cgaattgttt catcttgtct gtgtagaaga ccacacacga aaatcctgtg attttacatt 3240 ttacttatcg ttaatcgaat gtatatctat ttaatctgct tttcttgtct aataaatata 3300 tatgtaaagt acgctttttg ttgaaatttt ttaaaccttt gtttattttt ttttcttcat 3360 tccgtaactc ttctaccttc tttatttact ttctaaaatc caaatacaaa acataaaaat 3420 aaataaacac agagtaaatt cccaaattat tccatcatta aaagatacga ggcgcgtgta 3480 agttacaggc aagcgatccg tcctaagaaa ccattattat catgacatta acctataaaa 3540 ataggcgtat cacgaggccc tttcgtctcg cgcgtttcgg tgatgacggt gaaaacctct 3600 gacacatgca gctcccggag acggtcacag cttgtctgta agcggatgcc gggagcagac 3660 aagcccgtca gggcgcgtca gcgggtgttg gcgggtgtcg gggctggctt aactatgcgg 3720 catcagagca gattgtactg agagtgcacc ataattccgt tttaagagct tggtgagcgc 3780 taggagtcac tgccaggtat cgtttgaaca cggcattagt cagggaagtc ataacacagt 3840 cctttcccgc aattttcttt ttctattact cttggcctcc tctagtacac tctatatttt 3900 tttatgcctc ggtaatgatt ttcatttttt tttttccacc tagcggatga ctcttttttt 3960 ttcttagcga ttggcattat cacataatga attatacatt atataaagta atgtgatttc 4020 ttcgaagaat atactaaaaa atgagcaggc aagataaacg aaggcaaaga tgacagagca 4080 gaaagcccta gtaaagcgta ttacaaatga aaccaagatt cagattgcga tctctttaaa 4140 gggtggtccc ctagcgatag agcactcgat cttcccagaa aaagaggcag aagcagtagc 4200 agaacaggcc acacaatcgc aagtgattaa cgtccacaca ggtatagggt ttctggacca 4260 tatgatacat gctctggcca agcattccgg ctggtcgcta atcgttgagt gcattggtga 4320 cttacacata gacgaccatc acaccactga agactgcggg attgctctcg gtcaagcttt 4380 taaagaggcc ctactggcgc gtggagtaaa aaggtttgga tcaggatttg cgcctttgga 4440 tgaggcactt tccagagcgg tggtagatct ttcgaacagg ccgtacgcag ttgtcgaact 4500 tggtttgcaa agggagaaag taggagatct ctcttgcgag atgatcccgc attttcttga 4560 aagctttgca gaggctagca gaattaccct ccacgttgat tgtctgcgag gcaagaatga 4620 tcatcaccgt agtgagagtg cgttcaaggc tcttgcggtt gccataagag aagccacctc 4680 gcccaatggt accaacgatg ttccctccac caaaggtgtt cttatgtagt gacaccgatt 4740 atttaaagct gcagcatacg atatatatac atgtgtatat atgtatacct atgaatgtca 4800 gtaagtatgt atacgaacag tatgatactg aagatgacaa ggtaatgcat cattctatac 4860 gtgtcattct gaacgaggcg cgctttcctt ttttcttttt gctttttctt tttttttctc 4920 ttgaactcga cggatcatat gcggtgtgaa ataccgcaca gatgcgtaag gagaaaatac 4980 cgcatcagga tgagtaaagg agaagaactt ttc 5013 <210> 4 <211> 177 <212> DNA <213> Artificial sequence <400> 4 ggagaaaata ccgcatcagg ggcgcgcccc tccttgaaac tgaaatttta gcatgtgatt 60 aattaacttg taatattcta atcaagctta taaaagagca ctgttgggcg tgagtggagg 120 cgccggaaaa aagcatcgaa aaaatctaga aaaatgagta aaggagaaga acttttc 177 <210> 5 <211> 5937 <212> DNA <213> Artificial sequence <400> 5 catcgaaaaa atctagaaaa atgagtaaag gagaagaact tttcactgga gttgtcccaa 60 ttcttgttga attagatggt gatgttaatg ggcacaaatt ttctgtcagt ggagagggtg 120 aaggtgatgc aacatacgga aaacttaccc ttaaatttat ttgcactact ggaaaactac 180 ctgttccatg gccaacactt gtcactactt tctcttatgg tgttcaatgc ttttcaagat 240 acccagatca tatgaaacgg catgactttt tcaagagtgc catgcccgaa ggttatgtac 300 aggaaagaac tatatttttc aaagatgacg ggaactacaa gacacgtgct gaagtcaagt 360 ttgaaggtga tacccttgtt aatagaatcg agttaaaagg tattgatttt aaagaagatg 420 gaaacattct tggacacaaa ttggaataca actataactc acacaatgta tacatcatgg 480 cagacaaaca aaagaatgga atcaaagtta acttcaaaat tagacacaac attgaagatg 540 gaagcgttca actagcagac cattatcaac aaaatactcc aattggcgat ggccctgtcc 600 ttttaccaga caaccattac ctgtccacac aatctgccct ttcgaaagat cccaacgaaa 660 agagagacca catggtcctt cttgagtttg taacagctgc tgggattaca catggcatgg 720 atgaactata caaatagcaa agacgttgtt tcatcgcgct attaccaaga aggttacttt 780 acttgttctt gcacatggac gcacgttgtg tgttcatata tatatatata tatatatata 840 tatatttgtg cttgttttca ttgtctctat agttaataca ttctattttt atcgttatat 900 ttgcattctc ttcgcataaa aacttcatga aaattcggca gaaaataagc aaattgtaaa 960 cgttaatatt ttgttaaaat tcgcgttaaa tttttgttaa atcagctcat tttttaacca 1020 ataggccgaa atcggcaaaa tcccttataa atcaaaagaa tagaccgaga tagggttgag 1080 tgttgttcca gtttggaaca agagtccact attaaagaac gtggactcca acgtcaaagg 1140 gcgaaaaacc gtctatcagg gcgatggccc actacgtgaa ccatcaccct aatcaagttt 1200 tttggggtcg aggtgccgta aagcactaaa tcggaaccct aaagggagcc cccgatttag 1260 agcttgacgg ggaaagccgg cgaacgtggc gagaaaggaa gggaagaaag cgaaaggagc 1320 gggcgctagg gcgctggcaa gtgtagcggt cacgctgcgc gtaaccacca cacccgccgc 1380 gcttaatgcg ccgctacagg gcgcgtcgcg ccattcgcca ttcaggctgc gcaactgttg 1440 ggaagggcga tcggtgcggg cctcttcgct attacgccag ctggcgaagg ggggatgtgc 1500 tgcaaggcga ttaagttggg taacgccagg gttttcccag tcacgacgtt gtaaaacgac 1560 ggccagtgaa ttgtaatacg actcactata gggcgaattg gagctccacc gcggtggcgg 1620 ccgctctaga actagtggat cccccgggct gcaggaattc gatatcaagc ttatcgatac 1680 cgtcgacctc gagggggggc ccggtaccca gcttttgttc cctttagtga gggttaattc 1740 cgagcttggc gtaatcatgg tcatagctgt ttcctgtgtg aaattgttat ccgctcacaa 1800 ttccacacaa cataggagcc ggaagcataa agtgtaaagc ctggggtgcc taatgagtga 1860 ggtaactcac attaattgcg ttgcgctcac tgcccgcttt ccagtcggga aacctgtcgt 1920 gccagctgca ttaatgaatc ggccaacgcg cggggagagg cggtttgcgt attgggcgct 1980 cttccgcttc ctcgctcact gactcgctgc gctcggtcgt tcggctgcgg cgagcggtat 2040 cagctcactc aaaggcggta atacggttat ccacagaatc aggggataac gcaggaaaga 2100 acatgtgagc aaaaggccag caaaaggcca ggaaccgtaa aaaggccgcg ttgctggcgt 2160 ttttccatag gctcggcccc cctgacgagc atcacaaaaa tcgacgctca agtcagaggt 2220 ggcgaaaccc gacaggacta taaagatacc aggcgttccc ccctggaagc tccctcgtgc 2280 gctctcctgt tccgaccctg ccgcttaccg gatacctgtc cgcctttctc ccttcgggaa 2340 gcgtggcgct ttctcaatgc tcacgctgta ggtatctcag ttcggtgtag gtcgttcgct 2400 ccaagctggg ctgtgtgcac gaaccccccg ttcagcccga ccgctgcgcc ttatccggta 2460 actatcgtct tgagtccaac ccggtaagac acgacttatc gccactggca gcagccactg 2520 gtaacaggat tagcagagcg aggtatgtag gcggtgctac agagttcttg aagtggtggc 2580 ctaactacgg ctacactaga aggacagtat ttggtatctg cgctctgctg aagccagtta 2640 ccttcggaaa aagagttggt agctcttgat ccggcaaaca aaccaccgct ggtagcggtg 2700 gtttttttgt ttgcaagcag cagattacgc gcagaaaaaa aggatctcaa gaagatcctt 2760 tgatcttttc tacggggtct gacgctcagt ggaacgaaaa ctcacgttaa gggattttgg 2820 tcatgagatt atcaaaaagg atcttcacct agatcctttt aaattaaaaa tgaagtttta 2880 aatcaatcta aagtatatat gagtaaactt ggtctgacag ttaccaatgc ttaatcagtg 2940 aggcacctat ctcagcgatc tgtctatttc gttcatccat agttgcctga ctgcccgtcg 3000 tgtagataac tacgatacgg gagggcttac catctggccc cagtgctgca atgataccgc 3060 gagacccacg ctcaccggct ccagatttat cagcaataaa ccagccagcc ggaagggccg 3120 agcgcagaag tggtcctgca actttatccg cctccatcca gtctattaat tgttgccggg 3180 aagctagagt aagtagttcg ccagttaata gtttgcgcaa cgttgttgcc attgctacag 3240 gcatcgtggt gtcacgctcg tcgtttggta tggcttcatt cagctccggt tcccaacgat 3300 caaggcgagt tacatgatcc cccatgttgt gaaaaaaagc ggttagctcc ttcggtcctc 3360 cgatcgttgt cagaagtaag ttggccgcag tgttatcact catggttatg gcagcactgc 3420 ataattctct tactgtcatg ccatccgtaa gatgcttttc tgtgactggt gagtactcaa 3480 ccaagtcatt ctgagaatag tgtatgcggc gaccgagttg ctcttgcccg gcgtcaatac 3540 gggataatac cgcgccacat agcagaactt taaaagtgct catcattgga aaacgttctt 3600 cggggcgaaa actctcaagg atcttaccgc tgttgagatc cagttcgatg taacccactc 3660 gtgcacccaa ctgatcttca gcatctttta ctttcaccag cgtttctggg tgagcaaaaa 3720 caggaaggca aaatgccgca aaaaagggaa taagggcgac acggaaatgt tgaatactca 3780 tactcttcct ttttcaatat tattgaagca tttatcaggg ttattgtctc atgagcggat 3840 acatatttga atgtatttag aaaaataaac aaataggggt tccgcgcaca tttccccgaa 3900 aagtgccacc tgggtccttt tcatcacgtg ctataaaaat aattataatt taaatttttt 3960 aatataaata tataaattaa aaatagaaag taaaaaaaga aattaaagaa aaaatagttt 4020 ttgttttccg aagatgtaaa agactctagg gggatcgcca acaaatacta ccttttatct 4080 tgctcttcct gctctcaggt attaatgccg aattgtttca tcttgtctgt gtagaagacc 4140 acacacgaaa atcctgtgat tttacatttt acttatcgtt aatcgaatgt atatctattt 4200 aatctgcttt tcttgtctaa taaatatata tgtaaagtac gctttttgtt gaaatttttt 4260 aaacctttgt ttattttttt ttcttcattc cgtaactctt ctaccttctt tatttacttt 4320 ctaaaatcca aatacaaaac ataaaaataa ataaacacag agtaaattcc caaattattc 4380 catcattaaa agatacgagg cgcgtgtaag ttacaggcaa gcgatccgtc ctaagaaacc 4440 attattatca tgacattaac ctataaaaat aggcgtatca cgaggccctt tcgtctcgcg 4500 cgtttcggtg atgacggtga aaacctctga cacatgcagc tcccggagac ggtcacagct 4560 tgtctgtaag cggatgccgg gagcagacaa gcccgtcagg gcgcgtcagc gggtgttggc 4620 gggtgtcggg gctggcttaa ctatgcggca tcagagcaga ttgtactgag agtgcaccat 4680 aattccgttt taagagcttg gtgagcgcta ggagtcactg ccaggtatcg tttgaacacg 4740 gcattagtca gggaagtcat aacacagtcc tttcccgcaa ttttcttttt ctattactct 4800 tggcctcctc tagtacactc tatatttttt tatgcctcgg taatgatttt catttttttt 4860 tttccaccta gcggatgact cttttttttt cttagcgatt ggcattatca cataatgaat 4920 tatacattat ataaagtaat gtgatttctt cgaagaatat actaaaaaat gagcaggcaa 4980 gataaacgaa ggcaaagatg acagagcaga aagccctagt aaagcgtatt acaaatgaaa 5040 ccaagattca gattgcgatc tctttaaagg gtggtcccct agcgatagag cactcgatct 5100 tcccagaaaa agaggcagaa gcagtagcag aacaggccac acaatcgcaa gtgattaacg 5160 tccacacagg tatagggttt ctggaccata tgatacatgc tctggccaag cattccggct 5220 ggtcgctaat cgttgagtgc attggtgact tacacataga cgaccatcac accactgaag 5280 actgcgggat tgctctcggt caagctttta aagaggccct actggcgcgt ggagtaaaaa 5340 ggtttggatc aggatttgcg cctttggatg aggcactttc cagagcggtg gtagatcttt 5400 cgaacaggcc gtacgcagtt gtcgaacttg gtttgcaaag ggagaaagta ggagatctct 5460 cttgcgagat gatcccgcat tttcttgaaa gctttgcaga ggctagcaga attaccctcc 5520 acgttgattg tctgcgaggc aagaatgatc atcaccgtag tgagagtgcg ttcaaggctc 5580 ttgcggttgc cataagagaa gccacctcgc ccaatggtac caacgatgtt ccctccacca 5640 aaggtgttct tatgtagtga caccgattat ttaaagctgc agcatacgat atatatacat 5700 gtgtatatat gtatacctat gaatgtcagt aagtatgtat acgaacagta tgatactgaa 5760 gatgacaagg taatgcatca ttctatacgt gtcattctga acgaggcgcg ctttcctttt 5820 ttctttttgc tttttctttt tttttctctt gaactcgacg gatcatatgc ggtgtgaaat 5880 accgcacaga tgcgtaagga gaaaataccg catcaggggc gcgcccctcc ttgaaac 5937 <210> 6 <211> 844 <212> DNA <213> Artificial sequence <400> 6 ggagaaaata ccgcatcagg atactagcgt tgaatgttag cgtcaacaac aagaagttta 60 atgacgcgga ggccaaggca aaaagattcc ttgattacgt aagggagtta gaatcatttt 120 gaataaaaaa cacgcttttt cagttcgagt ttatcattat caatactgcc atttcaaaga 180 atacgtaaat aattaatagt agtgattttc ctaactttat ttagtcaaaa aattagcctt 240 ttaattctgc tgtaacccgt acatgcccaa aatagggggc gggttacaca gaatatataa 300 catcgtaggt gtctgggtga acagtttatt cctggcatcc actaaatata atggagcccg 360 ctttttaagc tggcatccag aaaaaaaaag aatcccagca ccaaaatatt gttttcttca 420 ccaaccatca gttcataggt ccattctctt agcgcaacta cagagaacag gggcacaaac 480 aggcaaaaaa cgggcacaac ctcaatggag tgatgcaacc tgcctggagt aaatgatgac 540 acaaggcaat tgacccacgc atgtatctat ctcattttct tacaccttct attaccttct 600 gctctctctg atttggaaaa agctgaaaaa aaaggttgaa accagttccc tgaaattatt 660 cccctacttg actaataagt atataaagac ggtaggtatt gattgtaatt ctgtaaatct 720 atttcttaaa cttcttaaat tctactttta tagttagtct tttttttagt tttaaaacac 780 caagaactta gtttcgaata aacacacata aacaaacaaa atgagtaaag gagaagaact 840 tttc 844 <210> 7 <211> 474 <212> DNA <213> Artificial sequence <400> 7 ggagaaaata ccgcatcagg agtgatcccc cacacaccat agcttcaaaa tgtttctact 60 ccttttttac tcttccagat tttctcggac tccgcgcatc gccgtaccac ttcaaaacac 120 ccaagcacag catactaaat ttcccctctt tcttcctcta gggtgtcgtt aattacccgt 180 actaaaggtt tggaaaagaa aaaagagacc gcctcgtttc tttttcttcg tcgaaaaagg 240 caataaaaat ttttatcacg tttctttttc ttgaaaattt ttttttttga tttttttctc 300 tttcgatgac ctcccattga tatttaagtt aataaacggt cttcaatttc tcaagtttca 360 gtttcatttt tcttgttcta ttacaacttt ttttacttct tgctcattag aaagaaagca 420 tagcaatcta atctaagttt taattacaaa atgagtaaag gagaagaact tttc 474 <210> 8 <211> 232 <212> DNA <213> Artificial sequence <220> <221> misc_feature <222> (178)..(183) <223> n is a, c, g, or t <400> 8 tgcggtgtga aataccgcac agatgcgtaa ggagaaaata ccgcatcagg ggcgcgcccc 60 tccttgaaac tgaaatttta gcatgtgatt aattaacttg taatattcta atcaagctta 120 taaaagagca ctgttgggcg tgagtggagg cgccggaaaa aagcatcgaa aaaatctnnn 180 nnnatgagta aaggagaaga acttttcact ggagttgtcc caattcttgt tg 232 <210> 9 <211> 6030 <212> DNA <213> Artificial sequence <220> <221> misc_feature <222> (178)..(183) <223> n is a, c, g, or t <400> 9 tgcggtgtga aataccgcac agatgcgtaa ggagaaaata ccgcatcagg ggcgcgcccc 60 tccttgaaac tgaaatttta gcatgtgatt aattaacttg taatattcta atcaagctta 120 taaaagagca ctgttgggcg tgagtggagg cgccggaaaa aagcatcgaa aaaatctnnn 180 nnnatgagta aaggagaaga acttttcact ggagttgtcc caattcttgt tgaattagat 240 ggtgatgtta atgggcacaa attttctgtc agtggagagg gtgaaggtga tgcaacatac 300 ggaaaactta cccttaaatt tatttgcact actggaaaac tacctgttcc atggccaaca 360 cttgtcacta ctttctctta tggtgttcaa tgcttttcaa gatacccaga tcatatgaaa 420 cggcatgact ttttcaagag tgccatgccc gaaggttatg tacaggaaag aactatattt 480 ttcaaagatg acgggaacta caagacacgt gctgaagtca agtttgaagg tgataccctt 540 gttaatagaa tcgagttaaa aggtattgat tttaaagaag atggaaacat tcttggacac 600 aaattggaat acaactataa ctcacacaat gtatacatca tggcagacaa acaaaagaat 660 ggaatcaaag ttaacttcaa aattagacac aacattgaag atggaagcgt tcaactagca 720 gaccattatc aacaaaatac tccaattggc gatggccctg tccttttacc agacaaccat 780 tacctgtcca cacaatctgc cctttcgaaa gatcccaacg aaaagagaga ccacatggtc 840 cttcttgagt ttgtaacagc tgctgggatt acacatggca tggatgaact atacaaatag 900 caaagacgtt gtttcatcgc gctattacca agaaggttac tttacttgtt cttgcacatg 960 gacgcacgtt gtgtgttcat atatatatat atatatatat atatatattt gtgcttgttt 1020 tcattgtctc tatagttaat acattctatt tttatcgtta tatttgcatt ctcttcgcat 1080 aaaaacttca tgaaaattcg gcagaaaata agcaaattgt aaacgttaat attttgttaa 1140 aattcgcgtt aaatttttgt taaatcagct cattttttaa ccaataggcc gaaatcggca 1200 aaatccctta taaatcaaaa gaatagaccg agatagggtt gagtgttgtt ccagtttgga 1260 acaagagtcc actattaaag aacgtggact ccaacgtcaa agggcgaaaa accgtctatc 1320 agggcgatgg cccactacgt gaaccatcac cctaatcaag ttttttgggg tcgaggtgcc 1380 gtaaagcact aaatcggaac cctaaaggga gcccccgatt tagagcttga cggggaaagc 1440 cggcgaacgt ggcgagaaag gaagggaaga aagcgaaagg agcgggcgct agggcgctgg 1500 caagtgtagc ggtcacgctg cgcgtaacca ccacacccgc cgcgcttaat gcgccgctac 1560 agggcgcgtc gcgccattcg ccattcaggc tgcgcaactg ttgggaaggg cgatcggtgc 1620 gggcctcttc gctattacgc cagctggcga aggggggatg tgctgcaagg cgattaagtt 1680 gggtaacgcc agggttttcc cagtcacgac gttgtaaaac gacggccagt gaattgtaat 1740 acgactcact atagggcgaa ttggagctcc accgcggtgg cggccgctct agaactagtg 1800 gatcccccgg gctgcaggaa ttcgatatca agcttatcga taccgtcgac ctcgaggggg 1860 ggcccggtac ccagcttttg ttccctttag tgagggttaa ttccgagctt ggcgtaatca 1920 tggtcatagc tgtttcctgt gtgaaattgt tatccgctca caattccaca caacatagga 1980 gccggaagca taaagtgtaa agcctggggt gcctaatgag tgaggtaact cacattaatt 2040 gcgttgcgct cactgcccgc tttccagtcg ggaaacctgt cgtgccagct gcattaatga 2100 atcggccaac gcgcggggag aggcggtttg cgtattgggc gctcttccgc ttcctcgctc 2160 actgactcgc tgcgctcggt cgttcggctg cggcgagcgg tatcagctca ctcaaaggcg 2220 gtaatacggt tatccacaga atcaggggat aacgcaggaa agaacatgtg agcaaaaggc 2280 cagcaaaagg ccaggaaccg taaaaaggcc gcgttgctgg cgtttttcca taggctcggc 2340 ccccctgacg agcatcacaa aaatcgacgc tcaagtcaga ggtggcgaaa cccgacagga 2400 ctataaagat accaggcgtt cccccctgga agctccctcg tgcgctctcc tgttccgacc 2460 ctgccgctta ccggatacct gtccgccttt ctcccttcgg gaagcgtggc gctttctcaa 2520 tgctcacgct gtaggtatct cagttcggtg taggtcgttc gctccaagct gggctgtgtg 2580 cacgaacccc ccgttcagcc cgaccgctgc gccttatccg gtaactatcg tcttgagtcc 2640 aacccggtaa gacacgactt atcgccactg gcagcagcca ctggtaacag gattagcaga 2700 gcgaggtatg taggcggtgc tacagagttc ttgaagtggt ggcctaacta cggctacact 2760 agaaggacag tatttggtat ctgcgctctg ctgaagccag ttaccttcgg aaaaagagtt 2820 ggtagctctt gatccggcaa acaaaccacc gctggtagcg gtggtttttt tgtttgcaag 2880 cagcagatta cgcgcagaaa aaaaggatct caagaagatc ctttgatctt ttctacgggg 2940 tctgacgctc agtggaacga aaactcacgt taagggattt tggtcatgag attatcaaaa 3000 aggatcttca cctagatcct tttaaattaa aaatgaagtt ttaaatcaat ctaaagtata 3060 tatgagtaaa cttggtctga cagttaccaa tgcttaatca gtgaggcacc tatctcagcg 3120 atctgtctat ttcgttcatc catagttgcc tgactgcccg tcgtgtagat aactacgata 3180 cgggagggct taccatctgg ccccagtgct gcaatgatac cgcgagaccc acgctcaccg 3240 gctccagatt tatcagcaat aaaccagcca gccggaaggg ccgagcgcag aagtggtcct 3300 gcaactttat ccgcctccat ccagtctatt aattgttgcc gggaagctag agtaagtagt 3360 tcgccagtta atagtttgcg caacgttgtt gccattgcta caggcatcgt ggtgtcacgc 3420 tcgtcgtttg gtatggcttc attcagctcc ggttcccaac gatcaaggcg agttacatga 3480 tcccccatgt tgtgaaaaaa agcggttagc tccttcggtc ctccgatcgt tgtcagaagt 3540 aagttggccg cagtgttatc actcatggtt atggcagcac tgcataattc tcttactgtc 3600 atgccatccg taagatgctt ttctgtgact ggtgagtact caaccaagtc attctgagaa 3660 tagtgtatgc ggcgaccgag ttgctcttgc ccggcgtcaa tacgggataa taccgcgcca 3720 catagcagaa ctttaaaagt gctcatcatt ggaaaacgtt cttcggggcg aaaactctca 3780 aggatcttac cgctgttgag atccagttcg atgtaaccca ctcgtgcacc caactgatct 3840 tcagcatctt ttactttcac cagcgtttct gggtgagcaa aaacaggaag gcaaaatgcc 3900 gcaaaaaagg gaataagggc gacacggaaa tgttgaatac tcatactctt cctttttcaa 3960 tattattgaa gcatttatca gggttattgt ctcatgagcg gatacatatt tgaatgtatt 4020 tagaaaaata aacaaatagg ggttccgcgc acatttcccc gaaaagtgcc acctgggtcc 4080 ttttcatcac gtgctataaa aataattata atttaaattt tttaatataa atatataaat 4140 taaaaataga aagtaaaaaa agaaattaaa gaaaaaatag tttttgtttt ccgaagatgt 4200 aaaagactct agggggatcg ccaacaaata ctacctttta tcttgctctt cctgctctca 4260 ggtattaatg ccgaattgtt tcatcttgtc tgtgtagaag accacacacg aaaatcctgt 4320 gattttacat tttacttatc gttaatcgaa tgtatatcta tttaatctgc ttttcttgtc 4380 taataaatat atatgtaaag tacgcttttt gttgaaattt tttaaacctt tgtttatttt 4440 tttttcttca ttccgtaact cttctacctt ctttatttac tttctaaaat ccaaatacaa 4500 aacataaaaa taaataaaca cagagtaaat tcccaaatta ttccatcatt aaaagatacg 4560 aggcgcgtgt aagttacagg caagcgatcc gtcctaagaa accattatta tcatgacatt 4620 aacctataaa aataggcgta tcacgaggcc ctttcgtctc gcgcgtttcg gtgatgacgg 4680 tgaaaacctc tgacacatgc agctcccgga gacggtcaca gcttgtctgt aagcggatgc 4740 cgggagcaga caagcccgtc agggcgcgtc agcgggtgtt ggcgggtgtc ggggctggct 4800 taactatgcg gcatcagagc agattgtact gagagtgcac cataattccg ttttaagagc 4860 ttggtgagcg ctaggagtca ctgccaggta tcgtttgaac acggcattag tcagggaagt 4920 cataacacag tcctttcccg caattttctt tttctattac tcttggcctc ctctagtaca 4980 ctctatattt ttttatgcct cggtaatgat tttcattttt ttttttccac ctagcggatg 5040 actctttttt tttcttagcg attggcatta tcacataatg aattatacat tatataaagt 5100 aatgtgattt cttcgaagaa tatactaaaa aatgagcagg caagataaac gaaggcaaag 5160 atgacagagc agaaagccct agtaaagcgt attacaaatg aaaccaagat tcagattgcg 5220 atctctttaa agggtggtcc cctagcgata gagcactcga tcttcccaga aaaagaggca 5280 gaagcagtag cagaacaggc cacacaatcg caagtgatta acgtccacac aggtataggg 5340 tttctggacc atatgataca tgctctggcc aagcattccg gctggtcgct aatcgttgag 5400 tgcattggtg acttacacat agacgaccat cacaccactg aagactgcgg gattgctctc 5460 ggtcaagctt ttaaagaggc cctactggcg cgtggagtaa aaaggtttgg atcaggattt 5520 gcgcctttgg atgaggcact ttccagagcg gtggtagatc tttcgaacag gccgtacgca 5580 gttgtcgaac ttggtttgca aagggagaaa gtaggagatc tctcttgcga gatgatcccg 5640 cattttcttg aaagctttgc agaggctagc agaattaccc tccacgttga ttgtctgcga 5700 ggcaagaatg atcatcaccg tagtgagagt gcgttcaagg ctcttgcggt tgccataaga 5760 gaagccacct cgcccaatgg taccaacgat gttccctcca ccaaaggtgt tcttatgtag 5820 tgacaccgat tatttaaagc tgcagcatac gatatatata catgtgtata tatgtatacc 5880 tatgaatgtc agtaagtatg tatacgaaca gtatgatact gaagatgaca aggtaatgca 5940 tcattctata cgtgtcattc tgaacgaggc gcgctttcct tttttctttt tgctttttct 6000 ttttttttct cttgaactcg acggatcata 6030 <210> 10 <211> 125 <212> DNA <213> Artificial sequence <400> 10 cctccttgaa actgaaattt tagcatgtga ttaattaact tgtaatattc taatcaagct 60 tataaaagag cactgttggg cgtgagtgga ggcgccggaa aaaagcatcg aaaaaatctt 120 caaca 125 <210> 11 <211> 125 <212> DNA <213> Artificial sequence <400> 11 cctccttgaa actgaaattt tagcatgtga ttaattaact tgtaatattc taatcaagct 60 tataaaagag cactgttggg cgtgagtgga ggcgccggaa aaaagcatcg aaaaaatctc 120 caacc 125 <210> 12 <211> 125 <212> DNA <213> Artificial sequence <400> 12 cctccttgaa actgaaattt tagcatgtga ttaattaact tgtaatattc taatcaagct 60 tataaaagag cactgttggg cgtgagtgga ggcgccggaa aaaagcatcg aaaaaatctg 120 caaag 125 <210> 13 <211> 125 <212> DNA <213> Artificial sequence <400> 13 cctccttgaa actgaaattt tagcatgtga ttaattaact tgtaatattc taatcaagct 60 tataaaagag cactgttggg cgtgagtgga ggcgccggaa aaaagcatcg aaaaaatcta 120 taacc 125 <210> 14 <211> 125 <212> DNA <213> Artificial sequence <400> 14 cctccttgaa actgaaattt tagcatgtga ttaattaact tgtaatattc taatcaagct 60 tataaaagag cactgttggg cgtgagtgga ggcgccggaa aaaagcatcg aaaaaatcta 120 cgaag 125 <210> 15 <211> 125 <212> DNA <213> Artificial sequence <400> 15 cctccttgaa actgaaattt tagcatgtga ttaattaact tgtaatattc taatcaagct 60 tataaaagag cactgttggg cgtgagtgga ggcgccggaa aaaagcatcg aaaaaatcta 120 tctag 125 <210> 16 <211> 125 <212> DNA <213> Artificial sequence <400> 16 cctccttgaa actgaaattt tagcatgtga ttaattaact tgtaatattc taatcaagct 60 tataaaagag cactgttggg cgtgagtgga ggcgccggaa aaaagcatcg aaaaaatctg 120 tcaac 125 <210> 17 <211> 125 <212> DNA <213> Artificial sequence <400> 17 cctccttgaa actgaaattt tagcatgtga ttaattaact tgtaatattc taatcaagct 60 tataaaagag cactgttggg cgtgagtgga ggcgccggaa aaaagcatcg aaaaaatcta 120 ctaca 125 <210> 18 <211> 125 <212> DNA <213> Artificial sequence <400> 18 cctccttgaa actgaaattt tagcatgtga ttaattaact tgtaatattc taatcaagct 60 tataaaagag cactgttggg cgtgagtgga ggcgccggaa aaaagcatcg aaaaaatctc 120 caagc 125 <210> 19 <211> 125 <212> DNA <213> Artificial sequence <400> 19 cctccttgaa actgaaattt tagcatgtga ttaattaact tgtaatattc taatcaagct 60 tataaaagag cactgttggg cgtgagtgga ggcgccggaa aaaagcatcg aaaaaatctg 120 caata 125 <210> 20 <211> 125 <212> DNA <213> Artificial sequence <400> 20 cctccttgaa actgaaattt tagcatgtga ttaattaact tgtaatattc taatcaagct 60 tataaaagag cactgttggg cgtgagtgga ggcgccggaa aaaagcatcg aaaaaatctt 120 cagca 125 <210> 21 <211> 125 <212> DNA <213> Artificial sequence <400> 21 cctccttgaa actgaaattt tagcatgtga ttaattaact tgtaatattc taatcaagct 60 tataaaagag cactgttggg cgtgagtgga ggcgccggaa aaaagcatcg aaaaaatctc 120 accaa 125 <210> 22 <211> 125 <212> DNA <213> Artificial sequence <400> 22 cctccttgaa actgaaattt tagcatgtga ttaattaact tgtaatattc taatcaagct 60 tataaaagag cactgttggg cgtgagtgga ggcgccggaa aaaagcatcg aaaaaatcta 120 tcgtc 125 <210> 23 <211> 125 <212> DNA <213> Artificial sequence <400> 23 cctccttgaa actgaaattt tagcatgtga ttaattaact tgtaatattc taatcaagct 60 tataaaagag cactgttggg cgtgagtgga ggcgccggaa aaaagcatcg aaaaaatcta 120 ttatt 125 <210> 24 <211> 225 <212> DNA <213> Artificial sequence <220> <221> misc_feature <222> (170)..(175) <223> n is a, c, g, or t <400> 24 gacaacttga aagagctata ttcgtcttcg gttttttgat ttttattaac cctccttgaa 60 actgaaattt tagcatgtga ttaattaact tgtaatattc taatcaagct tataaaagag 120 cactgttggg cgtgagtgga ggcgccggaa aaaagcatcg aaaaaatctn nnnnnctgca 180 gaccaattgg tgaaaactga agtcaccaag aagtctttta ctgct 225

Claims

1. A method for constructing a mutant library of artificial promoters in Saccharomyces cerevisiae, comprising the following steps: randomly mutating all or part of the nucleotide sequence at positions 1-6 from the 3'-end of the artificial promoter UASF-E-C-core1 in Saccharomyces cerevisiae to obtain a mutant library of artificial promoters in Saccharomyces cerevisiae; The nucleotide sequence of the artificial promoter UASF-E-C-core1 in Saccharomyces cerevisiae is shown as positions 29-153 of SEQ ID No. 4; The mutant library of artificial promoters in Saccharomyces cerevisiae contains 14 promoters, and their nucleotide sequences are shown as SEQ ID No. 10 to SEQ ID No. 23 respectively.

2. A recombinant vector library for screening Saccharomyces cerevisiae artificial promoter mutants, characterized in that: Each recombinant vector in the recombinant vector library is a double-stranded circular DNA formed by ligating a backbone vector fragment and a DNA fragment with a specific structure; the DNA fragment with a specific structure consists of a mutant of the artificial promoter UASF-E-C-core1 in Saccharomyces cerevisiae, a fragment to be transcribed, and a terminator in sequence from upstream to downstream; and The nucleotide sequences at positions 1-6 from the 3'-end of the mutant sequences of the artificial promoter UASF-E-C-core1 on different recombinant vectors in the recombinant vector library are different; and The sequences of the fragment to be transcribed and the terminator on different recombinant vectors in the recombinant vector library are the same; The nucleotide sequence of the artificial promoter UASF-E-C-core1 in Saccharomyces cerevisiae is shown as positions 29-153 of SEQ ID No. 4; There are 14 mutant sequences of the artificial promoter UASF-E-C-core1 in Saccharomyces cerevisiae, and their nucleotide sequences are shown as SEQ ID No. 10 to SEQ ID No. 23 respectively.

3. The recombinant vector library according to claim 2, wherein: The terminator is the SPG5 terminator.

4. The recombinant vector library according to claim 2, wherein: The fragment to be transcribed is the target gene.

5. The recombinant vector library according to any one of claims 2-4, characterized in that: The backbone vector is the Saccharomyces cerevisiae general expression vector pRS313.

6. A recombinant Saccharomyces cerevisiae library for screening mutant artificial promoters of Saccharomyces cerevisiae, which is obtained by introducing the recombinant vector library described in any one of claims 2-5 into recipient Saccharomyces cerevisiae.

7. Use of the method according to claim 1 or the recombinant vector library described in any one of claims 2-5 or the recombinant Saccharomyces cerevisiae library described in claim 6 in screening mutant artificial promoters of Saccharomyces cerevisiae.

8. A method for screening mutant artificial promoters of Saccharomyces cerevisiae, comprising the following steps: culturing the recombinant Saccharomyces cerevisiae library described in claim 6, and screening out recombinant Saccharomyces cerevisiae strains that meet the predetermined conditions as target recombinant Saccharomyces cerevisiae; the mutant of the artificial promoter UASF-E-C-core1 carried by the target recombinant Saccharomyces cerevisiae is the mutant artificial promoter of Saccharomyces cerevisiae.

9. Use of the method according to claim 1 or 8 or the recombinant vector library described in any one of claims 2-5 or the recombinant Saccharomyces cerevisiae library described in claim 6 in the regulation of gene expression in the metabolic pathway of Saccharomyces cerevisiae.

Images