Application of hsa_circRNA_103554 in the diagnosis of retinopathy of prematurity

Abstract

The present invention relates to the field of medical technology, and more particularly to the use of hsa_circRNA_103554 in the diagnosis of retinopathy of prematurity. The present invention demonstrates that hsa_circRNA_103554 levels are significantly reduced in patients with retinopathy of prematurity compared to normal controls, and can be used clinically as a biomarker for the diagnosis and differential diagnosis of retinopathy of prematurity. Furthermore, downregulating hsa_circRNA_103554 levels can establish a model for retinopathy of prematurity.

Description

Technical Field

[0001] The present invention relates to the field of medical technology, and in particular to the application of hsa_circRNA_103554 in the diagnosis of retinopathy of prematurity. Background Art

[0002] Retinopathy of prematurity (ROP) refers to the proliferation and contraction of fibroangiomatous structures in the non-vascularized retina of premature infants born before 36 weeks of gestation, with low birth weight, and prolonged oxygen therapy. This can lead to tractional retinal detachment and blindness. ROP occurs overwhelmingly in premature infants. Once established, it progresses rapidly, leaving a narrow window for effective treatment. Strictly restricting oxygen use in premature infants is the only effective preventive measure. Early detection and prompt application of cryotherapy or laser photocoagulation have been reported to successfully prevent further progression of the disease.

[0003] The key to preventing and treating retinopathy of prematurity lies in early detection and timely treatment. Currently, however, ROP is still primarily diagnosed through fundus examination. This requires a clear understanding of the child's incubator history and observation of abnormalities in the fundus nerve fiber layer during the examination. Doppler ultrasound examinations are also performed promptly. These combined methods can help doctors make a more accurate diagnosis. However, existing methods are time-sensitive and the diagnostic process is complex. Detecting abnormalities earlier would facilitate more effective treatment of ROP.

[0004] CircRNAs are a class of noncoding RNAs (ncRNAs) with closed circular structures formed by a specialized splicing mechanism. Numerous studies have revealed the potential value of circRNAs as diagnostic biomarkers for diabetic retinopathy (DR), retinoblastoma, and age-related macular degeneration. CircRNAs are also considered therapeutic targets for treating retinal neovascularization. However, studies using circRNAs as diagnostic biomarkers for retinopathy of prematurity have yet to be reported. Summary of the Invention

[0005] In view of this, the technical problem to be solved by the present invention is to provide an application of hsa_circRNA_103554 in the diagnosis of retinopathy of prematurity.

[0006] The present study found that the expression level of hsa_circRNA_103554 was inhibited in retinopathy of prematurity.

[0007] Therefore, the present invention provides the use of hsa_circRNA_103554 as a marker in the preparation of a diagnostic product for retinopathy of prematurity.

[0008] The present invention also provides the use of a reagent for detecting hsa_circRNA_103554 in the preparation of a diagnostic product for retinopathy of prematurity.

[0009] The retinopathy of prematurity diagnostic product of the present invention can be used for the early diagnosis of retinopathy of prematurity. In some embodiments, the retinopathy of prematurity diagnostic product is a diagnostic reagent, a diagnostic tool, and / or a diagnostic kit, which is not limited in the present invention.

[0010] Furthermore, the present invention also provides a diagnostic product for retinopathy of prematurity, comprising any one of the following I) to IV):

[0011] 1), detection primers for hsa_circRNA_103554;

[0012] II), detection probe for hsa_circRNA_103554;

[0013] III), aptamers of hsa_circRNA_103554;

[0014] IV), chip used to detect hsa_circRNA_103554.

[0015] The reagent for detecting hsa_circRNA_103554 provided by the present invention can perform qualitative and / or quantitative detection of hsa_circRNA_103554. In the present invention, the detection is mainly performed by PCR or isothermal amplification method, the PCR method is a conventional PCR method, and can also be RT-qPCR, qRT-PCR or real-time quantitative PCR; the isothermal amplification includes NASBA, RCA, HAD, RPA, LAMP, ERA or NERA, and the target of the PCR or isothermal amplification detection can be hsa_circRNA_103554, or a partial fragment of hsa_circRNA_103554, or a product obtained by transcription of the above two methods, and the present invention is not limited to this.

[0016] In some embodiments, the detection primers for hsa_circRNA_103554 include an upstream primer as shown in SEQ ID NO. 1 and a downstream primer as shown in SEQ ID NO. 2. The sequence shown in SEQ ID NO. 1 is CTGAACCAATACAGAGCAGACAT, and the sequence shown in SEQ ID NO: 2 is GAACTGCCACACAGAAGAACTC.

[0017] The chip for detecting hsa_circRNA_103554 of the present invention can carry the primers of the present invention, or can carry other substances that can be used to detect hsa_circRNA_103554, and the present invention is not limited to this.

[0018] The diagnostic product of the present invention also includes a total RNA extraction reagent, a reverse transcription reagent and an RT-qPCR detection reagent.

[0019] The total RNA extraction reagent described in the present invention is a total RNA extraction reagent for PBMCs. In some embodiments, the total RNA is extracted using the Trizol method.

[0020] The present invention also provides a method for diagnosing retinopathy of prematurity, which includes detecting the expression level of hsa_circRNA_103554 in a sample.

[0021] In the embodiment of the present invention, the detection adopts RT-qPCR method to judge whether the sample comes from a patient with retinopathy of prematurity based on the expression level of retinopathy of prematurity. The sample is peripheral blood PBMCs.

[0022] The method provided by the present invention is an auxiliary diagnostic detection method for patients with retinopathy of prematurity who need treatment. The method for determining whether the sample is from a patient with retinopathy of prematurity includes: taking a peripheral blood PBMC sample from the test subject, performing qRT-PCR detection with β-actin as an internal reference, and using the hsa_circRNA_103554 / β-actin ratio of 0.0005235 as the cutoff value. If the ratio is lower than the cutoff value, the test subject is a high-risk group for retinopathy of prematurity who needs treatment, and it is recommended to further combine fundus examination and other means for diagnosis. The expression level of hsa_circRNA_103554 in patients with retinopathy of prematurity is significantly lower than that in normal controls. Therefore, knocking down or knocking out the expression of hsa_circRNA_103554, or inhibiting the activity of hsa_circRNA_103554, can be used to construct a retinopathy of prematurity model.

[0023] The present invention provides a method for constructing a model of retinopathy of prematurity using hsa_circRNA_103554 as a target. The present invention further provides a method for constructing a model of retinopathy of prematurity using any one of the following i) to iii) as a target:

[0024] i) Reagents for knocking out or knocking down hsa_circRNA_103554;

[0025] ii), agents that inhibit the activity of hsa_circRNA_103554;

[0026] iii) a substance that increases the level or activity of an hsa_circRNA_103554 inhibitor.

[0027] In some embodiments, the retinopathy of prematurity model is an animal model or a cell model

[0028] The present invention also provides a method for constructing a retinopathy of prematurity model, which comprises: knocking out or knocking down hsa_circRNA_103554, reducing the activity of hsa_circRNA_103554, or increasing the level or activity of an hsa_circRNA_103554 inhibitor.

[0029] The present invention also provides a reagent for constructing a retinopathy of prematurity model, comprising any one of the following i) to iii):

[0030] i) Reagents for knocking out or knocking down hsa_circRNA_103554;

[0031] ii), agents that inhibit the activity of hsa_circRNA_103554;

[0032] iii) a substance that increases the level or activity of an hsa_circRNA_103554 inhibitor.

[0033] In the present invention, the model is an animal model or a cell model. The agent for knocking out or knocking down hsa_circRNA_103554 can be an agent for transfecting or transforming cells, which is not limited in the present invention. The agent for inhibiting the activity of hsa_circRNA_103554 in the present invention can reduce the activity of hsa_circRNA_103554. The substance that increases the level or activity of the hsa_circRNA_103554 inhibitor can be a small molecule compound or a substance that overexpresses or activates the hsa_circRNA_103554 inhibitor through genetic engineering. The present invention also does not limit this.

[0034] The present invention also provides a method for constructing a retinopathy of prematurity model, which is treated with the reagent of the present invention to increase the level or activity of hsa_circRNA_103554. The treatment includes transformation or transfection.

[0035] The present invention demonstrates that hsa_circRNA_103554 levels are significantly reduced in patients with retinopathy of prematurity, with significant differences compared to normal controls. This biomarker can be used clinically for the diagnosis and differential diagnosis of retinopathy of prematurity. Furthermore, downregulating hsa_circRNA_103554 levels can establish a model for retinopathy of prematurity. BRIEF DESCRIPTION OF THE DRAWINGS

[0036] In order to more clearly illustrate the embodiments of the present invention or the technical solutions in the prior art, the following briefly introduces the drawings required for the embodiments or the description of the prior art:

[0037] Figure 1 Figure 2 shows a heat map generated by hierarchical clustering analysis of differentially expressed circular RNAs between PBMCs in the control group (Control) and the retinopathy of prematurity (ROP) group; the color scale shows the relative expression levels of circRNAs in different samples, with red representing upregulation and green representing downregulation;

[0038] Figure 2 The volcano plot of differentially expressed circRNAs in PBMCs of patients with retinopathy of prematurity is shown. The corresponding fold changes and P-values ​​are divided by green lines in the figure. The fold change is up-regulated or down-regulated by 2 times, and P < 0.05.

[0039] Figure 3 The results of qPCR amplification of PBMCs target circRNA are shown in the figure; the data are presented as means±SD (Control: n1=5, ROP: n2=5), *P<0.05, **P<0.01, ***P<0.001; Figure 3 A and B show the test results respectively; the sample size is Control: n1 = 5, ROP: n2 = 5, a total of 10 samples;

[0040] Figure 4 The expression of hsa_circRNA_103554 in PBMCs of different groups was detected by RT-qPCR; in the figure, Control: n1 = 23; ROP: n2 = 24; **P < 0.01, ***P < 0.001;

[0041] Figure 5 Figure 3 shows the ROC curve of hsa_circRNA_103554; the AUC was 0.8822. DETAILED DESCRIPTION

[0042] The present invention provides the application of hsa_circRNA_103554 in the diagnosis of retinopathy of prematurity. Those skilled in the art can refer to the content of this article and appropriately improve the process parameters. It should be noted that all similar substitutions and modifications are obvious to those skilled in the art and are considered to be included in the present invention. The methods and applications of the present invention have been described through preferred embodiments. It is obvious that relevant personnel can modify or appropriately change and combine the methods and applications herein without departing from the content, spirit and scope of the present invention to implement and apply the technology of the present invention.

[0043] circRNA (cicular RNA): A special type of non-coding RNA molecule with a closed circular structure, it is resistant to RNA exonucleases, exhibits more stable expression, and is less susceptible to degradation. This invention provides a circRNA for the early diagnosis of retinopathy of prematurity, which is of great significance for the detection of retinopathy of prematurity. The molecular marker hsa_circRNA_103554 for the early diagnosis of retinopathy of prematurity is also described.

[0044] In the present invention, hsa_circRNA_103554 corresponds to hsa_circ_0068606. The former is named by the Arraystar Human circRNA Array V2 (8x15K, Arraystar) chip, and the latter is the unified name of circbase.

[0045] >hsa_circ_0068606|NM_003234|TFRC, the sequence is shown in SEQ ID No. 3:

[0046]

[0047] The test materials used in the present invention are all common commercial products and can be purchased on the market. The present invention is further described below with reference to the following examples:

[0048] Example 1 Establishment of circRNA expression profile for retinopathy of prematurity

[0049] 1. Sample collection:

[0050] This study was approved by the Ethics Committee of the Second Xiangya Hospital of Central South University and adhered to the tenets of the Declaration of Helsinki. Informed consent was obtained from the participants' guardians, and the nature and potential consequences of the study were explained. A total of 57 premature infants were enrolled in the study. Of these, 29 infants diagnosed with ROP required further treatment (5 for screening and 24 for validation), such as intravitreal anti-VEGF therapy and laser photocoagulation. Enrollment in the experimental group followed the International Classification of Retinopathy of Prematurity (ICROP) criteria (ICCROP, 2005), defined as infants with: 1. rapidly progressive posterior pole ROP, 2. additional lesions, or 3. type I ROP with or without additional lesions. For ethical reasons, to avoid additional blood draws, peripheral blood microbial cell (PBMC) samples were collected from the control group at the last blood draw before discharge from the NICU. Exclusion criteria include: 1. Infectious diseases such as AIDS, syphilis, hepatitis or cytomegalovirus infection; 2. Major systemic diseases such as congenital metabolic diseases, blood diseases, etc.; 3. Congenital cataracts, glaucoma, coloboma and other eye abnormalities; 4. Professional systemic malformations, 5. During the duration of abnormal coagulation state, or drugs that may affect the metabolic state.

[0051] 2. PBMCs extraction:

[0052] 1.0-2.0 ml of venous blood was collected from the subjects in the morning in ethylenediaminetetraacetic acid (EDTA) anticoagulant tubes and delivered to the laboratory within 2 hours. An equal volume of PBS solution was added at a 1:1 ratio, gently mixed, and added to a centrifuge tube containing an equal volume of Ficoll-Paque PLUS (GE Healthcare, NJ, USA). The tubes were centrifuged at 400 g for 20 min, acceleration 1, and deceleration 0 (no break). PBMCs in the buffy coat were aspirated and PBS was added to 10-15 ml. The tubes were centrifuged at 300 g for 10 min, acceleration 9, and deceleration 9. After the supernatant was removed, 1 ml of TRIzol reagent (Invitrogen, Carlsbad, USA) was added and mixed. The tubes were transferred to 1.5 ml cryovials, snap-frozen in liquid nitrogen for 30 min, stored at −80°C, and shipped on dry ice for circRNA biomarker analysis.

[0053] 3. RNA extraction:

[0054] Add 0.2 ml of chloroform to every 1 ml of TRIZOL homogenate and cap the tube securely. Manually shake the tube vigorously for 15 seconds, then incubate at 15 to 30°C for 2 to 3 minutes. Centrifuge at 12,000 × g for 15 minutes at 4°C. After centrifugation, the mixture will separate into a red phenol-chloroform phase at the bottom, a colorless aqueous phase at the middle, and a colorless aqueous phase at the top. The RNA is completely distributed in the aqueous phase. The volume of the aqueous phase is approximately 60% of the volume of TRIZOL added during homogenization. Transfer the aqueous phase to a fresh centrifuge tube. Precipitate the RNA in the aqueous phase by adding 0.5 ml of isopropanol to every 1 ml of TRIZOL added to the homogenate. After mixing, incubate at 15 to 30°C for 10 minutes, then centrifuge at 12,000 × g for 10 minutes at 4°C. The RNA precipitate, which was not visible before centrifugation, will form a gelatinous mass on the bottom and sides of the tube. Remove the supernatant and add at least 1 ml of 75% ethanol to each 1 ml of TRIZOL reagent homogenized sample to wash the RNA precipitate. After shaking, centrifuge at 7,500 × g at 4°C for 5 minutes. Remove the ethanol solution and air dry the RNA precipitate for 5-10 minutes. Do not vacuum centrifuge to dry it. Be careful not to dry the RNA precipitate completely, otherwise the solubility of the RNA will be greatly reduced. The A260 / 280 ratio of partially dissolved RNA samples will be less than 1.6. When dissolving RNA, first add RNase-free water and repeatedly pipette several times with a gun, then incubate at 55 to 60°C for 10 minutes. The obtained RNA solution is stored at -70°C. Before further study, check the integrity of the RNA by denaturing agarose gel electrophoresis.

[0055] 4. RNA quality testing:

[0056] Dissolve 1g of agarose in 72ml of water, cool to 60°C, and add 10ml of 10x MOPS running buffer and 18ml of 37% formaldehyde solution (12.3M). Cast the gel, leaving enough sample wells to add at least 25μl of solution. After gelation, remove the comb and place the gel in the electrophoresis tank. Add enough 1x MOPS running buffer to cover the gel surface by several millimeters. Take 3μg of RNA, add 3 volumes of formaldehyde loading solution, and add EB to the formaldehyde loading solution to a final concentration of 10μg / ml. Heat to 70°C and incubate for 5 minutes to denature the sample. Load the sample into the gel wells and electrophorese at 5-6V / cm until the bromophenol blue indicator is at least 2-3cm deep into the gel. The 28S and 18S ribosomal RNA bands are very bright and intense (their size depends on the species used for RNA extraction), with the upper band approximately twice as dense as the lower band. A smaller, slightly diffuse band may also be observed, consisting of low-molecular-weight RNA (tRNA and 5S ribosomal RNA). A diffuse EB staining material is typically seen between the 18S and 28S ribosomal bands, likely composed of mRNA and other isoforms of RNA. DNA contamination during the RNA preparation will appear above the 28S ribosomal RNA band as a higher-molecular-weight, diffusely migrating material or band. RNA degradation manifests as a diffuse smear of the ribosomal RNA band.

[0057] 5. cRNA synthesis and labeling:

[0058] RNase R was used to remove linear RNA and enrich circRNA. CircRNA was amplified using random primers according to the kit instructions and reverse transcribed (Arraystar Super RNA Labeling Kit) into fluorescently labeled cRNA. Labeled cRNA was purified using the RNeasy Mini Kit (Qiagen). The concentration and activity of labeled cRNA were measured using a NanoDrop ND-1000.

[0059] 6. Chip hybridization and data analysis:

[0060] The labeled cRNA probes were hybridized to a microarray (Arraystar Human Circular RNA Array 2.0) under standard conditions. Fluorescence intensity of the microarray was scanned using an Agilent Scanner G2505C, and the experimental data were converted and saved. Detected circRNAs were considered statistically significant when the fold change was ≥2.0 and P < 0.05.

[0061] 7. Results:

[0062] In 10 PBMCs samples (5 control groups and 5 patient groups), the chip detection targets included 13,617. After filtering the circRNAs with too low fluorescence intensity, the following Figure 1 Among them, the target circRNAs with significant expression differences (FoldChange ≥ 2 and P value < 0.05) included 54 up-regulated targets and 143 down-regulated targets ( Figure 2 ).

[0063] Example 2 qRT-PCR verification

[0064] In the expression profile established in Example 1, 12 target circRNAs with significant differential expression were selected and verified again in 10 samples using qRT-PCR. The differential expression of the 12 circRNAs in the two groups of PBMCs was statistically significant, and the change trend was consistent with the chip. They were hsa_circRNA_003986, hsa_circRNA_061346, hsa_circRNA_082319, hsa_circRNA_103399, and hsa_circRNA_003140 were upregulated relative to the control group; hsa_circRNA_007366, hsa_circRNA_020959, hsa_circRNA_092369, hsa_circRNA_103554, hsa_circRNA_103555, hsa_circRNA_103556, and hsa_circRNA_103557 were downregulated relative to the control group ( Figure 3 Then, four circRNAs with statistical differences were selected for further verification: hsa_circRNA_061346, hsa_circRNA_092369, hsa_circRNA_103554 and hsa_circRNA_003140 ( Figure 3 ).

[0065] Example 3

[0066] The qRT-PCR method was used to further expand the sample size to verify the expression level of hsa_circ_0000095 in PBMCs and examine its diagnostic value.

[0067] 1. Sample collection and total RNA extraction were the same as before.

[0068] 2. cDNA synthesis and qRT-PCR:

[0069] Total RNA was transcribed into cDNA using the SuperScript III Reverse Transcriptase Kit (Invitrogen, Carlsbad, CA, USA). The cDNA was placed on ice until ready for use or stored at −20°C. CircRNA sequences were downloaded from the circbase database or the UCSC Genome Browser, and primers were designed for the target and internal reference sequences using Primer 5.0 (Table 1). Quantitative PCR (qPCR) was performed using 2× PCRMasterMix (Arraystar). Reactions were performed in 384-well plates on a QuantStudio5 Real-Time PCR System (Applied Biosystems, Foster City, CA, USA). The reaction conditions were 95°C for 10 minutes, followed by 40 cycles of PCR (95°C for 10 seconds and 60°C for 60 seconds). Melting curves of the PCR products were generated after the amplification reaction.

[0070] Table 1 circRNA primer sequences

[0071]

[0072] Data were calculated using the double standard curve method. Continuous data are presented as median ± interquartile range and analyzed using the Mann-Whitney U test. A P value < 0.05 was considered statistically significant (Table 2).

[0073] 3. Results:

[0074] The expression level of hsa_circRNA_103554 was detected in 47 PBMCs samples (24 samples from premature infants with retinal disease and 23 samples from the control group, matched for age and sex). The results showed that the expression level of hsa_circRNA_103554 was statistically different in the two groups of peripheral blood PBMCs samples ( Figure 4 ).

[0075] Table 2 P value level of hsa_circRNA_103554

[0076] circRNA Diagnostic value (circRNA / β-actin) P-value hsa_circRNA_103554 <0.0005235 <0.0001

[0077] To further test the effectiveness of hsa_circRNA_103554 in diagnosing retinopathy of prematurity in peripheral blood PBMCs, we drew the receiver operating characteristic (ROC) curve ( Figure 5). The area under the ROC curve of hsa_circRNA_103554 for diagnosing retinopathy of prematurity in PBMCs samples was found to be 0.8822. When the diagnostic value of hsa_circRNA_103554 in PBMCs was set to <0.0005235, its diagnostic sensitivity and specificity were 91.67 / 73.91(%) ( Figure 5 ).

[0078] The above are only preferred embodiments of the present invention. It should be pointed out that for ordinary technicians in this technical field, several improvements and modifications can be made without departing from the principles of the present invention. These improvements and modifications should also be regarded as the scope of protection of the present invention. Sequence Listing <110> The Second Xiangya Hospital of Central South University <120> Application of hsa_circRNA_103554 in the diagnosis of retinopathy of prematurity <130> MP22016894 <160> 3 <170> SIPOSequenceListing 1.0 <210> 1 <211> twenty three <212> DNA <213> Artificial Sequence <400> 1 ctgaaccaat acagagcaga cat 23 <210> 2 <211> twenty two <212> DNA <213> Artificial Sequence <400> 2 gaactgccac acagaagaac tc 22 <210> 3 <211> 2063 <212> DNA <213> Artificial Sequence <400> 3 gttcttctgt gtggcagttc agaatgatgg atcaagctag atcagcattc tctaacttgt 60 ttggtggaga accattgtca tatacccggt tcagcctggc tcggcaagta gatggcgata 120 acagtcatgt ggagatgaaa cttgctgtag atgaagaaga aaatgctgac aataacacaa 180 aggccaatgt cacaaaacca aaaaggtgta gtggaagtat ctgctatggg actattgctg 240 tgatcgtctt tttcttgatt ggatttatga ttggctactt gggctattgt aaaggggtag 300 aaccaaaaac tgagtgtgag agactggcag gaaccgagtc tccagtgagg gaggagccag 360 gagaggactt ccctgcagca cgtcgcttat attgggatga cctgaagaga aagttgtcgg 420 agaaactgga cagcacagac ttcaccggca ccatcaagct gctgaatgaa aattcatatg 480 tccctcgtga ggctggatct caaaaagatg aaaatcttgc gttgtatgtt gaaaatcaat 540 ttcgtgaatt taaactcagc aaagtctggc gtgatcaaca ttttgttaag attcaggtca 600 aagacagcgc tcaaaactcg gtgatcatag ttgataagaa cggtagactt gttacctgg 660 tggagaatcc tgggggttat gtggcgtata gtaaggctgc aacagttact ggtaaactgg 720 tccatgctaa ttttggtact aaaaaagatt ttgaggattt atacactcct gtgaatggat 780 ctatagtgat tgtcagagca gggaaaatca cctttgcaga aaaggttgca aatgctgaaa 840 gcttaaatgc aattggtgtg ttgatataca tggaccagac taaatttccc attgttaacg 900 cagaactttc attctttgga catgctcatc tggggacagg tgacccttac acacctggat 960 tcccttcctt caatcacact cagtttccac catctcggtc atcaggattg cctaatatac 1020 ctgtccagac aatctccaga gctgctgcag aaaagctgtt tgggaatatg gaaggagact 1080 gtccctctga ctggaaaaca gactctacat gtaggatggt aacctcagaa agcaagaatg 1140 tgaagctcac tgtgagcaat gtgctgaaag agataaaaat tcttaacatc tttggagtta 1200 ttaaaggctt tgtagaacca gatcactatg ttgtagttgg ggcccagaga gatgcatggg 1260 gccctggagc tgcaaaatcc ggtgtaggca cagctctcct attgaaactt gcccagatgt 1320 tctcagatat ggtcttaaaa gatgggtttc agcccagcag aagcattatc tttgccagtt 1380 ggagtgctgg agactttgga tcggttggtg ccactgaatg gctagaggga tacctttcgt 1440 ccctgcattt aaaggctttc acttatatta atctggataa agcggttctt ggtaccagca 1500 acttcaggt ttctgccagc ccactgttgt atacgcttat tgagaaaaca atgcaaatg 1560 tgaagcatcc ggttactggg caatttctat atcaggacag caacggggcc agcaagttg 1620 agaaactcac tttagacaat gctgctttcc ctttccttgc atattctgga atcccagcag 1680 tttctttctg ttttgcg gacagatt atccttattt gggtaccacc atggacacct 1740 attaggaact gattgagagg attcctgagt tgaacaagt ggcacgagca gctgcagagg 1800 tcgctgtca gttcgtgatt aaactaaccc atgatgttga attgaacctg gactatgaga 1860 ggtacacag ccaactgctt tcattgtga gggatctgaa ccatacaga gcagacataa aggaaatggg cctgagttta cagtggctgt attctgctcg tggactc ttccgtgcta 1980 cttccagact aaacagat ttcgggaatg ctgagaaaac agacagattt gtcatgaaga 2040 aactcaatga tcgtgtcatg aga 2063

Claims

1. Application of hsa_circRNA_103554 detection reagent in the preparation of diagnostic products for retinopathy of prematurity.

2. The use according to claim 1, characterized in that The diagnostic product for retinopathy of prematurity includes a reagent for detecting hsa_circRNA_103554.

3. The use according to claim 2, characterized in that The reagent for detecting hsa_circRNA_103554 includes any one of the following I) to IV): 1), detection primers for hsa_circRNA_103554; II), detection probe for hsa_circRNA_103554; III), aptamers of hsa_circRNA_103554; IV), chip used to detect hsa_circRNA_103554.

4. The use according to claim 3, characterized in that The detection primers for hsa_circRNA_103554 include the primer pairs shown in SEQ ID NO.1 to 2.

5. The use according to any one of claims 2 to 4, characterized in that: It also includes total RNA extraction reagents, reverse transcription reagents and qRT-PCR detection reagents.

Images